Previous Article | Next Article 
Mol Cell Biol, May 1998, p. 2688-2696, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Ski6p Is a Homolog of RNA-Processing Enzymes That Affects
Translation of Non-Poly(A) mRNAs and 60S Ribosomal Subunit
Biogenesis
Lionel
Benard,
Kathleen
Carroll,
Rosaura C. P.
Valle,
and
Reed B.
Wickner*
Laboratory of Biochemistry and Genetics,
National Institute of Diabetes and Digestive and Kidney Diseases,
Bethesda, Maryland 20892-0830
Received 3 November 1997/Returned for modification 5 January
1998/Accepted 23 February 1998
 |
ABSTRACT |
We mapped and cloned SKI6 of Saccharomyces
cerevisiae, a gene that represses the copy number of the L-A
double-stranded RNA virus, and found that it encodes an essential
246-residue protein with homology to a tRNA-processing enzyme,
RNase PH. The ski6-2 mutant expressed electroporated
non-poly(A) luciferase mRNAs 8- to 10-fold better than did the isogenic
wild type. No effect of ski6-2 on expression of uncapped or
normal mRNAs was found. Kinetics of luciferase synthesis and direct
measurement of radiolabeled electroporated mRNA indicate that the
primary effect of Ski6p was on efficiency of translation rather than on
mRNA stability. Both ski6 and ski2 mutants show
hypersensitivity to hygromycin, suggesting functional alteration of the
translation apparatus. The ski6-2 mutant has normal amounts
of 40S and 60S ribosomal subunits but accumulates a 38S particle
containing 5'-truncated 25S rRNA but no 5.8S rRNA, apparently an
incomplete or degraded 60S subunit. This suggests an abnormality in 60S
subunit assembly. The ski6-2 mutation suppresses the poor
expression of the poly(A)
viral mRNA in a strain
deficient in the 60S ribosomal protein L4. Thus, a ski6
mutation bypasses the requirement of the poly(A) tail for translation,
allowing better translation of non-poly(A) mRNA, including the
L-A virus mRNA which lacks poly(A). We speculate that the
derepressed translation of non-poly(A) mRNAs is due to abnormal (but full-size) 60S subunits.
| |
INTRODUCTION |
The 5' end of eucaryotic mRNA has a
cap structure of the form m7G5'ppp5'Xp, while the 3' end is
polyadenylated. Both of these structures are essential for efficient
translation and mRNA stability. The requirement for cap and poly(A)
structure for messenger expression constitutes a handicap for RNA
viruses whose mRNA is not made by the cellular machinery. L-A virus
mRNA lacks both 5' cap and 3' poly(A) structures (4, 52),
and its cytoplasmic location makes it unlikely that it can use cellular
enzymes to modify its mRNA. Indeed, translation plays a large role in
the interactions of the L-A double-stranded RNA (dsRNA) virus with its
host, Saccharomyces cerevisiae (reviewed in references
11, 22, 32, and 58). L-A has two
overlapping open reading frames, gag, encoding the major
coat protein, and pol, encoding the RNA-dependent RNA
polymerase and packaging function. L-A uses a 
1 ribosomal frameshift
to make a Gag-Pol fusion protein, and the efficiency of this frameshift is critical for viral propagation (12-14).
Many viruses adopt a variety of tricks to acquire a cap or poly(A)
structure. Influenza viruses and Bunyaviruses steal caps from
cellular mRNAs; reoviruses, rhabdoviruses, and togaviruses encode
their own capping enzymes; and Picornaviridae carry
out cap-independent translation (15, 32).
Picornaviruses, togaviruses, influenza viruses, and many other
RNA viruses have an encoded sequence that is copied to produce mRNA
with a 3' poly(A) structure, while rhabdoviruses have no encoded
poly(A) but add it enzymatically to their transcripts. However,
reoviruses and many plant virus mRNAs lack a 3' poly(A).
The apparent lack of 5' cap and 3' poly(A) does not prevent L-A from
being highly expressed. However, this lack of both structures makes L-A
mRNA expression sensitive to chromosomal mutations affecting functions
related to cap or poly(A). Accordingly, studies of L-A have secondarily
brought insights into the roles of cap and poly(A).
For instance, the SKI genes (named SKI for
superkiller) were identified by the superkiller phenotype of mutants
(45, 53). The L-A particles can separately encapsidate a
satellite dsRNA, called M dsRNA, encoding a secreted protein toxin (the
killer toxin). ski mutants have higher copy numbers of
M1 and L-A dsRNAs and so make more killer toxin
(1). SKI1 later proved to be XRN1,
encoding the 5'
3' exoribonuclease specific for uncapped RNA and
responsible for the major pathway of mRNA decay (21, 23, 37, 50,
51). It is evident how the uncapped L-A mRNA would be affected by
this protein. To subvert the Ski1p/Xrn1p nuclease, the L-A major coat
protein has a decapping activity which decapitates some cellular
mRNAs to partially distract the nuclease from working on the
capless L-A mRNA (2, 3, 31).
While SKI1 concerns RNA stability, SKI2,
SKI3, and SKI8 encode a system that blocks the
translation of non-poly(A) [poly(A)] mRNA
(31). ski2, ski3, or ski8
mutants translated electroporated C+ A
[Cap+ poly(A)] mRNA nearly as well as
C+ A+ mRNA. Both physical and functional
stabilities of the electroporated mRNA showed little effect from these
mutations. Ski3p is a 163-kDa nuclear protein (44), while
Ski2p is an RNA helicase with a glycine-arginine-rich domain typical of
nucleolar proteins and is homologous to a human nucleolar protein
(7, 28, 61). Ski8p has two copies of the 
-transducin (WD)
repeat sequence but otherwise has no close homologs (33).
This suggested to us that the effects of ski2 and
ski3 (and ski8) on expression of
poly(A) mRNAs might best be explained by a function
taking place in the nucleus.
Strains with mutations in any of more than 20 genes resulting in
deficiency of 60S ribosomal subunits are defective in viral propagation
(5, 41). Mutations in ski2, ski3, or
ski8 suppress the effect of 60S subunit deficiency on viral
propagation (31, 54). We adopted a model in which 60S
interaction with poly(A) is a prerequisite for joining 40S subunits
waiting at the initiator AUG (reviewed in reference
22), and these SKI products mediate this
effect by a role in 60S subunit biogenesis (31, 41). This
model explains why a deficiency of 60S subunits impairs viral propagation more than cell growth, why ski mutants show
increased virus copy number and expression, and why ski
mutations suppress mutations producing deficiency of 60S subunits.
SKI6 genetically resembles SKI2, SKI3,
and SKI8 (45). Here, we show that SKI6
encodes an essential 246-residue protein homologous to several
bacterial RNase PHs, an enzyme responsible for processing the 3' end of
pre-tRNAs. We find that ski6-2 results in derepression of translation of non-poly(A) mRNA and hypersensitivity to the antibiotic hygromycin. The ski6 mutation suppresses the
effect of 60S subunit deficiency on viral propagation. Polysome
gradients reveal a novel 38S particle in ski6-2 mutants
which contains a fragment of 25S rRNA and lacks 5.8S rRNA. These
findings provide direct evidence that Ski6p is involved in 60S
ribosomal subunit biogenesis and, perhaps through this, affects
translation of non-poly(A) mRNA.
| |
MATERIALS AND METHODS |
Genetic mapping of SKI6.
M2 dsRNA is a
killer toxin-encoding satellite of the L-A virus, meaning that its coat
protein and replication proteins are encoded by L-A. At temperatures of
32°C or higher, M2 propagation depends on two genes,
called MKT1 and MKT2 (maintenance of
K2), which are not needed by M1 dsRNA (59,
60). Mutations in the SKI genes suppress this
requirement of M2 for MKT genes (45). Many laboratory strains carry mkt1 mutations, and some have
mkt2 mutations. We crossed mkt1 ski6
M2 strains with a set of multiply marked strains designed
for genetic mapping (18) which proved to also be
mkt1. We found ski6 tightly linked to
ade3 (parental ditype = 58, nonparental ditype = 0, tetratype = 10, 7.3 centimorgans) on the right arm of
chromosome VII.
