Division of Basic Sciences, National Cancer
Institute, Bethesda, Maryland 20892-4255
Received 7 October 1997/Returned for modification 26 November
1997/Accepted 19 February 1998
 |
INTRODUCTION |
The tumor suppressor p53 plays an
important and often central role in cellular responses to genotoxic
stress and other adverse environmental cues. While the protein's
effects are probably mediated by both transcriptional and
nontranscriptional mechanisms (reviewed in reference
32), its ability to regulate the expression of a
variety of cellular genes is required for important functions. For
example, sequence-specific transcriptional activation has been shown to
be essential for growth suppression by p53 (45). The list of
p53-inducible genes, which contain specific sequences that bind p53, is
continually expanding, and it has been estimated that there may be
several hundred such p53-binding sites in the human genome
(54). In addition to its ability to up-regulate transcription by sequence-specific binding, p53 is also known to be
able to down-regulate the expression of a number of genes (39), probably by interacting with the basal transcription
machinery (32). p53 has been found to interact with a
variety of cellular and viral proteins, including transcription
factors, although transcriptional activation by protein-protein
interactions in the absence of site-specific DNA binding by p53 has not
been observed. If p53 transcriptional up-regulation occurs by such
protein-protein interactions, then it could substantially broaden the
known role of p53 in positive gene regulation.
There are a number of striking similarities between the responses of
the gadd gene products and p53 activation. Like p53 protein, the
products of the gadd genes are activated by stresses, such as those caused by DNA-damaging agents or starvation, that elicit growth arrest, and overexpression of these proteins suppresses cell
growth (61). The five gadd genes were originally
isolated in hamster cells on the basis of induction by UV radiation
(12), but three, gadd45, gadd153, and
gadd34, have been found to be stress inducible in a wide
variety of mammalian cells (13). The regulation of these
genes after stress is probably mediated by multiple mechanisms. For
example, gadd153 contains a stress-responsive AP-1 site, but
its deletion only partially abrogates gadd153 induction by
DNA-damaging agents (35). In the case of gadd45,
the induction of the gene by ionizing radiation (IR) is strictly p53
dependent while its induction by other stresses, such as treatment with the alkylating agent methyl methanesulfonate (MMS), has been observed in all mammalian cells examined to date (28). As discussed
previously (23, 28), the p53-binding element in the third
intron of gadd45 is probably required for IR responsiveness,
since the transfected human gene, but not promoter-reporter constructs,
was induced by IR. In addition, the promoter contains no identifiable
p53-binding site and did not bind baculovirus p53 (28), and
a human GADD45 promoter-reporter construct was not
transactivated when introduced with a p53 expression vector
(59).
While results of early studies of gadd45 suggest two
distinct signaling pathways for IR-type damage and typical
gadd gene-inducing agents like MMS, UV radiation, or medium
starvation (referred to as MUM stresses), recent results indicate that
p53 may have a contributory role in MUM-type gadd gene
responses. Surprisingly, MUM-type stresses actually elicited stronger
activation of p53 than did IR, as determined by induction of a promoter
construct containing p53-binding sites (59). Compared to
normal human keratinocytes, human papillomavirus-immortalized
keratinocytes and an oral cancer cell line showed reduced induction of
GADD45 and GADD153 mRNA after UV irradiation, as
well as loss of p53 protein induction (16). In mouse embryo
fibroblasts from p53-null mice and in human lines where p53 function
was blocked with dominant-negative vectors, MUM stress responses, as
measured by increased mRNA, were appreciably reduced for
GADD45 and GADD153 (60). In the same
study, this p53 effect was localized to the promoters of these genes,
since a similar attenuation of induction was observed for
promoter-reporter constructs. Considering that neither promoter contains detectable p53-binding sites, a reasonable explanation is that
p53 is mediating its positive transcriptional effect indirectly by
protein-protein interaction(s) rather than direct DNA binding.
Like many other growth control-related genes, human GADD45
contains GC-rich motifs that match the consensus sequence for various transcription factors, such as Egr1 and WT1 (47). The
Egr1-WT1 family of transcription factors defines a group of related
proteins that have been associated with a variety of cellular
processes, including stress responses in the case of Egr1 (4,
31) and growth suppression for WT1. WT1 is of particular interest
for several reasons: it is a tumor suppressor; like the Gadd proteins, it suppresses cell growth; and it has been found to associate in vivo
with p53 (37). In the case of growth suppression, all four
splice forms of WT1 suppressed growth in transient assays (17). In most studies, WT1 appears to function as a
transcriptional suppressor (36); suppression by WT1 has been
found with a variety of human promoters, including EGFR
(9), CSF-1 (20), IGF-II (8), IGF-I-R (57), BCL2 and
c-MYC (21), RAR-
1 (14), and TGF-
1 (6). Evidence has been presented
that WT1 contains both a transcriptional repression domain and an
activation domain and that interaction with another protein(s) may
determine the effect of WT1 on transcription (55). In the
case of p53, cotransfection of p53 and WT1 with a reporter construct
containing a p53-binding site led to increased transcription, which
suggests that WT1 can have a cooperative interaction with p53; when a
reporter containing an Egr1-WT1 binding site was studied,
cotransfection with p53 suppressed transcription by WT1
(37). Since much of the stress responsiveness of the human
GADD45 promoter, as well as the p53-dependent effect on the
promoter, was localized to the GC-rich motif in the proximal promoter,
the roles of WT1 and Egr1 were investigated. p53 and WT1, but not Egr1,
were found in a complex that associated with this GC-rich region.
Expression vectors for WT1 and p53 in combination were found to induce
the promoter, and suppression of either p53 or WT1 reduced this
responsiveness. Since p53 does not bind directly to this promoter,
these results indicate that p53 can contribute to the positive
regulation of a promoter by protein-protein interactions.
 |
MATERIALS AND METHODS |
Plasmid clones.
The following cDNA clones were used:
pHG45-CAT1, constructed by inserting the
SalI-SmaI fragment of GADD45 spanning
2256 to +144 relative to the transcription start site into pCAT-Basic (Promega); pHG45-CAT2, similarly constructed by inserting the HindIII-SmaI fragment of this promoter from
909 to +144 into pCAT-Basic; and pHG45-CAT3, similarly constructed by
using a SphI-SmaI fragment spanning
70 to +144.
These restriction fragments were excised from pHG45HC, a 6-kb human
genomic clone. pHG45-CAT2mut was derived from pHG45-CAT2 by replacement
of the GC-rich WT1-EGR1 sites at positions
204 to
190; 5'
CGCCCCCCGCCCCCGC 3' was replaced with 5' TATTTTTATTTTTAT 3'.
The other pHG45-CAT2 derivatives were constructed by PCR cloning,
as described previously (61), and were cloned into the
HindIII-SmaI site of pCAT-Basic. The
wt1 construct NA is a murine WT1 protein expression vector
in which the wt1 cDNA with splice form A was cloned into a
pCMV vector (17, 18). pC53-SN3, which expresses wild-type
(wt) p53 protein driven by a cytomegalovirus promoter, and pC53-SCX3,
which expresses a dominant-negative mutant p53 protein containing a
substitution of Ala for Val-143, were provided by B. Vogelstein
(59). pCMV-EGR1, which expresses human Egr1 protein, was
provided by F. J. Rauscher III. pCMV-E6 expresses human
papillomavirus type 16 E6 and has been shown to be an effective
dominant-negative expression vector that blocks p53 action (30,
52). c-fos-CAT was derived from a
-galactosidase reporter
construct which consists of a c-fos gene where the reporter
(followed by translation stop codons) was inserted into the ATG start
site of c-fos (48); in c-fos-CAT the reporter
was replaced with the open reading frame encoding chloramphenicol
acetyltransferase (CAT). pCMV-ASWT1 was constructed by inserting a
497-bp XbaI-XhoI fragment from the 5' end of a full-length human WT1 cDNA clone (38) into pCI-neo vector
(Promega) in the antisense orientation. The Tac expression vector pcI
Tac was provided by J. Ashwell (40).
Cells and cell treatment.
