Previous Article | Next Article 
Mol Cell Biol, May 1998, p. 2659-2667, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Increased c-fos mRNA Expression By Human
Fibroblasts Contracting Stressed Collagen Matrices
Hans
Rosenfeldt,
David J.
Lee, and
Frederick
Grinnell*
Department of Cell Biology and Neuroscience,
University of Texas Southwestern Medical School, Dallas, Texas
75235-9039
Received 29 August 1997/Returned for modification 27 October
1997/Accepted 17 February 1998
 |
ABSTRACT |
We studied early changes in gene expression during fibroblast
contraction of stressed collagen matrices. The level of
c-fos mRNA increased dramatically and peaked 50 to 60 min
after matrix contraction was initiated. This response did not require
serum and could not be accounted for simply by disruption of the actin cytoskeleton. Increased c-fos mRNA levels required
Ca2+ influx but not the cyclic AMP or extracellular
signal-regulated kinase (ERK 1/2) signaling pathways, both of which are
activated when fibroblasts contract stressed collagen matrices. The
levels of two other immediate-early genes, fosb and
c-jun, also increased transiently after fibroblast
contraction, whereas the levels of fra-1,
fra-2, c-myc, and the transcription factor
NF-
B remained the same, indicating that fibroblast contraction
caused changes in a selective group of genes. The increase in
c-fos mRNA during contraction of stressed collagen matrices
may reflect a unique role for c-fos in mechanoregulated
events at the end of wound repair.
| |
INTRODUCTION |
Mechanical force influences cell
function in animal and plant tissues (6, 11, 30, 67). For
instance, increased mechanical load, such as fluid flow over
endothelial cells or tension applied to muscle cells, has been shown to
result in cell proliferation or hypertrophy (15, 64). During
wound repair, mechanical force within the wound tissue pulls the wound
edges closer together, which in pathological cases results in scarring
and loss of function (29, 52). Wound contraction is believed
to be mediated by fibroblasts as they go through a cycle of migration,
proliferation, contraction, and regression (13, 40).
Fibroblasts cultured in collagen matrices have been used as an in vitro
model for wound contraction (3, 20). In this model, cells
reorganize the extracellular matrix through migratory and contractile
activities (3, 25), resulting in formation of a dense,
tissue-like structure. The fibroblast phenotype that develops during
collagen matrix reorganization differs dramatically depending upon
whether collagen matrices are floating in medium or attached to a rigid
support. After reorganization of attached matrices, the cells resemble
proliferating fibroblasts of wound tissue under mechanical stress and
are characterized by polarized morphology, prominent stress fibers, and
fibronexus junctions (23, 37, 45, 62). Cells in attached
collagen matrices exert force on the matrix similar to that observed in
contracting skin wounds (12, 34). After reorganization of
floating matrices, on the other hand, cells resemble nondividing
fibroblasts of resting dermis or scar tissue in a state of mechanical
equilibrium and are characterized by isometric (stellate) cell
morphology and cytoskeletal meshwork (3, 4).
We have combined the attached and floating models to study the
regulatory events associated with the transition of fibroblasts from
mechanically stressed to mechanically equilibrated conditions (stress-relaxation) such as occurs by the end of wound repair. Initially, fibroblasts are cultured in attached collagen matrices until
mechanical stress develops. Then, the stressed matrices are released
and allowed to float in medium, which initiates a rapid and synchronous
smooth-muscle-like contraction as mechanical stress is dissipated.
Morphological changes in the cells during contraction of stressed
matrices include disruption of actin stress fibers (but not of
microtubules or intermediate filaments) and collapse of fibronexus
junctions (37, 45, 62). Subsequently, cells show marked
changes in growth factor receptor function and biosynthetic activity
(e.g., decreased synthesis of collagen) and become quiescent (39,
45, 46). During the initial moments of contraction, cells
transiently open passages ~3 nm in diameter in their plasma membranes, resulting in a burst of Ca2+ uptake from the
medium (38). Ca2+ uptake activates a signal
transduction pathway, resulting in increased synthesis of phosphatidic
acid, arachidonic acid, diacylglycerol, and cyclic AMP and activation
of protein kinase A (PKA) (26, 27).
Our study was carried out to learn if c-fos (2,
51) or other immediate-early genes are modulated when fibroblasts
contract stressed collagen matrices and to learn if changes in gene
expression can be attributed to the signal transduction processes
previously shown to be activated during contraction. We found that the
level of c-fos mRNA transcription increased dramatically and
peaked 50 to 60 min after matrix contraction was initiated. Increased c-fos mRNA levels required Ca2+ influx but not
the cyclic AMP or ERK 1/2 signaling pathways, both of which are
activated when fibroblasts contract stressed collagen matrices. Levels
of other immediately-early genes, fosB and c-jun,
also increased in response to contraction. Details are reported herein.
| |
MATERIALS AND METHODS |
Materials.
Dulbecco's modified Eagle's medium (DMEM),
restriction enzymes, reverse transcriptase (RT), and deoxynucleotides
were purchased from Gibco/BRL (Gaithersburg, Md.). T4 DNA ligase used
for subcloning, the MAP/ERK kinase (MEK) inhibitor PD98059, and
anti-phosphoCREB and anti-CREB antibodies were acquired from New
England Biolabs (Beverly, Mass.). Anti-active ERK 1/2 was obtained from
Promega Corp. (Madison, Wis.). Nylon (Nytran) membranes for Northern
hybridization were purchased from Schleicher and Schuell (Keene, N.H.).
Fetal bovine serum (FBS) was purchased from Intergen Co. (Purchase, N.Y.). Type I collagen (Vitrogen) was purchased from Collagen Corp.
(Palo Alto, Calif.). Guanadinium thiocyanate for solution D
(8) was purchased from Fluka Chemical Co. (Ronkonkoma,
N.Y.). All other chemicals were purchased from Sigma (St. Louis, Mo.).
Collagen matrix contraction.
Fibroblasts from human foreskin
specimens (<10 passages) were maintained in Falcon 75-cm2
tissue culture flasks in DMEM supplemented with 10% FBS. Hydrated collagen matrices were prepared from Vitrogen 100 collagen (Collagen Corp.). Neutralized collagen solutions (1.5 mg/ml) contained
fibroblasts in DMEM but no serum. Aliquots (0.2 ml) of the
cell-collagen mixtures were prewarmed to 37°C for 3 to 4 min and then
placed in Corning 24-well culture plates. Each aliquot occupied an area
outlined by a 12-mm-diameter circular score within a well.
Polymerization of collagen matrices required 60 min at 37°C in a
humidified incubator with 5% CO2.
The protocol for collagen matrix contraction has been described
previously (27, 38) and is shown schematically in Fig. 1. After polymerization, 1.0 ml of
DMEM-10% FBS and 50 µg of ascorbic acid per ml were added to each
well. Cultures were incubated for 2 days, during which stress
developed. To initiate contraction, stressed matrices were gently
released from the underlying culture dish with a spatula and incubated
at 37°C in DMEM with serum or other constituents as indicated below.
In some experiments, polymerized collagen matrices were released from
the underlying culture dish immediately after polymerization and
maintained as floating matrices subsequently.
RNA isolation.
RNA was isolated by a technique adapted from
Chomczynski and Sacchi (8). Briefly, collagen matrices (10 to 15 per sample for Northern hybridization or 1 per sample for RT-PCR)
were dissolved with solution D. Total RNA was extracted with
phenol-chloroform-isoamyl alcohol and precipitated with isopropanol.
Subsequently, RNA was redissolved in 260 µl of diethyl pyrocarbonate
treated (DEPC) water instead of in solution D and reprecipitated by
addition of 40 µl of sodium acetate (pH 5) and 750 µl of 100%
ethanol (55). Finally, the samples were redissolved in DEPC
water and subjected to Northern hybridization or RT-PCR. RNA prepared
by the above-described modification showed a more uniform
electrophoretic mobility in agarose gels.