Cloning of SKI6.
Strain RV493 (= MATa
ura3 ade3 his leu2 trp1 ski6-2 mkt1 L-A-HN
M2) is stably K2+ at either 25 or
32°C, but if it becomes SKI+, then it will be
K2 after growth at 32°C. Several 
clones
of yeast DNA located around ADE3 (46) were tested
by cotransformation of clone DNA and plasmid pBM2240 cut with
EcoRI and XhoI (16). pBM2240 has
homology with the arms of the clone, and the linearized plasmid can
replicate only by recombining with the clone in such a way as to
transfer the insert into the plasmid pBM2240 (16). The
transformants were first isolated at 25°C, grown at 25 or 32°C, and
then tested for killer activity. Only 5047 gave recombinants which
complemented ski6-2 (see Fig. 1). The pBM2240 derivative
carrying the insert of 5047 was isolated, and subclones were made by
cleavage with HindIII and ligation to pRS316 cut with
the same enzyme. One of these subclones, 5047H8, complemented
ski6-2. 5047H8 was cut with SpeI,
SacI, SalI, ClaI, or XhoI,
followed by ligation. The ends of several of these clones were
sequenced and found to be included in the 9-kb region sequenced by
Guerreiro et al. (20). Only the SalI-cut and
religated derivative of 5047H8 complemented ski6-2, suggesting that the open reading frame (ORF) designated YGR195w was
SKI6 (see Fig. 1). This was confirmed by cloning the
1,283-bp AflII-AflII fragment (blunt ended with
Klenow fragment) containing YGR195w from the SalI derivative
of 5047H8 into pRS316 cut with SmaI and showing that the
resulting plasmid, pSKI6, complements ski6-2 (see Fig. 1).
Plasmid constructions.
To make a disruption of
SKI6, the AflII-AflII fragment
containing SKI6 was inserted in a Bluescript vector, making
pSK+SKI6, and the HIS3 gene on a
SmaI-PvuII fragment from pJJ215 (24) was inserted into pSK+SKI6 cut with NdeI (blunt
ended with Klenow fragment) and EcoRV, replacing a 369-bp
segment of SKI6 (Fig. 1). The resulting
pSK+ski6::HIS3 plasmid was digested with
NaeI and SacI and used to transform the diploid
strain 2959 × 2966 (=MATa/MAT
his3/his3
trp1/trp1 ura3/+ +/leu2 L-A-HN M2). To confirm the
disruption, chromosomal DNA was isolated, digested with
HindIII, blotted onto a nitrocellulose filter, and
probed with the 353-bp AflII-NdeI fragment. The
probe detected an 8.2-kb fragment in the normal sequence and a 2.4-kb
fragment in the disrupted sequence. The disrupted diploid 2959 × 2966 ski6::HIS3 segregated two viable
His+ spores with the undisrupted pattern to two inviable
spores. Diploid disruptants showed both undisrupted and disrupted
bands.
Expression of luciferase mRNAs.
The luciferase mRNA
expression plasmids T7 LUC [poly(A)] and T7 LUC50
[50-mer poly(A) tail] have been described previously (19).
For RNA synthesis, T7 LUC was linearized with SmaI and T7
LUC50 was linearized with DraI. Transcripts were synthesized with the Ambion MEGAscript transcription kit in the presence or absence
of the cap analog m7GpppG in accordance with the manufacturer's instructions. After DNase I treatment followed by precipitation with
LiCl, RNAs were passed over G-50 columns (5 Prime-3 Prime Inc.
SELECT-B). RNA was quantitated both by measuring the optical density at
260 nm (OD260) and by a comparison on agarose gels with
known concentration standards.
RNA electroporation was done as described previously (17)
with minor modifications. Cells for spheroplast preparations were grown
in selective medium (H-Ura). After lyticase treatment, cells were
incubated for 2 h in YPAD-sorbitol medium to make them
metabolically active. Two micrograms of RNA was used for
electroporation, and cells were assayed for luciferase activity after
2 h (or as indicated) of outgrowth at 30°C in YPAD-sorbitol
medium. Luciferase activity was assayed as previously described
(31) with a buffer containing coenzyme A.
Stability of electroporated RNA and luciferase accumulation.
The method for determination of stability of electroporated RNA and
luciferase accumulation is identical to that described previously
(31) except that collected spheroplasts were quickly washed
twice with 0.5 ml of 1 M sorbitol, and resulting pellets were frozen in
a dry ice-ethanol mix. For every time and strain, two samples were
collected. One pellet was used for a luciferase assay, and the other
was used to extract RNA.
Yeast extracts, polysome preparation, and analysis.
Cell
lysis was done by a modification of a published protocol
(40). Cycloheximide (100 µg/ml) was added to a 200-ml cell culture at 30°C in H-Ura at an OD600 of 0.4 or 0.5. For
growth at the nonpermissive temperature, cells were grown first at
30°C to an OD600 of 0.05 to 0.1 and then at 39°C for
8 h. The culture was quickly cooled in ice water after
cycloheximide was added and then centrifuged and washed in 20 ml of
buffer A containing 20 mM HEPES (pH 7.5 with KOH), 10 mM KCl, 5 mM
MgCl2, 1 mM EGTA, 1 mM dithiothreitol, and 100 µg of
cycloheximide per ml (water was treated with diethylpyrocarbonate).
After a quick centrifugation, the pellet was resuspended in 0.6 ml of
buffer A. A 1.4-g amount of glass beads (Biospec Products) was added,
and cell lysis was performed by bead beating twice for 30 s each
time (with intermittent cooling) in a minibead beater (Biospec
Products). After lysis, the cell extract was clarified for 5 min at
full speed in a microcentrifuge. Twenty-five OD260 units of
each lysate was centrifuged through 11 ml of 10 to 50% linear sucrose
gradients containing buffer A without dithiothreitol or cycloheximide.
For a plain polysome profile, gradients were centrifuged for 2.5 h
at 39,000 rpm in an SW41 rotor at 4°C. To obtain better resolution of
species around 40S, centrifugations at 27,000 rpm for 14 h were
done. Gradients were run at 4°C through a UV ISCO type 6 monitor
reading OD254.
Northern hybridization.
While gradients were read, fractions
(0.5 ml) were collected and kept cool before an RNA extraction was
performed. RNA was extracted by adding 50 µl of 10% sodium dodecyl
sulfate (SDS), vortexing, and adding 550 µl of phenol previously
equilibrated in buffer AE (50 mM Na acetate [pH 5.3], 10 mM EDTA).
After vortexing, the tubes were incubated at 65°C for 4 min and then
frozen in a dry ice-ethanol mix, followed by a 6-min centrifugation at
room temperature. A second extraction with 600 µl of
phenol-Tris-EDTA-chloroform was performed, RNA from 400 µl of
supernatant was precipitated with 40 µl of 3 M Na acetate (pH 5.3)
and 2.5 volumes of ethanol and centrifuged at 4°C for 30 min, and the
pellet was washed in 80% ethanol. From each RNA pellet resuspended in
diethylpyrocarbonate-water, one-fifth was loaded on a 1.4% agarose gel
containing formamide. The size-fractionated RNA was blotted onto a
Hybond-N membrane (Amersham). Hybridization to end-labeled
oligodeoxynucleotide probes was carried out at 30°C overnight in 6×
SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-5×
Denhardt's solution-0.5% SDS-1 mM EDTA. The filters were washed
successively at 30°C in 5× SSC-0.1% SDS and then in 1× SSC-0.1%
SDS (and 0.1× SSC-0.1% SDS if a background persisted).
