Previous Article | Next Article 
Mol Cell Biol, May 1998, p. 2932-2939, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Selenium Deficiency Reduces the Abundance of mRNA for
Se-Dependent Glutathione Peroxidase 1 by a UGA-Dependent Mechanism
Likely To Be Nonsense Codon-Mediated Decay of Cytoplasmic mRNA
Patrick M.
Moriarty,1
C. Channa
Reddy,2 and
Lynne E.
Maquat1,*
Department of Human Genetics, Roswell Park
Cancer Institute, Buffalo, New York 14263,1
and
Department of Veterinary Science, Pennsylvania State
University, University Park, Pennsylvania 168022
Received 14 November 1997/Returned for modification 23 December
1997/Accepted 17 February 1998
 |
ABSTRACT |
The mammalian mRNA for selenium-dependent glutathione peroxidase 1 (Se-GPx1) contains a UGA codon that is recognized as a codon for the
nonstandard amino acid selenocysteine (Sec). Inadequate concentrations
of selenium (Se) result in a decrease in Se-GPx1 mRNA abundance by an
uncharacterized mechanism that may be dependent on translation,
independent of translation, or both. In this study, we have begun to
elucidate this mechanism. We demonstrate using hepatocytes from rats
fed either a Se-supplemented or Se-deficient diet for 9 to 13 weeks
that Se deprivation results in an ~50-fold reduction in Se-GPx1
activity and an ~20-fold reduction in Se-GPx1 mRNA abundance.
Reverse transcription-PCR analyses of nuclear and cytoplasmic
fractions revealed that Se deprivation has no effect on the levels
of either nuclear pre-mRNA or nuclear mRNA but reduces the level of
cytoplasmic mRNA. The regulation of Se-GPx1 gene expression by Se was
recapitulated in transient transfections of NIH 3T3 cells, and
experiments were extended to examine the consequences of
converting the Sec codon (TGA) to either a termination codon (TAA)
or a cysteine codon (TGC). Regardless of the type of codon, an
alteration in the Se concentration was of no consequence to the ratio
of nuclear Se-GPx1 mRNA to nuclear Se-GPx1 pre-mRNA. The ratio of
cytoplasmic Se-GPx1 mRNA to nuclear Se-GPx1 mRNA from the wild-type
(TGA-containing) allele was reduced twofold when cells were deprived of
Se for 48 h after transfection, which has been shown to be the
extent of the reduction for the endogenous Se-GPx1 mRNA of cultured
cells incubated as long as 20 days in Se-deficient medium. In contrast
to the TGA allele, Se had no effect on expression of either the
TAA allele or the TGC allele. Under Se-deficient conditions, the TAA
and TGC alleles generated, respectively, 1.7-fold-less and 3-fold-more
cytoplasmic Se-GPx1 mRNA relative to the amount of nuclear Se-GPx1 mRNA
than the TGA allele. These results indicate that (i) under conditions
of Se deprivation, the Sec codon reduces the abundance of cytoplasmic Se-GPx1 mRNA by a translation-dependent mechanism and (ii) there is no
additional mechanism by which Se regulates Se-GPx1 mRNA production.
These data suggest that the inefficient incorporation of Sec at the UGA
codon during mRNA translation augments the
nonsense-codon-mediated decay of cytoplasmic Se-GPx1 mRNA.
 |
INTRODUCTION |
Many organisms, including bacteria,
Saccharomyces cerevisiae, and vertebrates, appear to have
established mechanisms that eliminate the production of mRNAs that
prematurely terminate translation because of a frameshift or nonsense
mutation (reviewed in references 32, 33, 37, and
42). Therefore, the discovery of mRNAs in both
bacterial and mammalian cells in which one or more UGA codons are
purposefully used as selenocysteine (Sec) codons rather than as
nonsense codons (reviewed in references 10 and
30) raises the interesting issue of whether these
mRNAs are reduced in abundance when the UGA codon is recognized as
nonsense.
Cues from (i) biochemical and genetic studies of Escherichia
coli (reviewed in reference 10), (ii) the
discovery of mammalian homologs to some of the bacterial factors that
mediate the cotranslational incorporation of Sec (27, 29,
31), and (iii) information on mammalian mRNA sequences that
mediate the incorporation of Sec (7, 34) have contributed to
elucidating the mechanism by which a UGA codon is recognized as a Sec
codon. In mammals, recognition requires selenium (Se), a metabolic
pathway that converts Se to selenocysteyl-tRNA[Ser]Sec,
and at least one cis-acting Sec insertion sequence element
that presumably associates with the specialized elongation factor. Studies of the type I iodothyronine deiodinase (5' DI) gene, in which
the single TGA codon was converted to a cysteine (Cys) codon, indicate
that cells transiently overexpressing the gene are able to produce 20- to 400-fold-more protein from the Cys-containing allele than from the
TGA-containing allele (8). Therefore, at least in
transiently transfected cells, Sec is incorporated at the UGA codon of
5' DI mRNA only inefficiently, as may be the case for other
selenoprotein mRNAs.
Consistent with the concept that UGA-containing selenoprotein mRNAs
can be reduced in abundance when the UGA codon(s) is recognized as
nonsense, Se deprivation reduces the abundance of certain selenoprotein mRNAs, some more effectively than others. For example, rats or mice
fed a Se-deficient diet for 42 to 135 days manifest an 80 to 95% drop
in the level of Se-dependent glutathione peroxidase 1 (Se-GPx1)
mRNA in liver (28, 43, 46, 48) that is not attributable
to a decrease in Se-GPx1 gene transcription (6, 13, 14, 18,
46). The level of endogenous Se-GPx1 mRNA is also decreased
in Se-deficient cultured cells, although not by more than 70%, even if
the cells derive from liver (1, 13, 19, 49). Se deficiency
reduces the level of other selenoprotein mRNAs, including those for
5' DI (23), selenoprotein P (23), and
selenoprotein W (47). However, Se deficiency does not
reduce the level of all selenoprotein mRNAs, as exemplified
by mRNA for phospholipid hydroperoxide glutathione peroxidase
(PHGPx) (5, 6, 28). Consistent with Se having
different effects on different mRNAs, the results of incubating H4
rat hepatoma cells with actinomycin D indicate that Se deficiency
decreases the half-life of total-cell Se-GPx1 mRNA but is of no
consequence to the half-life of cytoplasmic PHGPx mRNA
(5). It is possible that Se regulates the level of
selenoprotein mRNAs not only in translation-dependent mechanisms but also in translation-independent mechanisms, and this possibility has been proposed given that (i) feeding Se to Se-deficient rats results in an increase in the level of Se-GPx1 mRNA before a
detectable increase in Se-GPx1 activity (45, 48) and (ii)
the level of Se-GPx1 activity in rats fed different amounts of Se does
not always parallel the level of Se-GPx1 mRNA (6). The
mechanism by which Se deprivation reduces the expression of Se-GPx1
cDNA in Chinese hamster ovary (CHO) cells has been demonstrated to be dependent on sequences within the 3' untranslated region
(49), which may also be consistent with a
translation-independent mechanism.
In order to clarify if Se (i) regulates the level of Se-GPx1 mRNA
via the Sec codon, (ii) affects Se-GPx1 gene expression independently
of the Sec codon, or (iii) does both, Se deficiency was induced in rat
liver and in NIH 3T3 cells transiently transfected with one of several
Se-GPx1 alleles that harbored different sequences at their Sec codons.
Results indicate that Se deficiency reduces the abundance of
cytoplasmic Se-GPx1 mRNA without altering the ratio of nuclear
Se-GPx1 mRNA to nuclear Se-GPx1 pre-mRNA. Regardless of
the Se concentration, changing the Sec codon from TGA to a TAA
nonsense codon decreased the ratio of cytoplasmic Se-GPx1 mRNA to nuclear Se-GPx1 mRNA while changing the Sec codon to a TGC cysteine codon increased the ratio of cytoplasmic Se-GPx1 mRNA
to nuclear Se-GPx1 mRNA. Neither change altered the ratio of
nuclear Se-GPx1 mRNA to nuclear Se-GPx1 pre-mRNA.
These data indicate that Se deprivation regulates the abundance of
cytoplasmic Se-GPx1 mRNA, presumably by eliciting the
nonsense-codon-mediated decay of cytoplasmic mRNA.
 |
MATERIALS AND METHODS |
Animals and diets.
Six weaned male Long-Evans hooded rats
weighing between 40 and 60 g were randomly assigned to either a
Se-supplemented or a Se-deficient dietary group. Rats in the
Se-supplemented group were fed a Torula yeast-based diet with 0.5 mg of
Se per kg of body weight as sodium selenite
(Na2SeO3), whereas rats in the Se-deficient
group were fed an unsupplemented diet (40). Animals, housed
four per cage and subjected to a cycle of 12 h of light and 12 h
of dark, were fed ad libitum and provided with double-distilled drinking water for the 9- to 13-week experimental period.
Hepatocyte isolation.