The human colorectal carcinoma
cell line RKO and the human large-cell lung carcinoma cell line H1299
were grown in modified Ham's F-12 medium supplemented with 10% fetal
bovine serum; the human breast carcinoma cell line MCF-7 was grown in
RPMI 1640 medium supplemented with 10% fetal bovine serum. While a
variety of different MCF-7 lines are in use in different laboratories, the line employed in this study has a wt p53 genotype and was shown to
express relatively low levels of p53 in unstressed cells; with
activation of p53, a substantial increase in nuclear p53 has
consistently been seen (43). MCF7-E6#9, designated MCF7-E6, was selected on the basis of its high-level expression of E6 after stable transfection with pCMV-E6 and has been described previously (60). For MMS treatment, cells were exposed in medium to MMS (Aldrich) at 100 µg/ml for 4 h, after which the medium was
replaced with fresh medium. For UV irradiation, 100-mm-diameter dishes were rinsed with buffered saline and irradiated with germicidal lamps
at a dose rate of 2.1 J m
2 s
1 to 14 J
m
2. The original medium was then replaced, and the cells
were incubated at 37°C for the indicated time.
Transfection of cells was performed by a calcium-phosphate method as
described previously (59). Cells stably expressing various
CAT reporter constructs were developed as described previously (59); unless otherwise specified, experiments were conducted with pooled cultures containing >50 clonal isolates. For assays involving transient transfection of expression vectors, growing cells
were seeded in 10-cm-diameter dishes at 60% confluence, with multiple
plates per point in each experiment; 20 h later they were
cotransfected with 5 µg of the indicated GADD45 CAT reporter construct and 5 µg of the indicated expression vector, pCMV-WT1 or pCMV-EGR1, plasmid DNA. Either pC53-SN3 or pC53-SCX3 (0.5 µg) was used. The amount of transfected DNA was kept constant by
using pCMV-neo, which expresses the neomycin resistance factor, or the
pCMV.3 vector alone.
For isolation of transiently transfected cells, 5 µg of either
pCMV-ASWT1 or pCMV-neo and 0.5 µg of pcI Tac were cotransfected into
MCF-7 cells. After 36 h, the cells were harvested and washed once
with cold medium. Dyna-beads (Dynal, Lake Success, N.Y.) coated with
anti-Tac antibody (provided by J. Ashwell) were added to the cells and
incubated with gentle rotation at 4°C for 1 h. The
Tac-expressing cells were isolated magnetically, washed once with
buffered saline, and then lysed for protein analysis (40).
The osteosarcoma cell line U2OS (31), which contains a
tetracycline-regulated WT1 expression vector, was grown in Dulbecco's modified Eagle's medium with 1 µg of tetracycline/ml. To examine GADD45 mRNA levels, cells were plated in 150-mm-diameter
dishes in the presence of tetracycline; after 24 h the medium was
replaced with fresh medium lacking tetracycline, and the cells were
harvested 4 h later. Poly(A) RNA was isolated and analyzed by blot
analysis as described previously (61); this included
Northern-type analysis with labeled probes for GADD45 or
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as well as
quantitative dot blot hybridization.
CAT assay.
Measurement of CAT activity was carried out as
described previously (59). Briefly, cells were collected and
resuspended in 0.25 M Tris (pH 7.8). The cells were then disrupted by
three freeze-thaw cycles, and equivalent amounts of protein were used for each assay. The CAT reaction mixture was incubated at 37°C for
16 h, and the CAT activity was determined by measuring the acetylation of 14C-labeled chloramphenicol by thin-layer
chromatography. Radioactivity was measured directly with a Betascope
model 630 blot analyzer (Betagen Inc.). The specific CAT activity was
calculated by determining the fraction of chloramphenicol that had been
acetylated. The relative CAT activity was determined by normalizing the
activity of the treated samples to that of the untreated sample. Each
value presented was based on the average of at least three separate determinations from samples transfected separately. Results with this
approach, where CAT activity was measured relative to protein content,
were comparable to those with a second reporter as an internal control
(53); in addition, the latter approach could be of concern
in stress studies, where activated p53 may cause unexpected repression
by interaction with the basal transcription machinery.
DNase protection assay.
A 183-bp
HindIII-SphI restriction fragment was labeled
on the antisense strand with
-32P-labeled
deoxynucleoside triphosphate, using Klenow fragment. DNA binding and
DNase I digestion were carried out as previously described
(27) in a 50-µl volume with 0.5 ng (1 fmol) of labeled DNA, 1 µg of poly(dI-dC), and 60 µg of nuclear extracts
(7) in a final buffer of 25 mM Tris-HCl (pH 7.9), 6.25 mM
MgCl2, 0.5 mM EDTA, 50 mM KCl, 0.5 mM dithiothreitol, 2%
polyvinyl alcohol, and 10% glycerol. After 15 min on ice followed by 1 min of digestion at 25°C with 1 to 2 µl of freshly diluted DNase I
(5 µg/ml; Worthington), the reactions were terminated and the DNA
fragments were extracted, and precipitated before being loaded on a
10% sequencing gel. Purine sequence ladders of DNA probes were
prepared by the Maxim and Gilbert procedure.
EMSA.
Nuclear extracts were prepared, and an electrophoretic
mobility shift assay (EMSA) was carried out as described previously (59). DNA binding reactions were performed for 20 min at
room temperature in a buffer containing 20 mM HEPES (pH 7.8), 100 mM KCl, 1 mM dithiothreitol, 1 µg of poly(dI-dC) (Sigma, St. Louis, Mo.), 1 mM ZnCl2, 104 dpm of labeled probe,
10% glycerol, and 15 µg of nuclear protein extract in a volume of 30 µl. For immunodepletion prior to EMSA, the nuclear extract was
incubated with the indicated antibodies on ice for 3 h, and then
protein A-Sepharose was added to the protein mixture to remove antibody
complex. The probe used was a 30-mer double-stranded synthetic
oligonucleotide containing the sequence
TCGGCACCGCCCCCGCCCCCGCCCCCTCGG, which
corresponds to positions
211 to
182 of the human GADD45
promoter with the 20-bp binding region. In some experiments, a 30-mer
oligonucleotide, TCGGCACTATTTTTATTTTTATCCCCTCGG,
with the WT1 or EGR1 sequence replaced with an AT-rich motif
(underlined) was used. Each strand was labeled separately with T4
polynucleotide kinase (New England Biolabs) and
[
-P32]ATP (3,000 Ci/mmol; Dupont), and then the
strands were annealed. Unincorporated counts were separated on a Nick
column (Pharmacia). The samples were analyzed on a nondenaturing 4%
acrylamide gel.
Gel electrophoresis and immunoblot analysis.
For measurement
of WT1, Egr1, and p53 protein levels, total cellular protein was
prepared as described previously (59). One hundred
micrograms of the protein was loaded onto sodium dodecyl sulfate-15%
polyacrylamide denaturing gels; following electrophoresis, the protein
was transferred electrophoretically to Immobilon membranes (Millipore,
Bedford, Mass.). The membranes were then blocked for 30 min in 5%
nonfat milk at room temperature. A monoclonal mouse antibody to p53
(pAb1801; Oncogene Science, Mineola, N.Y.) was used to measure the p53
protein level; for WT1 detection, the membrane was probed with the
monoclonal antibodies H2 (50) and H7 (provided by F. Rauscher), mWT12 (provided by D. Haber), and WTc8, a polyclonal rabbit
anti-mouse antibody (provided by D. Haber) (9, 10). For Egr1
(NGFI-A) detection, the membrane was probed with the anti-Egr1/NGFI-A
monoclonal antibody 1H4, which was a gift of J. Milbrandt
(5).
Biotin-streptavidin pull-down assay.