Generation of gene-specific DNA probes.
The
c-fos- and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH)-specific DNA probes were generated with a Boehringer Mannheim random primed labeling kit with a subcloned PCR fragment of the c-fos gene and a partial cDNA clone derived from the full
human GAPDH cDNA clone pHcGAP (63) obtained from the
American Type Tissue Collection (accession no. 57091). The
c-fos probe was generated with 5'
TTATCTCCAGAAGAAGAAGAGAAAAGGAGAATC 3' and 5'
AGGGCCAGCAGCGTGGGTGAGCTGAGCGAGTCA 3' as primers in a reaction
mixture with human genomic DNA as the template. The initial PCR product
generated was 860 bp, and a 491-bp ApaI fragment was
subcloned into the ApaI site of pBluescript SK
(pBS)
(Stratagene) and sequenced. When we generated probes for Northern
hybridization, this c-fos-pBS construct was restricted with
AccI and ApaI, generating a fragment 448 bp in
size that contained the final 7 bp of intron 3 and all of exon 4. The
GAPDH probe was generated from the 554-bp
HindIII/XbaI restriction fragment of pHcGAP
subcloned into pBS. Plasmids containing cloned sequences were amplified
in Escherichia coli DH5
(55) and purified with a Maxiprep kit (Qiagen, Santa Clarita, Calif.) according to the manufacturer's instructions. Insert sequences were verified by automated sequencing. Preparation of c-fos primers and
sequencing analyses were performed in the Molecular Biology Core
Facility of the University of Texas Southwestern Skin Diseases Research Center.
Northern hybridization.
Northern hybridization was performed
according to standard procedures (55) except that RNA
samples (8 to 15 matrices/sample) were initially mixed 1:3 with
ethidium bromide-containing denaturing buffer (0.75 mg of ethidium
bromide per ml, 10 mM MOPS [morpholinepropanesulfonic acid, pH 7.0],
4 mM sodium acetate, 0.5 mM EDTA, 13% formaldehyde, 50% formamide).
Samples were subjected to electrophoresis with 1% agarose-6%
formaldehyde minigels for 1 h at 100 V (55). The agarose gel was then washed twice for 10 min each time in 100 ml of
DEPC water and soaked in 0.05 N NaOH in DEPC water for 15 min to
improve transfer of larger RNAs. The gels were then pH neutralized with
20× SSPE (1× SSPE is 0.18 M sodium chloride, 10 mM sodium phosphate,
and 1 mM EDTA [pH 7.7]) (55) buffer for 5 min. After
transfer, RNA on the nylon membranes was cross-linked with a
Stratalinker UV light source (Stratagene) at a setting of 1,200 µJ of radiation per cm2. Hybridizations were carried
out under aqueous conditions at 65°C according to standard protocols
(55).
RT-PCR.
RNA was isolated from collagen matrices (1 to 6 matrices/sample) as described above and used for a first-strand
synthesis reaction with Moloney murine leukemia virus (Gibco/BRL) and
oligo dT(15) primer according to the manufacturer's protocol except for experiments to be carried out with c-fos heterogeneous
nuclear RNA (hnRNA) (see below), where first-strand synthesis was
carried out with p(N)d6 random primers. After incubation for 2.5 h
at 37°C, Moloney murine leukemia virus RT enzyme was heat killed by
incubation at 70°C for 10 min. Second-strand synthesis was then
carried out with RNase H and Klenow polymerase (Gibco/BRL) by standard
techniques (55). Subsequently, double-stranded cDNA was
extracted with phenol-chloroform-isoamyl alcohol, precipitated with
ethanol-NaCl, washed with 80% ethanol, and resuspended in 20 µl of
DEPC water. PCRs were carried out with 1 µl of cDNA preparation per
sample. DNA was denatured at 94°C for 4 min, followed by 20 to 25 cycles of a 45-s denaturation at 94°C, a 45-s annealing at 54°C,
and a 90-s elongation at 72°C and a final 10-min elongation at
72°C. Reaction mixtures (20 µl) contained 20 mM Tris-HCl (pH 8.4),
0.1 U of Taq polymerase per µl, 50 mM KCl, 1.5 mM
MgCl2, 200 µM each deoxynucleoside triphosphate, and 0.5 µM each primer. (In the experiments comparing c-fos mRNA
with c-fos hnRNA, only 10 to 12 cycles were used [see
below].) After PCR, the overlying oil from each sample was removed and
4 µl of 6× loading buffer II (55) was added. Whole
reaction mixtures were loaded onto 1% agarose gels containing 1×
Tris-acetate-EDTA (55) and 10 µg of ethidium bromide per
ml. Samples were subjected to electrophoresis for 1 h at 100 V. DNA was visualized with a UV light source, and the image was captured
with an Is-1000 Digital Imaging System (Alpha-Innotech Corp.).
RT-PCR-Southern hybridization experiments to detect
c-fos hnRNA.
RT-PCR was carried out as described above
except that DNA was denatured at 94°C for 4 min, followed by 10 to 12 cycles of a 30-s denaturation at 94°C, a 30-s annealing at 57°C,
and a 90-s elongation at 72°C and a final 10-min elongation at 72°C
(68). PCR products were detected by the method for Northern
hybridization described above except that the probe for
c-fos hnRNA was generated by five cycles of PCR with
[32P]dCTP and a gel-purified c-fos hnRNA
fragment and c-fos hnRNA primer. No PCR products were
obtained in the absence of RT, showing that the samples were not
contaminated with genomic DNA. c-fos mRNA and GAPDH mRNA PCR
products were detected with the same probes as those used in the
Northern hybridization studies (described above).
RT-PCR primers.
The sequences of each primer set
(synthesized by the University of Texas Southwestern Molecular Biology
Core Facility) were as follows: c-fos mRNA, the same as
those used to generate Northern hybridization probes; c-fos
hnRNA, 5' ATGATGTTCTCGGGCTTCAACGCAGCAG 3' and 5'
AACCAATTCTTACTATGGCAAGCG 3'; fosB, 5'
ACACCAGGCATGAGTGGCTACAGCAG 3' and 5'
GGCGAACGCGGAGACCTCCGGGCAGG 3'; fra-1, 5'
ACCCCGGCCAGGAGTCATCCGGGCCC 3' and 5'
AGGCGCCTCACAAAGCGAGGAGGGTT 3'; and fra-2, 5'
GGGCCTGGCCTCTGTCCCTGGACACA 3' and 5'
TTGGAGCAGGATTCGGAGGGAGATGC 3'.
Gene sequences were obtained from the GenBank sequence database, and
primers for RT-PCR were selected based on regions of
greatest
differences as determined with the Clustal W Multiple
Sequence
Alignment Program, except primers for c-
fos hnRNA, which
were designed to hybridize to the first exon and second intron
of
c-
fos (
68). Primer sets for c-
myc,
c-
jun, and GAPDH were
purchased from Clontech (Palo Alto,
Calif.).
SDS-PAGE and immunoblotting.