Hepatocytes were isolated from rat
liver according to the procedure outlined by Seglen (44) and
Boyer et al. (11), as modified by our laboratory. Animals
weighing between 350 and 440 g were anesthetized, their superior
venae cavae were ligated just below their hearts, their inferior venae
cavae were cannulated just above their renal veins with a 16-gauge
needle, and their portal veins were cut to allow the exit of perfusate.
Their livers were perfused in situ for 10 min at an approximate flow
rate of 40 ml per min with calcium-free and magnesium-free Hanks
balanced salt solution (Life Technologies) supplemented with 25 mM
sodium bicarbonate and 0.5 mM EGTA. Perfusion was continued at the same flow rate with Hanks balanced salt solution containing 1.2 mM calcium
and 0.93 mM magnesium and supplemented with 25 mM sodium bicarbonate
and 0.5% type I or type IV collagenase (Sigma). Prior to perfusion,
100% oxygen was bubbled through bottles of both Hanks buffers for 15 min in a 37°C water bath. Following perfusion, the livers were placed
in ice-cold Dulbecco's modified Eagle's medium (DMEM; Life
Technologies) supplemented with 10% heat-inactivated fetal calf serum
(Hyclone Laboratories) and teased apart with forceps to create a single
cell suspension. Cells were filtered through two layers of gauze and
pelleted at 500 rpm for 2 min at 4°C. The cell pellet was washed
twice with serum-free DMEM and suspended in DMEM. Cell viability was
determined by exclusion of 0.4% trypan blue (Sigma) to be ~70%. Of
the ~2.8 × 108 cells obtained per liver, evaluation
by light microscopy indicated that ~95% were hepatocytes. Cells were
pelleted and either used to isolate nuclear and cytoplasmic RNAs or
frozen at
80°C for later measurements of Se-GPx1 activity and
purification of total RNA.
Plasmid DNAs.
In order to generate pmCMV-GPx1, a plasmid
carrying the rat Se-GPx1 gene driven by the mouse cytomegalovirus
(mCMV) promoter, the 1,485-bp XbaI-NspI fragment
from pKS-rGPx (25) was inserted into the SacI and
XbaI sites of pUC19. Prior to insertion, the SacI
and NspI sites were made blunt with Klenow fragment and
deoxynucleoside triphosphates. Subsequently, the 538-bp
XbaI-EcoRI fragment from pMH4 (a gift from Jack
Gauldie, McMaster University) that harbors the mCMV promoter was
inserted upstream of the Se-GPx1 gene at the XbaI and
MboII sites. Prior to insertion, the EcoRI and
MboII sites were made blunt.
Overlap-extension PCR (24) was used to convert the
Sec-encoding TGA codon at position 46 within exon 1 to either a TGC
codon for cysteine (Cys) or a TAA termination codon. In order to create the TGC Cys codon, two overlapping fragments were generated from pGPx1211 (37). A 214-bp fragment was generated with the
flanking sense oligonucleotide 5'
GTCCAATATCTTCAAGCTTATGTCTGCTGCTCGG 3', which corresponds to 19 bp
of 5' untranslated sequences (which was mutagenized to harbor an
HindIII site for purposes unrelated to and not affecting
this work) plus codons 0 through 4, and the mutagenic antisense
oligonucleotide 5' CGTGGTGCCGCAGAGGGACGC 3', which corresponds to codons 43 through 49 and harbors the
italicized mutagenic nucleotide. An overlapping 706-bp fragment was
generated with the mutagenic sense oligonucleotide 5'
GCGTCCCTCTGCGGCACCACG 3', which corresponds to codons
43 through 49, and the flanking antisense oligonucleotide 5'
CAAAAACGTGCCCATCTAGACACGGAATTCC 3', which
corresponds to bp 851 through 881 of the 3' untranslated region.
In order to generate full-length cDNA of 854 bp harboring the
TGC Cys codon, the two PCR products were mixed and subjected to a
second PCR with both flanking oligonucleotides. The 129-bp SacII-XmaI fragment harboring the Cys codon was
then inserted into the SacII and XmaI sites of
pmCMV-GPx1, creating pmCMV-GPx1-TGC(46). A similar approach was used to
create cDNA harboring the TAA codon. A 262-bp fragment was
generated with the sense flanking oligonucleotide 5'
GAGCTGCGTTCTACGTGGG 3', which corresponds to nucleotides within the mCMV promoter, and the antisense mutagenic oligonucleotide 5'
GGGTCGTGGTGCCTTAGAGGG 3', which corresponds to codons
44 through 51. An overlapping 556-bp fragment was generated with
the sense mutagenic oligonucleotide 5' CCCTCTAAGGCACCACGACCC 3',
which corresponds to codons 44 through 51, and the antisense
flanking oligonucleotide 5' ATGTCGTTGCGGCACACCGGG 3',
which corresponds to codons 150 through 157. A 217-bp
KpnI-SmaI fragment containing the TAA mutation
was inserted into the KpnI and SmaI sites
of pmCMV-GPx1 to create pmCMV-GPx1-TAA(46). The integrity of all
three clones [pmCMV-GPx1, pmCMV-GPx1-TAA(46), and
pmCMV-GPx1-TGC(46)] was verified by DNA sequencing.
pmCMV-GPx1-TAA(46) harbored an additional mutation within codon 15 (TAT
TGT) that likely arose during the PCR.
In order to generate an intronless pmCMV-GPx1, the 457-bp
XmaI-
DraIII fragment that extends from exon 1 into exon 2 was excised
from pmCMV-GPx1 and replaced with the
corresponding 251-bp
XmaI-
DraIII
fragment from
pGPx1211.
Cell transfections.
Both NIH 3T3 cells and L cells were
maintained in minimal essential medium (Life Technologies) containing
5% calf serum and 10% fetal calf serum. NIH 3T3 cells
(107 cells/15-cm-diameter dish, 40 to 50% confluency) were
transiently transfected with the pmCMV-GPx1 test plasmid (25 µg) and
the pmCMV-G1 reference plasmid (25 µg) (34) with calcium
phosphate (50). After 12 h, cells were washed twice
with phosphate-buffered saline and cultured in either serum-free medium
or serum-free medium supplemented with 50 ng of selenous acid per ml
(26). Serum-free medium consisted of a 1:1 (vol/vol) mixture
of Ham's F-12 (Life Technologies) and DMEM plus 25 µg of bovine
holo-transferrin per ml, 10 µg of bovine insulin per ml, 10 ng of
mouse epidermal growth factor per ml, and 25 µg of human high-density
lipoprotein per ml (17). Cells were harvested after another
48 h.
Se-GPx1 enzyme activity and protein assay.
Hepatocytes, L
cells and NIH 3T3 cells were suspended in glutathione peroxidase
homogenization buffer (25 mM sucrose, 10 mM potassium phosphate, 1 mM
EDTA, 2 mM glutathione [pH 7.4]) and lysed by sonication (Branson
model 450 sonifier) at 4°C with two 30-s pulses at a power setting of
2. Cell lysates were centrifuged at 25,000 × g for 30 min at 4°C, and protein concentration was measured
spectrophotometrically by a protein dye-binding assay (Bio-Rad) with
bovine serum albumin as a standard. Se-GPx1 activity was measured
spectrophotometrically by the procedure as modified by Reddy et al.
(41) of coupling the reduction of
H2O2 by glutathione to the oxidation of NADPH
with glutathione reductase (36). A molar extinction
coefficient of 6,200 M
1 cm
1 for NADPH was
used in the calculation. One unit of enzyme activity was defined as 1 µM NADPH oxidized min
1 mg of protein
1.
RNA isolation, Northern hybridization, and RT-PCR analyses.
Hepatocytes and NIH 3T3 cells were separated into nuclear and
cytoplasmic fractions (method 1 [4]). Cytoplasmic RNA
was purified by CsCl gradient centrifugation (4), and
nuclear RNA was purified with Trizol reagent (Life Technologies). For
reverse transcriptase PCR (RT-PCR), RNA (25 µg) was treated with RQ1
DNase (1 U; Promega Corp.) in DNase buffer (40 mM Tris-HCl [pH 7.9], 10 mM NaCl, 6 mM MgCl2, 10 mM CaCl2) for 1 h at 37°C. Alternatively, total RNA was isolated with Trizol reagent.
For Northern hybridization, RNA (25 µg) was denatured with glyoxal,
electrophoresed in a 1.5% agarose gel, and transferred
to a nylon
membrane (Zetabind). The membrane was hybridized (
16)
to two
fragments: (i) a 311-bp
EcoRI-
EcoRI fragment that
derives
from pGPx1211 (
38) and that includes 44 bp of the 5'
untranslated
region and 267 bp of the translated region of Se-GPx1
cDNA and
(ii) a 428-bp fragment of the cytoplasmic

-actin
translated region
that was generated by RT-PCR with hepatocyte RNA and
two primers
(5' CACTGGCATTGTGATGGA 3' [sense] and 5'
ACGGATGTCAACGTCACA 3'
[antisense] [
21]). Prior
to hybridization, each fragment was
32P labeled by random
priming (Promega). Quantitative analysis was
performed with a
PhosphorImager and ImageQuant software (Molecular
Dynamics).