Oligonucleotides
(Midland) containing biotin on the 5' nucleotide of the sense strand
consisted of TCGGCACCGCCCCCGCCCCCGCCCCCTCGG, which corresponds to positions
211 to
182 of the human
GADD45 promoter,
TCGGCACTATTTTTATTTTTATCCCCTCGG, and
TCGGCACCGTTTCCGTTTCCGTTTCCTCGG. In the second oligonucleotide the GC-rich motif (underlined) was replaced with an AT-rich motif; in the third oligonucleotide, C bases,
which are critical for binding to WT1 and Egr1 (46a), were
replaced with T. These oligonucleotides were annealed to their
respective complementary oligonucleotides, and 30-bp double-stranded oligonucleotides were gel purified and used. Cellular protein was
extracted as described previously (11). One microgram of each oligonucleotide was incubated with 2 mg of cellular protein for 20 min at room temperature in binding buffer containing 12% glycerol, 12 mM HEPES (pH 7.9), 4 mM Tris (pH 7.9), 150 mM KCl, 1 mM EDTA, 1 mM
dithiothreitol, and 10 µg of poly(dI-dC) competitor. Following this
reaction, 30 µl of streptavidin-agarose (Sigma) was added to the
reaction and incubated at 4°C for 4 h. Prior to this step, 300 µl of the original streptavidin-agarose bead preparation was
preabsorbed with 500 µg of bovine serum albumin, 50 µg of
poly(dI-dC), and 50 µg of sheared salmon sperm DNA for 20 min at
25°C; the beads were washed three times and resuspended in 300 µl
of the binding buffer. The protein-DNA-streptavidin-agarose complex
was then washed three times with binding buffer and loaded onto a
sodium dodecyl sulfate-polyacrylamide gel. After electrophoresis, the
protein was transferred to Immobilon membranes (Millipore). The
detection of p53, WT1, and Egr1 was performed as described in "Gel
electrophoresis and immunoblot analysis" above. For immunodepletion prior to the DNA-protein binding reaction, the protein extract was
incubated with the indicated antibodies on ice for 3 h and then
protein A-Sepharose was added to the protein mixture to remove antibody
complex.
 |
RESULTS |
Mapping of a stress-responsive element in the proximal
GADD45 promoter.
As discussed earlier, the
GADD45 promoter does not contain a p53-binding site and is
not induced by overexpression of p53 or by ionizing radiation in cells
with functional p53. However, responses to stresses, such as MMS or UV
radiation, are stronger in wt p53 cells and p53 dominant-negative
vectors reduce the stress responsiveness of this promoter. In order to
localize the control elements involved in this response, 5'-deletion
analysis of the human GADD45 promoter was undertaken. As
shown in Fig. 1, the longest promoter
region (pHG45-CAT1) was strongly responsive in the two wt p53 lines,
RKO and MCF-7. This was seen for stably integrated reporter constructs
(RKO) as well as transiently transfected constructs (MCF-7). In
contrast, the p53-deficient H1299 line was appreciably less responsive.
In the MCF7-E6 subline, where much of the p53 action has been blocked
by E6, induction was also substantially less than that in the parent
MCF-7 line and was comparable to that of H1299 (Fig. 1A). When the E6
expression vector was cotransfected into MCF-7 cells with the reporter
constructs shown in Fig. 1C, induction was also less than that in cells
transfected with a control expression vector (Fig. 1B). With
progressive 5' deletions, induction did not change substantially until
the last construct, pHG45-CAT3 (Fig. 1), which extended 5' only to
70 relative to the transcription start site. With this minimal promoter, treatment of cells with MMS or UV radiation had little effect. These
studies indicate that the first 253 bp of the GADD45
promoter contain the major control regions required for responsiveness to these agents. However, a similar pattern, albeit of lower magnitude, was also observed in the p53-deficient lines. Thus, both the
p53-dependent and -independent stress responsiveness mapped to the
proximal promoter.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
GADD45 promoter deletion analysis in wt p53
and p53-deficient human cells. (A) Summary of results for reporter
constructs containing the indicated regions of the GADD45
promoter linked to the CAT reporter that were stably integrated in RKO
(wt p53) and H1299 (p53-null) cell lines. The cells were treated with
100 µg of MMS/ml for 4 h or with 14 J m 2 of UV
radiation; the cells were harvested 24 h after treatment, and CAT
assays were carried out as described in Materials and Methods. Results
are also summarized for MCF-7 and MCF7-E6 (stably expressing E6) cells
that were transfected with 5 µg of the indicated reporter constructs
20 h prior to treatment and harvested 24 h after treatment.
The values represent the relative expression with standard deviations
compared to that of the untreated controls. (B and C) Five micrograms
of the indicated reporter constructs was cotransfected into MCF-7 cells
with 5 µg of the indicated expression vectors 20 h prior to
treatment with MMS or UV radiation; the cells were harvested 24 h
later. The reporter constructs were cotransfected with control plasmid,
pCMV-neo (B), or with the E6 expression vector, pCMV-E6 (C). The values
below the panels indicate the relative induction compared to that of
untreated control cells (lanes C).
|
|
While the basal expression of the various GADD45 promoter
constructs was not appreciably affected by expression of E6 (Fig. 1C),
the basal expression in untreated cells did vary with progressive 5'
deletions. Relative to that for pHG45-CAT1, the values for basal
expression for pHG45-CAT2, -4, -6, -7, and -3 were 1.1, 2.4, 2.3, 7.2, and 0.3, respectively, in MCF-7 cells; in the case of stably
transfected H1299 cells the values, relative to that for pHG45-CAT1 in
this line, were 5.2, 11.5, 9.3, 16.5, and 0.2. In both cases, it
appears that one or more negative regulatory elements exist in the
upstream promoter that controls basal expression. With 5' deletion to
70 in pHG45-CAT3, basal expression, as well as stress responsiveness
(see above), was markedly reduced.
Identification of a GC-rich site with binding proteins in MCF-7 but
not H1299 cells.
In an initial attempt to distinguish possible
protein-binding sites that may differ between strongly and weakly
responsive cells, in vitro DNase I footprinting was carried out with
nuclear extracts from MCF-7 and H1299 cells. The most prominent
difference was a strongly protected area in a GC-rich region that was
observed only in the MCF-7 extract; the region containing this
protected area is shown in Fig. 2. This
region contained a continuous run of either G or C from
186 to
205.
Strong protection could be seen from
195 to
202, and weaker, less
prominent protection could be seen in flanking regions from
189 to
194 and from
203 to
212. The protected region was similar in
extracts from either UV-irradiated or untreated MCF-7 cells. Even
though the fourth lane, H1299 (control), was somewhat overloaded, there
was a clear difference discernible in this GC-rich region in the MCF-7
extracts compared to the other lanes. Interestingly, this region
contains a novel 15-bp symmetrical motif that consists of two perfect
overlapping EGR1-WT1 consensus sequences, CGCCCCCGC
(plus-strand sequence) (47).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
DNA footprint analysis of the GADD45
promoter. A labeled fragment from the proximal promoter (see Materials
and Methods) was analyzed by in vitro footprinting with DNase I. Extracts were prepared from either untreated growing H1299 (control) or
MCF-7 (control) cells or cells harvested 4 h after UV irradiation
[H1299 (UV) and MCF-7 (UV)]. The sequence of the sense strand is
shown for the two overlapping WT1-EGR1 sites. Purine sequence ladders
of the antisense strand (A+G) were prepared by the Maxim and Gilbert
technique.
|
|
Using a labeled double-stranded oligonucleotide of this region, we
detected several DNA-protein complexes by EMSA with extracts from MCF-7
cells (Fig. 3A). A prominent slowly
migrating band was seen in MCF-7 cells, while it was much less intense
or undetectable in H1299 extracts. In addition, this band was also
substantially less intense in MCF-7 cells stably expressing E6 (data
not shown). When this GC-rich motif was replaced with another sequence
(Fig. 3A, "mutated sequence") this prominent band disappeared. In
competition experiments (Fig. 3C) the MCF-7-specific band was
effectively competed away with wt but not with mutant sequence. The
identity of the prominent faster-migrating band that was common to
H1299 and MCF-7 is unknown, but its failure to change in the
competition experiment would argue that its binding is not specific to
this sequence.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 3.
EMSAs with DNA containing the GADD45 WT1-EGR1
site. (A) Nuclear extracts from H1299 or MCF-7 cells, which were
prepared from untreated cells (Control) or cells 4 h after
treatment with MMS or UV radiation, were incubated with a labeled 30-bp
probe corresponding to this region (intact sequence) or to one
containing mutated WT1-EGR1 sites (mutated sequence) as described in
Materials and Methods. (B) EMSA was carried out in the same manner
except that extracts were immunodepleted prior to analysis with
preimmune serum (PI); antibody (Ab) against WT1 (WTc8), Egr1 (NGF-1),
or p53 (PAB421; Oncogene Science); or nonspecific IgG prior to
analysis. Control, no immunodepletion. (C) EMSA was carried out as for
panel A, but with a 20- or 50-fold excess of either the wt (SELF) or
the same mutated sequence (MUTANT) as in A. Probe, no nuclear extract.