Collagen matrices to be
extracted (two matrices per sample) were placed into 100 µl of
ice-cold lysis buffer (0.2% Nonidet P-40, 150 mM NaCl, 3 mM KCl, 6 mM
Na2HPO4 [pH 7.4], 1 mM
KH2PO4, 0.5 mM MgCl2, 1 µg of
leupeptin per ml, 1 µg of pepstatin A per ml, 10 mM
4-(2-aminoethyl)benzenesulfonylfluoride (AEBSF), 50 mM NaF, 1 mM
Na3VO4, 1 mM Na2MoO4)
and homogenized (50 strokes) with a Dounce homogenizer (pestle B;
Wheaton Scientific, Millville, N.J.). Samples were clarified by
centrifugation for 5 min at 16,000 × g (Eppendorf
microcentrifuge, model 5415 C), and the supernatants were dissolved in
4× reducing sample buffer (250 mM Tris, 4% sodium dodecyl sulfate
[SDS], 40% glycerol, 20% mercaptoethanol, 0.04% bromophenol blue)
and boiled for 5 min. Equal volumes from each sample were subjected to
SDS-polyacrylamide gel electrophoresis (PAGE) with 9% acrylamide
minislab gels and transferred to polyvinylidene difluoride membranes.
For analysis of CREB, membranes were subjected to immunoblotting with
anti-phosphoCREB (Ser133) and anti-CREB antibodies (New England
Biolabs) according to the manufacturer's instructions, except the
primary antibodies were diluted 1:800. For analysis of ERK 1/2,
membranes were subjected to immunoblotting with anti-active ERK 1/2 or
anti-ERK 1/2 (Y691, a gift from Melanie Cobb).
Densitometry.
Autoradiographs from Northern and Western
blots were scanned and stored as image files with a Personal
Densitometer (Molecular Dynamics). The pixel volume of each band was
measured with the ImageQuant program (Molecular Dynamics). Readings
from each sample were then adjusted for background. Ratios derived from
experimental samples and loading controls were plotted with CA-Cricket
Graph III (Computer Associates).
| |
RESULTS |
c-fos mRNA transcription increases during fibroblast
contraction of stressed collagen matrices.
Fibroblast contraction
of stressed collagen matrices was previously shown to result in
activation of signaling pathways that may have activated transcription
of genes important in the wound healing process (26, 27, 38,
39). To examine this possibility, fibroblasts were cultured for 2 days in attached collagen matrices, which allowed mechanical stress to
develop, and then the matrices were released to initiate contraction
(Fig. 1). Cells in stressed and contracting matrices were extracted,
and Fig. 2A shows the results of a
typical Northern hybridization analysis of c-fos mRNA levels
in the cells. GAPDH mRNA levels were determined for loading controls.
The results were quantified, and Fig. 2B shows a time course for
contraction versus c-fos/GAPDH mRNA ratios. In stressed
matrices, levels of c-fos mRNA were low or undetectable. Within 30 min after release and initiation of contraction,
c-fos mRNA levels began to increase, reached maximal levels
by 50 to 60 min, and then declined.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
c-fos mRNA levels increase during
contraction. Stressed collagen matrices were released to initiate
contraction. RNA was isolated from the matrices at the times indicated.
(A) Northern hybridization analysis with c-fos and GAPDH
probes; (B) c-fos/GAPDH ratios based on densitometry
readings.
|
|
Fibroblasts cultured 24 to 48 h in floating collagen matrices had
undetectable c-
fos mRNA levels. Physically manipulating
these matrices by transferring them between culture dishes did
not
increase levels of c-
fos mRNA, but tearing the matrix in
half
with two spatulas resulted in increased c-
fos
expression (data
not shown) analogous to that of fibroblasts wounded in
tissues
(
10,
41,
47).
The findings shown in Fig.
2 may have resulted from an increase in
c-
fos mRNA transcription or stability. Because of technical
limitations of the cell-collagen matrix cultures, it was not possible
to perform in vitro nuclear run-on assays to make the above-described
distinction. As an alternative, two kinds of experiments were
carried
out. First, we used RT-PCR to compare contraction-stimulated
changes in
levels of c-
fos mRNA and c-
fos hnRNA. Levels of
hnRNA
have been shown to be directly proportional to the
transcriptional
activity of the c-
fos gene (
68).
In addition, both RT-PCR and
Southern blot analyses were carried out to
determine the effects
of inhibiting transcription with actinomycin D on
contraction-stimulated
changes in levels of c-
fos mRNA and
hnRNA.
Figure
3A shows that low levels of
c-
fos mRNA and hnRNA could be detected by RT-PCR even in
stressed collagen matrices. These
levels increased markedly after
contraction, and the increase
was inhibited by addition of 5 µg of
actinomycin D per ml. In
other experiments, we used Northern blot
analysis to examine the
effects of actinomycin D on the time course of
c-
fos mRNA expression
when the inhibitor was added 30 min
after initiating contraction.
Figure
3B shows that in the absence of
actinomycin D, the level
of c-
fos mRNA continued to increase
between 30 to 60 min, consistent
with the results shown in Fig.
2. In
the presence of actinomycin
D, however, the level of c-
fos
mRNA decreased between 30 to 60
min and was undetectable by 80 min.
Taken together, these findings
indicate that the contraction-stimulated
increase in c-
fos mRNA
levels resulted from an increase in
c-
fos mRNA transcription rather
than an increase in mRNA
stability.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Contraction-stimulated accumulation of c-fos
mRNA and hnRNA detected by RT-PCR and Northern blot analysis. (A)
Stressed collagen matrices were preincubated for 30 min with or without
5 µg of actinomycin D (Act D) per ml. Subsequently, the matrices were
released to initiate contraction. After 60 min, RNAs were isolated from
the matrices and analyzed by RT-PCR with primers for c-fos
mRNA, c-fos hnRNA, and GAPDH. (B) Stressed collagen matrices
were released to initiate contraction. Thirty minutes later, 5 µg of
actinomycin D per ml was added to the samples indicated. RNAs were
isolated from the matrices at the times shown and analyzed by Northern
hybridization with c-fos mRNA and GAPDH probes.
|
|
The basal component of fibroblast contraction of stressed collagen
matrices is sufficient to stimulate c-fos mRNA
transcription.
Fibroblast contraction of stressed collagen
matrices exhibits basal and stimulated (by serum) components (38,
62). Basal contraction results in disruption of actin stress
fibers, Ca2+ uptake, and cyclic AMP signaling
(38). Stimulated contraction, on the other hand, is required
for actin cytoskeletal retraction to the cellular perinuclear region
(38) and growth factor receptor desensitization
(39). To determine if the basal component of contraction was
sufficient to stimulate c-fos transcription,
c-fos mRNA levels were compared during contraction in
serum-free and serum-containing DMEM. Figure
4 shows that levels of stimulation of
c-fos mRNA expression during contraction were similar with or without serum in the medium. This result not only showed that the
basal component of contraction was sufficient to stimulate c-fos transcription but also ruled out the possibility that
increased c-fos mRNA transcription during contraction was a
result of direct serum stimulation (2, 19).
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
The increase in c-fos mRNA levels during
contraction does not require serum. Stressed collagen matrices in
medium with or without 10% serum as shown were released to initiate
contraction as indicated. After 50 min, RNAs were isolated from the
matrices and analyzed by Northern hybridization with c-fos
and GAPDH probes.
|
|
Contraction-stimulated increase in c-fos transcription
is independent of actin cytoskeletal organization.
Disruption of
the actin cytoskeleton has been reported to cause an increase in
c-fos expression (69). Since disruption of actin
stress fibers (but not microtubules or intermediate filaments) occurs
during contraction-stressed matrices (37, 38, 62), it was of
interest to learn whether disruption of actin stress fibers of
fibroblasts in stressed collagen matrices was sufficient to induce
c-fos expression. Figure 5
shows that treatment of fibroblasts in stressed collagen matrices with
10 µM cytochalasin D (which completely disrupts stress fibers of
fibroblasts in stressed collagen matrices and blocks stimulated
contraction [data not shown]) did not cause a significant increase in
c-fos mRNA levels. Also, treatment of cells with
cytochalasin D did not prevent increased c-fos mRNA levels
during contraction. The latter finding is consistent with the results
of experiments on serum dependence (Fig. 4), since cytochalasin D
inhibits the stimulated component of contraction (38, 62)
but only partially blocks the basal component of contraction, e.g., it
results in reduced cyclic AMP signaling (26) and no change
in Ca2+ uptake (38).
