Previous Article | Next Article 
Mol Cell Biol, May 1998, p. 2738-2747, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Bub1p Kinase Activates the Saccharomyces
cerevisiae Spindle Assembly Checkpoint
Katie A.
Farr and
M. Andrew
Hoyt*
Department of Biology, The Johns Hopkins
University, Baltimore, Maryland 21218
Received 10 December 1997/Returned for modification 26 January
1998/Accepted 23 February 1998
 |
ABSTRACT |
Saccharomyces cerevisiae BUB1 encodes a protein kinase
required for spindle assembly checkpoint function. In the presence of
spindle damage, BUB1 is required to prevent cell cycle
progression into anaphase. We have identified a dominantly acting
BUB1 allele that appears to activate the spindle assembly
checkpoint pathway in cells with undamaged spindles. High-level
expression of BUB1-5 did not cause detectable spindle
damage, yet it delayed yeast cells in mitosis at a stage following
bipolar spindle assembly but prior to anaphase spindle elongation.
Delayed cells possessed a G2 DNA content and elevated Clb2p
mitotic cyclin levels. Unlike cells delayed in mitosis by spindle
damage or MPS1 kinase overexpression, hyperphosphorylated
forms of the Mad1p checkpoint protein did not accumulate. Similar to
cells overexpressing MPS1, the BUB1-5 delay was
dependent upon the functions of the other checkpoint genes, including
BUB2 and BUB3 and MAD1,
MAD2, and MAD3. We found that the mitotic delay
caused by BUB1-5 or MPS1 overexpression was
interdependent upon the function of the other. This suggests that the
Bub1p and Mps1p kinases act together at an early step in generating the
spindle damage signal.
 |
INTRODUCTION |
Successful mitotic cell division
requires the coordination of numerous complex processes. Since loss of
coordination would cause drastic consequences, cells utilize
surveillance feedback mechanisms, referred to as
"checkpoints," to enforce the proper sequence of cell division
events (3, 9). Checkpoint mechanisms monitor aspects of
normal division processes and can act to halt cell cycle progression
should defects be detected. The spindle assembly (or mitotic)
checkpoint acts to ensure that replicated chromosomes are properly
attached to a functioning mitotic spindle (reviewed in references
3, 21, and 30). In the presence of spindle damage, this mechanism prevents cells from entering anaphase, the chromosome segregation stage of mitosis.
Studies of the budding yeast Saccharomyces cerevisiae have
revealed seven genes (BUB1, BUB2,
BUB3, MAD1, MAD2, MAD3, and
MPS1) whose functions are required to properly arrest cell
cycle progression following spindle damage. While the normal response
to spindle damage (i.e., as caused by microtubule-depolymerizing
compounds) is to arrest in M phase, loss of function of these
checkpoint genes causes cells to prematurely exit from mitosis, rebud,
and reinitiate DNA replication (10, 15, 29). Loss of
BUB or MAD function also causes precocious sister
chromatid disjunction under microtubule-depolymerizing conditions
(26).
The studies reported in this article are directed toward understanding
the role of the BUB1 product and its relationships to the
products of the other checkpoint genes. BUB1 and
MPS1 encode protein kinases, suggesting that they function
in transduction of the spindle damage signal (14, 20).
MAD1 encodes a phosphoprotein that is believed to be a
substrate of the Mps1p kinase in vivo (6, 7). Bub3p is a
substrate of Bub1p in vitro (20). Studies of vertebrate
cells have revealed that unattached kinetochores are a major source of
the signal indicating spindle malfunction (17).
Interestingly, vertebrate homologs of the Bub1p protein kinase and
Mad2p are physically associated with unattached prometaphase kinetochores (2, 16, 27). In addition, physical associations of S. cerevisiae Bub1p with Bub3p (20) and Mad1p
with Mad2p (cited in reference 21) have been
demonstrated. Therefore, it seems possible that many of the checkpoint
gene products participate in a spindle damage-signaling complex at
kinetochores.
Although the cellular site of action of the Mps1p protein kinase has
not been determined, it is believed to function at an early step in the
generation of the spindle damage signal. Overexpression of
MPS1 is able to delay cell cycle progression into anaphase in a manner similar to checkpoint activation by spindle damage (7). Both treatments cause cellular accumulation of
hyperphosphorylated forms of Mad1p (6, 7). The delay caused
by overexpressed MPS1 is dependent upon the functions of the
six MAD and BUB gene products, suggesting that
they act downstream from, or in concert with, Mps1p. Unlike the
MAD and BUB genes, MPS1 is essential
for cell viability; it is required for the essential process of spindle pole body duplication (31).
Loss of BUB1 function is recessive and causes inappropriate
cell cycle progression through mitosis. In this study, we identified the dominantly acting BUB1-5 allele and demonstrated that it
blocks yeast cell cycle progression in mitosis at a stage prior to
anaphase onset. The mitotic delay resembled that caused by spindle
damage or MPS1 overexpression by a few criteria but differed
in that hyperphosphorylated forms of Mad1p were not detected. Similar to the mitotic delay caused by overexpressed MPS1, the
BUB1-5 delay was dependent upon the functions of the other
checkpoint genes. In addition, we found that the delay caused by
BUB1-5 or MPS1 overexpression was interdependent
upon the function of the other. This suggests that these kinases act
together at an early step in generating the spindle damage signal.
 |
MATERIALS AND METHODS |
Yeast strains and media.
The yeast strains used in these
experiments are listed in Table 1.
bub1
and bub3
frequently become aneuploid
and suppress their slow-growth phenotype. Therefore, bub1
and bub3
strains were routinely generated by sporulation
of heterozygous diploids (MAY2517 and MAY2068, respectively).
MAD gene-deleting DNA constructs were gifts from K. Hardwick
and A. W. Murray. All deletions were verified by Southern blotting
or PCR, as well as by benomyl sensitivity.
Rich and minimal synthetic media were as described previously
(
23). To derepress galactose-inducible genes, cells were
grown
in 2% raffinose synthetic medium at 26°C for 24 h prior
to induction
by the addition of galactose to 2%. Derepression on solid
medium
was accomplished with glycerol-lactate plates (3% and 2%,
respectively)
prior to transfer to galactose medium. Cells were
synchronized
in G
1 phase by the addition of

-factor
(Bachem) to liquid medium,
pH 4.0, to 4 to 6 µg/ml. Cells were
synchronized in S phase by
the addition of hydroxyurea (Sigma) to
liquid medium, pH 5.8,
to 0.1 M. To inhibit microtubule function in
liquid cultures,
nocodazole (Sigma) was added to 10 µg/ml. To inhibit
microtubule
function on solid media, benomyl (DuPont) was added to 10 µg/ml.
Isolation of BUB1-5.
