INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Glucose repression is a transcriptional regulatory mechanism in Saccharomyces cerevisiae which permits the cell to adapt its metabolism to the availability of glucose or other fermentable carbon sources (for reviews, see references 14, 21, and 36). Genetic analysis has identified several transcription factors and transcriptional regulators of glucose-repressible genes (22, 25, 31, 35, 44). Furthermore, it has been shown that glucose transport and phosphorylation are involved in triggering glucose signaling (21, 34, 35, 37, 42). However, the mechanism of glucose signaling and the links between the signal and the elements implied in the glucose repression response have not been elucidated yet.

S. cerevisiae contains three glucose-phosphorylating enzymes, hexokinase PI (HXK1), hexokinase PII (HXK2), and glucokinase (GLK1). The HXK2 gene product appears to play an important role in glucose-mediated response (8, 26, 37). Mutations in HXK2 abolish catabolite repression of invertase (8) and other glucose-regulated genes (35), whereas the deletion of the other sugar kinases does not have this effect (37). HXK2 is also required for generation of the induction signal for expression of the HXT gene encoding for hexose transporters (35). The molecular basis of the specific role of Hxk2p in glucose signaling is still unclear. Initially, glucose repression was inversely correlated to the sugar-phosphorylating activity of Hxk2p (26, 37). Nevertheless, overexpression of HXK1, but not of GLK1, restored glucose repression in an hxk2 mutant (37). Recently, it has been shown that the glucose repression of the SUC2 gene may be resolved into two steps: an early repression response which is mediated through any of the three hexose-phosphorylating enzymes present in S. cerevisiae and a long-term response which requires Hxk2p on glucose (40) and either Hxk1p or Hxk2p on fructose (6). Hence, hexokinases should exhibit any property, not shared by glucokinase, that relates them to the mechanism of glucose repression.

Hexokinases can exist in vitro either as dimers or as monomers depending on the binding of glucose and nucleotides (13, 19, 30, 51). In vitro assays also indicate that the hexokinase PII monomer shows a higher K_m for glucose than does the dimer (50). The relevance of the Hxk2p dimerization for glucose repression has been questioned since the repression of invertase by glucose occurs in the presence of a truncated Hxk2p derivative (lacking the 15 N-terminal amino acids) that is unable to form a dimer (27).

It has also been reported that both Hxk1p and Hxk2p are phosphoproteins which are predominantly phosphorylated in conditions of derepression (23, 48). The in vivo phosphorylation site has been identified as serine-15, located in a protein kinase A consensus phosphorylation sequence (23). This residue was phosphorylated in vitro by protein kinase A, whereas an alanine-15 mutant protein (S15A) was not. Attempts to correlate this modification with glucose repression of invertase failed (23). However, these experiments were carried out with multicopy plasmids resulting in an unusually high level of hexokinase activity, as was remarked by Kriegel et al. (23). Neither the physiological significance of the in vivo phosphorylation nor the implied protein kinase and protein phosphatase are known.

The reversible phosphorylation of proteins depends on the activities of either protein kinases or protein phosphatases. Both kinases and phosphatases have been shown to play critical roles in regulating glucose repression (3, 45). It is known that protein phosphatase type 1 (PP1) of S. cerevisiae, encoded by the GLC7/CID1 gene (10, 33), is required to maintain glucose repression (45). Cid1p appears to function antagonistically to the kinase Cat1p/Snf1p. Genetic and molecular approaches have led to the identification of PP1 regulatory subunits (12, 46). Hex2p/Reg1p has been demonstrated to bind Cid1p, and it is proposed to direct the activity of Cid1p to the glucose repression pathway (46), although the target of Cid1p activity in the signaling cascade has not been identified yet.

We demonstrate in this work that phosphorylation of Hxk2p is involved in the mechanism underlying the function of hexokinase in glucose response. Mutants containing the S15A substitution prevent phosphorylation in vivo of Hxk2p, lead to derepression of the SUC2 gene in glucose-growing cells, and abolish the glucose-induced HXT gene expression. We also report here genetic evidence that Hxk2p is a target of the protein phosphatase Cid1p. The physiological implications of these results in respect to glucose signaling are discussed.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Strains and culture conditions. The yeast strains used in this work are listed in Table 1. Yeast cells were grown in YP rich medium (1% yeast extract, 2% peptone) containing 2% glucose, 2% galactose, 2% maltose, 2% raffinose, 2% sucrose, or 3% ethanol as carbon source. In some experiments yeast cells were grown in minimal medium (0.67% yeast nitrogen base without amino acids [Difco] plus the corresponding carbon source) supplemented with the appropriate concentrations of histidine, tryptophan, and uracil as described by Sherman et al. (41).