Total RNA extracts were obtained from 30 ml of cell cultures
(OD
600 = 0.4) grown at 30°C. Cell pellets were
resuspended in
400 µl of buffer AE, and RNA was extracted as
previously mentioned.
Northern blot analysis was performed as described
above, except
that 30 µg of RNA for each strain was loaded on a 4%
agarose gel
(Nusieve GTG; FMC BioProducts). The probes used were p18S
(5'CGTCCTATTCTATTATTCCATG3'),
p5.8S
(5'TTTCGCTGGGTTCTTCATC3'), p25S
(5'GCCCGTTCCCTTGGCTGTG3')
(complementary to 25S rRNA
bases 2359 to 2377), p25S5' (5'GCGGGTACTCCTACCTGATTTGAGGTC3')
(complementary to 25S rRNA bases 5 to 31), and p25S3'
(5'CAGCAGATCGTAACAACAAGGCTACTCTAC3')
(complementary to bases
3336 to 3365).
Drug hypersensitivity test.
Isogenic wild-type and
ski6 cells growing in selective medium (H-Ura) in log phase
were diluted to OD600s of 0.15, 0.015, and 0.0015, and
5-µl aliquots were spotted on selective plates (H-Ura) with and
without drug (the viabilities of both strains appeared to be
identical and proportional to the measured OD on YPAD and H-Ura media).
In the experiment shown, concentrations of hygromycin B, paromomycin,
and cycloheximide of 50 µg/ml, 300 µg/ml, and 100 ng/ml
(concentrations twofold higher prevented the growth of both strains),
respectively, were used. The wild-type strain, 3221 (61),
and an isogenic ski2 disruptant
(ski2::HIS3) were tested in the same manner on
YPAD plates with or without drug.
| |
RESULTS |
SKI6 is an essential gene, and Ski6p is homologous to
tRNA- processing enzymes and to proteins of Caenorhabditis
elegans and Schizosaccharomyces pombe.
We genetically
mapped SKI6, finding it tightly linked to ADE3 on
chromosome VII. We obtained clones (46) including this small area and cloned the gene from one of them (see Materials and Methods) (Fig. 1). Since the gene
complementing the ski6 mutation was obtained
from DNA mapping close to ADE3, we have cloned
SKI6 and not a suppressor. Sequence analysis shows that the
246-residue Ski6 protein is most closely related to proteins encoded by
uncharacterized ORFs found in S. pombe and
C. elegans (Fig. 2). These
proteins are similar through most of their sequences except for the
C. elegans SKI6 homolog, which has an N-terminal extension
beyond the region of homology. Ski6p is also more distantly
related to Mtr3p, a nucleolar protein required for mRNA export
from the nucleus (25).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning of SKI6. The location of
SKI6 was determined on the linkage map, and genomic clones
in this area were screened for complementation (see text).
Complementation tests of subclones localized SKI6 to
YGR195w. The region deleted in the ski6::HIS3
disruption and the probe used are shown.
|
|
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Ski6 protein is homologous to tRNA-processing enzymes of
bacteria (9, 27) and proteins encoded by uncharacterized
ORFs of Schizosaccharomyces pombe (pombe; GenBank accession
no. D89141) (64) and Caenorhabditis elegans (C. eleg. or C. e.; EMBL accession no. Z49909) (62). S.c. or S. cerev., S. cerevisiae; coli or E. coli,
Escherichia coli; H. flu, Haemophilus influenzae;
Ps. aer., Pseudomonas aeruginosa.
|
|
Ski6p also has homology to several tRNA-processing enzymes from
bacteria, the RNase PH group. These are phosphate-dependent
enzymes
involved in the removal of the last few 3' nucleotides
from tRNA
precursors (
10,
26,
27). They are highly specific
in their
action and work together with other nucleases in trimming
the 3' end of
the pre-tRNA molecule. They resemble polynucleotide
phosphorylase in
producing nucleoside diphosphates from RNA and
phosphate and in their
ability to synthesize RNA from nucleoside
diphosphates (
26).
Ski6p has weaker similarity to
Bacillus subtilis polynucleotide phosphorylase. We have not tested whether
ski6 mutations affect tRNA processing, but we present
evidence below
that they do affect ribosome biogenesis.
A deletion-substitution mutation was produced by replacing the
NdeI-
EcoRV fragment of
SKI6 extending
from just upstream of
the AUG to codon 122 with the
HIS3 gene. The meiotic tetrads produced
two viable
His
spores:two inviable spores (15 of 16 tetrads
examined), indicating
that
SKI6 is an essential gene. The
ski6-2 mutant strains are
temperature sensitive for
growth at 39°C, and the temperature
sensitivity is complemented
by our clone of
SKI6. In liquid culture,
ski6-2
cells gradually stop growth after about three doublings,
with no unique
morphology of the arrested cells. Revertants do
not appear on plating a
ski6 mutant at 39°C on rich medium.
Thus,
SKI6, whose mutation, like
ski1,
ski2,
ski3, and
ski8, increases
expression of the uncapped, nonpolyadenylated viral
mRNAs, is an
essential gene with similarities to sequences corresponding
to known
3'
5' exonucleases. Ski6p might act on stability of mRNAs
(on the
Ski1p model) or on translation (like Ski2p, Ski3p, and
Ski8p).
Ski6p blocks translation of non-poly(A) mRNA.
We used
electroporation of luciferase mRNAs to study the effect of a
ski6-2 mutation (Table 1). In
a wild-type strain, cap+ poly(A)+ mRNA was
translated 33 times better than cap+ poly(A)
mRNA (Table 1). In the isogenic ski6-2 strain, the
poly(A)+ mRNA was translated only three times better than
poly(A) mRNA. Thus, the ski6-2 mutation
increases the efficiency of translation of C+
A mRNA 10-fold. A similar effect on C
A mRNA translation was also seen, with an eightfold
increase in translation in the ski6-2 strain (Table 1). In
contrast, there is no effect of the ski6-2 mutation on
translation of C A+ mRNA (Table 1).
Since the poly(A) structure is important in both translation and
stability (reviewed in reference
22), we examined
luciferase
mRNA stability by direct assay of both structural integrity
(Fig.
3) and functional integrity (Fig.
4).
Radiolabeled mRNAs were
electroporated into cells and incubated as they
were for translation,
samples were taken periodically, the cells were
washed, and RNA
was extracted. The amount of intact mRNA remaining was
determined
by electrophoresis and autoradiography (Fig.
3).
Quantitation
of the autoradiograms showed that each form of the
luciferase
mRNA was, if anything, more stable in the wild type than in
the
ski6-2 mutant, suggesting that mRNA turnover was not the
basis
of better expression in the mutant. However, since we could not
determine into what compartments the electroporated mRNAs had
been
delivered, we examined the functional integrity of the luciferase
mRNAs
by measuring the kinetics of luciferase synthesis with the
same samples
(Fig.
4). This tests the stability of those mRNA
molecules with access
to the translation apparatus. For the poly(A)
+ mRNAs, the
kinetics of synthesis by mutant and wild type were
similar. For the
mRNAs lacking poly(A), synthesis was greater
in the
ski6
strain from the earliest time points, indicating a
difference in
translation rather than in mRNA stability. Plotted
as percent maximal
activity, the wild-type strain showed the same
pattern as did the
ski6 strain. If mRNA instability in the wild
type were the
cause of the reduced expression of the non-poly(A)
mRNAs, it would
quickly reach 100% maximal expression and then
stop, while the
ski6 mutant would continue expression (
19).
This
was not observed (Fig.
4).