For all RT-PCRs (
16), cDNA was synthesized from 0.16 to
5.0 µg of total, nuclear, or cytoplasmic RNA with RT (Superscript;
GIBCO) and random hexamers (Promega). Se-GPx1 and

-actin cDNAs
that derived from rat hepatocyte RNA were amplified in separate
tubes.
Each PCR mixture contained 1/20 of the RT reaction mixture,
0.12 mM
each deoxynucleotide (
n = 4), 4 µCi of
[

-
32P]dATP (3,000 Ci/mmol; Amersham), 0.5 µM
each primer (
n = 2),
and 2.5 U of
Taq DNA
polymerase (Promega). To amplify

-actin
RNA, the primers consisted
of 5' CACTGGCATTGTGATGGA 3' (sense)
and 5'
ACGGATGTCAACGTCACA 3' (antisense) and amplification was
for 21 cycles. To amplify Se-GPx1 RNA, the primers consisted of
5'
ATGTCTGCTGCTCGGCTCTCCGCGG 3' (sense) and 5'
CTTCFTCACCATTCACCTCGCCTT
3' (antisense) and amplification was for
32 cycles. mCMV-GPx1
and mCMV-G1 cDNAs from transfected NIH
3T3 cells were amplified
in 19 cycles with a sense primer, 5'
ACCACCGTAGAACGCAGATCG 3',
that corresponds to the common
mCMV promoter region. The antisense
primer used to amplify
mCMV-GPx1 cDNA, 5' CTTCTCACCATTCACCTCGCACTT
3',
corresponds to Se-GPx1 exon 2. The antisense primer used to
amplify mCMV-G1 cDNA, 5' CGGGGTGAAGCTCCTTGCCAAG 3',
corresponds
to exon 3 of the human

-globin gene
(
16). Notably, Se-GPx1
cDNA that derived from the
endogenous NIH 3T3 cell gene was not
amplified. For all PCRs, each
cycle consisted of denaturation
at 94°C for 75 s, annealing at
55°C for 40 s, and extension at
72°C for 40 s. One-tenth
of each PCR mixture was electrophoresed
in a 4% polyacrylamide gel,
and RT-PCR products were quantitated
by PhosphorImaging.
 |
RESULTS |
Se deprivation has no effect on the abundance of nuclear Se-GPx1
pre-mRNA or nuclear Se-GPx1 mRNA but reduces the abundance of
cytoplasmic Se-GPx1 mRNA in rat liver.
One way to determine if
Se regulates the level of rat Se-GPx1 mRNA through the UGA codon or
if regulation also takes place independently of Sec incorporation is to
analyze the expression of Se-GPx1 alleles harboring a mutated TGA
codon. This might be accomplished by transfecting cultured cells with
normal and mutated rat Se-GPx1 alleles, provided the exogenous
TGA-containing allele is regulated like the endogenous Se-GPx1 gene of
the intact animal. As a start, the metabolism of Se-GPx1 RNA in the
livers of rats fed either a Se-supplemented or a Se-deficient diet for
10 to 13 weeks was evaluated. Liver was chosen because it has the
highest level of Se-GPx1 activity of any tissue that has been
analyzed (2) and retains Se only inefficiently during Se
deprivation (3, 12). Furthermore, a sufficient number
of a single type of cell can be isolated from one animal, since one
liver routinely yields ~2.8 × 108 cells,
~95% of which are hepatocytes.
Hepatocytes from three individually analyzed rats fed a Se-deficient
diet had an average of only ~2% of the Se-GPx1 activity
and ~5%
of the level of Se-GPx1 mRNA of hepatocytes from three
individually
analyzed rats fed a Se-supplemented diet (Fig.
1),
consistent with Se-GPx1 activity and
mRNA measurements of rat
liver made by others (
18,
23,
28,
43). For RNA quantitation,
Northern blot analysis was used to
normalize the level of Se-GPx1
mRNA to the level of

-actin
mRNA, which is Se unresponsive, to
control for variations in levels
of RNA loaded between samples.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
Hepatocytes from rats fed a Se-supplemented diet for 12 weeks have 2% of the Se-GPx1 activity and 5% of the level of Se-GPx1
mRNA of hepatocytes from rats fed a Se-supplemented diet for the
same amount of time. Rats were analyzed in pairs in which one was fed a
Se-supplemented diet and the other was fed a Se-deficient diet, and the
periods of feeding for both members of the pair were the same.
Hepatocytes were isolated according to the methods of Seglen
(44) and Boyer et al. (11), as modified by us
(see Materials and Methods). (A) Se-GPx1 activity was measured
according to the method of Paglia and Valentine (36), as
modified by Reddy et al. (39). Hepatocytes from three
different animals per dietary group were analyzed, and duplicate
measurements were taken for each animal. Measurements are presented as
means ± standard deviations. (B) Total hepatocyte RNA (25 µg)
was electrophoresed in agarose, transferred to a nylon membrane, and
hybridized to a 311-bp EcoRI-EcoRI fragment of
Se-GPx1 cDNA (38) and a 428-bp fragment, generated by
RT-PCR, that consists of the open reading frame of cytoplasmic
-actin cDNA. Lanes marked with a minus sign contain RNAs isolated
from three different animals fed a Se-deficient diet. Lanes marked with
a plus sign contain RNAs isolated from three different animals fed a
Se-supplemented diet. The level of Se-GPx1 mRNA was normalized to
the level of -actin mRNA in order to control for variations in
the amounts of RNAs loaded in lanes. The normalized value for each rat
fed a Se-supplemented diet (+Se) was considered to be 100%, and the
normalized value for the corresponding rat fed a Se-deficient diet was
calculated as a percentage of that of the rat fed a Se-supplemented
diet.
|
|
While Se deficiency has been shown to have no effect on the level of
Se-GPx1 gene transcription (
6,
13,
14,
18,
46),
the
consequence of Se deficiency on the processing of nuclear
Se-GPx1
pre-mRNA or nuclear mRNA has never been successfully evaluated
because of detection difficulties (
18). Therefore,
RT-PCR, which
is a more sensitive assay than Northern hybridization,
was used
to determine if the reduction in Se-GPx1 mRNA abundance
brought
about by Se deficiency takes place in the nuclear fraction, the
cytoplasmic fraction, or both. cDNA was made from each RNA fraction
with random hexamers. Specific pairs of primers were subsequently
used to amplify exon 1 through exon 2 of Se-GPx1 cDNA and, as
a
control, exon 1 through exon 2 of

-actin cDNA, i.e., the first
through the last exon of each cDNA. Conditions were empirically
established to provide a linear relationship between the amount
of each
RT-PCR product and the amount of input RNA, as evidenced
by an analysis
of serial dilutions of cytoplasmic RNA (Fig.
2).
In agreement with the results of
Northern hybridization (Fig.
1B), Se deficiency in two individually
analyzed rats reduced the
abundance of cytoplasmic Se-GPx1 mRNA to
~3% of the level observed
for rats fed a Se-supplemented diet (Fig.
2; Table
1). Notably,
Se deficiency had no effect
on the level of either nuclear Se-GPx1
pre-mRNA or nuclear Se-GPx1
mRNA, which, respectively, comprised
averages of 9 and 29% of the
level of cytoplasmic Se-GPx1 mRNA
in Se-fed rats (Fig.
2;
Table
1). By evaluating the data another
way, the ratio of
nuclear Se-GPx1 mRNA to nuclear Se-GPx1 pre-mRNA
was
unaffected by Se while the ratio of cytoplasmic Se-GPx1 mRNA
to
nuclear Se-GPx1 mRNA in Se-deficient rats was 3 to 4% of the
ratio
in Se-fed rats (Table
1). Together with demonstrations
with actinomycin
D that Se deficiency decreases the stability
of Se-GPx1 mRNA in
total RNA (
5), these data indicate that
Se deficiency
reduces the half-life of cytoplasmic Se-GPx1 mRNA
without affecting
the metabolism of nuclear RNA.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 2.