Ten micrograms of plasmid pTR134
(PGAL>BUB1 [BUB1
overexpressed from promoter PGAL] URA3
CEN) was mutagenized (25) with hydroxylamine (Sigma) at
70°C for 1 h (1 M hydroxylamine, 50 mM sodium pyrophosphate [pH
7.0], 100 mM sodium chloride, and 2 mM EDTA) and then concentrated
with Microcon filters (Amicon). To assess the degree of mutagenesis,
treated pTR134 DNA was transformed into the pyrF Escherichia
coli strain KC8. Uracil auxotrophs were found at a frequency of
4.7%. Mutagenized plasmids, amplified in E. coli DH5
,
were transformed into the wild-type yeast strain MAY589 and plated onto
solid minimal medium missing uracil. Developed colonies were then
replica transferred to glycerol-lactate medium (missing uracil) and
after 24 h were transferred again to minimal medium (missing
uracil) containing either galactose or glucose. Mutants that exhibited
poor growth on galactose, but not glucose, were chosen for further
study. Only the BUB1-5 plasmid caused slow growth on
galactose upon retesting.
DNA manipulations.
Standard DNA manipulation techniques were
utilized to construct the various plasmids described in Table 1
(22). The BUB1-5 mutation was mapped by
exchanging fragments of the wild-type and mutant BUB1 genes.
Specifically, NotI-XbaI,
XbaI-KpnI, and KpnI-BstXI fragments were used for this experiment. When exchanged into the wild-type PGAL>BUB1 plasmid pKF28,
the 1.6-kb KpnI-BstXI 3' region from
BUB1-5 was found to confer slow growth on galactose medium. The reciprocal exchange of the wild-type
KpnI-BstXI fragment into the
PGAL>BUB1-5 plasmid pKF30 resulted
in normal growth on galactose. The KpnI-BstXI
region of BUB1-5 was sequenced, revealing a single mutation
of G to A at nucleotide position 2352 (relative to the A in the
initiation codon).
The
bub1-5 K733R double mutant was created via a PCR-based
method. Briefly, a
BUB1 region downstream from
K733R was amplified
with primer A
(CTACGCCAGTCAAAGTACGGTCTTGGATT), containing the
BUB1-5 mutation, and 3'-located primer B
(GTATGACGCCTGCTAATCC).
The 421-bp product of this reaction
was used as a primer along
with 5'-located primer C
(CGTTCACCTACAGTAACAGCT) to amplify a
fragment that includes
the
bub1-K733R mutation.
Cytological techniques.
To observe DNA, cells were fixed
with 70% ethanol on ice for 30 min and stained with DAPI
(4',6-diamidino-2-phenylindole). Samples were scored microscopically
for cell and nuclear morphology. Cells were considered large budded if
the diameter of the bud was about three-fourths of the diameter of the
mother or larger. For immunofluorescence microscopy of tubulin
structures, cells were fixed with formaldehyde and stained with the
antitubulin antibody YOL1/34 (Harland Bioproducts) as described
previously (19). Cells were observed with a Zeiss Axiovert
inverted microscope with a 100× objective. A cooled, slow-scan CCD
camera was used to capture digital images. Samples were fixed for
electron microscopy in 2% phosphate-buffered glutaraldehyde at 26°C
for 30 min, as described previously (1). Thin sections were
analyzed with a JEOL 100S electron microscope. Flow-cytometric analysis
of DNA content was performed as described previously (11)
with an EPICS 752 flow cytometer.
Protein analysis.
Yeast protein extracts were prepared by
beating cells with glass beads (diameter, 425 to 600 µm) in 50 mM
Tris-HCl (pH 6.8) plus 0.6 mM phenylmethylsulfonyl fluoride. Cells were
vortexed four times at the maximum speed for 1 min, with 1 min on ice
in between. Lysate was separated from cell debris and glass beads via
centrifugation for 5 min in the cold. An aliquot was reserved for
protein concentration determination by the BCA assay (Pierce) to ensure
equal loading of samples. One volume of 2× sodium dodecyl sulfate
sample buffer was added to the lysate, which was then boiled. Samples
were run on sodium dodecyl sulfate-polyacrylamide gels, and the
proteins were transferred to polyvinylidene difluoride Immobilon-P
(Millipore) membranes by standard techniques (22). Reagents
for immunoblot analysis were obtained from Tropix. The manufacturer's
instructions were followed for the detection of proteins. Mad1p
antibody was kindly provided by K. Hardwick and A. W. Murray.
Clb2p antibody was a generous gift of D. Kellogg. The Bub1p antibody
has been described elsewhere (20). Goat anti-rabbit secondary antibody was obtained from Jackson ImmunoResearch.
 |
RESULTS |
Identification of the dominant BUB1-5 allele.
The
Bub1p protein kinase may be involved in generating or transmitting a
signal indicating spindle damage. Defects in BUB1 or other
spindle assembly checkpoint genes lead to inappropriate cell cycle
progression in the presence of spindle damage. This implies that the
spindle assembly checkpoint has the capacity to inhibit cycle
progression when it senses damage. To gain a better understanding of
this inhibitory mechanism we screened for a dominant BUB1
allele that would constitutively block progression through mitosis.
Overexpression of
BUB1 from the galactose-inducible
GAL1 promoter (P
GAL>
BUB1)
caused only mild phenotypes (
20)
but did not block cell
cycle progression or reduce growth rates
(Fig.
1A and
2A).
We mutagenized a P
GAL>
BUB1
centromere-containing
plasmid (see Materials and Methods) and
identified a mutant (designated
BUB1-5) that caused slow
growth of wild-type cells specifically
on galactose-containing medium
(Fig.
1A). Cells harboring the
P
GAL>
BUB1-5 plasmid also exhibited
reduced plating efficiency
on galactose, relative to glucose, medium
(44% for P
GAL>
BUB1-5 versus 100%
for P
GAL>
BUB1 [Table
2]). A restriction
fragment exchange
experiment (see Materials and Methods) demonstrated
that a mutation
within a 1.6-kb 3' region of
BUB1 caused the slow-growth
effect. Sequencing of this entire region revealed a single base
pair
mutation causing a change from glycine to serine at amino
acid residue
785 within the Bub1p kinase domain (Fig.
1B). This
position is located
within protein kinase subdomain V, a region
of weakly conserved amino
acid sequence implicated in ATP binding
(
5).
Gly
785 is conserved in
Caenorhabditis elegans,
mouse,
and human Bub1p homologs but not in other protein kinases.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
BUB1-5 slows cell growth when overexpressed.
(A) A wild-type strain (MAY589) was transformed with a
PGAL plasmid vector (pBM272) or plasmids
containing PGAL>BUB1 (pTR134) or
PGAL>BUB1-5 (pKF14) and plated on
galactose-containing medium. The plates in the left three panels were
incubated at 26°C for 4 days. The panel on the right is the
PGAL>BUB1-5 plate photographed after
another two days at 26°C. (B) The BUB1-5 mutation changes
a glycine to serine within the kinase domain. This position occurs
within the kinase domain region designated as subdomain V and is
conserved among known Bub1p homologs. Sc, S. cerevisiae; Ce,
C. elegans; Mm, Mus musculus; Hs, Homo
sapiens.
|
|

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
BUB1-5 overexpression causes a mitotic delay.