View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Cytochalasin D treatment does not affect the level of
c-fos mRNA in stressed or contracting collagen matrices.
Stressed collagen matrices were preincubated for 10 min with 10 µM
cytochalasin D (Cyto D) or an equivalent amount of dimethyl sulfoxide
(DMSO). Subsequently, the matrices were released to initiate
contraction. After 50 min, RNAs were isolated from the matrices and
analyzed by Northern hybridization with c-fos and GAPDH
probes. S, stressed; C, contracting.
|
|
Increased c-fos mRNA expression requires
Ca2+ uptake but not the cyclic AMP signaling pathway.
Basal contraction of stressed collagen matrices results in
Ca2+ uptake and an increase in cyclic AMP (26, 27,
38), and Ca2+ and cyclic AMP have been implicated in
the stimulation of c-fos transcription through the cyclic
AMP response element (58). Therefore, we tested the
possibility that Ca2+ and cyclic AMP are important for
c-fos stimulation during contraction.
Figure
6 shows that addition of EGTA to
chelate extracellular calcium inhibited increased c-
fos mRNA
expression in response
to contraction and that inhibition was prevented
by the addition
of excess Ca
2+ with EGTA to the medium.
Therefore, extracellular Ca
2+ uptake appeared to be
necessary for the contraction-stimulated
increase in c-
fos
expression. Figure
7A, on the other hand,
shows
that Ca
2+ uptake alone was not sufficient for
increased c-
fos expression,
since addition of calcium
ionophore to fibroblasts in stressed
collagen matrices caused an
increase in the level of c-
fos mRNA
that was less than half
of that observed during matrix contraction.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
The increase in c-fos mRNA levels during
contraction requires extracellular Ca2+. Stressed collagen
matrices were preincubated for 10 min with 3 mM EGTA and/or 3 mM
CaCl2 as shown. Subsequently, the matrices were released to
initiate contraction. After 50 min, RNAs were isolated from the
matrices and analyzed by Northern hybridization with c-fos
and GAPDH probes.
|
|
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of calcium ionophore and forskolin on
c-fos mRNA levels and CREB phosphorylation in fibroblasts in
stressed collagen matrices. Stressed collagen matrices were incubated
for 50 min with 50 µM A23187 and/or 30 µM forskolin or allowed to
contract for 10 min as indicated. (A) RNAs were isolated from the
matrices and analyzed by Northern hybridization with c-fos
and GAPDH probes. (B) The matrices (two per sample) were extracted,
subjected to SDS-PAGE, and immunoblotted with phosphoCREB (p-CREB)
(Ser133) antibody or control CREB antibody. The phosphoCREB antibody
also reacts with phosphorylated ATF-1 (p-ATF1) S, stressed; C,
contracting.
|
|
Figure
7A shows that treatment of fibroblasts in stressed collagen
matrices with forskolin did not stimulate c-
fos mRNA
transcription
even though it resulted in an increase in cyclic AMP
twice as
high as that observed in fibroblasts contracting collagen
matrices.
A c-
fos mRNA response similar in magnitude to that
observed during
collagen matrix contraction was observed when cells in
stressed
matrices were subjected to combined treatment with
Ca
2+ ionophore and forskolin, but under these conditions
there was
a synergistic effect resulting in cyclic AMP levels sixfold
higher
than those observed during contraction. Specifically, in an
experiment
in which the conditions were the same as those described for
Fig.
7 except that after 10 min the matrices were extracted and cyclic
AMP was determined as described previously (
26,
27), the
cyclic
AMP levels of fibroblasts (means ± standard deviations)
were as
follows: 1.2 × 10
3 cpm ± 0.2 × 10
3 cpm for a stressed matrix, 9.3 × 10
3
cpm ± 1.0 × 10
3 cpm for a contracting matrix, 7.2 × 10
3 ± 2.4 × 10
3 cpm for a stressed matrix
with A23187, 21.0 × 10
3 ± 0.1 × 10
3 cpm
for a stressed matrix with forskolin, and 61.8 × 10
3 ± 7.0 × 10
3 cpm for a stressed matrix with A23187 and
forskolin.
The above-described results indicated that there was not a clear
correlation between cyclic AMP levels of fibroblasts in stressed
matrices and stimulation of c-
fos. Nor was there a
correlation
between c-
fos mRNA levels and phosphorylation of
CREB, the cyclic
AMP response element-binding protein on which
Ca
2+ and cyclic AMP signals converge, leading to activation
of c-
fos transcription (
58). Indeed, as shown in
Fig.
7B, the highest
levels of phosphoCREB (and the related activating
transcription
factor 1 [ATF-1]) were observed when fibroblasts in
stressed matrices
were treated with forskolin, even though levels of
c-
fos mRNA
did not increase under these conditions.
To clarify the above-described findings, additional experiments were
carried out with the PKA inhibitor H89. Addition of H89
to fibroblasts
contracting stressed collagen matrices only slightly
inhibited
stimulation of c-
fos mRNA (Fig.
8A) but completely blocked
phosphorylation of CREB stimulated by forskolin (Fig.
8B). Taken
together, the results in Fig.
7 and
8 suggest that although increased
cyclic AMP synthesis may contribute to stimulation of c-
fos
transcription
during fibroblast contraction of stressed collagen
matrices, this
increase is neither necessary nor sufficient to account
for the
overall c-
fos response.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
PKA inhibitor H89 blocks contraction-stimulated CREB
phosphorylation but not increased transcription of c-fos
mRNA. Stressed collagen matrices were preincubated for 1 h with
H89 at the concentrations indicated or an equivalent amount of DMSO.
Subsequently, collagen matrices were either released to initiate
contraction or treated with 30 µM forskolin to activate PKA. After 50 min, matrices were extracted. (A) RNAs were isolated and subjected to
Northern hybridization with c-fos and GAPDH probes. S,
stressed; C, contracting. (B) Samples were subjected to SDS-PAGE and
immunoblotted with antibodies to phosphoCREB (p-CREB) or total CREB.
p-ATF1, phosphorylated ATF-1.
|
|
Increased c-fos mRNA expression does not require the
ERK 1/2 signaling pathway.
In addition to calcium influx and
increased cyclic AMP production, Fig. 9A
shows that fibroblast contraction of stressed collagen matrices also
results in activation of the ERK 1/2 signaling pathway. This activation
was completely blocked by the MEK 1/2 inhibitor PD98059 (1).
Since activation of the ERK 1/2 signaling pathway can stimulate
c-fos transcription through the serum-response element (SRE)
of the c-fos promoter (32, 51), experiments were
carried out to learn if the ERK 1/2 pathway plays a role in the
contraction-stimulated increase in the level of c-fos.
Figure 9B shows that PD98059 only partially inhibited stimulation of
c-fos mRNA during contraction. Under the same conditions,
however, PD98059 completely blocked the c-fos mRNA increase
when fibroblasts in stressed collagen matrices were treated with 100 nM
phorbol myristate acetate, which also stimulates c-fos mRNA
transcription through the SRE (2, 18, 59). These data
suggest that activation of the ERK 1/2 signaling pathway was not
required for the contraction-activated increase in c-fos
mRNA transcription.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
The MEK 1/2 inhibitor PD98059 blocks
contraction-stimulated activation of ERK 1/2 but not increased
c-fos mRNA levels. (A) Stressed collagen matrices were
preincubated for 1 h with 100 µM PD98059 or an equivalent amount
of DMSO. Subsequently, the collagen matrices were released to initiate
contraction. After 10 min, the matrices (two per sample) were
extracted, subjected to SDS-PAGE, and immunoblotted with antibodies to
phosphorylated ERK 1/2 or total ERK 1/2 (p-ERK). (B) Stressed collagen
matrices were preincubated for 1 h with 100 µM PD98059 or an
equivalent amount of DMSO as shown. Subsequently, the matrices were
released to initiate contraction or treated with 100 nM phorbol
myristate acetate to stimulate protein kinase C. After 50 min, RNAs
were isolated from the matrices and analyzed by Northern hybridization
with c-fos and GAPDH probes. S, stressed; C, contracting.
|
|
fosB and c-jun mRNA levels increase in
response to fibroblast contraction of stressed collagen matrices.