The reduced level of Se-GPx1 mRNA in Se-deficient
hepatocytes is due to a decrease in the level of cytoplasmic Se-GPx1
mRNA but not nuclear Se-GPx1 mRNA. Nuclear (N) and cytoplasmic
(C) RNA was isolated (method 1 [4]) from hepatocytes
of each pair of rats fed either a Se-deficient ( ) or a
Se-supplemented (+) diet. Se-GPx1 and -actin RNAs in each sample
were analyzed by RT-PCR. The left-most four lanes consist of serial
dilutions of cytoplasmic RNA (5.0, 1.3, 0.6, and 0.3 µg, from left to
right), which were used to establish that there is a linear
relationship between the amount of input RNA and the amount of each
RT-PCR product. Size standards for RT-PCR products of Se-GPx1
pre-mRNA and Se-GPx1 mRNA were provided by the PCR
amplification of, respectively, 25 pg of pmCMV-GPx1 (Se-GPx1 gene) and
25 pg of pGPx1211 (Se-GPx1 cDNA) with the same primers that were
used to amplify hepatocyte cDNA.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Incubating either L cells or NIH 3T3 cells in
Se-deficient medium for 24, 48, or 72 h decreases Se-GPx1 activity
to 50 to 55% of the activity of Se-supplemented cells. Activity was
measured according to the method of Paglia and Valentine
(36), as modified by Reddy et al. (39). Each cell
line was mock transfected with either DEAE dextran (L cells) or calcium
phosphate (NIH 3T3 cells) and incubated for an additional 12 h
before the medium was changed to either Se-deficient ( ) or
Se-supplemented (+) medium. Se-GPx1 activities are presented as the
means of duplicate measurements for each time point.
|
|
The rat Se-GPx1 gene, when transiently expressed in NIH 3T3 cells,
is qualitatively regulated by Se as it is in rat liver.
Having
concluded that Se deficiency reduces the abundance of cytoplasmic but
not nuclear Se-GPx1 mRNA in intact animals, we wanted to determine
if Se deficiency does the same when the Se-GPx1 gene is transiently
expressed in cultured cells. If it does, there would be a way of
testing the effects of mutations within the TGA codon on Se-GPx1 gene
expression. Mouse L and mouse NIH 3T3 cells were chosen for their
superior transfection efficiencies, our ability to distinguish rat and
mouse Se-GPx1 RNAs by RT-PCR, and there being no appreciable difference
between cultured liver cells and cultured fibroblasts (or any other
cultured cell type evaluated) in the extents to which Se deficiency
reduces Se-GPx1 mRNA abundance (1, 13, 19, 23, 49).
First, in order to determine the rate of decline in Se-GPx1 activity
after Se deprivation, cells were mock transfected and
transferred
12 h later to Se-deficient medium. After 24 h in Se-deficient
medium, Se-GPx1 activity in L cells had decreased to 51% of the
activity in L cells grown in Se-supplemented medium (Fig.
3).
This
decrease was not significantly different from the decreases
observed
after 48 and 72 h in Se-deficient medium (Fig.
3). Similarly,
the
activity in NIH 3T3 cells after 48 h in Se-deficient medium
was
55% of the activity in NIH 3T3 cells grown in Se-supplemented
medium
(Fig.
3). These data resemble data from the time-dependent
decline in
Se-GPx1 activity observed for other cultured cells
grown in
Se-deficient medium (
1,
5,
23).
Northern hybridization with total RNA revealed that the level of
endogenous Se-GPx1 mRNA in Se-deficient NIH 3T3 cells was
reduced
by only 31% compared to the level in Se-supplemented NIH
3T3 cells
(data not shown). The level in Se-deficient cells was
not expected to
be further reduced with a longer period of Se
deficiency, since Se
deprivation of cultured HepG2 or H4IIIE cells
for 4 days yielded only a
two- to threefold decrease in the level
of endogenous Se-GPx1 mRNA
(
23). Furthermore, Se deprivation
of cultured HL-60 cells
for as long as 20 days yielded only a
1.2- to 2.3-fold decrease in the
level of endogenous Se-GPx1 mRNA
(
13), and the
analysis of CHO cells that had been stably transfected
with
Se-GPx1 cDNAs and Se deprived for 7 days yielded less than
a 2-fold
decrease in the level of exogenous Se-GPx1 mRNA (
49).
According to these data, stable transfections offer no advantage
over
transient transfections in achieving a larger effect of Se
deprivation
on Se-GPx1 mRNA abundance. The greater extent to which
Se
deprivation mediates a reduction in the abundance of Se-GPx1
mRNA
in the liver cells of animals relative to that in cultured
cells may
reflect a difference in mechanism. However, data suggest
that the
variation in extents may be limited to a quantitative
difference rather
than a mechanistic difference since the cellular
compartment of the
reduction and the molecule targeted for reduction
are the same in liver
cells and cultured cells (see below). Since
our extensive experience
with RT-PCR (see references
4,
16,
and
51) has proven the technique to be sufficiently
sensitive
and accurate to measure twofold differences in levels of RNA
between
samples, we reasoned that the transient transfection of either
NIH 3T3 or L cells would provide a suitable means to study changes
in
Se-GPx1 mRNA concentration in response to Se nutrition.
NIH 3T3 cells were transiently transfected with a test plasmid,
pmCMV-GPx1, which harbors a rat Se-GPx1 allele driven by the
mCMV
promoter (Fig.
4A), and a reference
plasmid, pmCMV-G1 (
52),
which harbors a

-globin allele
similarly driven by the mCMV promoter.
RNA produced from the reference
plasmid was used to control for
variations in the efficiencies of cell
transfection and RNA recovery.
Twelve hours after transfection, cells
were placed in either Se-deficient
or Se-supplemented medium, and after
an additional 48 h, either
total or nuclear and cytoplasmic RNA
was isolated. RT-PCR was
used to quantitate the levels of
plasmid-derived Se-GPx1 and

-globin
RNAs in a way that did not
detect NIH 3T3 cell transcripts.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Structures of the mCMV-GPx1 gene and derivative
alleles. The shaded box represents the 550-bp
XbaI-EcoRI fragment that harbors the mCMV
promoter. The open boxes represent exons, the intervening line
represents the single 216-bp intron, and the right-most line represents
3' flanking DNA. ATG(0), TGA(46), and TAA(201) represent,
respectively, the initiation codon, Sec codon, and termination codon.
Mutations that convert the Sec codon to either a Cys codon (TGC) or a
premature termination codon (TAA) are indicated below the gene
structure. (B) The level of mCMV-GPx1 mRNA in total RNA of NIH 3T3
cells grown in Se-deficient medium ( ) is 50% of the level in NIH 3T3
cells grown in Se-supplemented (+) medium. Cells were either
untransfected or transiently transfected with pmCMV-GPx1
(25 µg) and the reference plasmid pmCMV-G1 (25 µg). Total
RNA was isolated, and RT-PCR was used to quantitate mCMV-GPx1 and
mCMV-G1 mRNAs. The left-most five lanes contain twofold serial
dilutions of RNA from Se-supplemented cells in order to demonstrate a
linear relationship between the amounts of input RNA and RT-PCR
products. The level of mCMV-GPx1 mRNA was normalized to the level
of mCMV-G1 mRNA. The normalized value for mCMV-GPx1 mRNA in
Se-deficient cells was then calculated as a percentage of the
normalized value for mCMV-GPx1 mRNA in Se-supplemented
cells, which was considered to be 100%. The values from two
independently performed experiments did not differ by more than 3%.
(C) The ratio of cytoplasmic mCMV-GPx1 mRNA to nuclear mCMV-GPx1
mRNA is decreased in Se-deficient NIH 3T3 cells by a decay pathway
that is dependent on recognition of the Sec codon as a termination
codon. Transfections and analyses of RNA were as described in the
legend to Fig. 4B, except that nuclear and cytoplasmic RNAs were
purified and analyzed as described in the legend to Fig. 2. The
left-most four lanes contain twofold dilutions of cytoplasmic RNA from
Se-supplemented NIH 3T3 cells transiently transfected with
pmCMV-GPx1-TGC(46). GPx1, GPx1-TAA(46), and GPx1-TGC(46)
signify pmCMV-GPx1 plasmids harboring at position 46 the wild-type
sequence (TGA), a nonsense codon (TAA), and a Cys codon (TGC),
respectively. The two right-most lanes, which reflect PCR
analyses of intronless pmCMV-GPx1 DNA and pmCMV-GPx1 DNA,
provide molecular weight standards for pre-mRNA and mRNA,
respectively.
|
|
As anticipated, Se deficiency reduced the level of Se-GPx1 mRNA in
total RNA to 50% of the level observed under Se-supplemented
conditions (Fig.
4B). By analyzing nuclear and cytoplasmic RNA,
this
reduction was found to be characteristic of cytoplasmic but
not nuclear
Se-GPx1 mRNA: Se deprivation reduced the ratio of
cytoplasmic to
nuclear Se-GPx1 mRNA to 52% of the ratio observed
under
conditions of Se supplementation but had no effect on the
ratio
of nuclear Se-GPx1 mRNA to nuclear Se-GPx1 pre-mRNA (Fig.
4C;
Table
2). Therefore, the transient
expression of pmCMV-GPx1
in Se-deficient NIH 3T3 cells results in the
production of an
abnormally low level of cytoplasmic but not nuclear
Se-GPx1 mRNA,
as does Se deficiency induced in the livers of rats
fed a Se-deficient
diet. This finding suggests, but does not prove,
that the difference
in the extent to which Se deficiency affects the
level of Se-GPx1
mRNA in the cells of animals and in cultured cells
is quantitative
rather than mechanistic.