The arrows indicate specific bands in MCF-7 cell extract.
|
|
Evidence for a complex containing WT1 and p53 that binds to the
GADD45 GC-rich promoter element.
Even though the
MCF-7-specific bandshift shown in Fig. 3 did not show any change in
UV-irradiated cells, it may still represent binding by proteins
important in the stress responsiveness of wt p53 cells. Constitutive
binding is not without precedent for promoter elements important in
stress responsiveness. For example, the
-polymerase promoter
contains an ATF-CREB site that was required for mediating induction by
alkylating agents, and the EMSA bandshift was similar for treated and
untreated cells (29). In an initial effort to identify which
proteins bind the GADD45 element, supershift-type experiments were conducted with antibodies to WT1, Egr1, and p53. However, no convincing mobility shifts were seen with these antibodies (data not shown). It has previously been reported (9) that anti-WT1 and -Egr1 antibodies failed to supershift a complex containing a typical Egr1-binding site motif. An alternative approach was undertaken in the experiment shown in Fig. 3B, where nuclear cell extracts were immunodepleted prior to the EMSA. As controls,
immunodepletion with preimmune serum or nonspecific immunoglobulin G
(IgG) had no effect on the MCF-7-specific band, and no effect was seen
with any antibody with the H1299 extract. In contrast, this band was markedly reduced by immunodepletion with anti-WT1 antibody, but anti-Egr1 antibody had no effect. To confirm that these antibodies were
effective in depleting the extracts, aliquots of the extracts before
and after immunodepletion were analyzed by immunoblotting, and WT1 and
Egr1 were found to be markedly reduced in their respective immunodepleted extracts (data not shown). In addition, the p53 antibody
was also effective in reducing this band, as shown in Fig. 3B. In order
to determine if p53 binds directly to this sequence, EMSA-type
experiments (see reference 49 for the methodology) were undertaken with baculovirus-produced p53; no binding was detected
with this oligonucleotide, while strong binding occurred with an
oligonucleotide probe containing the GADD45 intronic
p53-binding site (data not shown).
WT1 plays an important role in renal cells, but there is increasing
evidence that it is expressed in a variety of tissues and cell types
(3, 44). As shown in Fig. 4,
immunoblot analysis with the H2 antibody demonstrated that this protein
was expressed at appreciable levels in MCF-7 cells, while a negligible
effect was detected in H1299 cells. In order to confirm that this was in fact WT1, a battery of three other anti-WT1 antibodies was tested,
including WTc8, mWT12, and H7. In each case, the same-size protein band
was detected in MCF-7 cells (data not shown), although the multiple WT1
isoforms, ranging from 46 to 65 kDa, were best visualized with the H2
antibody. In the case of Egr1, similar expression was detected in both
MCF-7 and H1299 cells. Although EGR1 has been found to be IR
inducible in human fibroblasts and kidney epithelial cells
(19) and UV inducible in NIH 3T3 cells (25), it
was expressed at the same appreciable level in untreated control cells
as in both MCF-7 and H1299 cells treated with IR, UV radiation, or MMS.
No evidence for WT1 induction was observed in either of these cell
lines, as shown in Fig. 4. In the case of p53, no expression was
detected in H1299, which is known to have deletions in both p53 alleles
(59), and typical induction was seen for all three damaging
agents in MCF-7 cells, as seen previously in this line (11,
43). Taken together with the EMSA results, these studies suggest
that in MCF-7 cells both WT1 and p53 could well play roles in the
regulation of GADD45 by interaction with this element, i.e.,
WT1-EGR1.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of WT1, p53, and Egr1 in H1299 and MCF-7
cells. The cells were treated as described in the legend to Fig. 3 or
were irradiated with 20 Gy of rays and harvested 1 h later
(IR). Cellular protein was analyzed by immunoblotting with antibodies
to the indicated proteins. The visualized bands are shown; their
estimated masses were 46 to 65 kDa for WT1, 53 kDa for p53, and 69 kDa
for Egr1.
|
|
The results shown in Fig. 3 and 4 suggest several possible
interpretations for our EMSA results. In particular, p53 levels were
quite low in untreated MCF-7 cells but the bandshifts showed no
difference for either untreated or treated cells. This could indicate
that the association of p53 with the WT1-containing complex is
disrupted during the EMSA, or perhaps p53 constitutively binds to this
complex. In addition, any conclusion is dependent on the assumption
that the anti-p53 or -WT1 antibodies specifically depleted only p53- or
WT1-containing complexes, respectively, in the gels shown in Fig. 3B.
To address these issues, a biotin-avidin pull-down procedure was
employed to isolate proteins that bind to the GADD45 GC-rich
motif. As shown in Fig. 5A, protein
complexes containing WT1 and Egr1 specifically bound to the GC-rich
motif while mutation of bases known to be involved in Egr1 and WT1 DNA
binding ablated this association. Interestingly, p53 was barely
detected in the extract from untreated cells but showed substantial
binding with the extract from MMS- and UV-treated cells.
Non-sequence-specific binding by p53 was prevented by the inclusion of
excess carrier DNA (see Materials and Methods). While both WT1 and p53
bound to the GC-rich motif, this experiment cannot distinguish between binding to the same or separate DNA molecules in the association assay.
To address this issue, the cell extracts were immunodepleted with
various antibodies prior to addition of the biotin-labeled DNA (Fig.
5B). As demonstrated in the figure, two different anti-WT1 antibodies
depleted both WT1- and p53-containing complexes while an anti-Egr1
antibody had no effect. This occurred in spite of the fact that the
last antibody removed much of the Egr1 from the extract, as determined
by immunoblotting (data not shown). Interestingly, the majority of the
p53 protein, which bound to this DNA, was removed by WT1
immunodepletion. Considering that WT1 is known to bind strongly to this
sequence (56) while p53 does not directly bind to it (see
earlier comments), these results indicate that p53 is associated with
WT1-containing complexes but not with EGR1-containing complexes.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Pull-down assay with biotin-labeled GADD45
GC-rich motif. Nuclear extracts were prepared from MCF-7 cells as
explained in the legend to in Fig. 4 and incubated with biotin-labeled
30-bp DNA; proteins binding to this DNA were isolated with
streptavidin-agarose and detected by immunoblot analysis (see Materials
and Methods). (A) Extracts were incubated with one of the following: no
oligonucleotide (No oligo); mutated sequence-1, in which the GC-rich
motif was replaced with an AT-rich motif; or mutated sequence-2, in
which critical C nucleotides were replaced by T. Binding proteins were
then detected by immunoblotting to the proteins designated to the left
of the blots. (B) Extracts were immunodepleted with the antibodies (Ab)
indicated at the top of the panel prior to addition of the
oligonucleotide with the intact GC-rich motif. NS Ab, nonspecific IgG;
WT1 Ab-1, WTc8; WT1 Ab-2, mWT12. Analysis was then carried out as
described for panel A with mWT12 and PAb421 for immunoblot detection of
WT1 and p53, respectively.
|
|
Induction of the GADD45 promoter-reporter construct by
WT1 and p53 expression vectors.
Even though the GADD45
promoter does not contain a p53-binding site (28) and is not
induced by overexpression of p53 (59), the contribution of
p53 to the responsiveness of this promoter could be mediated by
protein-protein interactions with other factors, such as WT1, which has
been shown to interact with p53 (37) and to bind to the same
consensus sequence as Egr1. In order to test this possibility, H1299
cells were transfected with the GADD45 reporter construct
and various expression vectors (Fig. 6).
Since high-level expression of p53 with the pC53-SN3 expression vector has been shown to repress a variety of promoter constructs, including GADD45 (59), the amount of p53 expression vector
was reduced. As shown in Fig. 6A, cotransfection of the reporter with
p53 had no appreciable effect on expression. Likewise, cotransfection with an expression vector for WT1 had at most a minimal effect. In
contrast, the combination of p53 and WT1 resulted in a consistent large
increase in expression of the CAT reporter. This effect required wt
p53, since no increased expression was seen with mutant p53 (143 Val
Ala) transfected either with reporter alone or with WT1 and the
reporter. In the case of Egr1, a similar but substantially weaker
effect was seen when it was cotransfected with p53; the increase in
expression was less than 25% of that seen with WT1 and p53. Again,
Egr1 alone or in combination with mutant p53 had no effect. In order to
determine if the GC-rich motif in the GADD45 promoter was
required for this effect, similar experiments were carried out (Fig.