Finally, to examine if increased transcription during matrix
contraction was a widespread response of immediate-early genes to
contraction or limited to c-fos, RT-PCR experiments were
carried out to probe the levels of several other immediate-early genes as well as the transcription factor NF-B. Figure
10 shows results from a typical
experiment comparing levels of gene expression by fibroblasts in
stressed matrices (lanes S), contracting matrices (lanes C), and
matrices that had been floating in culture medium for 2 days (lanes F).
Consistent with the results of experiments already described,
c-fos was essentially undetectable in cells in stressed
matrices, markedly upregulated in response to contraction, and low
again in floating matrices. A second member of the fos family, fosB (both transcripts) responded similarly to
c-fos, while two other fos family members,
fra-1 and fra-2, showed no differences in mRNA
levels detected by RT-PCR. Three other genes, c-jun,
c-myc, and that encoding NF-B, were expressed at
detectable levels in fibroblasts in stressed matrices. Of these, only
c-jun showed a detectable increase in response to
contraction. Taken together, these results indicate that contraction of
stressed collagen matrices stimulates highly selective changes in gene expression.
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 10.
RT-PCR analysis of mRNA levels of c-fos and
related genes in stressed, contracting, and floating collagen matrices.
Collagen matrices were stressed (lanes S), contracting for 50 min
(lanes C), or floating for 2 days (lanes F). RNAs were isolated from
the matrices. RT-PCR was performed with probes for c-fos,
fosB, fra-1, fra-2, c-jun,
c-myc, and NF-B as indicated. The 100- to 125-bp band
observed in some lanes results from nonspecific primer dimerization.
|
|
| |
DISCUSSION |
c-fos mRNA levels increase when fibroblasts contract
stressed collagen matrices.
The goal of our study was to determine
if c-fos or other immediate-early genes are modulated in
response to fibroblast contraction of stressed collagen matrices and to
learn whether changes in gene expression can be attributed to the
signal transduction processes activated by contraction. We found that
c-fos mRNA
initially undetectable in fibroblasts in
stressed collagenincreased dramatically and peaked 50 to 60 min after
matrix contraction was initiated. The level of c-fos hnRNA
also increased after contraction, and both c-fos mRNA and
hnRNA responses to contraction were prevented by actinomycin D. These
results indicated that the increase in c-fos mRNA during
stressed matrix contraction resulted from an increase in mRNA synthesis
rather than an increase in mRNA stability. Levels of two other
immediate-early genes, fosb and c-jun, also
increased transiently after fibroblast contraction, but those of
fra-1, fra-2, c-myc, and the
transcription factor NF-B did not appear to change. Therefore,
contraction appeared to activate a select group of genes.
The basal component of collagen matrix contraction is sufficient to
account for the increase in c-fos mRNA levels.
Fibroblast contraction of stressed collagen matrices exhibits basal and
stimulated (by serum) components (38, 62). The mechanism of
basal contraction is unknown but probably includes an elastic element,
since it is only partially inhibited by cytochalasin D. Since levels of
stimulation of c-fos mRNA expression during contraction were
similar with or without serum in the medium and in the presence and
absence of cytochalasin D, it seems likely that the basal component of
contraction is sufficient to stimulate c-fos transcription.
Contraction-stimulated c-fos mRNA transcription
requires Ca2+ uptake but not the cyclic AMP signaling
pathway or CREB phosphorylation.
The basal component of fibroblast
contraction results in stimulation of several signaling events,
including Ca2+ uptake and increased production of cyclic
AMP (26, 27, 38), which might have stimulated
c-fos transcription through the Ca2+-responsive
transcription factor CREB (58). Our studies show that
Ca2+ influx is necessary but not sufficient for
contraction-stimulated c-fos expression. That is, addition
of EGTA to the medium blocked the contraction-stimulated increase in
c-fos mRNA expression completely but addition of
Ca2+ ionophore to fibroblasts in stressed matrices resulted
in only a partial increase in c-fos mRNA levels compared to
those stimulated by contraction.
Also, the contraction-stimulated increase in cyclic AMP did not appear
to be necessary or sufficient for the c-
fos mRNA response,
judging from the experiments with forskolin and H89. Nevertheless,
Ca
2+ ionophore and forskolin added together produced a
synergistic
rise in cyclic AMP levels and an elevation of
c-
fos mRNA levels
comparable to those observed during
contraction of stressed matrices.
Since fibroblast contraction results
in simultaneous increases
in Ca
2+ and cyclic AMP levels
(
26,
27,
38), it is possible that
the mechanism by which
contraction stimulates c-
fos mRNA transcription
involves a
synergistic interaction between Ca
2+ and cyclic AMP. Such
synergistic effects have been described
previously, but the underlying
mechanism is not clearly understood
(
44).
The mechanism by which Ca
2+ and cyclic AMP influence
c-
fos levels of fibroblasts in collagen matrices remains
puzzling, since
we did not find a correlation between c-
fos
mRNA levels and CREB
activation (cf. reference
28).
Indeed, the highest levels of
phosphoCREB were observed after forskolin
treatment of fibroblasts
in stressed matrices, which did not cause a
change in c-
fos expression.
On the other hand, matrix
contraction or combined addition of
Ca
2+ ionophore and
forskolin to fibroblasts in stressed matrices resulted
in markedly
increased c-
fos mRNA expression but only a modest
increase
in phosphoCREB expression. Also, addition of the PKA
inhibitor H89
blocked contraction-stimulated CREB phosphorylation
but did not
increase c-
fos mRNA transcription. Although these
findings
suggest that CREB phosphorylation and c-
fos transcription
are not linked in human fibroblasts in collagen matrices, we cannot
exclude the possibility that rapid turnover of CREB phosphorylation
occurred as a result of Ca
2+ uptake and activation of
calcineurin (or some other phosphatase)
that dephosphorylates CREB
(
5,
16,
22).
Contraction-stimulated c-fos mRNA transcription does
not require the ERK 1/2 kinase signaling pathway.
Depending on the
mechanism of entry into cells and on the spatial location of increased
concentrations of Ca2+, Ca2+ can also can
initiate signals leading to activation of the c-fos SRE
(17, 24). Moreover, contraction of stressed collagen
matrices by fibroblasts was found to stimulate activation of the ERK
1/2 signaling pathway, which also might have led to activation of c-fos transcription through the SRE (32, 50).
If the c-
fos SRE promoter region does play a role in
contraction-stimulated c-
fos transcription, then the
mechanism involved
probably does not require ERK 1/2 signaling. The MEK
1/2 inhibitor
PD98059 completely blocked contraction-stimulated
activation of
the ERK 1/2 pathway and increased c-
fos
transcription stimulated
by phorbol ester but only partly reduced the
increase in c-
fos mRNA transcription caused by contraction.
There are, however,
other mitogen-activated protein kinase pathways
besides that of
ERK 1/2 that can result in activation of the
c-
fos SRE, such as
those of c-Jun N-terminal kinase (JNK)
and p38 (
31,
32). In
preliminary studies, we have found that
the JNK and p38 mitogen-activated
protein kinase signaling pathways
also are activated during fibroblast
contraction (
36a).