Se regulates Se-GPx1 gene expression through the Sec TGA
codon.
Conceivably, Se deficiency reduces the abundance of
cytoplasmic Se-GPx1 mRNA by more than one mechanism. For example,
some investigators have hypothesized the binding of one or more
Se-regulated proteins to a sequence within Se-GPx1 RNA that
stabilizes the RNA (48, 49). As another example, our
interest in the nonsense-codon-mediated decay of mRNA has led
us to propose that Se deficiency destabilizes Se-GPx1 mRNA by
evoking the premature termination of translation at the UGA(46)
codon. Se deficiency has been shown to reduce the levels of both
selenocysteine tRNA[Ser]Sec isoacceptors (20,
22), which is likely to reduce the efficiency of Sec insertion
into position 46 of the growing Se-GPx1 polypeptide chain.
In order to determine if Se-GPx1 mRNA is susceptible to
nonsense-codon-mediated decay, the TGA(46) codon within pmCMV-GPx1
was changed to either a TAA nonsense codon or a TGC Cys codon
(Fig.
4A). Each change would eliminate the sensitivity of Se-GPx1
mRNA to Se if the TGA codon is required for Se sensitivity. NIH
3T3
cells were transiently transfected with each pmCMV-GPx1 plasmid
together with the reference pmCMV-G1 plasmid, and gene expression
was quantitated by RT-PCR after cell growth in Se-deficient or
Se-supplemented medium. Results indicate that neither the
TAA-containing
allele nor the TGC-containing allele is sensitive to Se:
neither
the ratio of nuclear Se-GPx1 mRNA to nuclear Se-GPx1
pre-mRNA
nor the ratio of cytoplasmic Se-GPx1 mRNA to
nuclear Se-GPx1 mRNA
was affected by a change in Se concentration
(Fig.
4C; Table
2).
Therefore, Se regulates Se-GPx1 gene expression in
a mechanism
that is dependent on the TGA codon. For reasons not
understood,
the level of Se-GPx1 pre-mRNA was highest for the
TGC-containing
allele and lowest for the TAA-containing allele
(Fig.
4C; Table
2), even though the TGC-containing and
TAA-containing alleles
were generated from the TGA-containing
allele simply by swapping
the appropriate 129-bp fragment.
This variation, however, is unaffected
by Se and not
relevant to our studies.
Evidence that the Sec codon reduces the abundance of
cytoplasmic Se-GPx1 mRNA by eliciting nonsense-codon-mediated
mRNA in the cytoplasm.
Relative to results with the
TGA-containing allele expressed under Se-deficient conditions,
the TAA-containing allele produced a 1.7-fold-lower ratio of
cytoplasmic to nuclear Se-GPx1 mRNA and the TGC-containing allele
produced a 3-fold-higher ratio of cytoplasmic to nuclear Se-GPx1
mRNA (Fig. 4C; Table 2). These findings suggest that the premature
termination of translation at position 46 mediates the decay of
cytoplasmic Se-GPx1 mRNA, whether the codon is a UGA codon in
Se-deficient cells or a UAA codon in either Se-deficient or
Se-supplemented cells. mRNA from the TAA-containing allele,
regardless of the Se concentration, is degraded more efficiently
than mRNA from the TGA-containing allele under Se-deficient
conditions. This result indicates that the UAA codon mediates
translation termination more efficiently than the UGA codon even when
cells are incubated in Se-deficient medium, suggesting that
the cells are never completely depleted of Se.
 |
DISCUSSION |
Our results indicate that the responsiveness of the Se-GPx1 gene
to Se deprivation is (i) dependent on the efficiency with which the TGA
codon at position 46 mediates the incorporation of Sec and (ii) likely
attributable to the nonsense-codon-mediated decay of cytoplasmic
Se-GPx1 mRNA. First, liver cells of rats fed a Se-deficient diet,
like Se-deficient cultured cells that transiently express the rat
Se-GPx1 gene, are characterized by an abnormally low cytoplasmic level
of rat Se-GPx1 mRNA that is not attributable to alterations in the
metabolism of nuclear RNA (Fig. 1B and 4B; Table 1). Second, changing
the TGA codon to either a TAA nonsense codon or a TGC Cys codon makes
the Se-GPx1 gene insensitive to Se concentration (Fig. 4; Table 2). The
efficiency with which cytoplasmic Se-GPx1 mRNA is degraded in
Se-deficient medium is highest for the TAA-containing allele,
intermediate for the TGA-containing allele, and lowest for the
TGC-containing allele (Fig. 4C; Table 2). These data suggest that,
even in Se-deficient medium, there may be some incorporation of Sec at
the UGA codon that abrogates nonsense-codon-mediated mRNA decay.
Consistent with data indicating that incorporation of Sec at the UGA
codons of mammalian selenoprotein mRNAs is less than 100% under
Se-supplemented conditions (8, 9), the ratio of cytoplasmic
to nuclear Se-GPx1 mRNA is 1.5-fold higher for mRNA
harboring the UGC codon than for mRNA harboring the UGA codon under
Se-supplemented conditions (Fig. 4C; Table 2). Therefore, it appears
that a fraction of cytoplasmic Se-GPx1 mRNA harboring the
UGA codon, even under Se-supplemented conditions, is subject
to nonsense-codon-mediated decay. It is currently not known
how the efficiency of UGA-mediated translation termination correlates
with the efficiency of UGA-mediated mRNA decay.
Interestingly, not all selenoprotein mRNAs are reduced in abundance
when the Se concentration is reduced. As an example, mRNA for PHGPx
essentially escapes reduction (6). It follows that mRNA
sequences residing outside of a UGA codon for Sec must determine whether the codon will mediate a reduction in mRNA abundance.
The mechanism by which nonsense codons mediate a reduction in mRNA
abundance is a topic of considerable controversy, with some
investigators proposing that nonsense codons can influence pre-mRNA splicing (reviewed in references 32 and
33). With regard to instances in which fully spliced
mRNA is the target of decay, decay may take place (i) in
association with nuclei, presumably, but not certainly, during the
process of mRNA export from the nucleus to the cytoplasm, or (ii)
in the cytoplasm (reviewed in references 32 and
33). To date, it is not possible to predict where a
particular mRNA will be degraded other than by noting that most
mammalian cell mRNAs that have been studied are degraded in
association with nuclei. Therefore, studies of Se-GPx1 mRNA decay
add to our understanding of the under-represented type of mRNA that
is degraded in the cytoplasm.
The analyses of insertions and deletions within mRNAs for
triosephosphate isomerase and
-globin indicate that nonsense codons located more than ~50 nucleotides upstream of the final exon-exon junction reduce mRNA abundance but that those residing closer to
the junction or downstream of the junction have no effect on mRNA
abundance (15, 52, 53). A priori, there is no reason why
this criterion could not be used to predict whether a Sec codon
mediates Se-GPx1 mRNA decay when it is inefficiently utilized. The
TGA codon within the Se-GPx1 gene resides 105 bp upstream of the sole
intron (25), consistent with indications from our research
that Se-GPx1 mRNA is susceptible to nonsense-codon-mediated decay.
Furthermore, deletion of the intron eliminates decay (35), which is also consistent with what we know about
nonsense-codon-mediated decay (52).
While the simplest interpretation of our data is that the UGA codon of
Se-GPx1 mRNA mediates mRNA decay by the same mechanism as the
UAA codon, this, in fact, may not be true. Our data, combined with data
of Weiss and Sunde (49), demonstrate that the UGA codon and
the 3' untranslated region are required for the reduction in Se-GPx1
mRNA abundance brought about by Se deprivation. While it is quite
possible that the interplay between the codon and the 3' untranslated
region is solely a means for Sec incorporation, our data do not rule
out the proposal by Weiss and Sunde (49) that Se-GPx1
mRNA is also directly protected from cytoplasmic decay by the
formation of an Se-dependent RNA binding complex that depends on the
presence of the UGA codon but involves sequences within the 3'
untranslated region. Future studies will examine the finer points
of the mechanism by which the UGA codon mediates a reduction in
the abundance of Se-GPx1 mRNA.
 |
ACKNOWLEDGMENTS |
We thank Jing Zhang, Yimei Qian, and Gerry Jahries for advice and
Donna Ovak for typing the manuscript.
This work was supported by Public Health Service research grant GM52822
to L.E.M. from the National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Human Genetics, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263. Phone: (716) 845-3325. Fax: (716) 845-8449. E-mail:
Maquat{at}sc3101.med.buffalo.edu.
 |
REFERENCES |
| 1.
|
Baker, R. D.,
S. S. Baker,
K. LaRosa,
C. Whitney, and P. E. Newburger.
1993.
Selenium regulation of glutathione peroxidase in human hepatoma cell line Hep3B.
Arch. Biochem. Biophys.
304:53-57[Medline].
|
| 2.
|
Behne, D., and W. Wolters.
1983.
Distribution of selenium and glutathione peroxidase in the rat.