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
SKI6 does not affect stability of
electroporated luciferase mRNA. Labeled mRNA was electroporated into
wild-type and ski6-2 cells. The kinetics of luciferase
synthesis (Fig. 4) and mRNA degradation were determined on portions of
the same samples taken at 0, 10, 20, and 30 min. Extracted RNA was
analyzed by agarose gel electrophoresis and autoradiography as
described previously (31).
|
|
View larger version (25K):
[in this window]
[in a new window]
View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
Kinetics of luciferase accumulation in ski6-2
and SKI+ cells indicates an effect on
translation rather than mRNA degradation. (A) Kinetics of luciferase
activity accumulation are plotted in the upper panels (luciferase
activity in light units per microgram of protein), and percent maximal
luciferase activity (% Max Luc Activity) is plotted in the lower
panels. (B) Comparison of ski6-2 and
SKI+ cells in translation of C+
A mRNA over a 90-min time course. If accumulation were
low in wild-type cells for C+ A or
C A mRNAs because of mRNA degradation, then
activity would accumulate rapidly and stop at later time points. The
plateau (100%) would be expected early. In fact, the kinetics as
percent maximal activity are similar for SKI+
and ski6 strains for all types of mRNA. The differences in
rates of accumulation must be due to differences in translation rate.
The percentage was calculated as follows: 100 {[(value at time
t) (value at t = 0)]/[30-min
value]}.
|
|
Antibiotic sensitivity of ski6 mutants.
Many
mutations affecting components of the translation apparatus produce
hypersensitivity to hygromycin B (6, 49) and other drugs
that increase translational errors (30). We found that
ski6-2 strains are hypersensitive to hygromycin B (Fig.
5), supporting the notion that they
affect translation. We also found that ski2 strains are
hypersensitive to hygromycin B and slightly hypersensitive to
cycloheximide (Fig. 5). Neither ski2 nor ski6 mutants are hypersensitive to paromomycin (data not shown).
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
Drug sensitivity assay. Different dilutions of log-phase
cultures were tested for their sensitivities to hygromycin B or
cycloheximide (see Materials and Methods).
|
|
ski6 mutants have a novel 25S rRNA-containing
particle.
At 30°C, growth rates of the isogenic ski6
and wild-type strains are almost identical, although the
ski6 mutant shows a greater delay in leaving stationary
phase than does the wild type. The amount of polysomes in
ski6 strains is consistently lower than that in the
wild-type (Fig. 6). The normal growth
rates imply that translation is proceeding at an essentially normal
rate, although, as shown above, non-poly(A) mRNAs are more
translatable in ski6 cells under these conditions. In
cells grown at 30°C, the polysome gradients reveal the existence of
an extra peak in the ski6 strain, sedimenting slightly
slower than the 40S subunits (Fig. 6 and
7). This 38S extra peak is most clearly
distinguished from the 40S ribosomal subunit in longer centrifugation
runs (Fig. 7). The amount of this extra peak is increased by a shift of
temperature to 39°C, the nonpermissive temperature, and the mutant
stops growing after three more generations. The ratio of polysomes in
ski6-2 cells to those in SKI+ cells
is similar at 39°C to the ratio at 30°C (Fig. 6).
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
ski6-2 cells show a novel species of rRNA
whose origin is 25S rRNA. Polysome profiles of ski6-2
(ski6) and wild-type (SKI6+) cells grown at
either 30 or 39°C are shown. The A260 is
plotted on the vertical axis. Northern analysis of fractions from
polysome profiles at 30°C were made by using probes for 25S (p25S),
18S (p18S), or 5.8S (p5.8S) rRNAs (see Materials and Methods).
|
|
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Long-term centrifugation on sucrose gradients allows
a better separation of the novel 38S species from the usual 40S peak.
The A260 is plotted on the vertical axis.
Northern analysis of fractions from polysome profiles at 39°C was
done by using probes against the 25S (p25S) and 18S (p18S) rRNAs (see
Materials and Methods). The dashed lines show the points on the UV scan
corresponding to the fractions analyzed by Northern hybridization. (B)
Hybridization of the blots from panel A with probes specific for either
the 5' end (p25S5') or 3' end (p25S3') of 25S rRNA.
|
|
We examined the distribution of rRNAs by Northern blot analysis of
gradient fractions (Fig.
6). Fractions containing the extra
peak
in the mutant, close to the 40S peak, give the expected signal
with an
18S rRNA probe for both strains. A probe specific for
25S rRNA
detects a species in the novel peak that is smaller than
25S rRNA and
does not appear in the wild type (Fig.
6). A probe
specific for 5.8S
rRNA shows that this species is absent from
this part of the gradient
in both the mutant and wild type (Fig.
6). Longer centrifugation allows
better separation of this extra
peak (about 38S) from the 40S subunit
peak and reduces contamination
of free 60S subunits (Fig.
7A). Northern
blot analysis confirms
again in these fractions the presence of an RNA
of about 20S,
whose origin is the 25S rRNA. This 20S RNA might be a
product
of degradation of the 25S rRNA that is poorly protected in an
incomplete 60S subunit. The ratio of 18S rRNA in the
ski6
mutant
to 18S rRNA in the wild type is 1.04, while the ratio of
full-length
25S rRNA in the
ski6 mutant to 25S rRNA in the
wild type is 1.05.
Thus, the ratios of free ribosomal subunits are
similar.
Probing the rRNA in the 38S peak with probes specific for the 5' end or
the 3' end of 25S rRNA shows that the 25S-related
species lacks the
normal 5' end but has sequences close to the
3' end (Fig.
7B). The
25S-related sequence in the 38S peak can
be distinguished both by size
and by hybridization specificity
from breakdown products of 25S rRNA
found in the 60S peak of both
mutant and wild-type strains (Fig.
7B).
The latter hybridizes
with both 5' and 3' probes, suggesting that
they are a mixture
of randomly broken molecules, while the former
hybridizes with
the 3' probe but not with the 5' probe.
Comparison of total 5.8S rRNA in isogenic mutant and wild-type
strains shows a 1.9-fold decrease in the
ski6-2 mutant
cells,
with 18S rRNA as the control (Fig.
8).
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
A ski6-2 strain shows a deficiency in 5.8S
rRNA accumulation. Northern blot analysis was done with 30 µg of
total RNA extracted from cells grown at 30°C. The same blots were
hybridized with 18S rRNA as a control (data not shown). Blots of each
were quantitated by scanning.
|
|
ski6-2 suppresses the effect of 60S subunit deficiency
on L-A mRNA translation.
The SKI genes were
discovered based on their derepression of virus expression. Mutations
in genes needed for 60S ribosome biogenesis, including 60S subunit
protein genes, show reduced copy number of L-A dsRNA and loss of the
killer toxin-encoding satellite M1 dsRNA (41).
The mak7-1 mutation is deficient in ribosomal protein L4,
has decreased free 60S ribosomal subunits, and shows halfmers, due to
polysomes with a 40S subunit which is awaiting 60S joining
(41). These mutants lose M1 dsRNA, but we find
that ski6-2 mak7-1 double mutants propagate M1
normally. The mak7-1 ski6-2 strain 4566-2C
(=MATa trp1 leu2 ura3 ski6-2 mak7-1 his
ade3) was transformed with either pSKI6 or pYRC50 (41)
or both to make isogenic strains defective in one or both genes.
Polysome profiles were obtained as described in Materials and Methods, and the ability of the double mutant to propagate M1 was
examined. The mak7-1 strain lost M1, but the
isogenic wild type and the ski6-2 mak7-1 double mutant
propagate M1 normally. This indicates that translation of
the L-A mRNA [which lacks poly(A)] is improved as a result of the
ski6-2 mutation. Moreover, the halfmer peak is absent in
polysome gradients of the double mutants (Fig.