Future studies will be required to determine
the possible role of these
pathways in contraction-stimulated
changes in gene expression.
Fibroblast contraction in relationship to mechanoregulation of cell
function.
As mentioned in the introduction, fibroblast contraction
of stressed collagen matrices provides a model to study the transition of fibroblasts from mechanically stressed to mechanically relaxed conditions (stress-relaxation), a transition that occurs at the end of
wound repair in vivo (although over a longer period in an asynchronous
fashion). Stress-relaxation is believed to be an important determinant
of cell quiescence and regression (20).
The signal transduction pathways and changes in gene expression that
account for mechanoregulation of cell function are just
beginning to be
understood. Most previous experimental studies
have focused on
increased mechanical force as a determinant of
cell proliferation in
animal and plant tissues (see, e.g., references
6,
11,
30, and
67), and c-
fos
transcription has been
shown to increase in response to elevated fluid
shear or mechanical
loading (
36,
49,
53). Our results show
that increased transcription
of c-
fos and other
immediate-early genes also accompanies stress-relaxation.
Since increased c-
fos transcription was found to require
Ca
2+ uptake and Ca
2+ uptake occurs through
plasma membrane passages ~3 nm in diameter
that transiently open
during the basal component of cell contraction
(
38), the
formation of these plasma membrane passages may be
a critical feature
of c-
fos regulation. Ca
2+ uptake often
accompanies cell wounding (
14,
56,
61), and
a variety of
studies have shown that increased c-
fos mRNA levels
occur
after wounding of cells in monolayer culture in vitro (
49,
60,
65) or in tissue in vivo (
10,
41,
47). Typically,
this
upregulation has been interpreted in terms of a role for
c-
fos and other immediate-early genes in the wound-induced
onset
of cell motility and proliferation (
2,
50). From the
perspective
of our study, however, one can also understand the
experimental
wound as a means of eliciting a mechanical response from
cells,
regardless of whether the outcome is cell proliferation or cell
quiescence. Indeed, with stress-relaxation, the c-
fos signal
may
be important for cell survival (
57) or some other
mechanically
regulated differentiation function.
The linkage between mechanostimulation and cell wound responses has
recently begun to receive increased attention (
43).
Significantly, mechanostimulated changes in gene expression and
other
cell functions often depend on autocrine signaling mechanisms
(
21,
36,
50,
54,
66), and cell wounding can lead to
release of
molecules that mediate these responses (
7,
9,
33,
42).
Whether the increase in c-
fos mRNA levels in response
to
contraction of stressed collagen matrices also depends on an
autocrine
mechanism remains to be studied.
| |
ACKNOWLEDGMENTS |
We are indebted to William Snell and Evan Simpson for their
helpful comments and suggestions.
These studies were supported by NIH grant GM31321 and by the University
of Texas Southwestern Skin Diseases Research Center (grant AR41940).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cell Biology and Neuroscience, University of Texas Southwestern Medical School, Dallas, TX 75235-9039. Phone: (214) 648-2181. Fax: (214) 648-8694. E-mail: grinne01{at}utsw.swmed.edu.
| |
REFERENCES |
| 1.
|
Alessi, D. R.,
A. Cuenda,
P. Cohen,
D. T. Dudley, and A. R. Saltiel.
1995.
PD098059 is a specific inhibitor of the activation of mitogen activated protein kinase kinase in vitro and in vivo.
J. Biol. Chem.
270:27489-27494[Abstract/Free Full Text].
|
| 2.
|
Angel, P., and M. Karin.
1991.
The role of jun, fos and the AP-1 complex in cell-proliferation and transformation.
Biochim. Biophys. Acta
1072:129-157[Medline].
|
| 3.
|
Bell, E.,
B. Ivarsson, and C. Merrill.
1979.
Production of a tissue-like structure by contraction of collagen lattices by human fibroblasts of different proliferative potential in vitro.
Proc. Natl. Acad. Sci. USA
76:1274-1278[Abstract/Free Full Text].
|
| 4.
|
Bellows, C. G.,
A. H. Melcher, and J. E. Aubin.
1981.
Contraction and organization of collagen gels by cell cultured from periodontal ligament, gingiva, and bone suggest functional differences between cell types.
J. Cell Sci.
50:299-314[Abstract].
|
| 5.
|
Bito, H.,
K. Diesseroth, and R. W. Tsien.
1996.
CREB phosphorylation and dephosphorylation: a CA(2+)- and stimulus duration-dependent switch for hippocampal gene expression.
Cell
87:1203-1214[Medline].
|
| 6.
|
Braam, J., and R. W. Davis.
1990.
Rain-, wind-, and touch-induced expression of calmodulin and calmodulin-related genes in arabidopsis.
Cell
60:357-364[Medline].
|
| 7.
|
Cheng, G. C.,
P. Libby,
A. J. Grodzinsky, and R. T. Lee.
1996.
Induction of DNA synthesis by a single transient mechanical stimulus of human vascular smooth muscle cells. Role of fibroblast growth factor-2.
Circulation
93:99-105[Abstract/Free Full Text].
|
| 8.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 9.
|
Clarke, M. S. F.,
R. W. Caldwell,
H. Chiao,
K. Miyake, and P. L. McNeil.
1995.
Contraction-induced cell wounding and release of fibroblast growth factor in heart.
Circ. Res.
76:927-934[Abstract/Free Full Text].
|
| 10.
|
Dash, P. K.,
A. N. Moore, and C. E. Dixon.
1995.
Spatial memory deficits, increased phosphorylation of the transcription factor CREB, and induction of the AP-1 complex following experimental brain injury.
J. Neurosci.
15:2030-2039[Abstract].
|
| 11.
|
Davies, P. F.,
K. A. Barber,
M. V. Volin,
A. Robotewskyj,
J. Chen,
L. Joseph,
M. L. Griem,
M. N. Wernick,
E. Jacobs,
D. C. Polacek,
N. DePaola, and A. I. Barakat.
1997.
Spatial relationships in early signaling events of flow-mediated endothelial mechanotransduction.
Annu. Rev. Physiol.
59:527-549[Medline].
|
| 12.
|
Delvoye, P.,
P. Wiliquet,
J.-L. Leveque,
B. V. Nusgens, and C. M. Lapiere.
1991.
Measurement of mechanical forces generated by skin fibroblasts embedded in the three-dimensional collagen gel.
J. Investig. Dermatol.
97:898-902[Medline].
|
| 13.
|
Desmoulière, A., and G. Gabbiani.
1996.
The role of the myofibroblast in wound healing and fibrocontractive disease, p. 391-423.
In
R. A. F. Clark (ed.), The molecular and cellular biology of wound repair, 2nd ed. Plenum Press, New York, N.Y.
|
| 14.
|
Drumheller, P. D., and J. A. Hubbell.
1991.
Local modulation of intracellular calcium levels near a single-cell wound in human endothelial monolayers.
Arterioscler. Thromb.
11:1258-1265[Abstract/Free Full Text].
|
| 15.
|
Erdos, T.,
G. S. Butler-Browne, and L. Rappaport.
1991.
Mechanogenetic regulation of transcription.
Biochemie
73:1219-1231[Medline].
|
| 16.
|
Florio, T.,
B. A. Perrino, and P. J. Stork.
1996.
Cyclic 3,5 adenosine monophosphate and cyclosporin A inhibit cellular proliferation and serine/threonine protein phosphatase activity in pituitary cells.
Endocrinology
137:4409-4418[Abstract].
|
| 17.
|
Ghosh, A.,
D. D. Ginty,
H. Bading, and M. E. Greenberg.
1993.
Calcium regulation of gene expression in neuronal cells.