J. Nutr.
113:456-461.
|
| 3.
|
Behne, D.,
H. Hilmert,
S. Scheid,
H. Gessner, and W. Elger.
1988.
Evidence for specific selenium target tissues and new biologically important selenoproteins.
Biochim. Biophys. Acta
966:12-21[Medline].
|
| 4.
|
Belgrader, P.,
J. Cheng,
X. Zhou,
L. S. Stephenson, and L. E. Maquat.
1994.
Mammalian nonsense codons can be cis-effectors of nuclear mRNA half-life.
Mol. Cell. Biol.
14:8219-8228[Abstract/Free Full Text].
|
| 5.
|
Bermano, G.,
J. R. Arthur, and J. E. Hesketh.
1996.
Selective control of cytosolic glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase mRNA stability by selenium supply.
FEBS Lett.
387:157-160[Medline].
|
| 6.
|
Bermano, G.,
F. Nicol,
J. A. Dyer,
R. A. Sunde,
G. J. Beckett,
J. R. Arthur, and J. E. Hesketh.
1995.
Tissue-specific regulation of selenoenzyme gene expression during selenium deficiency in rats.
Biochem. J.
311:425-430.
|
| 7.
|
Berry, M. J.,
L. Banu,
J. W. Harney, and P. R. Larsen.
1993.
Functional characterization of the eukaryotic SECIS elements which direct selenocysteine insertion at UGA codons.
EMBO J.
12:3315-3322[Medline].
|
| 8.
|
Berry, M. J.,
A. L. Maia,
J. D. Kieffer,
J. W. Harney, and P. R. Larsen.
1992.
Selenocysteine insertion or termination: factors affecting UGA codon fate and complementary anticodon: codon mutations.
Endrocrinology
131:1848-1852[Abstract/Free Full Text].
|
| 9.
|
Berry, M. J.,
J. W. Harney,
T. Ohama, and D. L. Hatfield.
1994.
Selenocysteine insertion or termination: factors affecting UGA codon fate and complementary anticodon:codon mutations.
Nucleic Acids Res.
22:3753-3759[Abstract/Free Full Text].
|
| 10.
|
Böck, A.,
K. Forchhammer,
J. Heider, and C. Baron.
1991.
Selenoprotein synthesis: an expansion of the genetic code.
Trends Biochem. Sci.
16:463-467[Medline].
|
| 11.
|
Boyer, J. L.,
J. M. Phillips, and J. Graf.
1990.
Preparation and specific applications of isolated hepatocyte couplets.
Methods Enzymol.
192:501-509[Medline].
|
| 12.
|
Buckman, T. D.,
M. S. Sutphin, and C. D. Eckhert.
1993.
A comparison of the effects of dietary selenium on selenoprotein expression in rat brain and liver.
Biochim. Biophys. Acta
1163:176-184[Medline].
|
| 13.
|
Chada, S.,
C. Whitney, and P. E. Newburger.
1989.
Post-transcriptional regulation of glutathione peroxidase gene expression by selenium in the HL-60 human myeloid cell line.
Blood
74:2535-2541[Abstract/Free Full Text].
|
| 14.
|
Chang, M., and C. C. Reddy.
1991.
Active transcription of the selenium-dependent glutathione peroxidase gene in selenium-deficient rats.
Biochem. Biophys. Res. Commun.
181:1431-1436[Medline].
|
| 15.
|
Cheng, J.,
P. Belgrader,
X. Zhou, and L. E. Maquat.
1994.
Introns are cis effectors of the nonsense-codon-mediated reduction in nuclear mRNA abundance.
Mol. Cell. Biol.
14:6317-6325[Abstract/Free Full Text].
|
| 16.
|
Cheng, J., and L. E. Maquat.
1993.
Nonsense codons can reduce the abundance of nuclear mRNA without affecting the abundance of pre-mRNA or half-life of cytoplasmic mRNA.
Mol. Cell. Biol.
13:1892-1902[Abstract/Free Full Text].
|
| 17.
|
Chiang, L.,
J. Silnutzer,
J. Pipas, and D. W. Barnes.
1985.
Selection of transformed cells in serum-free media.
In Vitro Cell. Dev. Biol.
21:707-712[Medline].
|
| 18.
|
Christensen, M. J., and K. W. Burgener.
1992.
Dietary selenium stabilizes glutathione peroxidase mRNA in rat liver.
J. Nutr.
122:1620-1626.
|
| 19.
|
Chu, F.-F.,
R. S. Esworthy,
S. Akman, and J. H. Doroshow.
1990.
Modulation of glutathione peroxidase expression by selenium: effect on human MCF-7 breast cancer cell transfectants expressing a cellular glutathione peroxidase cDNA and doxorubicin-resistant MCF-7 cells.
Nucleic Acids Res.
18:1531-1539[Abstract/Free Full Text].
|
| 20.
|
Diamond, A. M.,
I. S. Choi,
P. F. Crain,
T. Hashizume,
S. C. Pomerantz,
R. Cruz,
C. J. Steer,
K. E. Hill,
R. F. Burk,
J. A. McCloskey, and D. L. Hatfield.
1993.
Dietary selenium affects methylation of the Wobble nucleoside in the anticodon of selenocysteine tRNA[Ser]Sec.
J. Biol. Chem.
19:14215-14223.
|
| 21.
|
Hall, J. C., and N. G. Reddy.
1992.
Protein D is differentially expressed and regulated in the rat epididymis.
Biochem. Biophys. Res. Commun.
183:1109-1116[Medline].
|
| 22.
|
Hatfield, D.,
B. J. Lee,
L. Hampton, and A. M. Diamond.
1991.
Selenium induces changes in the selenocysteine tRNA[Ser]Sec population in mammalian cells.
Nucleic Acids Res.
19:939-943[Abstract/Free Full Text].
|
| 23.
|
Hill, K. E.,
P. R. Lyons, and R. F. Burk.
1992.
Differential regulation of rat liver selenoprotein mRNAs in selenium deficiency.
Biochem. Biophys. Res. Commun.
185:260-263[Medline].
|
| 24.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 25.
|
Ho, Y., and A. J. Howard.
1992.
Cloning and characterization of the glutathione peroxidase gene.
FEBS Lett.
301:5-9[Medline].
|
| 26.
|
Kelner, M. J.,
R. D. Bagnell,
S. F. Uglik,
M. A. Montoya, and G. T. Mullenbach.
1995.
Heterologous expression of selenium-dependent glutathione peroxidase affords cellular resistance to paraquat.
Arch. Biochem. Biophys.
323:40-46[Medline].
|
| 27.
|
Kim, I. Y., and T. C. Stadtman.
1995.
Selenophosphate synthetase: detection in extracts of rat tissues by immunoblot assay and partial purification of the enzyme from the archaean Methanococcus vannielii.
Proc. Natl. Acad. Sci. USA
92:7710-7713[Abstract/Free Full Text].
|
| 28.
|
Lei, X. G.,
J. K. Evenson,
K. M. Thompson, and R. A. Sunde.
1995.
Glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase are differentially regulated in rats by dietary selenium.
J. Nutr.
125:1438-1446.
|
| 29.
|
Lesson, A.,
A. Mehta,
R. Singh,
G. M. Chisolm, and D. M. Driscoll.
1997.
An RNA-binding protein recognizes a mammalian selenocysteine insertion sequence element required for cotranslational incorporation of selenocysteine.
Mol. Cell. Biol.
17:1977-1985[Abstract].
|
| 30.
|
Low, S. C., and M. J. Berry.
1996.
Knowing when not to stop: selenocysteine incorporation in eukaryotes.
Trends Biol. Sci.
21:203-208.
|
| 31.
|
Low, S. C.,
J. W. Harney, and M. J. Berry.
1995.
Cloning and functional characterization of human selenophosphate synthetase, an essential component of selenoprotein synthesis.
J. Biol. Chem.
270:21659-21664[Abstract/Free Full Text].
|
| 32.
|
Maquat, L. E.
1995.
When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 33.
|
Maquat, L. E.
1996.
Defects in RNA splicing and the consequence of shortened translational reading frames.
Am. J. Hum. Genet.
59:279-286[Medline].
|
| 34.
|
Martin, G. W., III,
J. W. Harney, and M. J. Berry.
1996.
Selenocysteine incorporation in eukaryotes: insights into mechanism and efficiency from sequence, structure, and spacing proximity studies of the type 1 deiodinase SECIS element.
RNA
2:171-182[Abstract].
|
| 35.
|
Moriarty, P. M.,
C. C. Reddy, and L. E. Maquat.
1997.
The presence of an intron within the rat gene for selenium-dependent glutathione peroxidase 1 is not required to protect nuclear RNA from UGA-mediated decay.
RNA
3:1369-1373[Medline].
|
| 36.
|
Paglia, D. E., and W. N. Valentine.
1967.
Studies in the quantitative and qualitative characterization of glutathione peroxidase.