6B) with a reporter construct containing a mutated WT1-EGR1 site. When
this binding site was mutated in pHG45-CATmut, induction was markedly
reduced and more than 80% of the effect was lost compared to that of
the reporter with the wt WT1-EGR1 site.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Induction of the GADD45 promoter by
cotransfection with WT1 and p53 expression vectors. (A) H1299 cells
were transfected with the GADD45 promoter-reporter construct
pHG45-CAT2 and the indicated pCMV expression vectors; pCMV-neo was
included as a control. Plasmids used are shown to the left with
simplified names to the right. Vector, pCMV.3, was included in some
cases to keep the total amount of transfected DNA constant. CAT assays
were carried out as described earlier. (B) The experiment was carried
out in a similar manner with the exception that the reporter was driven
by the normal GADD45 promoter or by a similar construct,
pHG45-CAT2mut (143 Val Ala), where the WT1-EGR1 site had been mutated
(see Materials and Methods). Results from multiple separate
determinations of relative expression are shown at the bottom of each
panel as bar graphs with standard deviations.
|
|
The WT1-EGR1-binding site and WT1 contribute to GADD45
responsiveness in MCF-7 cells.
Since expression by exogenous p53
and WT1 resulted in induction of the GADD45 promoter, the
role of the WT1-EGR1 site and cellular WT1 on the responsiveness of
this promoter was studied in the wt p53 MCF-7 line. Reporter constructs
driven by either the normal promoter sequence or one where the WT1-EGR1
site had been mutated were transfected into cells, and responsiveness
to MMS or UV radiation was measured (Fig.
7). As shown in earlier figures, the
normal promoter showed strong induction by these stresses, while the
reporter driven by the promoter with the mutated WT1-EGR1 site was
markedly less responsive, even though levels of basal expression in the
untreated controls were similar (data not shown). In fact, the
induction of the mutated construct was comparable to that of a deletion
construct, pHG45-CAT9, where the WT1-EGR1 site and all upstream
sequence had been deleted. Interestingly, this residual induction in
the latter two constructs is comparable to that seen with the normal
promoter in MCF-7 cells expressing E6 (Fig. 1 and 7). In addition,
expression of E6 had no appreciable effect on the MMS induction of
pHG45-CAT9, as shown in Fig. 7, or of pHG45-CAT2mut (data not shown).
Presumably, the residual induction of constructs, such as pHG45-CAT2mut
and pHG45-CAT9, is due to one or more additional stress-responsive
control elements between
186 and
70 because pHG45-CAT3 (
70 to
+144) (Fig. 1) showed no responsiveness. Since this line expresses both
WT1 and p53, these findings are consistent with roles for these
proteins in mediating stress responsiveness through the WT1-EGR1 site.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 7.
Role of the WT1-EGR1 site in the stress responsiveness
of the GADD45 promoter. CAT reporter constructs, shown
diagrammatically at the bottom of the figure, were transiently
transfected into MCF-7 cells and then treated with MMS or UV radiation
and analyzed in the same manner as described in the legend to in Fig.
1. In the case of pPH45-CAT2mut, the WT1-EGR1 site (WT1) was replaced
with an unrelated sequence (see Materials and Methods). The two
righthand pairs of bars show pHG45-CAT2 and pHG45-CAT9 cotransfected
with the E6 expression vector as described in the legend to Fig. 1B.
The average inductions (with standard deviations) relative to that of
untreated cells for repeated experiments are shown.
|
|
In order to further examine the role of cellular WT1 in regulation of
the GADD45 gene, MCF-7 cells were transfected with the normal GADD45 promoter and an expression vector encoding
human WT1 cDNA in the antisense orientation. As shown in
Fig. 8A, induction in the presence of
antisense WT1 was significantly reduced for the
GADD45 promoter. To rule out some general attenuation of
cellular stress responsiveness in the presence of antisense
WT1, an unrelated stress gene, c-fos, which has
been shown to be inducible by a wide variety of DNA-damaging agents
(24), was also tested. In contrast to GADD45,
antisense WT1 had no significant effect on the induction of
c-fos. It should also be noted that antisense WT1
had no appreciable effect on the basal expression of these promoters in
untreated cells: the basal expression of CAT2 transfected with
pCMV-ASWT1 was 93% of that with pCMV-neo, and c-fos-CAT basal expression with pCMV-ASWT1 was 84% of that with pCMV-neo. As an additional control, cells transiently expressing pCMV-ASWT1 were isolated, as described in Materials and Methods, and WT1 protein levels
were shown to be markedly reduced by immunoblot analysis with either
the H2 (Fig. 8B) or WTc8 (data not shown) antibody. Thus, abrogation of
either cellular p53 (such as by E6 [Fig. 1 and 7]) or WT1 expression
(Fig. 8) in this line resulted in reduced stress responsiveness of the
human GADD45 promoter.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 8.
The effect of antisense WT1 expression on the stress
responsiveness of the GADD45 promoter. (A) MCF-7 cells were
transfected with 5 µg of either the GADD45 (pHG45-CAT2) or
c-fos (c-fos-CAT) reporter and 5 µg of either the WT1
antisense expression vector (solid bars) or pCMV-neo (open bars);
20 h later they were treated with the indicated damaging agent and
then harvested and analyzed 24 h after the start of treatment in
the same manner as described in the legend to Fig. 1. (B) MCF-7 cells
were transfected with 5 µg of pCMV-ASWT1 plus 0.5 µg of pcI Tac and
either the WT1 antisense expression vector (lanes 2, 3, 5, and 6) or
pCMV-neo (lanes 1 and 4). Tac-expressing cells were isolated (see
Materials and Methods), and cell lysates (40 µg of protein) were
analyzed by immunoblotting with the H2 anti-WT1 antibody. Results are
shown for two separate experiments (lanes 1 to 3 vs. lanes 4 to 6) done
on different days. (C) The U2OS line UB27, containing
tetracycline-inducible WT1, was analyzed by blot analysis of poly(A)
RNA (1 µg) isolated from cells containing tetracycline (Tet +) and
cells where the tetracycline had been removed 4 h earlier (Tet
); to show equivalent loading, the same blot was hybridized with
GAPDH probe. The two pairs of samples were prepared separately; only
the hybridizing bands of 1.4 kb for GADD45 and 1.3 kb for
GAPD are shown. The relative GADD45 expression,
shown in the bar graph, was determined on the same samples by
quantitative hybridization.
|
|
To further strengthen the evidence for the role of WT1 in the
regulation of the GADD45 gene, wt p53 osteosarcoma cells
containing a tetracycline-inducible WT1 expression vector, which were
developed by Englert et al. (9), were studied for changes in
GADD45 expression. Removal of tetracycline consistently led
to a rapid and significant increase in GADD45 expression in
multiple independent experiments. As shown in Fig. 8C, the
GADD45 mRNA level increased severalfold. These results
demonstrate that increased GADD45 expression can occur in
vivo when WT1 levels are increased in cells with wt p53.