J. Neurobiol.
25:294-303.
|
| 18.
|
Gilman, M. Z.
1988.
The c-fos serum response element responds to protein kinase C-dependent and -independent signals but not to cyclic AMP.
Genes Dev.
2:394-402[Abstract/Free Full Text].
|
| 19.
|
Greenberg, M. E., and E. B. Ziff.
1984.
Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene.
Nature
311:433-438[Medline].
|
| 20.
|
Grinnell, F.
1994.
Fibroblasts, myofibroblasts, and wound contraction.
J. Cell Biol.
124:401-404[Free Full Text].
|
| 21.
|
Grygorczyk, R., and J. W. Hanrahan.
1997.
CFTR-independent ATP release from epithelial cells triggered by mechanical stimuli.
Am. J. Physiol.
272:C1058-C1066[Abstract/Free Full Text].
|
| 22.
|
Hagiwara, M.,
A. Alberts,
P. Brindle,
J. Meinkoth,
J. Feramisco,
T. Deng,
M. Karin,
S. Shenolikar, and M. Montminy.
1992.
Transcriptional attenuation following cAMP induction requires PP-1-mediated dephosphorylation of CREB.
Cell
70:105-113[Medline].
|
| 23.
|
Halliday, N. L., and J. J. Tomasek.
1995.
Mechanical properties of the extracellular matrix influence fibronectin fibril assembly in vitro.
Exp. Cell Res.
217:109-117[Medline].
|
| 24.
|
Hardingham, G. E.,
S. Chawla,
C. M. Johnson, and H. Bading.
1997.
Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression.
Nature
385:260-265[Medline].
|
| 25.
|
Harris, A. K.,
D. Stopak, and P. Wild.
1981.
Fibroblast traction as a mechanism for collagen morphogenesis.
Nature
290:249-251[Medline].
|
| 26.
|
He, Y., and F. Grinnell.
1994.
Stress relaxation of fibroblasts activates a cyclic AMP signaling pathway.
J. Cell Biol.
126:457-464[Abstract/Free Full Text].
|
| 27.
|
He, Y., and F. Grinnell.
1995.
Role of phospholipase D in the cAMP signal transduction pathway activated during fibroblast contraction of collagen matrices.
J. Cell Biol.
130:1197-1205[Abstract/Free Full Text].
|
| 28.
|
Heldin, N. E.,
Y. Paulsson,
K. Forsberg,
C. H. Heldin, and B. Westermark.
1989.
Induction of cyclic AMP synthesis by forskolin is followed by a reduction in the expression of c-myc messenger RNA and inhibition of 3H-thymidine incorporation in human fibroblasts.
J. Cell. Physiol.
138:17-23[Medline].
|
| 29.
|
Hunt, T. K., and J. E. Dunphy.
1979.
In
Fundamentals of wound management.
Appleton-Century-Crofts, New York, N.Y.
|
| 30.
|
Ingber, D. E.
1997.
Tensegrity: the architectural basis of cellular mechanotransduction.
Annu. Rev. Physiol.
59:575-599[Medline].
|
| 31.
|
Karin, M.
1995.
The regulation of AP-1 activity by mitogen-activated protein kinases.
J. Biol. Chem.
270:16483-16486[Free Full Text].
|
| 32.
|
Karin, M.,
Z.-G. Liu, and E. Zandi.
1997.
AP-1 function and regulation.
Curr. Opin. Cell Biol.
9:240-246[Medline].
|
| 33.
|
Kaye, D.,
D. Pimental,
S. Prasad,
T. Maki,
H. J. Berger,
P. L. McNeil, and R. A. Kelly.
1996.
Role of transiently altered sarcolemmal membrane permeability and basic fibroblast growth factor release in the hypertrophic response of adult rat ventricular myocytes to increased mechanical activity in vitro.
J. Clin. Invest.
97:281-291[Medline].
|
| 34.
|
Kolodney, M. S., and R. B. Wysolmerski.
1992.
Isometric contraction by fibroblasts and endothelial cells in tissue culture: a quantitative study.
J. Cell Biol.
117:73-82[Abstract/Free Full Text].
|
| 35.
|
Komuro, I., and Y. Yazaki.
1993.
Control of cardiac gene expression by mechanical stress.
Annu. Rev. Physiol.
55:55-75[Medline].
|
| 36.
|
Lean, J. M.,
A. G. Mackay,
J. W. Chow, and T. J. Chambers.
1996.
Osteocytic expression of mRNA for c-fos and IGF-I: an immediate early gene response to an osteogenic stimulus.
Am. J. Physiol.
270:E937-E945.
|
| 36a.
| Lee, D. J., and F. Grinnell. Unpublished
observations.
|
| 37.
|
Lee, T.-L.,
Y.-C. Lin,
K. Mochitate, and F. Grinnell.
1993.
Stress-relaxation of fibroblasts in collagen matrices triggers ectocytosis of plasma membrane vesicles containing actin, annexins II and VI, and b1 integrin receptors.
J. Cell Sci.
105:167-177[Abstract].
|
| 38.
|
Lin, Y. C.,
C.-H. Ho, and F. Grinnell.
1997.
Fibroblasts contracting collagen matrices form transient plasma membrane passages through which the cells take up fluorescein isothiocyanate-dextran and Ca2+.
Mol. Biol. Cell
8:59-71[Abstract].
|
| 39.
|
Lin, Y.-C., and F. Grinnell.
1993.
Fibroblasts in mechanically-relaxed collagen matrices show decreased levels of PDGF-stimulated receptor autophosphorylation.
J. Cell Biol.
122:663-672[Abstract/Free Full Text].
|
| 40.
|
Martin, P.
1997.
Wound healingaiming for perfect skin regeneration.
Science
276:75-81[Abstract/Free Full Text].
|
| 41.
|
Martin, P., and C. D. Nobes.
1992.
An early molecular component of the wound healing response in rat embryosinduction of c-fos protein in cells at the epidermal wound margin.
Mech. Dev.
38:209-216[Medline].
|
| 42.
|
McNeil, P. L.,
L. Muthukrishnan,
E. Warder, and P. A. D'Amore.
1989.
Growth factors are released by mechanically wounded endothelial cells.
J. Cell Biol.
109:811-822[Abstract/Free Full Text].
|
| 43.
|
McNeil, P. L., and R. A. Steinhardt.
1997.
Loss, restoration, and maintenance of plasma membrane integrity.
J. Cell Biol.
137:1-4[Free Full Text].
|
| 44.
|
Mehmet, H.,
C. Morris, and E. Rozengurt.
1990.
Multiple synergistic signal transduction pathways regulate c-fos expression in Swiss 3T3 cells: the role of cyclic AMP.
Cell Growth Differ.
1:293-298[Abstract].
|
| 45.
|
Mochitate, K.,
P. Pawelek, and F. Grinnell.
1991.
Stress relaxation of contracted collagen gels: disruption of actin filament bundles, release of cell surface fibronectin, and down regulation of DNA and protein synthesis.
Exp. Cell Res.
193:198-207[Medline].
|
| 46.
|
Nakagawa, S.,
P. Pawelek, and F. Grinnell.
1989.
Extracellular matrix organization modulates fibroblast growth and growth factor responsiveness.
Exp. Cell Res.
182:572-582[Medline].
|
| 47.
|
Okada, Y.,
S. Saika,
N. Hashizume,
S. Kobata,
O. Yamanaka,
Y. Ohnishi, and E. Senba.
1996.
Expression of fos family and jun family proto-oncogenes during corneal epithelial wound healing.
Curr. Eye Res.
15:824-832[Medline].
|
| 48.
|
Patrick, C. W., Jr., and L. V. McIntire.
1995.