9), suggesting an alteration in the 60S
joining reaction.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
ski6-2 suppresses mak7-1 without
relieving the 60S ribosomal subunit deficiency of mak7-1
strains. The mak7-1 ski6-2 strain 4566-2C (=MATa
trp1 leu2 ura3 ski6-2 mak7-1 his ade3) was
transformed with either pSKI6 or pYRC50 (41) or both to make
isogenic strains defective in one or both genes. Polysome profiles were
obtained as described in Materials and Methods.
|
|
| |
DISCUSSION |
Ski6p is involved in 60S ribosome assembly.
Mutations in
ribosomal protein genes result in decreased rates and extents of
ribosome assembly as expected from their being essential components of
the final structure (36, 63). Other components that are not
part of the finished product but are necessary for its construction
have also been identified (29, 47, 55, 57).
Ski6p is clearly not one of the ribosomal proteins, but we show
that a
ski6 mutant, even at the permissive
temperature, accumulates
a novel particle that contains a fragment of
25S rRNA lacking
the 5' end of the normal 25S rRNA. This is likely
to be either
a misassembled 60S subunit or a misassembled and then
partially
degraded 60S particle. This particle lacks 5.8S rRNA,
and the
cells show some deficiency of total 5.8S rRNA in
comparison to
an isogenic wild-type strain. There is no change in
the relative
levels of free 60S or 40S particles. It is unlikely that
the 38S
particle carries out any of the reactions of protein synthesis
since it lacks both 5.8S rRNA and part of 25S rRNA.
However, the
ski6 mutants plainly do have alterations of the
translation apparatus itself. They are hypersensitive to hygromycin
B,
a phenotype typical of mutants in components of the translation
apparatus.
ski2 mutants show the same phenotype. This
suggests
that, in addition to the 38S defective 60S ribosomal subunits
that accumulate in
ski6 strains, the normal-sized 60S
subunits
are probably also functionally abnormal, perhaps by containing
improperly processed rRNA.
Mitchell et al. have found that Ski6p is in a complex with other
RNA-processing exoribonucleases (
34), suggesting that
it
has a similar function. One of these exoribonucleases, Rrp4p,
is known to be involved in 5.8S rRNA processing (
35),
and
ski6 (renamed
rrp41) mutants are likewise
defective in 5.8S rRNA processing
(
34).
Does Ski6p derepress translation of non-poly(A) mRNAs via
alterations of full-sized 60S subunits?
Ski6p, like Ski2p, Ski3p,
and Ski8p, is necessary for blocking the translation of non-poly(A)
mRNAs, such as the viral mRNAs whose overexpression formed the
basis of the original mutant isolations. The evidence points to
translation, rather than mRNA turnover, as the basis of the
derepressed expression of non-poly(A) mRNAs. The kinetics of
luciferase accumulation and direct measurements of mRNA
turnover show the pattern expected for a translation effect.
The
ski2,
ski3,
ski6, and
ski8 mutants translate non-poly(A) mRNAs nearly as
well as they do poly(A)
+ mRNAs (
31;
also this work), showing that the translation apparatus
is inherently
able to use non-poly(A) mRNAs. Indeed, it had already
been shown
that poly(A)-deficient mRNAs are found on polysomes
in
strains lacking the
SKI1/XRN1 exoribonuclease that degrades
uncapped mRNAs (
21) and in a poly(A) polymerase
temperature-sensitive
mutant shifted to the nonpermissive
temperature (
43).
Elucidating the means by which Ski proteins block translation of
non-poly(A) mRNA requires consideration of the role in translation
of the 3' poly(A) structure of eucaryotic mRNA, an area which
remains controversial (reviewed in references
22 and
48).
Translation of electroporated mRNAs is
stimulated by the 5' cap
and 3' poly(A) structures by 12- and
200-fold, respectively (
19,
56). The 3' poly(A)
structure is known to affect mRNA turnover
(for an example, see
reference
8), but the kinetics of
reporter
synthesis show that there is a substantial effect on
synthesis,
independent of mRNA stability differences
(
19).
One role suggested for poly(A) is to promote the joining of the 60S
subunit to the 40S subunit waiting with associated initiation
factors at the initiator AUG (
38; for reviews, see
references
22 and
39). This was
proposed to occur by an interaction between
the poly(A) and the
60S subunit, forming a circular mRNA, at least
at the time of
initiation. Our results support this model (
31,
41;
also this work). A deficiency of free 60S ribosomal subunits
(in
strains with mutations in any of 20
mak genes) results in
poor translation of the viral mRNAs because they lack poly(A)
and
so compete poorly with the poly(A)
+ cellular mRNAs for
limiting free 60S subunits (
41). Indeed,
limitation of 40S
or 60S subunits in a strain temperature sensitive
for poly(A)
polymerase showed greater discrimination against
non-poly(A)
mRNA when 60S subunits were limiting
(
42). Mutations in the
ski2,
ski3,
ski6, and
ski8 genes improve
viral mRNA translation
[since they improve the translation of all
non-poly(A) mRNAs]
and suppress the effect of 60S subunit
deficiency (without restoring
the levels of 60S subunits)
(
31; also this work). Another model
for the role of
poly(A) in translation involves the association
of the poly(A)
binding protein with eIF-4G (
48). However, this
model does
not suggest an explanation of our data.
We suggested that the Ski2, Ski3, and Ski8 proteins prepare 60S
subunits so that they have the requirement for interaction
with the 3'
poly(A) structure before they will join with the 40S
subunit
waiting at the AUG (
31,
41,
58). We had no direct
evidence
that these proteins have these effects by altering 60S
biogenesis
besides the fact that Ski3p is nuclear (
44) and that
Ski2p
is highly homologous to the mammalian Ski2p (
28,
61)
which
has been localized to the nucleolus (
28). In the case
of
ski6, we have shown directly that 60S subunits are altered.
Conclusions.
We find that SKI6 encodes a homolog of
bacterial tRNA-processing enzymes and is necessary for a system that
specifically blocks translation of non-poly(A) mRNA. We see a novel
species in ski6 mutants that includes a fragment of 25S rRNA
but lacks 5.8S rRNA, suggesting that in these strains 60S subunits are
not properly formed. Hygromycin B hypersensitivity and suppression of
halfmers in a mutant deficient in the ribosomal protein L4 also support the idea that a subtle modification exists in the functional ribosomes and suggests that this modification bypasses the requirement of a 3'
poly(A) for translation.
The results presented here and previously (
31) suggest that
the default for translation is efficient translation of mRNA
independent of poly(A) and that, in a wild-type cell, the specificity
for poly(A) mRNA is accomplished (by the Ski2, Ski3, Ski6, and
Ski8
proteins) by repressing translation of poly(A)
mRNA.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Bldg. 8, Room
225, NIH, 8 Center Dr., MSC 0830, Bethesda, MD 20892-0830. Phone:
(301) 496-3452. Fax: (301) 402-0240. E-mail:
wickner{at}helix.nih.gov.
Present address: Technology Development and Commercialization
Branch, National Cancer Institute, Rockville, Md.
Present address: CBER, Food and Drug Administration, Bethesda,
Md.
| |
REFERENCES |
| 1.
|
Ball, S. G.,
C. Tirtiaux, and R. B. Wickner.
1984.
Genetic control of L-A and L-BC dsRNA copy number in killer systems of Saccharomyces cerevisiae.
Genetics
107:199-217[Abstract/Free Full Text].
|
| 2.
|
Blanc, A.,
C. Goyer, and N. Sonenberg.
1992.
The coat protein of the yeast double-stranded RNA virus L-A attaches covalently to the cap structure of eukaryotic mRNA.
Mol. Cell. Biol.
12:3390-3398[Abstract/Free Full Text].
|
| 3.
|
Blanc, A.,
J. C. Ribas,
R. B. Wickner, and N. Sonenberg.
1994.
His-154 is involved in the linkage of the Saccharomyces cerevisiae L-A double-stranded RNA virus Gag protein to the cap structure of mRNAs and is essential for M1 satellite virus expression.