J. Lab. Clin. Med.
70:158-169[Medline].
|
| 37.
|
Peltz, S. W.,
H. Feng,
E. Welch, and A. Jacobson.
1994.
Nonsense-mediated decay in yeast.
Prog. Nucleic Acid Res. Mol. Biol.
47:271-298[Medline].
|
| 38.
|
Reddy, A. P.,
B. L. Hsu,
P. S. Reddy,
N. Q. Li,
T. Kedam,
C. C. Reddy,
M. F. Tam, and C. P. D. Tu.
1988.
Expression of glutathione peroxidase 1 gene in selenium-deficient rats.
Nucleic Acids Res.
16:5561-5568.
|
| 39.
|
Reddy, A. P.,
B. L. Hsu,
P. S. Reddy,
N. Q. Li,
K. Thyagaraju,
C. C. Reddy,
M. F. Tam, and C. P. D. Tu.
1988.
Expression of glutathione peroxidase 1 gene in selenium-deficient rats.
Nucleic Acids Res.
16:5557-5568[Abstract/Free Full Text].
|
| 40.
|
Reddy, C. C.,
C. E. Thomas, and R. W. Scholz.
1985.
Xenobiotic metabolism: nutritional effects.
ACS Symp. Ser.
277:253-265.
|
| 41.
|
Reddy, C. C.,
C. P. Tu,
J. R. Burgess,
C. Y. Ho,
R. W. Scholz, and E. J. Massaro.
1981.
Evidence for the occurrence of selenium-independent glutathione peroxidase activity in rat liver microsomes.
Biochem. Biophys. Res. Commun.
101:970-978[Medline].
|
| 42.
|
Ruiz-Echevarria, M. J., and S. W. Peltz.
1996.
Utilizing the GCN4 leader region to investigate the role of the sequence determinants in nonsense-mediated mRNA decay.
EMBO J.
15:2810-2819[Medline].
|
| 43.
|
Saedi, M.,
C. G. Smith,
J. Frampton,
I. Chambers,
P. R. Harrison, and R. A. Sunde.
1988.
Effect of selenium status on mRNA levels for glutathione peroxidase in rat liver.
Biochem. Biophys. Res. Commun.
53:855-861.
|
| 44.
|
Seglen, P. O.
1973.
Preparation of rat liver cells. III. Enzymatic requirements for tissue dispersion.
Exp. Cell Res.
82:391-398[Medline].
|
| 45.
|
Toyoda, H.,
S.-I. Himeno, and N. Imura.
1989.
The regulation of glutathione peroxidase gene expression relevant to species difference and the effects of dietary selenium manipulation.
Biochim. Biophys. Acta
1008:301-308[Medline].
|
| 46.
|
Toyoda, H.,
S.-I. Himeno, and N. Imura.
1990.
Regulation of glutathione peroxidase mRNA level by dietary selenium manipulation.
Biochim. Biophys. Acta
1049:213-215[Medline].
|
| 47.
|
Vendeland, S. C.,
M. A. Beilstein,
J. Y. Yeh,
W. Ream, and P. D. Whanger.
1995.
Rat skeletal muscle selenoprotein W: cDNA clone and mRNA modulation by dietary selenium.
Proc. Natl. Acad. Sci. USA
92:8749-8753[Abstract/Free Full Text].
|
| 48.
|
Weiss, S. L.,
J. K. Evenson,
K. M. Thompson, and R. A. Sunde.
1996.
The selenium requirement for glutathione peroxidase mRNA level is half of the selenium requirement for glutathione peroxidase activity in female rats.
J. Nutr.
126:2260-2267.
|
| 49.
|
Weiss, S. L., and R. A. Sunde.
1997.
Selenium regulation of classical glutathione peroxidase expression requires the 3' untranslated region in Chinese hamster ovary cells.
J. Nutr.
127:1304-1310[Abstract/Free Full Text].
|
| 50.
|
Wigler, M.,
R. Sweet,
G. K. Sim,
B. Wold,
A. Pellicer,
E. Lacy,
T. Maniatis,
S. Silverstein, and R. Axel.
1979.
Transformation of mammalian cells with genes from procaryotes and eucaryotes.
Cell
16:777-785[Medline].
|
| 51.
|
Zhang, J., and L. E. Maquat.
1996.
Evidence that the decay of nucleus-associated nonsense mRNA for human triosephosphate isomerase involves nonsense codon recognition after splicing.
RNA
2:235-243[Abstract].
|
| 52.
| Zhang, J., X. Sun, Y. Qian, and L. E. Maquat.
At least one intron is required for nonsense-mediated decay of
triosephosphate isomerase mRNA: a possible link between nuclear
splicing and cytoplasmic translation. Submitted for publication.
|
| 53.
| Zhang, J., X. Sun, Y. Qian, and L. E. Maquat.
Intron function in the nonsense-mediated decay of -globin mRNA:
indications that nuclear splicing can influence cytoplasmic
translation. Submitted for publication.
|
Mol Cell Biol, May 1998, p. 2932-2939, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Miranda, S. G., Wang, Y. J., Purdie, N. G., Osborne, V. R., Coomber, B. L., Cant, J. P.
(2009). Selenomethionine stimulates expression of glutathione peroxidase 1 and 3 and growth of bovine mammary epithelial cells in primary culture. J DAIRY SCI
92: 2670-2683
[Abstract]
[Full Text]
-
Kobayashi, H., Matsuda, M., Fukuhara, A., Komuro, R., Shimomura, I.
(2009). Dysregulated glutathione metabolism links to impaired insulin action in adipocytes. Am. J. Physiol. Endocrinol. Metab.
296: E1326-E1334
[Abstract]
[Full Text]
-
Zhou, J.-C., Zhao, H., Li, J.-G., Xia, X.-J., Wang, K.-N., Zhang, Y.-J., Liu, Y., Zhao, Y., Lei, X. G.
(2009). Selenoprotein Gene Expression in Thyroid and Pituitary of Young Pigs Is Not Affected by Dietary Selenium Deficiency or Excess. J. Nutr.
139: 1061-1066
[Abstract]
[Full Text]
-
Barnes, K. M., Evenson, J. K., Raines, A. M., Sunde, R. A.
(2009). Transcript Analysis of the Selenoproteome Indicates That Dietary Selenium Requirements of Rats Based on Selenium-Regulated Selenoprotein mRNA Levels Are Uniformly Less Than Those Based on Glutathione Peroxidase Activity. J. Nutr.
139: 199-206
[Abstract]
[Full Text]
-
Pagmantidis, V., Meplan, C., van Schothorst, E. M, Keijer, J., Hesketh, J. E
(2008). Supplementation of healthy volunteers with nutritionally relevant amounts of selenium increases the expression of lymphocyte protein biosynthesis genes. Am. J. Clin. Nutr.
87: 181-189
[Abstract]
[Full Text]
-
Squires, J. E., Stoytchev, I., Forry, E. P., Berry, M. J.
(2007). SBP2 Binding Affinity Is a Major Determinant in Differential Selenoprotein mRNA Translation and Sensitivity to Nonsense-Mediated Decay. Mol. Cell. Biol.
27: 7848-7855
[Abstract]
[Full Text]
-
Carlson, B. A., Moustafa, M. E., Sengupta, A., Schweizer, U., Shrimali, R., Rao, M., Zhong, N., Wang, S., Feigenbaum, L., Lee, B. J., Gladyshev, V. N., Hatfield, D. L.
(2007). Selective Restoration of the Selenoprotein Population in a Mouse Hepatocyte Selenoproteinless Background with Different Mutant Selenocysteine tRNAs Lacking Um34. J. Biol. Chem.
282: 32591-32602
[Abstract]
[Full Text]
-
Durand, S., Cougot, N., Mahuteau-Betzer, F., Nguyen, C.-H., Grierson, D. S., Bertrand, E., Tazi, J., Lejeune, F.
(2007). Inhibition of nonsense-mediated mRNA decay (NMD) by a new chemical molecule reveals the dynamic of NMD factors in P-bodies. JCB
178: 1145-1160
[Abstract]
[Full Text]
-
Isken, O., Maquat, L. E.
(2007). Quality control of eukaryotic mRNA: safeguarding cells from abnormal mRNA function. Genes Dev.
21: 1833-3856
[Abstract]
[Full Text]
-
Hoffmann, P. R., Hoge, S. C., Li, P.-A., Hoffmann, F. W., Hashimoto, A. C., Berry, M. J.
(2007). The selenoproteome exhibits widely varying, tissue-specific dependence on selenoprotein P for selenium supply. Nucleic Acids Res
35: 3963-3973
[Abstract]
[Full Text]
-
Jacobs, J. L., Belew, A. T., Rakauskaite, R., Dinman, J. D.
(2007). Identification of functional, endogenous programmed -1 ribosomal frameshift signals in the genome of Saccharomyces cerevisiae. Nucleic Acids Res
35: 165-174
[Abstract]
[Full Text]
-
de Jesus, L. A., Hoffmann, P. R., Michaud, T., Forry, E. P., Small-Howard, A., Stillwell, R. J., Morozova, N., Harney, J. W., Berry, M. J.