(A) Wild-type cells carrying the indicated plasmid construct were
synchronized with -factor and released into galactose-containing
medium at 26°C. At specific time points, samples were fixed, stained
with DAPI, and observed by microscopy. The percentages of total cells
with large-budded (LB) morphologies (diameter of bud cell, 75% of
diameter of mother cell) and single nuclei are displayed. This
morphology is characteristic of mitotic cells. , vector plasmid;
, PGAL>BUB1 plasmid; ,
PGAL>BUB1-5 plasmid. (B) Images of
PGAL>BUB1-5 cells prepared as
described for panel A and stained for DNA with DAPI and antitubulin
with a specific antibody. (C) Thin-section electron micrograph of
PGAL vector (left) and
PGAL>BUB1-5 (right) cells fixed
after growth in galactose for 3 h.
|
|
BUB1-5 causes a delay in mitosis.
To determine the
cause of the slow-growth phenotype, we examined the
morphology of cells expressing the BUB1-5 allele.
Cells harboring PGAL>BUB1-5,
PGAL>BUB1, or
PGAL vector only were synchronized in
G1 with
-factor and released into galactose-containing
medium to induce expression from PGAL. At
intervals, samples were fixed, stained with DAPI, and observed by
microscopy for cellular and nuclear morphology (Fig. 2A and B). The
morphologies of all three strains were indistinguishable up until about
2.5 h postinduction. At this time,
PGAL>BUB1-5 cells with large-budded
(diameter of bud cell,
75% diameter of mother cell) morphologies and
undivided nuclei began to accumulate in the culture. Cells with this
morphology, characteristic of a mitotic block, peaked at around 67% of
total. In contrast, large-budded mononucleate cells did not
accumulate in the PGAL>BUB1 or
PGAL vector only cultures, indicating that these
cells were able to pass through mitosis unhindered. Antitubulin
immunofluorescence microscopy revealed that the large-budded
mononucleate PGAL>BUB1-5 cells
possessed short bipolar spindles characteristic of cells blocked in
mitosis prior to the onset of anaphase (Fig. 2B). As judged from
images generated by thin-section electron microscopy, these spindles
were indistinguishable from the short spindles found in cells not
expressing BUB1-5 (Fig. 2C). Within the resolution limits of
electron microscopy, therefore, BUB1-5 expression delayed cells at a point in mitosis following the assembly of normal-appearing bipolar spindles but prior to anaphase.
Cells in metaphase contain high amounts of the mitotic cyclin proteins,
required for the activation of cyclin-dependent kinases
(
13). Entry into anaphase is accompanied by rapid
degradation
of these cyclins mediated by the anaphase-promoting complex
(
12).
Induced P
GAL>
BUB1-5
cells were found to contain elevated
levels of the mitotic cyclin Clb2p
relative to uninduced cells,
as determined by Western blot analysis
(Fig.
3A). In particular,
a
slower-migrating form of Clb2p greatly accumulated in
P
GAL>
BUB1-5 cells during incubation
in galactose. This slower-migrating Clb2
form, specific to cells
blocked in mitosis, has been observed
by others (
7). Cells
overexpressing
BUB1 did not exhibit elevated
levels of Clb2p
(data not shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
BUB1-5 overexpression affects Clb2p mitotic
cyclin levels. (A) Wild-type cells carrying the
PGAL>BUB1-5 construct were grown in
raffinose-containing medium and then switched to glucose (Glu) or
galactose (Gal) medium for the indicated number of hours. Protein
extracts were prepared and subjected to polyacrylamide gel
electrophoresis and Western blot analysis with an antibody specific for
the mitotic cyclin Clb2p. (B) The indicated checkpoint mutant cells,
carrying the PGAL>BUB1-5 plasmid,
were grown in galactose for the indicated number of hours and examined
for Clb2p levels as in panel A.
|
|
Flow-cytometric analysis of DNA content also demonstrated that
P
GAL>
BUB1-5 cells were delayed in
mitosis (Fig.
4).
Following release from

-factor synchronization in late G
1,
P
GAL>
BUB1-5,
P
GAL>
BUB1, and
P
GAL vector cells replicated
their DNA. By 4 to
5 h after release, the
P
GAL>
BUB1 and
P
GAL vector cells had undergone mitosis and
cytokinesis,
as indicated by the reappearance of cells with a
G
1 DNA content.
In contrast, most of the
P
GAL>
BUB1-5 cells still maintained
their G
2 DNA content, characteristic of a block to mitosis.
Therefore,
by three criteria

cell morphology, mitotic cyclin content,
and
DNA content

overexpression of
BUB1-5 caused a block or
delay to
cell cycle progression in mitosis.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
BUB1-5 overexpression causes arrest after DNA
synthesis. Wild-type cells carrying the indicated construct were
synchronized with -factor and released into galactose-containing
medium at 26°C. At the indicated time points, samples were prepared
for flow-cytometric analysis of DNA content. Displayed is cell number
as a function of DNA content. G1 and G2 roughly indicate the positions
of cells with unreplicated and replicated DNA, respectively.
|
|
The phenotypes described above required that the
BUB1-5
mutant form be expressed from the high-level galactose-inducible
promoter.
Expression of
BUB1-5 from its normal promoter did
not slow colony
growth of wild-type cells (data not shown). This was
observed
for both low-copy (centromere-based) and high-copy
(2µm-based)
constructs. However, we did detect a slight delay in
mitosis for
cells expressing
BUB1-5 from its normal promoter
(on a centromere
plasmid). Following synchronization with

-factor
and release,
more cells harboring a
BUB1-5 plasmid with a
mitotic morphology
(large-budded and mononucleate) accumulated than did
BUB1 or vector
plasmid cells (Fig.
5A).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Normally expressed BUB1-5 causes a slight
mitotic delay and complements bub1 . (A) Wild-type cells
carry the indicated constructs that express BUB1 alleles
from its normal promoter. These cells were synchronized with
-factor, released into galactose-containing medium, and examined for
mitotic cells as described for Fig. 2A. A second trial of this
experiment yielded a similar increase in the number of large-budded
(LB) mononucleate cells for the BUB1-5 strain only. ,
vector plasmid; , BUB1 plasmid; , BUB1-5
plasmid. (B) A bub1 strain was transformed with the
indicated construct expressing BUB1 alleles from its normal
promoter. These cells were spotted onto rich medium and the same medium
containing 10 µg of benomyl per ml. Each spot to the right is a 1:50
dilution of the corresponding spot on the left. Plasmids used:
BUB1, pKF44; BUB1-5, pKF48.
|
|
BUB1-5 provides BUB1 function.
As a
first step toward determining the nature of the BUB1-5
defect, we examined its ability to provide normal BUB1
function. For these tests, we used a centromere plasmid that contained
BUB1-5 expressed from its normal promoter. Cells deleted for
BUB1 exhibit slow growth and sensitivity to the
antimicrotubule agent benomyl. The BUB1-5 plasmid was able
to rescue these phenotypes just as well as a BUB1 plasmid
(Fig. 5B). bub1
is also lethal in combination with a
deletion of CIN8, which encodes a nonessential
kinesin-related mitotic motor (4). By standard genetic
techniques, we were able to construct strains that were deleted for
BUB1 and CIN8 but were viable due to the presence
of the BUB1-5 plasmid (i.e., strain MAY5035). Therefore, by
three criteria, BUB1-5 expressed from its normal promoter
was able to provide BUB1-complementing activity.
Kinase activity is necessary for the BUB1-5
phenotype.