Mol. Cell. Biol.
14:2664-2674[Abstract/Free Full Text].
|
| 4.
|
Bruenn, J., and B. Keitz.
1976.
The 5' ends of yeast killer factor RNAs are pppGp.
Nucleic Acids Res.
3:2427-2436.
|
| 5.
|
Carroll, K., and R. B. Wickner.
1995.
Translation and M1 double-stranded RNA propagation: MAK18 = RPL41B and cycloheximide curing.
J. Bacteriol.
177:2887-2891[Abstract/Free Full Text].
|
| 6.
|
Crouzet, M.,
F. Izgu,
C. M. Grant, and M. F. Tuite.
1988.
The allosuppressor gene SAL4 encodes a protein important for maintaining translational fidelity in Saccharomyces cerevisiae.
Curr. Genet.
14:537-543[Medline].
|
| 7.
|
Dangel, A. W.,
L. Shen,
A. R. Mendoza,
L.-C. Wu, and C. Y. Yu.
1995.
Human helicase gene SKI2W in the HLA class III region exhibits striking structural similarities to the yeast antiviral gene SKI2 and to the human gene KIAA0052: emergence of a new gene family.
Nucleic Acids Res.
23:2120-2126[Abstract/Free Full Text].
|
| 8.
|
Decker, C. J., and R. Parker.
1993.
A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation.
Genes Dev.
7:1632-1643[Abstract/Free Full Text].
|
| 9.
|
Deutscher, M. P.
1990.
Ribonucleases, tRNA nucleotidyltransferase and the 3' processing of tRNA.
Prog. Nucleic Acids Res. Mol. Biol.
39:209-240[Medline].
|
| 10.
|
Deutscher, M. P.,
G. T. Marshall, and H. Cudny.
1988.
RNase PH: an Escherichia coli phosphate-dependent nuclease distinct from polynucleotide phosphorylase.
Proc. Natl. Acad. Sci. USA
85:4710-4714[Abstract/Free Full Text].
|
| 11.
|
Dinman, J. D.
1995.
Ribosomal frameshifting in yeast viruses.
Yeast
11:1115-1127[Medline].
|
| 12.
|
Dinman, J. D.,
T. Icho, and R. B. Wickner.
1991.
A 1 ribosomal frameshift in a double-stranded RNA virus of yeast forms a gag-pol fusion protein.
Proc. Natl. Acad. Sci. USA
88:174-178[Abstract/Free Full Text].
|
| 13.
|
Dinman, J. D.,
M. J. Ruiz-Echevarria,
K. Czaplinski, and S. W. Peltz.
1997.
Peptidyl-transferase inhibitors have antiviral properties by altering programmed 1 ribosomal frameshifting efficiencies: development of model systems.
Proc. Natl. Acad. Sci. USA
94:6606-6611[Abstract/Free Full Text].
|
| 14.
|
Dinman, J. D., and R. B. Wickner.
1992.
Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast M1 double-stranded RNA virus propagation.
J. Virol.
66:3669-3676[Abstract/Free Full Text].
|
| 15.
|
Ehrenfeld, E.
1996.
Initiation of translation by picornavirus RNAs, p. 549-573.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Erickson, J. R., and M. Johnston.
1993.
Direct cloning of yeast genes from an ordered set of lambda clones in Saccharomyces cerevisiae by recombination in vivo.
Genetics
134:151-157[Abstract].
|
| 17.
|
Everett, J. G., and D. R. Gallie.
1992.
RNA delivery in Saccharomyces cerevisiae using electroporation.
Yeast
8:1007-1014[Medline].
|
| 18.
|
Gaber, R. F., and M. R. Culbertson.
1982.
Frameshift suppression in Saccharomyces cerevisiae. IV. New suppressors among spontaneous co-revertants of the group II his4-206 and leu2-3 frameshift mutations.
Genetics
101:345-367[Abstract/Free Full Text].
|
| 19.
|
Gallie, D. R.
1991.
The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency.
Genes Dev.
5:2108-2116[Abstract/Free Full Text].
|
| 20.
|
Guerreiro, P.,
A. M. E. Silva,
T. Barreiros,
J. Arroyo,
M. Garcia-Gonzalez,
M. I. Garcia-Saez,
C. Rodrigues-Pousada, and C. Nombela.
1995.
The complete sequence of a 9000 bp fragment of the right arm of Saccharomyces cerevisiae chromosome VII contains four previously unknown open reading frames.
Yeast
11:1087-1091[Medline].
|
| 21.
|
Hsu, C. L., and A. Stevens.
1993.
Yeast cells lacking 5'3' exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 5' cap structure.
Mol. Cell. Biol.
13:4826-4835[Abstract/Free Full Text].
|
| 22.
|
Jacobson, A.
1996.
Poly(A) metabolism and translation: the closed-loop model, p. 451-480.
In
J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 23.
|
Johnson, A. W., and R. D. Kolodner.
1995.
Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control.
Mol. Cell. Biol.
15:2719-2727[Abstract].
|
| 24.
|
Jones, J. S., and L. Prakash.
1990.
Yeast Saccharomyces cerevisiae selectable markers in pUC18 polylinkers.
Yeast
6:363-366[Medline].
|
| 25.
|
Kadowaki, T.,
R. Schneiter,
M. Hitomi, and A. M. Tartakoff.
1995.
Mutations in nucleolar proteins lead to nucleolar accumulation of polyA+ RNA in Saccharomyces cerevisiae.
Mol. Biol. Cell
6:1103-1110[Abstract].
|
| 26.
|
Kelly, K. O., and M. P. Deutscher.
1992.
Characterization of Escherichia coli RNase PH.
J. Biol. Chem.
267:17153-17158[Abstract/Free Full Text].
|
| 27.
|
Kelly, K. O.,
N. B. Reuven,
Z. Li, and M. P. Deutscher.
1992.
RNase PH is essential for tRNA processing and viability in RNase-deficient Escherichia coli.
J. Biol. Chem.
267:16015-16018[Abstract/Free Full Text].
|
| 28.
|
Lee, S.-G.,
I. Lee,
C. Kang, and K. Song.
1994.
Identification and characterization of a human cDNA homologous to yeast SKI2.
Genomics
25:660-666.
|
| 29.
|
Lee, W. C.,
D. Zabetakis, and T. Melese.
1992.
NSR1 is required for pre-rRNA processing and for the proper maintenance of steady-state levels of ribosomal subunits.
Mol. Cell. Biol.
12:3865-3871[Abstract/Free Full Text].
|
| 30.
|
Liu, R., and S. W. Liebman.
1996.
A translational fidelity mutation in the universally conserved sarcin/ricin domain of 25S yeast ribosomal RNA.
RNA
2:254-263[Abstract].
|
| 31.
|
Masison, D. C.,
A. Blanc,
J. C. Ribas,
K. Carroll,
N. Sonenberg, and R. B. Wickner.
1995.
Decoying the cap mRNA degradation system by a double-stranded RNA virus and poly(A) mRNA surveillance by a yeast antiviral system.
Mol. Cell. Biol.
15:2763-2771[Abstract].
|
| 32.
|
Mathews, M. B.
1996.
Interactions between viruses and the cellular machinery for protein synthesis, p. 505-548.
In
J. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Matsumoto, Y.,
G. Sarkar,
S. S. Sommer, and R. B. Wickner.
1993.
A yeast antiviral protein, SKI8, shares a repeated amino acid sequence pattern with beta-subunits of G proteins and several other proteins.
Yeast
8:43-51.
|
| 34.
|
Mitchell, P.,
E. Petfalski,
A. Shevchenko,
M. Mann, and D. Tollervey.
1997.
The exosome, a conserved eukaryotic RNA processing complex containing multiple 3'5' exoribonucleases.