 |
DISCUSSION |
Studies reported here and earlier (60) have shown that
abrogation of either p53 function or WT1 expression reduces the stress responsiveness of the GADD45 promoter in spite of the fact
that p53 does not bind to the promoter directly, while transient
expression of p53 and WT1 could induce this promoter without typical
direct p53 binding to DNA. An important implication of these studies is
that the role of p53 in mediating positive transcriptional responses is
broader than induction by direct binding to p53-binding sites alone and
could involve many genes that lack p53-binding sites. Transcriptional
repression by p53 protein-protein interactions has been demonstrated by
numerous investigators (discussed in reference 32),
and the present studies indicate that protein-protein interactions can
also contribute to transcriptional up-regulation. In the case of both
GADD45 and GADD153, abrogation of p53 function reduced the responsiveness to MUM-type (i.e., MMS, UV radiation, and
medium starvation) agents in spite of the fact neither promoter contains a p53-binding site (60). This MUM-type response
differed from typical p53 activation in that p53 alone was neither
required nor sufficient; e.g., overexpression of p53 alone did not
induce the GADD45 promoter (59), while abrogation
of p53 function, such as in p53
/
mouse embryo
fibroblasts (60), reduced but did not prevent induction. The
p53 effect was mapped to the proximal promoter of GADD45,
and deletion or replacement of the GC-rich motif with unrelated
sequence removed the p53 responsiveness; e.g., induction of pHG45-CAT9
by MMS was similar in MCF-7 and MCF7-E6 cells. By DNase footprinting
and EMSA, protein binding to this region was detected in wt p53 cells,
and prior immunodepletion by antibodies to p53 or WT1 substantially
reduced this binding, while an anti-Egr1 antibody had no effect. This
same band in the EMSA was much less intense or absent in H1299 cells,
which do not express appreciable levels of p53 or WT1, and in MCF-7
cells expressing E6. The biotinylated-DNA pull-down experiments
indicate that one or more complexes containing both WT1 and p53 can
bind to the GC-rich motif, while Egr1-binding complexes do not contain
appreciable p53. The combination of p53 and WT1 expression vectors
induced the pHG45-CAT2 reporter construct in transient assays, while
the effect with Egr1 plus p53 was much less. While the argument could
be made that such expression vectors produce abnormally high levels of
protein that may not be physiologically relevant, attenuation of
cellular WT1 expression by an antisense vector reduced the stress
responsiveness of the GADD45 promoter in transfected MCF-7
cells. In addition, increased expression of WT1 in vivo (Fig. 8B)
caused a rapid increase in GADD45 expression in a wt p53
cell line. WT1 was expressed at appreciable levels in MCF-7 cells (Fig.
4), and it also has been found to be expressed in various human wt p53
tumor cell lines (unpublished data) and in a variety of tissues and
cell types, including tumor cells in vivo (3, 44). This may
indicate that WT1 plays a role in p53-mediated stress responses in
certain cell types, such as MCF-7, while other p53 protein-protein
interactions could also contribute to stress responsiveness in other
cases.
The GC-rich motif required for the p53 effect on the GADD45
promoter contains consensus sequences for multiple transcription factors in addition to WT1. In particular, it contains three
overlapping Egr1 sites, two of which are perfect matches. In fact, this
9-bp motif has been shown to bind Egr1 more strongly than WT1, while for certain related sites WT1 binding was stronger (41, 47). However, p53 has been shown to interact with WT1 in vivo by binding involving the first two Zn fingers of WT1, while p53 does not bind Egr1
(5, 37). In the same study, WT1 was found to stabilize p53
and modulate its transactivational properties. In combination with p53,
induction of the GADD45 promoter-reporter construct was much
weaker for Egr1 than WT1 (Fig. 6) and expression vectors for Egr2 or
Egr3 had no effect (data not shown). In addition, no footprint in this
area was detected with extract from H1299 cells (Fig. 2) in spite of
the fact that this line showed a level of Egr1 expression similar to
that of MCF-7 cells (Fig. 4). The argument for stronger WT1 binding to
the GADD45 site is strengthened by the fact that this region
defines a larger WT1 consensus sequence that matches the 20-bp site in
the PDGF-A promoter (GenBank accession no. HUMPDGFA1), which
strongly binds WT1. In combination with a second site in the
PDGF-A gene, this site has been shown to mediate
transcriptional repression by WT1, while reporter constructs containing
only one of the two sites resulted in induction by WT1 in transient
assays (56). All four WT1 splice variants were found to bind
to this site, or to the site and several adjacent nucleotides, in the
PDGF-A gene (56), and expression vectors for the
four different splice forms in combination with p53 caused appreciable
induction of pHG45-CAT2, as shown in Fig. 6 for splice form A. A BLAST
search of the GenBank database revealed a surprising number of matches
for this relatively long (20-bp) consensus sequence: there were 12 perfect matches, which were all mammalian sequences, and >40 matches
with one mismatch, which were predominantly mammalian sequences. In
several cases, homology extended beyond 20 bp, such as for
JUN-D (25 bp) and MDR3 (26 bp). A simple
approximation demonstrates that the chances for such matches
(10
12 to 10
15) are very remote in a genome
of 109 bp. Considering that this motif is in the proximal
promoters of multiple human genes (such as GADD45,
PDGF-A, JUN-D, and MDR3)
a much
smaller target than the entire genome
their presence certainly has
functional significance. Unlike PDGF-A and MDR3,
only JUN-D is in the same orientation as GADD45
relative to the transcription start site. It is of interest that
JUN-D is also an immediate-early gene that is induced by
stresses such as hypoxia (46), which have been shown to
induce p53 protein and the GADD45 gene (discussed in
reference 32).
The role of p53 in induction of the gadd gene promoters
exhibits some important differences from its role with previously described p53-regulated genes. In addition to lacking p53-binding sites, neither the GADD45 promoter nor the
GADD153 gene is inducible by IR in most wt p53 cells
(23, 58), in contrast to genes containing p53-binding sites.
As discussed previously (22), IR damage is qualitatively and
quantitatively different from MUM-type stresses and probably activates
p53 by DNA strand breakage (42). The regulation of
GADD45 is complex, since the IR response is probably
mediated by the strong p53-binding site in the third intron (23,
28), while most of the MUM-type responses are localized to the
promoter. This highlights the multifactorial aspect of stress gene
regulation, which often involves multiple sites and interacting
proteins. Another important difference from other p53-regulated genes
is that p53 alone is neither required nor sufficient for activation of
the GADD45 promoter. Promoter constructs lacking the WT1
site were still inducible by MUM-type stresses, albeit at lower levels,
and such stresses caused induction in p53-deficient cells. A reasonable
interpretation of these results could be that MUM-type stresses
activate adjacent control elements, such in pHG45-CAT9, that interact
with proteins binding to the WT1 site and also with proteins of the
basal transcription machinery.
While a variety of proteins are known to directly associate with WT1 or
p53, results to date indicate that WT1 and p53 do not directly
associate with each other. In MCF-7 cells we have confirmed previous
results in other cells (37) showing that these two proteins
associate in vivo, as determined by immunoprecipitation (data not
shown); our results (Fig. 5) also demonstrate this association. While
in vitro-translated WT1 has been to shown to bind to DNA containing
WT1-binding sites (41) and to directly interact with another
transcription factor, Par-4 (26), we consistently failed to
see an in vitro association between baculovirus-synthesized p53 and in
vitro-translated WT1 (data not shown); others (16a) also
have not detected an in vitro association of these two proteins. A
weak, possibly indirect interaction between the proteins is suggested
by our EMSA results. In particular, the bandshift shown in Fig. 3 did
not change with p53 induction by stress while p53 binding in the
pull-down studies shown in Fig. 5 markedly increased after stress; a
likely interpretation is that the p53 binding was disrupted during the
electrophoresis in the EMSA. A less likely scenario is that p53 could
conceivably compete with another protein for binding to the WT1
complex; however, it would be somewhat surprising to see no change in
the footprint shown in Fig. 2 if this were the case. While the argument
could be made that posttranslational changes are needed for the
proteins to associate, a more likely explanation is that the WT1-p53
association is indirect and involves one or more intervening proteins
in the binding complex. It has been suggested that WT1 contains both a
repression domain, residues 85 to 124 in the protein, and an activation
domain, residues 181 to 250, and that a second interactive protein is
required for repression (55). Interacting proteins, such as
p53, could affect this second interactive protein in the complex
binding the GADD45 site following stress. Recently, p53 has
been found to bind to the large transcriptional coactivator proteins
CBP and p300 (2, 15, 34); these proteins function by
interaction with a number of cellular activators, and probably with
multiple components of the transcriptional machinery, and modulate p53
transcriptional activity. Thus, a number of known directly interacting
proteins, such as CBP, p300, and Par-4, or perhaps as-yet-unknown
interacting proteins, may be required for p53 to associate with
proteins like WT1.
The physiologic consequences of WT1 interaction with p53 are
uncertain but could very well contribute to growth control after stress. Overexpression of WT1 has been shown to arrest cells in G1 and to down-regulate Cdk kinase activities
(33). In this study increased expression of any of the four
WT1 splice forms reduced colony yield and also blocked entry into S
phase after serum stimulation. This G1 arrest was blocked
by increased expression of cyclin-cdk complexes (9).