(2006). Nuclear Assembly of UGA Decoding Complexes on Selenoprotein mRNAs: a Mechanism for Eluding Nonsense-Mediated Decay?. Mol. Cell. Biol.
26: 1795-1805
[Abstract]
[Full Text]
-
Small-Howard, A., Morozova, N., Stoytcheva, Z., Forry, E. P., Mansell, J. B., Harney, J. W., Carlson, B. A., Xu, X.-m., Hatfield, D. L., Berry, M. J.
(2006). Supramolecular complexes mediate selenocysteine incorporation in vivo.. Mol. Cell. Biol.
26: 2337-2346
[Abstract]
[Full Text]
-
Wittmann, J., Hol, E. M., Jack, H.-M.
(2006). hUPF2 Silencing Identifies Physiologic Substrates of Mammalian Nonsense-Mediated mRNA Decay. Mol. Cell. Biol.
26: 1272-1287
[Abstract]
[Full Text]
-
Handy, D. E., Hang, G., Scolaro, J., Metes, N., Razaq, N., Yang, Y., Loscalzo, J.
(2006). Aminoglycosides Decrease Glutathione Peroxidase-1 Activity by Interfering with Selenocysteine Incorporation. J. Biol. Chem.
281: 3382-3388
[Abstract]
[Full Text]
-
Kelly, V. P., Suzuki, T., Nakajima, O., Arai, T., Tamai, Y., Takahashi, S., Nishimura, S., Yamamoto, M.
(2005). The Distal Sequence Element of the Selenocysteine tRNA Gene Is a Tissue-Dependent Enhancer Essential for Mouse Embryogenesis. Mol. Cell. Biol.
25: 3658-3669
[Abstract]
[Full Text]
-
Maquat, L. E.
(2005). Nonsense-mediated mRNA decay in mammals. J. Cell Sci.
118: 1773-1776
[Full Text]
-
Zhang, Y., Handy, D. E., Loscalzo, J.
(2005). Adenosine-Dependent Induction of Glutathione Peroxidase 1 in Human Primary Endothelial Cells and Protection Against Oxidative Stress. Circ. Res.
96: 831-837
[Abstract]
[Full Text]
-
Handy, D. E., Zhang, Y., Loscalzo, J.
(2005). Homocysteine Down-regulates Cellular Glutathione Peroxidase (GPx1) by Decreasing Translation. J. Biol. Chem.
280: 15518-15525
[Abstract]
[Full Text]
-
Carlson, B. A., Xu, X.-M., Gladyshev, V. N., Hatfield, D. L.
(2005). Selective Rescue of Selenoprotein Expression in Mice Lacking a Highly Specialized Methyl Group in Selenocysteine tRNA. J. Biol. Chem.
280: 5542-5548
[Abstract]
[Full Text]
-
Mehta, A., Rebsch, C. M., Kinzy, S. A., Fletcher, J. E., Copeland, P. R.
(2004). Efficiency of Mammalian Selenocysteine Incorporation. J. Biol. Chem.
279: 37852-37859
[Abstract]
[Full Text]
-
Bierl, C., Voetsch, B., Jin, R. C., Handy, D. E., Loscalzo, J.
(2004). Determinants of Human Plasma Glutathione Peroxidase (GPx-3) Expression. J. Biol. Chem.
279: 26839-26845
[Abstract]
[Full Text]
-
Chiu, S.-Y., Lejeune, F., Ranganathan, A. C., Maquat, L. E.
(2004). The pioneer translation initiation complex is functionally distinct from but structurally overlaps with the steady-state translation initiation complex. Genes Dev.
18: 745-754
[Abstract]
[Full Text]
-
Wu, Y., Zhang, X., Bardag-Gorce, F., Robel, R. C. V., Aguilo, J., Chen, L., Zeng, Y., Hwang, K., French, S. W., Lu, S. C., Wan, Y.-J. Y.
(2004). Retinoid X Receptor {alpha} Regulates Glutathione Homeostasis and Xenobiotic Detoxification Processes in Mouse Liver. Mol. Pharmacol.
65: 550-557
[Abstract]
[Full Text]
-
Throm, S. L., Klemsz, M. J.
(2003). PU.1 regulates glutathione peroxidase expression in neutrophils. J. Leukoc. Biol.
74: 111-117
[Abstract]
[Full Text]
-
Maderazo, A. B., Belk, J. P., He, F., Jacobson, A.
(2003). Nonsense-Containing mRNAs That Accumulate in the Absence of a Functional Nonsense-Mediated mRNA Decay Pathway Are Destabilized Rapidly upon Its Restitution. Mol. Cell. Biol.
23: 842-851
[Abstract]
[Full Text]
-
Forgione, M. A., Cap, A., Liao, R., Moldovan, N. I., Eberhardt, R. T., Lim, C. C., Jones, J., Goldschmidt-Clermont, P. J., Loscalzo, J.
(2002). Heterozygous Cellular Glutathione Peroxidase Deficiency in the Mouse: Abnormalities in Vascular and Cardiac Function and Structure. Circulation
106: 1154-1158
[Abstract]
[Full Text]
-
Hatfield, D. L., Gladyshev, V. N.
(2002). How Selenium Has Altered Our Understanding of the Genetic Code. Mol. Cell. Biol.
22: 3565-3576
[Full Text]
-
Wang, J., Vock, V. M., Li, S., Olivas, O. R., Wilkinson, M. F.
(2002). A Quality Control Pathway That Down-regulates Aberrant T-cell Receptor (TCR) Transcripts by a Mechanism Requiring UPF2 and Translation. J. Biol. Chem.
277: 18489-18493
[Abstract]
[Full Text]
-
Rao, L., Puschner, B., Prolla, T. A.
(2001). Gene Expression Profiling of Low Selenium Status in the Mouse Intestine: Transcriptional Activation of Genes Linked to DNA Damage, Cell Cycle Control and Oxidative Stress. J. Nutr.
131: 3175-3181
[Abstract]
[Full Text]
-
Kim, V. N., Kataoka, N., Dreyfuss, G.
(2001). Role of the Nonsense-Mediated Decay Factor hUpf3 in the Splicing-Dependent Exon-Exon Junction Complex. Science
293: 1832-1836
[Abstract]
[Full Text]
-
Rajavel, K. S., Neufeld, E. F.
(2001). Nonsense-Mediated Decay of Human HEXA mRNA. Mol. Cell. Biol.
21: 5512-5519
[Abstract]
[Full Text]
-
Sun, X., Li, X., Moriarty, P. M., Henics, T., LaDuca, J. P., Maquat, L. E.
(2001). Nonsense-mediated Decay of mRNA for the Selenoprotein Phospholipid Hydroperoxide Glutathione Peroxidase Is Detectable in Cultured Cells but Masked or Inhibited in Rat Tissues. Mol. Biol. Cell
12: 1009-1017
[Abstract]
[Full Text]
-
Copeland, P. R., Stepanik, V. A., Driscoll, D. M.
(2001). Insight into Mammalian Selenocysteine Insertion: Domain Structure and Ribosome Binding Properties of Sec Insertion Sequence Binding Protein 2. Mol. Cell. Biol.
21: 1491-1498
[Abstract]
[Full Text]
-
Isshiki, M., Yamamoto, Y., Satoh, H., Shimamoto, K.
(2001). Nonsense-Mediated Decay of Mutant waxy mRNA in Rice. Plant Physiol.
125: 1388-1395
[Abstract]
[Full Text]
-
Mitrovich, Q. M., Anderson, P.
(2000). Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans. Genes Dev.
14: 2173-2184
[Abstract]
[Full Text]
-
Nasim, M. T., Jaenecke, S., Belduz, A., Kollmus, H., Flohe, L., McCarthy, J. E. G.
(2000). Eukaryotic Selenocysteine Incorporation Follows a Nonprocessive Mechanism That Competes with Translational Termination. J. Biol. Chem.
275: 14846-14852
[Abstract]
[Full Text]
-
Wen, W., Weiss, S. L., Sunde, R. A.
(1998). UGA Codon Position Affects the Efficiency of Selenocysteine Incorporation into Glutathione Peroxidase-1. J. Biol. Chem.
273: 28533-28541
[Abstract]
[Full Text]
-
Sun, X., Perlick, H. A., Dietz, H. C., Maquat, L. E.
(1998). A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsensecontaining mRNAs in mammalian cells. Proc. Natl. Acad. Sci. USA
95: 10009-10014
[Abstract]
[Full Text]
-
Denning, G., Jamieson, L., Maquat, L. E., Thompson, E. A., Fields, A. P.
(2001). Cloning of a Novel Phosphatidylinositol Kinase-related Kinase. CHARACTERIZATION OF THE HUMAN SMG-1 RNA SURVEILLANCE PROTEIN. J. Biol. Chem.
276: 22709-22714
[Abstract]
[Full Text]