Cell
91:457-466[Medline].
|
| 35.
|
Mitchell, P.,
E. Petfalski, and D. Tollervey.
1996.
The 3' end of yeast 5.8S rRNA is generated by an exonuclease processing mechanism.
Genes Dev.
10:502-513[Abstract/Free Full Text].
|
| 36.
|
Moritz, M.,
A. G. Paulovich,
Y. F. Tsay, and J. L. Woolford.
1990.
Depletion of yeast ribosomal proteins L16 or RP59 disrupts ribosome assembly.
J. Cell Biol.
111:2261-2274[Abstract/Free Full Text].
|
| 37.
|
Muhlrad, D.,
C. J. Decker, and R. Parker.
1995.
Turnover mechanisms of the stable yeast PGK1 mRNA.
Mol. Cell. Biol.
15:2145-2156[Abstract].
|
| 38.
|
Munroe, D., and A. Jacobson.
1990.
mRNA poly(A) tail, a 3' enhancer of translation initiation.
Mol. Cell. Biol.
10:3441-3455[Abstract/Free Full Text].
|
| 39.
|
Munroe, D., and A. Jacobson.
1990.
Tales of poly(A): a review.
Gene
91:151-158[Medline].
|
| 40.
|
Nelson, R. J.,
T. Ziegilhoffer,
C. Nicolet,
M. Werner-Washburne, and E. A. Craig.
1992.
The translation machinery and 70 kDal heat shock protein cooperate in protein synthesis.
Cell
71:97-105[Medline].
|
| 41.
|
Ohtake, Y., and R. B. Wickner.
1995.
Yeast virus propagation depends critically on free 60S ribosomal subunit concentration.
Mol. Cell. Biol.
15:2772-2781[Abstract].
|
| 42.
|
Proweller, A., and J. S. Butler.
1997.
Ribosome concentration contributes to discrimination against poly(A) mRNA during translation initiation in Saccharomyces cerevisiae.
J. Biol. Chem.
272:6004-6010[Abstract/Free Full Text].
|
| 43.
|
Proweller, A., and J. S. Butler.
1994.
Efficient translation of poly(A)-deficient mRNAs in Saccharomyces cerevisiae.
Genes Dev.
8:2629-2640[Abstract/Free Full Text].
|
| 44.
|
Rhee, S. K.,
T. Icho, and R. B. Wickner.
1989.
Structure and nuclear localization signal of the SKI3 antiviral protein of Saccharomyces cerevisiae.
Yeast
5:149-158[Medline].
|
| 45.
|
Ridley, S. P.,
S. S. Sommer, and R. B. Wickner.
1984.
Superkiller mutations in Saccharomyces cerevisiae suppress exclusion of M2 double-stranded RNA by L-A-HN and confer cold sensitivity in the presence of M and L-A-HN.
Mol. Cell. Biol.
4:761-770[Abstract/Free Full Text].
|
| 46.
|
Riles, L.,
J. E. Dutchik,
A. Baktha,
B. K. McCauley,
E. C. Thayer,
M. P. Leckie,
V. V. Braden,
J. E. Depke, and M. V. Olson.
1993.
Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs.
Genetics
134:81-150[Abstract].
|
| 47.
|
Ripmaster, T. L.,
G. P. Vaughn, and J. L. Woolford.
1993.
DRS1 to DRS7, novel genes required for ribosome assembly and function in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:7901-7912[Abstract/Free Full Text].
|
| 48.
|
Sachs, A. B.,
P. Sarnow, and M. W. Hentze.
1997.
Starting at the beginning, middle and end: translation initiation in eukaryotes.
Cell
89:831-838[Medline].
|
| 49.
|
Sandbaken, M. G.,
J. A. Lupisella,
B. DiDimenico, and K. Chakraburtty.
1990.
Protein synthesis in yeast: structural and functional analysis of the gene encoding elongation factor 3.
J. Biol. Chem.
265:15838-15844[Abstract/Free Full Text].
|
| 50.
|
Stevens, A.
1980.
Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5' mononucleotides by a 5'3' mode of hydrolysis.
J. Biol. Chem.
255:3080-3085[Abstract/Free Full Text].
|
| 51.
|
Stevens, A., and M. K. Maupin.
1987.
A 5'3' exoribonuclease of Saccharomyces cerevisiae: size and novel substrate specificity.
Arch. Biochem. Biophys.
252:339-347[Medline].
|
| 52.
|
Thiele, D. J.,
E. M. Hannig, and M. J. Leibowitz.
1984.
Genome structure and expression of a defective interfering mutant of the killer virus of yeast.
Virology
137:20-31[Medline].
|
| 53.
|
Toh-e, A.,
P. Guerry, and R. B. Wickner.
1978.
Chromosomal superkiller mutants of Saccharomyces cerevisiae.
J. Bacteriol.
136:1002-1007[Abstract/Free Full Text].
|
| 54.
|
Toh-e, A., and R. B. Wickner.
1980.
"Superkiller" mutations suppress chromosomal mutations affecting double-stranded RNA killer plasmid replication in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
77:527-530[Abstract/Free Full Text].
|
| 55.
|
Tollervey, D.,
H. Lehtonen,
R. Jansen,
H. Kern, and E. C. Hurt.
1993.
Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation and ribosome assembly.
Cell
72:443-457[Medline].
|
| 56.
|
Vasilescu, S.,
M. Ptushkina,
B. Linz,
P. P. Muller, and J. E. McCarthy.
1996.
Mutants of eukaryotic initiation factor eIF-4E with altered mRNA cap binding specificity reprogram mRNA selection by ribosomes in Saccharomyces cerevisiae.
J. Biol. Chem.
271:7030-7037[Abstract/Free Full Text].
|
| 57.
|
Venema, J., and D. Tollervey.
1995.
Processing of pre-ribosomal RNA in Saccharomyces cerevisiae.
Yeast
11:1629-1650[Medline].
|
| 58.
|
Wickner, R. B.
1996.
Double-stranded RNA viruses of yeast.
Microbiol. Rev.
60:250-265[Free Full Text].
|
| 59.
|
Wickner, R. B.
1983.
Killer systems in Saccharomyces cerevisiae: three distinct modes of exclusion of M2 double-stranded RNA by three species of double-stranded RNA, M1, L-A-E, and L-A-HN.
Mol. Cell. Biol.
3:654-661[Abstract/Free Full Text].
|
| 60.
|
Wickner, R. B.
1980.
Plasmids controlling exclusion of the K2 killer double-stranded RNA plasmid of yeast.
Cell
21:217-226[Medline].
|
| 61.
|
Widner, W. R., and R. B. Wickner.
1993.
Evidence that the SKI antiviral system of Saccharomyces cerevisiae acts by blocking expression of viral mRNA.
Mol. Cell. Biol.
13:4331-4341[Abstract/Free Full Text].
|
| 62.
|
Wilson, R.,
R. Ainscough,
K. Anderson,
C. Baynes,
M. Berks,
J. Bonfield,
J. Burton,
M. Connell,
T. Copsey,
J. Cooper,
A. Coulson,
M. Craxton,
S. Dear, et al.
1994.
2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans.
Nature
368:32-38[Medline].
|
| 63.
|
Woolford, J. L., and J. R. Warner.
1991.
The ribosome and its synthesis, p. 587-626.
In
J. R. Broach, J. R. Pringle, and E. W. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis and energetics, vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 64.
| Yoshioka, S., K. Kato, and H. Okayama. Unpublished
data.
|
Mol Cell Biol, May 1998, p. 2688-2696, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Todeschini, A.-L., Condon, C., Benard, L.
(2006). Sodium-induced GCN4 Expression Controls the Accumulation of the 5' to 3' RNA Degradation Inhibitor, 3'-Phosphoadenosine 5'-Phosphate. J. Biol. Chem.