Bub1p is a protein kinase with the ability to
phosphorylate itself, Bub3p, and possibly other proteins in vitro
(20). The kinase activity of Bub1p is required for its
checkpoint function and its ability to support a normal growth rate and
benomyl resistance. The ability of BUB1-5 to complement
bub1
indicated that it could provide some kinase
activity. We investigated whether kinase activity was required for the
Bub1-5p effect.
Lysine
733 of Bub1p corresponds to an active-site residue
conserved among the protein kinases. A Bub1p mutant form in which
this
lysine was changed to arginine (
bub1-K733R) exhibited no
kinase activity in vitro and a checkpoint defect in vivo (
2a,
20). To examine the requirement for kinase function for the
Bub1-5p effect, we created the
bub1-5-K733R double mutant.
When
expressed from the galactose promoter, the amount of double mutant
protein that accumulated in cells was similar to that of the wild
type
and either single mutant (Fig.
6A).
Following

-factor synchronization
and release into galactose medium,
P
GAL>
BUB1-5 caused
a delay in
mitosis (Fig.
6B). In contrast, galactose-driven
BUB1,
bub1-K733R and
bub1-5,
K733R cells
were not blocked. Therefore,
a functional kinase domain is required for
Bub1-5p to effect a
cell cycle delay.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
The BUB1-5 mitotic delay requires a
functional kinase domain. (A) Wild-type cells carrying the
indicated construct were induced in galactose for 4 h. Protein
extracts were then prepared and subjected to gel electrophoresis and
immunoblotting with Bub1p antibody. As previously described
(20), multiple forms of Bub1p were observed. These have been
determined to be due to different phosphorylation states
(3b). (B) Wild-type cells carrying the indicated
construct were synchronized with -factor, released into
galactose-containing medium, and examined for mitotic cells as
described for Fig. 2A. The K733R mutation inactivates kinase
function. , PGAL>BUB1 plasmid;
, PGAL>BUB1-5 plasmid; ,
PGAL>bub1-K733R plasmid; ,
PGAL>bub1-5, K733R
plasmid.
|
|
Mad1p protein does not become hyperphosphorylated when
BUB1-5 is overexpressed.
Activation of the spindle
assembly checkpoint by microtubule disruption or mutational
inactivation of spindle pole body duplication or kinetochore structure
results in the appearance of hyperphosphorylated forms of the Mad1p
checkpoint protein (3a, 6, 7). This modification is
dependent upon BUB1, BUB3, and MAD2
and is believed to be mediated by the protein kinase product of
MPS1 (6, 7). Using Mad1p-specific antibodies and
Western blot analysis, we examined whether overexpression of
BUB1-5 would lead to the appearance of hyperphosphorylated
forms of Mad1p. Extracts from cells overexpressing BUB1-5 or
MPS1, as well as wild-type cells treated with the
microtubule-disrupting agent nocodazole, were compared (Fig.
7). The hyperphosphorylated forms of
Mad1p migrate more slowly in polyacrylamide gels (6). Slower-migrating forms of Mad1p were clearly induced in
PGAL>MPS1 cells treated with
galactose or wild-type cells treated with nocodazole. These
slower-migrating forms were not evident in extracts from PGAL>BUB1-5 cells, however. The
MAD1-specific bands were unchanged in comparisons of
PGAL>BUB1-5 cells grown in glucose
versus those grown in galactose. Therefore, unlike other treatments
that block S. cerevisiae cells in mitosis, the mitotic delay
mediated by BUB1-5 did not result in a detectable elevation in Mad1p phosphorylated forms. To rule out the possibility that BUB1-5 overexpression inhibited the phosphorylation of
Mad1p, PGAL>MPS1 cells were
transformed with the PGAL>BUB1-5 plasmid. Overexpression of both MPS1 and BUB1-5
resulted in the appearance of hyperphosphorylated Mad1p forms. Under
these conditions, more Mad1p reproducibly appeared to be shifted to the
slower-migrating forms than resulted from overexpression of
MPS1 only. Therefore, BUB1-5 overexpression
enhanced but did not inhibit Mad1p phosphorylation mediated by
overexpression MPS1.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 7.
BUB1-5 overexpression does not lead to Mad1p
hyperphosphorylation. Wild-type cells carrying the indicated
construct(s) were grown in glucose (Glu)- or galactose (Gal)-containing
medium for 5 h or treated with 10 µg of nocodazole per ml (in
glucose medium) for 4 h. Protein extracts were analyzed by gel
electrophoresis and Western blotting probed with an antibody specific
for Mad1p. To help identify Mad1p-specific bands, a mad1
strain was also examined. We detected no difference in Mad1p forms
between PGAL>BUB1-5-containing cells
grown in glucose or galactose even when the film was greatly
overexposed.
|
|
The BUB1-5 mitotic delay depends upon the presence of
other mitotic checkpoint genes.
The ability of overexpressed
BUB1-5 to mimic aspects of a spindle assembly
checkpoint-induced cell cycle delay allowed us to examine where in this
pathway the Bub1p kinase acts. We would expect that loss of function of
a checkpoint pathway component that acts downstream of Bub1p, or in
concert with Bub1p, would eliminate the ability of Bub1-5p to delay the
cell cycle in mitosis. However, a component that acts upstream or in a
different pathway from Bub1p would not be required for the Bub1-5p
effect.
We transformed the P
GAL>
BUB1-5 and
P
GAL>
BUB1 plasmids into strains
deleted for either
BUB1,
BUB2, or
BUB3 or
MAD1,
MAD2, or
MAD3. Following

-factor synchronization and
release into galactose-containing
medium, we compared the effects
of
BUB1 and
BUB1-5 overexpression between each mutant and a wild-type
strain (Fig.
8A). As we previously
observed for the wild type,
overexpression of
BUB1 did not
cause a mitotic delay in any of
the mutants. We found that deletion of
the chromosomal
BUB1 gene
did not eliminate the
Bub1-5p-induced delay, demonstrating that
wild-type Bub1p was not
required for the effect caused by Bub1-5p.
In contrast, deletion of
BUB3,
MAD1,
MAD2, and
MAD3
eliminated
the cell cycle delay caused by overexpressed
BUB1-5. The effect
of deleting
BUB2 was
intermediate between those of the wild type
and the
BUB3 and
MAD deletions. Although
bub2
(P
GAL>
BUB1-5)
cells accumulated in
mitosis at a high level, the peak was not
sustained over time as was
observed for wild-type cells. The peak
of mitotic cells fluctuated down
and then back up again during
the 6-h observation period. This
bub2
fluctuation effect was
replicated in seven different
experiments. In the example displayed
in Fig.
8A, samples were taken at
closely spaced time points in
order to better document this behavior.
This finding suggests
that although
BUB2 may not be required
for the initial delay caused
by
BUB1-5, it may be required
for normal maintenance of the delay.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
The BUB1-5 mitotic delay requires the other
spindle assembly checkpoint genes. (A) Cells with the indicated
checkpoint mutation and carrying the
PGAL>BUB1 or
PGAL>BUB1-5 construct were
synchronized with -factor, released into galactose-containing
medium, and examined for mitotic cells, as described for Fig. 2A. (B)
The temperature-sensitive mps1-3796 mutant was transformed
with the PGAL>BUB1 or
PGAL>BUB1-5 construct. These cells
were synchronized in S phase with hydroxyurea at 26°C and were
switched to galactose-containing medium (plus hydroxyurea) for 3 h
to induce BUB1 expression. This was followed by release from
the hydroxyurea block by transfer into the same medium at 33°C.