Shear stress and cyclic strain modulation of gene expression in vascular endothelial cells.
Blood Purif.
13:112-124[Medline].
|
| 49.
|
Pawar, S.,
S. Kartha, and F. G. Toback.
1995.
Differential gene expression in migrating renal epithelial cells after wounding.
J. Cell. Physiol.
165:556-565[Medline].
|
| 50.
|
Perrone, C. E.,
D. Fenwick-Smith, and H. H. Vandenburgh.
1995.
Collagen and stretch modulate autocrine secretion of insulin-like growth factor-1 and insulin-like growth factor binding proteins from differentiated skeletal muscle cells.
J. Biol. Chem.
270:2099-2106[Abstract/Free Full Text].
|
| 51.
|
Piechaczyk, M., and J.-M. Blanchard.
1994.
c-fos proto-oncogene regulation and function.
Crit. Rev. Oncol.-Hematol.
17:93-131[Medline].
|
| 52.
|
Rudolph, R.,
J. V. Berg, and H. P. Ehrlich.
1992.
Wound contraction and scar contracture, p. 96-114.
In
I. K. Cohen, R. F. Diegelmann, and W. J. Lindblad (ed.), Wound healing: biochemical and clinical aspects. W. B. Saunders, Philadelphia, Pa.
|
| 53.
|
Sadoshima, J.-I., and S. Izumo.
1993.
Mechanical stretch rapidly activates multiple signal transduction pathways in cardiac myocytes: potential involvement of an autocrine/paracrine mechanism.
EMBO J.
12:1681-1692[Medline].
|
| 54.
|
Sadoshima, J.-I.,
Y. Xu,
H. S. Slayter, and S. Izumo.
1993.
Autocrine release of angiotensin II mediates stretch-induced hypertrophy of cardiac myocytes in vitro.
Cell
75:977-984[Medline].
|
| 55.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 56.
|
Sammak, J. P.,
L. Hinman,
P. O. T. Tran,
M. D. Sjaastad, and T. E. Machen.
1997.
How do injured cells communicate with the surviving cell monolayer?
J. Cell Sci.
110:465-475[Abstract].
|
| 57.
|
Schreiber, M.,
B. Baumann,
M. Cotton,
P. Angel, and E. F. Wanger.
1995.
Fos is an essential component of the mammalian UV response.
EMBO J.
14:5338-5349[Medline].
|
| 58.
|
Sheng, M.,
G. McFadden, and M. E. Greenberg.
1990.
Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB.
Neuron
4:571-582[Medline].
|
| 59.
|
Siegfried, Z., and E. B. Ziff.
1989.
Transcription activation by serum, PDGF, and TPA through the c-fos DSE: cell type specific requirements for induction.
Oncogene
4:3-11[Medline].
|
| 60.
|
Sosnowski, R. G.,
S. Feldman, and J. R. Feramisco.
1993.
Interference with endogenous ras function inhibits cellular responses to wounding.
J. Cell Biol.
121:113-119[Abstract/Free Full Text].
|
| 61.
|
Stanisstreet, M.
1982.
Calcium and wound healing in Xenopus early embryos.
J. Embryol. Exp. Morphol.
67:195-205[Medline].
|
| 62.
|
Tomasek, J. J.,
C. J. Haaksma,
R. J. Eddy, and M. B. Vaughan.
1992.
Fibroblast contraction occurs on release of tension in attached collagen lattices: dependency on an organized actin cytoskeleton and serum.
Anat. Rec.
232:359-368[Medline].
|
| 63.
|
Tso, J. Y.,
X. H. Sun,
T. H. Kao,
K. S. Reece, and R. Wu.
1985.
Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNA's: genomic complexity and molecular evolution of the gene.
Nucleic Acids Res.
13:2485-2502[Abstract/Free Full Text].
|
| 64.
|
Vandenburgh, H. H.
1992.
Mechanical forces and their second messengers in stimulating cell growth in vitro.
Am. J. Physiol.
262:R350-R355[Abstract/Free Full Text].
|
| 65.
|
Verrier, B.,
D. Muller,
R. Bravo, and R. Muller.
1986.
Wounding a fibroblast monolayer results in the rapid induction of the c-fos proto-oncogene.
EMBO J.
5:913-917[Medline].
|
| 66.
|
Wilson, E.,
Q. Mai,
K. Sudhir,
R. H. Weiss, and H. E. Ives.
1993.
Mechanical strain induces growth of vascular smooth muscle cells via autocrine action of PDGF.
J. Cell Biol.
123:741-747[Abstract/Free Full Text].
|
| 67.
|
Yamazaki, T.,
I. Komuro, and Y. Yazaki.
1995.
Molecular mechanism of cardiac cellular hypertrophy by mechanical stress.
J. Mol. Cell. Cardiol.
27:133-140[Medline].
|
| 68.
|
Yang, M., and M. Kurkinen.
1994.
Different mechanisms of regulation of stromelysin and collagenase genes.
Eur. J. Biochem.
222:651-658[Medline].
|
| 69.
|
Zambetti, G.,
A. Ramsey-Ewing,
R. Bortel,
G. Stein, and J. Stein.
1991.
Disruption of the cytoskeleton with cytochalasin D induces c-fos gene expression.
Exp. Cell Res.
192:93-101[Medline].
|
Mol Cell Biol, May 1998, p. 2659-2667, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vishwanath, M., Ma, L., Otey, C. A., Jester, J. V., Petroll, W. M.
(2003). Modulation of Corneal Fibroblast Contractility within Fibrillar Collagen Matrices. IOVS
44: 4724-4735
[Abstract]
[Full Text]
-
Javelaud, D., Laboureau, J., Gabison, E., Verrecchia, F., Mauviel, A.
(2003). Disruption of Basal JNK Activity Differentially Affects Key Fibroblast Functions Important for Wound Healing. J. Biol. Chem.
278: 24624-24628
[Abstract]
[Full Text]
-
LANGEVIN, H. M., CHURCHILL, D. L., CIPOLLA, M. J.
(2001). Mechanical signaling through connective tissue: a mechanism for the therapeutic effect of acupuncture. FASEB J.
15: 2275-2282
[Abstract]
[Full Text]
-
Steffensen, B., Hakkinen, L., Larjava, H.
(2001). Proteolytic Events of Wound-Healing -- Coordinated Interactions Among Matrix Metalloproteinases (MMPs), Integrins, and Extracellular Matrix Molecules. CROBM
12: 373-398
[Abstract]
[Full Text]
-
Rosenfeldt, H., Grinnell, F.
(2000). Fibroblast Quiescence and the Disruption of ERK Signaling in Mechanically Unloaded Collagen Matrices. J. Biol. Chem.
275: 3088-3092
[Abstract]
[Full Text]
-
Cooke, M., Sakai, T, Mosher, D.
(2000). Contraction of collagen matrices mediated by alpha2beta1A and alpha(v)beta3 integrins. J. Cell Sci.
113: 2375-2383
[Abstract]
-
Cheresh, D. A., Leng, J., Klemke, R. L.
(1999). Regulation of Cell Contraction and Membrane Ruffling by Distinct Signals in Migratory Cells. JCB
146: 1107-1116
[Abstract]
[Full Text]
-
Corbett, S. A., Schwarzbauer, J. E.
(1999). Requirements for alpha 5beta 1 Integrin-mediated Retraction of Fibronectin-Fibrin Matrices. J. Biol. Chem.
274: 20943-20948
[Abstract]
[Full Text]
-
Grembowicz, K. P., Sprague, D., McNeil, P. L.
(1999). Temporary Disruption of the Plasma Membrane Is Required for c-fos Expression in Response to Mechanical Stress. Mol. Biol. Cell
10: 1247-1257
[Abstract]
[Full Text]
Top
Abstract
Introduction