281: 3276-3282
[Abstract]
[Full Text]
-
Meskauskas, A., Petrov, A. N., Dinman, J. D.
(2005). Identification of Functionally Important Amino Acids of Ribosomal Protein L3 by Saturation Mutagenesis. Mol. Cell. Biol.
25: 10863-10874
[Abstract]
[Full Text]
-
WANG, L., LEWIS, M. S., JOHNSON, A. W.
(2005). Domain interactions within the Ski2/3/8 complex and between the Ski complex and Ski7p. RNA
11: 1291-1302
[Abstract]
[Full Text]
-
Vos, H. R., Faber, A. W., de Gier, M. D., Vos, J. C., Raue, H. A.
(2004). Deletion of the Three Distal S1 Motifs of Saccharomyces cerevisiae Rrp5p Abolishes Pre-rRNA Processing at Site A2 without Reducing the Production of Functional 40S Subunits. Eukaryot Cell
3: 1504-1512
[Abstract]
[Full Text]
-
FABER, A. W., VOS, J. C., VOS, H. R., GHAZAL, G., ABOU ELELA, S., RAUE, H. A.
(2004). The RNA catabolic enzymes Rex4p, Rnt1p, and Dbr1p show genetic interaction with trans-acting factors involved in processing of ITS1 in Saccharomyces cerevisiae pre-rRNA. RNA
10: 1946-1956
[Abstract]
[Full Text]
-
Bhabhra, R., Miley, M. D., Mylonakis, E., Boettner, D., Fortwendel, J., Panepinto, J. C., Postow, M., Rhodes, J. C., Askew, D. S.
(2004). Disruption of the Aspergillus fumigatus Gene Encoding Nucleolar Protein CgrA Impairs Thermotolerant Growth and Reduces Virulence. Infect. Immun.
72: 4731-4740
[Abstract]
[Full Text]
-
ROSADO, I. V., DE LA CRUZ, J.
(2004). Npa1p is an essential trans-acting factor required for an early step in the assembly of 60S ribosomal subunits in Saccharomyces cerevisiae. RNA
10: 1073-1083
[Abstract]
[Full Text]
-
Chong, J.-L., Chuang, R.-Y., Tung, L., Chang, T.-H.
(2004). Ded1p, a conserved DExD/H-box translation factor, can promote yeast L-A virus negative-strand RNA synthesis in vitro. Nucleic Acids Res
32: 2031-2038
[Abstract]
[Full Text]
-
BENARD, L.
(2004). Inhibition of 5' to 3' mRNA degradation under stress conditions in Saccharomyces cerevisiae: from GCN4 to MET16. RNA
10: 458-468
[Abstract]
[Full Text]
-
Maderazo, A. B., Belk, J. P., He, F., Jacobson, A.
(2003). Nonsense-Containing mRNAs That Accumulate in the Absence of a Functional Nonsense-Mediated mRNA Decay Pathway Are Destabilized Rapidly upon Its Restitution. Mol. Cell. Biol.
23: 842-851
[Abstract]
[Full Text]
-
Moy, T. I., Boettner, D., Rhodes, J. C., Silver, P. A., Askew, D. S.
(2002). Identification of a role for Saccharomyces cerevisiae Cgr1p in pre-rRNA processing and 60S ribosome subunit synthesis. Microbiology
148: 1081-1090
[Abstract]
[Full Text]
-
Searfoss, A., Dever, T. E., Wickner, R.
(2001). Linking the 3' Poly(A) Tail to the Subunit Joining Step of Translation Initiation: Relations of Pab1p, Eukaryotic Translation Initiation Factor 5B (Fun12p), and Ski2p-Slh1p. Mol. Cell. Biol.
21: 4900-4908
[Abstract]
[Full Text]
-
van Hoof, A., Staples, R. R., Baker, R. E., Parker, R.
(2000). Function of the Ski4p (Csl4p) and Ski7p Proteins in 3'-to-5' Degradation of mRNA. Mol. Cell. Biol.
20: 8230-8243
[Abstract]
[Full Text]
-
Morillon, A., Springer, M., Lesage, P.
(2000). Activation of the Kss1 Invasive-Filamentous Growth Pathway Induces Ty1 Transcription and Retrotransposition in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 5766-5776
[Abstract]
[Full Text]
-
Searfoss, A. M., Wickner, R. B.
(2000). 3' poly(A) is dispensable for translation. Proc. Natl. Acad. Sci. USA
97: 9133-9137
[Abstract]
[Full Text]
-
Brown, J. T., Yang, X., Johnson, A. W.
(2000). Inhibition of mRNA Turnover in Yeast by an xrn1 Mutation Enhances the Requirement for eIF4E Binding to eIF4G and for Proper Capping of Transcripts by Ceg1p. Genetics
155: 31-42
[Abstract]
[Full Text]
-
Burkard, K. T. D., Butler, J. S.
(2000). A Nuclear 3'-5' Exonuclease Involved in mRNA Degradation Interacts with Poly(A) Polymerase and the hnRNA Protein Npl3p. Mol. Cell. Biol.
20: 604-616
[Abstract]
[Full Text]
-
Kressler, D., Linder, P., de la Cruz, J.
(1999). Protein trans-Acting Factors Involved in Ribosome Biogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol.
19: 7897-7912
[Full Text]
-
Wood, L. C., Ashby, M. N., Grunfeld, C., Feingold, K. R.
(1999). Cloning of Murine Translation Initiation Factor 6 and Functional Analysis of the Homologous Sequence YPR016c in Saccharomyces cerevisiae. J. Biol. Chem.
274: 11653-11659
[Abstract]
[Full Text]
-
Benard, L., Carroll, K., Valle, R. C. P., Masison, D. C., Wickner, R. B.
(1999). The Ski7 Antiviral Protein Is an EF1-alpha Homolog That Blocks Expression of Non-Poly(A) mRNA in Saccharomyces cerevisiae. J. Virol.
73: 2893-2900
[Abstract]
[Full Text]
-
Ho, J. H.-N., Johnson, A. W.
(1999). NMD3 Encodes an Essential Cytoplasmic Protein Required for Stable 60S Ribosomal Subunits in Saccharomyces cerevisiae. Mol. Cell. Biol.
19: 2389-2399
[Abstract]
[Full Text]
-
Zanchin, N. I. T., Goldfarb, D. S.
(1999). Nip7p Interacts with Nop8p, an Essential Nucleolar Protein Required for 60S Ribosome Biogenesis, and the Exosome Subunit Rrp43p. Mol. Cell. Biol.
19: 1518-1525
[Abstract]
[Full Text]
-
Peltz, S. W., Hammell, A. B., Cui, Y., Yasenchak, J., Puljanowski, L., Dinman, J. D.
(1999). Ribosomal Protein L3 Mutants Alter Translational Fidelity and Promote Rapid Loss of the Yeast Killer Virus. Mol. Cell. Biol.
19: 384-391
[Abstract]
[Full Text]
-
McCarthy, J. E. G.
(1998). Posttranscriptional Control of Gene Expression in Yeast. Microbiol. Mol. Biol. Rev.
62: 1492-1553
[Abstract]
[Full Text]
-
Edskes, H. K., Ohtake, Y., Wickner, R. B.
(1998). Mak21p of Saccharomyces cerevisiae, a Homolog of Human CAATT-binding Protein, Is Essential for 60 S Ribosomal Subunit Biogenesis. J. Biol. Chem.
273: 28912-28920
[Abstract]
[Full Text]
-
Brouwer, R., Allmang, C., Raijmakers, R., van Aarssen, Y., Egberts, W. V., Petfalski, E., van Venrooij, W. J., Tollervey, D., Pruijn, G. J. M.
(2001). Three Novel Components of the Human Exosome. J. Biol. Chem.
276: 6177-6184
[Abstract]
[Full Text]
Top
Abstract
Introduction