Passage of the cells through mitosis was evidenced by the reduction of
large-budded (LB) mononucleate cells in the culture. The experiments in
this figure were repeated 2 (mad2 ), 3 (bub1 , mad1 ), 4 (mad3 ), 5 (bub3 , mps1-3796), and 10 (bub2 )
times, always yielding the same results. Mutant strains:
bub1 , MAY4537; bub2 , MAY2055;
bub3 , MAY4574; mad1 , MAY3728;
mad2 , MAY4428; mad3 , MAY4612;
mps1-3796 , AS131-2d.
|
|
MPS1 is an essential gene. To test the requirement for
MPS1 in the
BUB1-5-induced mitotic delay, we
transformed the P
GAL>
BUB1-5 and
P
GAL>
BUB1 plasmids into a
temperature-sensitive
mps1-3796 mutant. The Mps1p kinase has
two roles, a spindle pole duplication
function and a spindle assembly
checkpoint function. In this experiment,
we synchronized the cells with
the DNA synthesis inhibitor hydroxyurea.
This inhibitor blocks the
S. cerevisiae cell cycle after the execution
point for the
Mps1p spindle pole duplication function but before
its execution point
for checkpoint function (
29). Hydroxyurea-arrested
cells (at
26°C) were switched to galactose-containing medium (plus
hydroxyurea)
for 3 h to induce
BUB1 expression. This was followed
by
release from the hydroxyurea block by transfer into the same
medium but
at a temperature nonpermissive for
mps1-3796 (33°C).
Passage of the cells through mitosis was evidenced by the reduction
of
large-budded mononucleate cells in the culture (Fig.
8B). Under
these
conditions, P
GAL>
BUB1-5 was able to
delay progression
through mitosis in the wild-type cells but not the
mps1-3796 mutant
cells. Once again, overexpression of
BUB1 had no effect in either
genetic background. Therefore,
MPS1 function is required for the
mitotic delay caused by
overexpressed
BUB1-5.
In the P
GAL>
BUB1-5 experiments
described in this section, we also monitored levels of the mitotic
cyclin Clb2p as
an independent assay for mitotic delay (Fig.
3B). In
strains for
which we observed a
BUB1-5-induced delay (wild
type and
bub1
),
a corresponding increase in Clb2p levels
was observed after the
switch to galactose medium. In strains that were
immune to the
BUB1-5-induced delay (
bub3
,
mad1
,
mad2
, and
mad3
), Clb2p
levels
remained low and unchanged during galactose incubation. The
fluctuating
BUB1-5-induced delay we observed for the
bub2
strain was accompanied
by Clb2p accumulation that
was somewhat lower than that observed
for the wild-type and
bub1
strains.
While checkpoint gene mutations were able to eliminate the mitotic
delay caused by P
GAL>
BUB1-5, none
were able to
rescue the slow growth caused by
P
GAL>
BUB1-5 (although
the
BUB1 and
BUB3 deletions caused slow growth on
their own).
In some cases, the plating efficiency of
P
GAL>
BUB1-5 cells on galactose was
reduced further by the checkpoint mutations
(Table
2). A strong effect
was caused by
mad1
and
mad2
, which,
interestingly, also most strongly reduced the viability of cells
overexpressing
MPS1 (
7). The reasons for these
plating efficiency
differences are not clear and may reflect complex
interactions.
For example, some of the checkpoint gene products may act
in more
than one functional pathway. Overexpression of
BUB1
had no effect
on the plating efficiency of any checkpoint mutant or of
the wild
type.
 |
DISCUSSION |
Eukaryotic cells that have incurred mitotic spindle damage are
delayed or arrested prior to anaphase onset by the actions of the
spindle assembly checkpoint. Recessive loss of function of the S. cerevisiae checkpoint gene BUB1 eliminates this arrest. We have identified a dominantly acting BUB1 allele that
produces a phenotype that appears to be the opposite of loss of
function. High-level expression of BUB1-5 delayed yeast
cells in mitosis at a stage following bipolar spindle assembly but
prior to anaphase spindle elongation. Characteristic of cells blocked
at this stage, the intracellular level of the Clb2p mitotic cyclin was
elevated. Continued high-level expression of BUB1-5 caused a
reduction in growth rate but not lethality. These phenotypes required
both a change of a conserved amino acid residue within the Bub1p kinase domain (glycine785) and high-level expression of the gene
product. The single changes individually produced only subtle
phenotypic effects, while the combination elicited a strong response.
The finding of a BUB1 allele that can delay cells in mitosis
lends strong support to the hypothesis that Bub1p participates in
spindle assembly checkpoint function. Our previous conclusions regarding BUB1 were based upon loss-of-function mutants that
inappropriately disjoin sister chromatids, rebud, and reinitiate DNA
replication in the presence of spindle damage (10, 20, 26).
However, the apparent aberrant cycling of these mutants is not
dramatic. For example, rebudding occurs efficiently only once and with
slow kinetics. In addition, bub1 mutant cells grow poorly
and are difficult to study due to aneuploidy. The conclusion that
BUB1 encodes a checkpoint function was tempered by these
problems. Our findings here indicate that the Bub1p kinase has the
capacity to inhibit cell cycle progression in mitosis prior to anaphase
onset, precisely the role expected for a spindle assembly checkpoint
function.
A possible explanation for the BUB1-5 effect is that it
encodes an overactive kinase. Overphosphorylation of a Bub1p target may
mimic the spindle assembly checkpoint activation normally caused by
spindle damage. Consistent with this hypothesis was our finding that
the BUB1-5 phenotypes were eliminated by a second mutation
that kills kinase function. Therefore, kinase activity is required for
the BUB1-5 effect. Nevertheless, we have not observed elevated kinase activity for Bub1-5p in vitro. Immune complexes precipitated from cells overexpressing BUB1-5 were actually
reduced in the ability to transfer labeled phosphate to both Bub1-5p
and Bub3p compared to complexes from BUB1-overexpressing
cells (3a). The significance of this in vitro finding with
respect to the in vivo activity of Bub1p is not clear, however. We can
conclude that altered kinase function is probably responsible for the
BUB1-5 effect but are unsure of the nature of this change.
We found that the mitotic delay induced by BUB1-5 required
the activities of other identified spindle assembly checkpoint genes
(BUB2, BUB3, MAD1, MAD2,
MAD3, and MPS1). Therefore, two possibilities,
which are not mutually exclusive, may account for the
BUB1-5-induced mitotic delay. (i) High levels of Bub1-5p may activate the spindle assembly checkpoint. The requirement for the
remaining checkpoint components may indicate that Bub1p acts upstream
or in a manner dependent upon their functions (see below). (ii) High
levels of Bub1-5p may cause mitotic spindle damage. The remaining
spindle assembly checkpoint components may therefore be required to
respond to this damage. It is currently impossible to completely rule
out one of these explanations. Nonetheless, we favor the checkpoint
activation hypothesis for the following reasons. (i) Observations of
spindles in PGAL>BUB1-5 cells
by immunofluorescence and electron microscopy did not reveal any
obvious defects. Of course, we cannot rule out damage that was not
detectable by microscopy. (ii) Although
PGAL>BUB1-5 greatly reduced cell
growth rates, colony-forming ability was high (only reduced by a factor
of 2). In addition, we found that PGAL>BUB1-5 cells maintained high
viability following as much as 6 h in galactose-containing medium
(3a). This indicates that any damage caused by Bub1-5p must
be either reversible or not severe enough to disrupt the fidelity of
chromosome segregation required for viability. (iii) We failed to
observe the hyperphosphorylated forms of Mad1p that are characteristic
of damaged spindles (6).