Interestingly, similar results have been found after increased
expression of Gadd45: reduced colony survival (61),
prevention of S-phase progression after serum stimulation
(51), and rescue of Gadd45 growth suppression by
cotransfection with cyclin expression vectors (57a). In
addition, overexpression of Gadd45 has been found to trigger a
G2-M arrest in wt p53 cells, and reduced Gadd45 expression
resulted in reduced G2-M arrest after certain stresses
(54a). As discussed earlier, EGR1, a member of
the same gene family as WT1, has been found to be stress responsive in
some cell types (4, 31), and recent evidence indicates that
it may contribute to G1 arrest after IR exposure in
melanoma cells (1). Since development has been found to be
relatively normal in p53
/
mice, the primary role of p53
is probably in mediating various stress responses to damage produced
either endogenously or by external agents. Our finding that p53 can
contribute to induction by stress in the absence of direct p53-DNA
binding indicates a possible role for the interacting proteins, such as
WT1, in the maintenance of genomic stability.
We thank D. A. Haber for providing cell lines, anti-WT1
antibodies, and cDNA clones; F. J. Rauscher III for providing
anti-WT1 antibodies and cDNA clones; J. Milbrandt for providing the
anti-Egr1 antibody; and J. Ashwell for providing the Tac expression
vector and antibody.
| 1.
|
Ahmed, M. M.,
S. F. Sells,
K. Venkatasubbarao,
S. M. Fruitwala,
S. Muthukkumar,
C. Harp,
M. Mohiuddin, and V. M. Rangnekar.
1997.
Ionizing radiation-inducible apoptosis in the absence of p53 linked to transcription factor EGR-1.
J. Biol. Chem.
272:33056-33061[Abstract/Free Full Text].
|
| 2.
|
Avantaggiati, M. L.,
V. Ogryzko,
K. Gardner,
A. Giordano,
A. S. Levine, and K. Kelly.
1997.
Recruitment of p300/CBP in p53-dependent signal pathways.
Cell
89:1175-1184[Medline].
|
| 3.
|
Buckler, A. J.,
J. Pelletier,
D. A. Haber,
T. Glaser, and D. E. Housman.
1991.
Isolation, characterization, and expression of the murine Wilms' tumor gene (WT1) during kidney development.
Mol. Cell. Biol.
11:1707-1712[Abstract/Free Full Text].
|
| 4.
|
Datta, R.,
N. Taneja,
V. P. Sukhatme,
S. A. Qureshi,
R. Weichselbaum, and D. W. Kufe.
1993.
Reactive oxygen intermediates target CC(A/T)6GG sequences to mediate activation of the early growth response 1 transcription factor gene by ionizing radiation.
Proc. Natl. Acad. Sci. USA
90:2419-2422[Abstract/Free Full Text].
|
| 5.
|
Day, M. L.,
T. J. Fahrner,
S. Aykent, and J. Milbrandt.
1990.
The zinc finger protein NGFI-A exists in both nuclear and cytoplasmic forms in nerve growth factor-stimulated PC12 cells.
J. Biol. Chem.
265:15253-15260[Abstract/Free Full Text].
|
| 6.
|
Dey, B. R.,
V. P. Sukhatme,
A. B. Roberts,
M. B. Sporn,
F. J. Rauscher III, and S. J. Kim.
1994.
Repression of the transforming growth factor-beta 1 gene by the Wilms' tumor suppressor WT1 gene product.
Mol. Endocrinol.
8:595-602[Abstract].
|
| 7.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 8.
|
Drummond, I. A.,
S. L. Madden,
P. Rohwer-Nutter,
G. I. Bell,
V. P. Sukhatme, and F. J. D. Rauscher.
1992.
Repression of the insulin-like growth factor II gene by the Wilms tumor suppressor WT1.
Science
257:674-678[Abstract/Free Full Text].
|
| 9.
|
Englert, C.,
X. Hou,
S. Maheswaran,
P. Bennett,
C. Ngwu,
G. G. Re,
A. J. Garvin,
M. R. Rosner, and D. A. Haber.
1995.
WT1 suppresses synthesis of the epidermal growth factor receptor and induces apoptosis.
EMBO J.
14:4662-4675[Medline].
|
| 10.
|
Englert, C.,
M. Vidal,
S. Maheswaran,
Y. Ge,
R. M. Ezzell,
K. J. Isselbacher, and D. A. Haber.
1995.
Truncated WT1 mutants alter the subnuclear localization of the wild-type protein.
Proc. Natl. Acad. Sci. USA
92:11960-11964[Abstract/Free Full Text].
|
| 11.
|
Fan, S.,
M. L. Smith,
D. J. Rivet II,
D. Duba,
Q. Zhan,
K. W. Kohn,
A. J. Fornace, Jr., and P. M. O'Connor.
1995.
Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.
Cancer Res.
55:1649-1654[Abstract/Free Full Text].
|
| 12.
|
Fornace, A. J., Jr.,
I. J. Alamo, and M. C. Hollander.
1988.
DNA damage-inducible transcripts in mammalian cells.
Proc. Natl. Acad. Sci. USA
85:8800-8804[Abstract/Free Full Text].
|
| 13.
|
Fornace, A. J., Jr.,
D. W. Nebert,
M. C. Hollander,
J. D. Luethy,
M. Papathanasiou,
J. Fargnoli, and N. J. Holbrook.
1989.
Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents.
Mol. Cell. Biol.
9:4196-4203[Abstract/Free Full Text].
|
| 14.
|
Goodyer, P.,
M. Dehbi,
E. Torban,
W. Bruening, and J. Pelletier.
1995.
Repression of the retinoic acid receptor-alpha gene by the Wilms' tumor suppressor gene product, wt1.
Oncogene
10:1125-1129[Medline].
|
| 15.
|
Gu, W.,
X. L. Shi, and R. G. Roeder.
1997.
Synergistic activation of transcription by CBP and p53.
Nature
387:819-823[Medline].
|
| 16.
|
Gujuluva, C. N.,
J. H. Baek,
K. H. Shin,
H. M. Cherrick, and N. H. Park.
1994.
Effect of UV-irradiation on cell cycle, viability and the expression of p53, gadd153 and gadd45 genes in normal and HPV-immortalized human oral keratinocytes.
Oncogene
9:1819-1827[Medline].
|
| 16a.
| Haber, D. A. Personal communication.
|
| 17.
|
Haber, D. A.,
S. Park,
S. Maheswaran,
C. Englert,
G. G. Re,
D. J. Hazen-Martin,
D. A. Sens, and A. J. Garvin.
1993.
WT1-mediated growth suppression of Wilms tumor cells expressing a WT1 splicing variant.
Science
262:2057-2059[Abstract/Free Full Text].
|
| 18.
|
Haber, D. A.,
R. L. Sohn,
A. J. Buckler,
J. Pelletier,
K. M. Call, and D. E. Housman.
1991.
Alternative splicing and genomic structure of the Wilms tumor gene WT1.
Proc. Natl. Acad. Sci. USA
88:9618-9622[Abstract/Free Full Text].
|
| 19.
|
Hallahan, D. E.,
V. P. Sukhatme,
M. L. Sherman,
S. Virudachalam,
D. Kufe, and R. R. Weichselbaum.
1991.
Protein kinase C mediates x-ray inducibility of nuclear signal transducers EGR1 and JUN.
Proc. Natl. Acad. Sci. USA
88:2156-2160[Abstract/Free Full Text].
|
| 20.
|
Harrington, M. A.,
B. Konicek,
A. Song,
X. L. Xia,
W. J. Fredericks, and F. J. Rauscher.
1993.
Inhibition of colony-stimulating factor-1 promoter activity by the product of the Wilms' tumor locus.
J. Biol. Chem.
268:21271-21275[Abstract/Free Full Text].
|
| 21.
|
Hewitt, S. M.,
S. Hamada,
T. J. McDonnell,
F. J. Rauscher III, and G. F. Saunders.
1995.
Regulation of the proto-oncogenes bcl-2 and c-myc by the Wilms' tumor suppressor gene WT1.
Cancer Res.
55:5386-5389[Abstract/Free Full Text].
|
| 22.
|
Holbrook, N. J., and A. J. Fornace, Jr.