Components of the spindle assembly checkpoint may act in a pathway
or complex.
The preanaphase delay caused by overexpression of
either BUB1-5 or MPS1 requires the functions of
all of the other spindle assembly checkpoint gene products (reference
7 and this study). This supports, but does not
prove, the simple hypothesis that they all work in a common pathway.
The common pathway hypothesis is complicated by the finding that loss
of function of these checkpoint genes causes different phenotypes. For
example, loss of BUB1 or BUB3 causes very slow
growth while loss of BUB2 and the three MAD genes
causes little change in the growth rate (10, 15, 20). In
addition, MPS1 performs a function essential for spindle pole body duplication beyond its checkpoint role (31).
Therefore, multiple roles or pathway participation for some of these
gene products seems likely.
A simple linear pathway relationship that can explain some of the
findings concerning the spindle assembly checkpoint gene
products has
been proposed (
30). However, not all observations
concerning
this checkpoint (references
6 and
7 and this
study) are easily accommodated by this
linear model. An equally
likely possibility is that many of the
checkpoint proteins are
commonly involved in a protein complex whose
function depends
upon the presence of all complex members. Vertebrate
homologs
of Mad2p and Bub1p are localized to kinetochores (
2,
16,
27). In
S. cerevisiae, Mad1p physically interacts with
Mad2p
and is phosphorylated by Mps1p (
7,
21) and Bub3p
physically
interacts with Bub1p (
20). Therefore, a
kinetochore-localized
spindle damage-signaling complex, constructed
of many of the spindle
assembly checkpoint proteins, seems reasonable.
Bub1p and Mps1p appear to act at a closely related early step in the
checkpoint mechanism. First, we note the similarities
in the effects
caused by overexpression of
BUB1-5 and
MPS1. Both
caused a preanaphase delay dependent upon the other checkpoint
genes.
Cells delayed with either treatment exhibited elevated
Clb2p levels.
Both caused increased lethality when overexpressed
in
mad1
and
mad2
cells. A major difference,
however, is that
overexpression of
MPS1 led to Mad1p
hyperphosphorylation while
overexpression of
BUB1-5 did not.
Most significantly, we found
that the mitotic delay caused by
overexpressed
BUB1-5 was dependent
upon
MPS1
function. Conversely, it has been reported that the
mitotic delay
caused by overexpressed
MPS1 is dependent upon
BUB1 function (
7). We verified this finding by
monitoring the effect
of overexpression of
MPS1 in
BUB1 and
bub1
cells. In agreement
with
Hardwick et al., we found that deletion of
BUB1 eliminated
the delay caused by high levels of
MPS1 (corroborative data
not
shown). These findings indicate that the functions of Bub1p and
Mps1p are interdependent (at least with respect to mitotic delay).
This
may mean that Bub1p and Mps1p actions are both required for
the same
step in checkpoint activation or that the function of
one activates the
function of the other.
The hyperphosphorylated forms of Mad1p that appear after spindle damage
suggested that Mad1p modification may be an important
step in
activating the spindle assembly checkpoint (
6). While
it is
possible that hyperphosphorylated forms of Mad1p may be
a good
indicator of spindle damage, Mad1p hyperphosphorylation
is not always
correlated with mitotic delay. We found that mitotic
delay could be
induced in cells by
BUB1-5 overexpression without
resulting
in detectable Mad1p hyperphosphorylation. The opposite
situation has
also been observed: Mad1p can be hyperphosphorylated
in cells that
nevertheless are not delayed in mitosis (i.e., in
bub1
cells in which
MPS1 is overexpressed [
7]).
The ability
of
BUB1-5 to cause mitotic delay dependent upon
MAD1 but without
leading to Mad1p hyperphosphorylation may
indicate that hyperphosphorylated
Mad1p is not an intermediate in
spindle damage signal transduction.
The relationships of Bub2p and Mad3p with the other checkpoint proteins
is still somewhat unclear.
bub2 and
mad3 mutants
exhibit
less-severe phenotypes than the other checkpoint mutants
(
10,
15,
18,
28). Neither is required for Mad1p
hyperphosphorylation,
although both are required for the normal mitotic
delay caused
by
BUB1-5 or
MPS1 overexpression. It
is possible that these perform
a downstream function or act in a
different pathway that is nonetheless
required for normal response to
spindle damage. Unlike the other
checkpoint mutants, we found that the
bub2
mutant was still delayed
by overexpression of
BUB1-5. However, unlike wild-type cells,
bub2
cells were unable to maintain the delay. In the
bub2
cells,
the delay appeared to be relieved and then cyclically
reinstated.
Therefore, it is possible that Bub2p is not required for
the establishment
of the activated checkpoint delay but is required to
properly
maintain the delay (also see reference
18).
In summary, we have found a way to activate the spindle assembly
checkpoint in cells with apparently normal spindles. Just
as ectopic
checkpoint activation has aided our definition of the
S. cerevisiae spindle assembly checkpoint mechanism, so could
similar
approaches be used to study checkpoint regulation in mammalian
cells.
Loss of checkpoint regulation has been correlated with
oncogenic
transformation (
3,
8,
24). Ectopic checkpoint
activation,
therefore, might also be exploited to prevent unrestrained
proliferation of cancer cells.
 |
ACKNOWLEDGMENTS |
We gratefully thank Kevin Hardwick, Doug Kellogg, Andrew Murray,
and Mark Winey for strains, DNA constructs, and antibodies; Mike
Sepanski for assistance with electron microscopy; and Frank Cottingham,
Cindy Dougherty, Emily Hildebrandt, and Doug Koshland for comments
on the manuscript.
This study was supported by National Institutes of Health grant GM49363
to M.A.H.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, The Johns Hopkins University, Baltimore, MD 21218. Phone:
(410) 516-7299. Fax: (410) 516-5213. E-mail: hoyt{at}jhu.edu.
 |
REFERENCES |
| 1.
|
Byers, B., and L. Goetsch.
1991.
Preparation of yeast cells for thin-section electron microscopy.
Methods Enzymol.
194:602-608[Medline].
|
| 2.
|
Chen, R.,
J. C. Waters,
E. D. Salmon, and A. W. Murray.
1996.
Association of spindle assembly checkpoint component XMAD2 with unattached kinetochores.
Science
274:242-246[Abstract/Free Full Text].
|
| 2a.
| Dougherty, C., and M. A. Hoyt. Unpublished
observations.
|
| 3.
|
Elledge, S. J.
1996.
Cell cycle checkpoints: preventing an identity crisis.
Science
274:1664-1672[Abstract/Free Full Text].
|
| 3a.
| Farr, K. A., and M. A. Hoyt. Unpublished
observations.
|
| 3b.
| Farr, K. A., C. Dougherty, and M. A. Hoyt. Unpublished observations.
|
| 4.
|
Geiser, J. R.,
E. J. Schott,
T. J. Kingsbury,
N. B. Cole,
L. J. Totis,
G. Bhattacharyya,
L. He, and M. A. Hoyt.
1997.
S. cerevisiae genes required in the absence of the CIN8-encoded spindle motor act in functionally diverse mitotic pathways.
Mol. Biol. Cell
8:1035-1050[Abstract].
|
| 5.
|
Hanks, S. K., and T. Hunter.
1995.
The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification.
FASEB J.
9:576-596[Abstract].
|
| 6.
|
Hardwick, K. G., and A. W. Murray.
1995.
Mad1p, a phosphoprotein component of the spindle assembly checkpoint in budding yeast.
J. Cell Biol.
131:709-720[Abstract/Free Full Text].
|
| 7.
| Hardwick, K. G., E. Weiss, F. C. Luca, M. Winey, and A. W. Murray. 1996. Activation of the budding
yeast spindle assembly checkpoint without mitotic spindle disruption.
273:953-956.
|
| 8.
|
Hartwell, L. H., and M. B. Kastan.
1994.
Cell cycle control and cancer.
Science
266:1821-1828[Abstract/Free Full Text].
|
| 9.
|
Hartwell, L. H., and T. A. Weinert.
1989.
Checkpoints: controls that ensure the order of cell cycle events.
Science
246:629-634[Abstract/Free Full Text].
|
| 10.
|
Hoyt, M. A.,
L. Totis, and B. T. Roberts.
1991.
S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function.
Cell
66:507-517[Medline].
|
| 11.
|
Hutter, K. J., and H. E. Eipel.
1978.
Flow cytometric determinations of cellular substances in algae, bacteria, molds and yeast.
Antonie Leeuwenhoek J. Microbiol. Serol.
44:269-282.
|
| 12.
|
King, R. W.,
R. J. Deshaies,
J. Peters, and M. W. Kirschner.
1996.
How proteolysis drives the cell cycle.
Science
274:1652-1659[Abstract/Free Full Text].
|
| 13.
|
King, R. W.,
P. K. Jackson, and M. W. Kirschner.
1994.
Mitosis in transition.
Cell
79:563-571[Medline].
|
| 14.
|
Lauzé, E.,
B. Stoelcker,
F. C. Luca,
E. Weiss,
A. R. Schutz, and M. Winey.
1995.
Yeast spindle pole body duplication gene MPS1 encodes an essential dual specificity protein kinase.
EMBO J.
14:1655-1663[Medline].
|
| 15.
|
Li, R., and A. W. Murray.
1991.
Feedback control of mitosis in budding yeast.
Cell
66:519-531[Medline].
|
| 16.
|
Li, Y., and R. Benezra.
1996.
Identification of a human mitotic checkpoint gene: hsMAD2.
Science
274:246-248[Abstract/Free Full Text].
|
| 17.
|
Nicklas, R. B.
1997.
How cells get the right chromosomes.
Science
275:623-637.
|
| 18.
|
Pangilinan, F., and F. Spencer.
1996.
Abnormal kinetochore structure activates the spindle assembly checkpoint in budding yeast.
Mol. Biol. Cell
7:1195-1208[Abstract].
|
| 19.
|
Pringle, J. R.,
A. E. M. Adams,
D. G. Drubin, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-602[Medline].
|
| 20.
|
Roberts, B. T.,
K. A. Farr, and M. A. Hoyt.
1994.
The Saccharomyces cerevisiae checkpoint gene BUB1 encodes a novel protein kinase.
Mol. Cell. Biol.
14:8282-8291[Abstract/Free Full Text].
|
| 21.
|
Rudner, A. D., and A. W. Murray.
1996.
The spindle assembly checkpoint.
Curr. Opin. Cell Biol.
8:773-780[Medline].
|
| 22.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 23.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1983.
In
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Sherr, C. J.
1996.
Cancer cell cycles.
Science
274:1672-1677[Abstract/Free Full Text].
|
| 25.
|
Sikorski, R. S., and J. D. Boeke.
1991.
In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast.
Methods Enzymol.
194:302-318[Medline].
|
| 26.
|
Straight, A.,
A. Belmont,
C. C. Robinett, and A. W. Murray.
1996.
GFP tagging of budding yeast chromosomes reveals that protein-protein interactions can mediate sister chromatid cohesion.
Curr. Biol.
6:1599-1608[Medline].
|
| 27.
|
Taylor, S. S., and F. McKeon.
1997.
Kinetochore localization of murine Bub1 is required for normal mitotic timing and checkpoint response to spindle damage.
Cell
89:725-735.
|
| 28.
|
Wang, Y., and D. J. Burke.
1995.
Checkpoint genes required to delay cell division in response to nocodazole respond to impaired kinetochore function in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:6838-6844[Abstract].
|
| 29.
|
Weiss, E., and M. Winey.
1996.
The Saccharomyces cerevisiae Spindle Pole Body duplication gene MPS1 is part of a mitotic checkpoint.
J. Cell Biol.
132:111-123[Abstract/Free Full Text].
|
| 30.
|
Wells, W. A. E.
1996.
The spindle-assembly checkpoint: aiming for a perfect mitosis, every time.
Trends Cell Biol.
6:228-234.
|
| 31.
|
Winey, M.,
L. Goetsch,
P. Baum, and B. Byers.
1991.
MPS1 and MPS2: novel yeast genes defining distinct steps of Spindle Pole Body duplication.
J. Cell Biol.
114:745-754[Abstract/Free Full Text].
|
Mol Cell Biol, May 1998, p. 2738-2747, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Qi, W., Yu, H.
(2007). KEN-Box-dependent Degradation of the Bub1 Spindle Checkpoint Kinase by the Anaphase-promoting Complex/Cyclosome. J. Biol. Chem.
282: 3672-3679
[Abstract]
[Full Text]
-
Guo, C., Wu, G., Chin, J. L., Bauman, G., Moussa, M., Wang, F., Greenberg, N. M., Taylor, S. S., Xuan, J. W.
(2006). Bub1 Up-Regulation and Hyperphosphorylation Promote Malignant Transformation in SV40 Tag-Induced Transgenic Mouse Models. Mol Cancer Res
4: 957-969
[Abstract]
[Full Text]
-
Li, J.-m., Li, Y., Elledge, S. J.
(2005). Genetic Analysis of the Kinetochore DASH Complex Reveals an Antagonistic Relationship with the Ras/Protein Kinase A Pathway and a Novel Subunit Required for Ask1 Association. Mol. Cell. Biol.
25: 767-778
[Abstract]
[Full Text]
-
Vigneron, S., Prieto, S., Bernis, C., Labbe, J.-C., Castro, A., Lorca, T.
(2004). Kinetochore Localization of Spindle Checkpoint Proteins: Who Controls Whom?. Mol. Biol. Cell
15: 4584-4596
[Abstract]
[Full Text]
-
Gillett, E. S., Espelin, C. W., Sorger, P. K.