1991.
Response to adversity: molecular control of gene activation following genotoxic stress.
New Biol.
3:825-833[Medline].
|
| 23.
|
Hollander, M. C.,
I. Alamo,
J. Jackman,
O. W. McBride, and A. J. Fornace, Jr.
1993.
Sequence conservation and DNA damage-responsiveness of the mammalian gadd45 gene.
J. Biol. Chem.
268:24385-24393[Abstract/Free Full Text].
|
| 24.
|
Hollander, M. C., and A. J. Fornace, Jr.
1989.
Induction of fos RNA by DNA-damaging agents.
Cancer Res.
49:1687-1692[Abstract/Free Full Text].
|
| 25.
|
Huang, R. P., and E. D. Adamson.
1995.
A biological role for Egr-1 in cell survival following ultra-violet irradiation.
Oncogene
10:467-475[Medline].
|
| 26.
|
Johnstone, R. W.,
R. H. See,
S. F. Sells,
J. Wang,
S. Muthukkumar,
C. Englert,
D. A. Haber,
J. D. Licht,
S. P. Sugrue,
T. Roberts,
V. M. Rangnekar, and Y. Shi.
1996.
A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms' tumor suppressor WT1.
Mol. Cell. Biol.
16:6945-6956[Abstract].
|
| 27.
|
Jones, K. A.,
K. R. Yamamoto, and R. Tjan.
1985.
Two distinct transcription factors bind to the HSV thymidine kinase promoter in vitro.
Cell
42:559-572[Medline].
|
| 28.
|
Kastan, M. B.,
Q. Zhan,
W. S. El-Deiry,
F. Carrier,
T. Jacks,
W. V. Walsh,
B. S. Plunkett,
B. Vogelstein, and A. J. Fornace, Jr.
1992.
A mammalian cell cycle checkpoint utilizing p53 and GADD45 is defective in ataxia telangiectasia.
Cell
71:587-597[Medline].
|
| 29.
|
Kedar, P. S.,
S. G. Widen,
E. W. Englander,
A. J. Fornace, Jr., and S. H. Wilson.
1991.
The ATF/CREB transcription factor-binding site in the polymerase beta promoter mediates the positive effect of N-methyl-N'-nitro-N-nitrosoguanidine on transcription.
Proc. Natl. Acad. Sci. USA
88:3729-3733[Abstract/Free Full Text].
|
| 30.
|
Kessis, T. D.,
R. J. Slebos,
W. G. Nelson,
M. B. Kastan,
B. S. Plunkett,
S. M. Han,
A. T. Lorincz,
L. Hedrick, and K. R. Cho.
1993.
Human papillomavirus 16 E6 expression disrupts the p53 mediated cellular response to DNA damage.
Proc. Natl. Acad. Sci. USA
90:3988-3992[Abstract/Free Full Text].
|
| 31.
|
Khachigian, L. M.,
V. Lindner,
A. J. Williams, and T. Collins.
1996.
Egr-1-induced endothelial gene expression: a common theme in vascular injury.
Science
271:1427-1431[Abstract].
|
| 32.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 33.
|
Kudoh, T.,
T. Ishidate,
M. Moriyama,
K. Toyoshima, and T. Akiyama.
1995.
G1 phase arrest induced by Wilms tumor protein WT1 is abrogated by cyclin/CDK complexes.
Proc. Natl. Acad. Sci. USA
92:4517-4521[Abstract/Free Full Text].
|
| 34.
|
Lill, N. L.,
S. R. Grossman,
D. Ginsberg,
J. DeCaprio, and D. M. Livingston.
1997.
Binding and modulation of p53 by p300/CBP coactivators.
Nature
387:823-827[Medline].
|
| 35.
|
Luethy, J. D.,
J. Fargnoli,
J. S. Park,
A. J. Fornace, Jr., and N. J. Holbrook.
1990.
Isolation and characterization of the hamster gadd153 gene. Activation of promoter activity by agents that damage DNA.
J. Biol. Chem.
265:16521-16526[Abstract/Free Full Text].
|
| 36.
|
Madden, S. L.,
D. M. Cook,
J. F. Morris,
A. Gashler,
V. P. Sukhatme, and F. J. Rauscher, III.
1991.
Transcriptional repression mediated by the WT1 Wilms tumor gene product.
Science
253:1550-1553[Abstract/Free Full Text].
|
| 37.
|
Maheswaran, S.,
S. Park,
A. Bernard,
J. F. Morris,
F. J. D. Rauscher,
D. E. Hill, and D. A. Haber.
1993.
Physical and functional interaction between WT1 and p53 proteins.
Proc. Natl. Acad. Sci. USA
90:5100-5104[Abstract/Free Full Text].
|
| 38.
|
Morris, J. F.,
S. L. Madden,
O. E. Tournay,
D. M. Cook,
V. P. Sukhatme, and F. J. Rauscher, III.
1991.
Characterization of the zinc finger protein encoded by the WT1 Wilms' tumor locus.
Oncogene
6:2339-2348[Medline].
|
| 39.
|
Murphy, M.,
A. Hinman, and A. J. Levine.
1996.
Wild-type p53 negatively regulates the expression of a microtubule-associated protein.
Genes Dev.
10:2971-2980[Abstract/Free Full Text].
|
| 40.
|
Muzio, M.,
A. M. Chinnaiyan,
F. C. Kischkel,
K. O'Rourke,
A. Shevchenko,
J. Ni,
C. Scaffidi,
J. D. Bretz,
M. Zhang,
R. Gentz,
M. Mann,
P. H. Krammer,
M. E. Peter, and V. M. Dixit.
1996.
FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death-inducing signaling complex.
Cell
85:817-827[Medline].
|
| 41.
|
Nakagama, H.,
G. Heinrich,
J. Pelletier, and D. E. Housman.
1995.
Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product.
Mol. Cell. Biol.
15:1489-1498[Abstract].
|
| 42.
|
Nelson, W. G., and M. B. Kastan.
1994.
DNA strand breaks: the DNA template alterations that trigger p53-dependent DNA damage response pathways.
Mol. Cell. Biol.
14:1815-1823[Abstract/Free Full Text].
|
| 43.
|
O'Connor, P. M.,
J. Jackman,
I. Bae,
T. G. Myers,
S. Fan,
M. Mutoh,
D. Scudiero,
A. Monks,
E. A. Sausville,
J. N. Weinstein,
S. Friend,
A. J. Fornace, Jr., and K. W. Kohn.
1997.
Characterization of the p53 tumor suppressor pathway in cell lines of the NCI anticancer drug screen and correlations with the growth inhibitory potency of 123 anticancer agents.
Cancer Res.
57:4285-4300[Abstract/Free Full Text].
|
| 44.
|
Park, S.,
A. Bernard,
K. E. Bove,
D. A. Sens,
D. J. Hazen-Martin,
A. J. Garvin, and D. A. Haber.
1993.
Inactivation of WT1 in nephrogenic rests, genetic precursors to Wilms' tumour.
Nat. Genet.
5:363-367[Medline].
|
| 45.
|
Pietenpol, J. A.,
T. Tokino,
S. Thiagalingam,
W. S. el-Deiry,
K. W. Kinzler, and B. Vogelstein.
1994.
Sequence-specific transcriptional activation is essential for growth suppression by p53.
Proc. Natl. Acad. Sci. USA
91:1998-2002[Abstract/Free Full Text].
|
| 46.
|
Prabhakar, N. R.,
B. C. Shenoy,
M. S. Simonson, and N. S. Cherniack.
1995.
Cell selective induction and transcriptional activation of immediate early genes by hypoxia.
Brain Res.
697:266-270[Medline].
|
| 46a.
| Rauscher, F. Personal communication.
|
| 47.
|
Rauscher, F. J., III,
J. F. Morris,
O. E. Tournay,
D. M. Cook, and T. Curran.
1990.
Binding of the Wilms' tumor locus zinc finger protein to the EGR-1 consensus sequence.
Science
250:1259-1262[Abstract/Free Full Text].
|
| 48.
|
Robertson, L. M.,
T. K. Kerppola,
M. Vendrell,
D. Luk,
R. J. Smeyne,
C. Bocchiaro,
J. I. Morgan, and T. Curran. |