(2004). Spindle checkpoint proteins and chromosome-microtubule attachment in budding yeast. JCB
164: 535-546
[Abstract]
[Full Text]
-
Tunquist, B. J., Eyers, P. A., Chen, L. G., Lewellyn, A. L., Maller, J. L.
(2003). Spindle checkpoint proteins Mad1 and Mad2 are required for cytostatic factor-mediated metaphase arrest. JCB
163: 1231-1242
[Abstract]
[Full Text]
-
Kerscher, O., Crotti, L. B., Basrai, M. A.
(2003). Recognizing Chromosomes in Trouble: Association of the Spindle Checkpoint Protein Bub3p with Altered Kinetochores and a Unique Defective Centromere. Mol. Cell. Biol.
23: 6406-6418
[Abstract]
[Full Text]
-
Iouk, T., Kerscher, O., Scott, R. J., Basrai, M. A., Wozniak, R. W.
(2002). The yeast nuclear pore complex functionally interacts with components of the spindle assembly checkpoint. JCB
159: 807-819
[Abstract]
[Full Text]
-
Warren, C. D., Brady, D. M., Johnston, R. C., Hanna, J. S., Hardwick, K. G., Spencer, F. A.
(2002). Distinct Chromosome Segregation Roles for Spindle Checkpoint Proteins. Mol. Biol. Cell
13: 3029-3041
[Abstract]
[Full Text]
-
Chen, R.-H.
(2002). BubR1 is essential for kinetochore localization of other spindle checkpoint proteins and its phosphorylation requires Mad1. JCB
158: 487-496
[Abstract]
[Full Text]
-
Abruzzi, K. C., Magendantz, M., Solomon, F.
(2002). An {alpha}-Tubulin Mutant Demonstrates Distinguishable Functions Among the Spindle Assembly Checkpoint Genes in Saccharomyces cerevisiae. Genetics
161: 983-994
[Abstract]
[Full Text]
-
Millband, D. N., Hardwick, K. G.
(2002). Fission Yeast Mad3p Is Required for Mad2p To Inhibit the Anaphase-Promoting Complex and Localizes to Kinetochores in a Bub1p-, Bub3p-, and Mph1p-Dependent Manner. Mol. Cell. Biol.
22: 2728-2742
[Abstract]
[Full Text]
-
Li, Y., Bachant, J., Alcasabas, A. A., Wang, Y., Qin, J., Elledge, S. J.
(2002). The mitotic spindle is required for loading of the DASH complex onto the kinetochore. Genes Dev.
16: 183-197
[Abstract]
[Full Text]
-
Hildebrandt, E. R., Hoyt, M. A.
(2001). Cell Cycle-dependent Degradation of the Saccharomyces cerevisiae Spindle Motor Cin8p Requires APCCdh1 and a Bipartite Destruction Sequence. Mol. Biol. Cell
12: 3402-3416
[Abstract]
[Full Text]
-
Sharp-Baker, H., Chen, R.-H.
(2001). Spindle Checkpoint Protein Bub1 Is Required for Kinetochore Localization of Mad1, Mad2, Bub3, and Cenp-E, Independently of Its Kinase Activity. JCB
153: 1239-1250
[Abstract]
[Full Text]
-
Olesen, S. H., Thykjaer, T., Orntoft, T. F.
(2001). Mitotic checkpoint genes hBUB1, hBUB1B, hBUB3 and TTK in human bladder cancer, screening for mutations and loss of heterozygosity. Carcinogenesis
22: 813-815
[Abstract]
[Full Text]
-
Kalitsis, P., Earle, E., Fowler, K. J., Choo, K.H. A.
(2000). Bub3 gene disruption in mice reveals essential mitotic spindle checkpoint function during early embryogenesis. Genes Dev.
14: 2277-2282
[Abstract]
[Full Text]
-
Murakumo, Y., Roth, T., Ishii, H., Rasio, D., Numata, S.-i., Croce, C. M., Fishel, R.
(2000). A Human REV7 Homolog That Interacts with the Polymerase zeta Catalytic Subunit hREV3 and the Spindle Assembly Checkpoint Protein hMAD2. J. Biol. Chem.
275: 4391-4397
[Abstract]
[Full Text]
-
Li, W., Lan, Z., Wu, H., Wu, S., Meadows, J., Chen, J., Zhu, V., Dai, W.
(1999). BUBR1 Phosphorylation Is Regulated during Mitotic Checkpoint Activation. Cell Growth Differ.
10: 769-775
[Abstract]
[Full Text]
-
Chen, R.-H., Brady, D. M., Smith, D., Murray, A. W., Hardwick, K. G.
(1999). The Spindle Checkpoint of Budding Yeast Depends on a Tight Complex between the Mad1 and Mad2 Proteins. Mol. Biol. Cell
10: 2607-2618
[Abstract]
[Full Text]
-
Basu, J., Bousbaa, H., Logarinho, E., Li, Z., Williams, B. C., Lopes, C., Sunkel, C. E., Goldberg, M. L.
(1999). Mutations in the Essential Spindle Checkpoint Gene bub1 Cause Chromosome Missegregation and Fail to Block Apoptosis in Drosophila. JCB
146: 13-28
[Abstract]
[Full Text]
-
Li, R.
(1999). Bifurcation of the mitotic checkpoint pathway in budding yeast. Proc. Natl. Acad. Sci. USA
96: 4989-4994
[Abstract]
[Full Text]
-
Bernard, P., Hardwick, K., Javerzat, J.-P.
(1998). Fission Yeast Bub1 Is a Mitotic Centromere Protein Essential for the Spindle Checkpoint and the Preservation of Correct Ploidy through Mitosis. JCB
143: 1775-1787
[Abstract]
[Full Text]
-
Mendenhall, M. D., Hodge, A. E.
(1998). Regulation of Cdc28 Cyclin-Dependent Protein Kinase Activity during the Cell Cycle of the Yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
62: 1191-1243
[Abstract]
[Full Text]
-
Chen, R.-H., Shevchenko, A., Mann, M., Murray, A. W.
(1998). Spindle Checkpoint Protein Xmad1 Recruits Xmad2 to Unattached Kinetochores. JCB
143: 283-295
[Abstract]
[Full Text]
-
Wassmann, K., Benezra, R.
(1998). Mad2 transiently associates with an APC/p55Cdc complex during mitosis. Proc. Natl. Acad. Sci. USA
95: 11193-11198
[Abstract]
[Full Text]
-
Taylor, S. S., Ha, E., McKeon, F.
(1998). The Human Homologue of Bub3 Is Required for Kinetochore Localization of Bub1 and a Mad3/Bub1-related Protein Kinase. JCB
142: 1-11
[Abstract]
[Full Text]
-
Wang, X., Babu, J. R., Harden, J. M., Jablonski, S. A., Gazi, M. H., Lingle, W. L., de Groen, P. C., Yen, T. J., van Deursen, J. M. A.
(2001). The Mitotic Checkpoint Protein hBUB3 and the mRNA Export Factor hRAE1 Interact with GLE2p-binding Sequence (GLEBS)-containing Proteins. J. Biol. Chem.
276: 26559-26567
[Abstract]
[Full Text]