Preparation of yeast extracts. Cells were harvested, washed in cold homogenization buffer (10 mM triethanolamine, 0.2 mM EDTA [pH 7.6]), and transferred into a tube containing 0.3 ml of the same buffer and 1.0 g of glass beads (acid washed, 0.4-mm diameter). The protease inhibitors pepstatin (1 µg/ml), leupeptin (0.5 µg/ml), aprotinin (2 µg/ml), and phenylmethylsulfonyl fluoride (1 mM) were added, and the mixture was vortexed 3 times for 1 min each time with 1-min intervals of resting on ice between each mixing. Finally, the crude extract was centrifuged at 18,000 × g (4°C) for 10 min, and the supernatant was used for further analysis.

Electrophoretic analyses. Polyacrylamide gel electrophoresis (PAGE) of native proteins and sodium dodecyl sulfate (SDS)-PAGE were performed on 7.5 and 10% polyacrylamide gels, respectively, with the buffer systems described by Davis (5) and Laemmli (24). Two-dimensional electrophoresis was carried out by running the samples on a polyacrylamide gel as the first dimension. Then, a gel strip was cut and packed with 1% agarose on the top of an SDS-PAGE stacking gel as the second dimension.

Gel filtration. Gel filtration was carried out with a Superdex 200 pg column (300 ml; Pharmacia) equilibrated with 50 mM Tris-HCl (pH 7.3). Cells were grown in galactose medium to mid-log phase, and crude extracts were prepared as described above. Samples were further clarified by centrifugation at 10,000 × g (4°C) for 10 min and applied (3.5 ml) onto the column. Fractions (4.8 ml) were collected and analyzed for PAGE mobility and hexokinase activity. A molecular weight marker mixture containing cytochrome c (12.3 kDa), ovalbumin (66 kDa), -amylase (200 kDa), and apoferritin (443 kDa) was used to generate a standard curve. Chromatography fractions were subjected to hexokinase test as described below.

Immunoblotting and antibodies. Transfer of proteins to a nitrocellulose membrane was carried out by Western blotting as described by Towbin et al. (43). Hxk2p was detected by sequential incubation with crude polyclonal antibody (1:1,500 dilution) and goat peroxidase-coupled anti-rabbit immunoglobulin G (1:3,000 dilution) or by enhanced chemiluminescence (ECL). ECL detection was performed by probing the membrane with biotinylated anti-Hxk2p (1:1,500 dilution) and subsequent screening with horseradish peroxidase-labeled streptavidin (1:2,000 dilution).

-Phosphatase treatment. Crude extracts obtained as described above were treated with -phosphatase (200 U; New England Biolabs) with or without the addition of a phosphatase inhibitor cocktail (5 mM sodium fluoride, 5 mM sodium phosphate [pH 8.0], 10 mM sodium pyrophosphate, 5 mM EGTA, 5 mM EDTA, 0.1 mM sodium orthovanadate). Protein samples (30 µg) were incubated in a final volume of 20 µl for 1 h at 30°C. Incubations at 4°C were carried out in parallel as control assays.

DNA manipulations. Standard DNA manipulation techniques were carried out as described by Sambrook et al. (38). Restriction enzymes were from Boehringer GmbH (Mannheim, Germany). The Sure Clone ligation kit was from Pharmacia Biotech. Probes for Southern blot analyses were radiolabeled with the random primer labeling kit Ready to Go (Pharmacia Biotech) and [-³²P]dCTP (Amersham).

Transformants. Yeast cells were transformed by the lithium acetate method (20). E. coli was transformed by electroporation following the manufacturer's instructions (Eppendorf).

Constructions of plasmids and integrative mutants. The HXK2 coding region with its corresponding promoter (+1 to 505) was amplified by PCR with S. cerevisiae genomic DNA and the oligonucleotides Hxk2-1 5'CACATTGGATCCTAGAAATGG3' (BamHI site underlined) and Hxk2-2 5'GATCATAGAATTCATGTTCAC3' (EcoRI site underlined). The amplified 2.0-kb fragment was subcloned into the pUC18-SmaI plasmid, resulting in plasmid pUC-HXK2(S15).

DNA sequencing. Inserts present in plasmids YIpHXK2(S15) and YIpHXK2(S15A) were sequenced by the dideoxy nucleotide chain termination procedure (39).

Southern blot analysis. A TRP1 fragment (EcoRI-PstI) from the YRp7 plasmid was radiolabeled and used as a probe to hybridize genomic DNAs from WAY.78-1 and YSH7.4-3c cells transformed with the integrative plasmids after digestion with XmnI or HindIII.

Enzyme determinations. External invertase was assayed as described by Gascon and Lampen (15). One unit is defined as the amount of enzyme that is able to release 1 nmol of glucose per min under the assay conditions.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

The dimer-monomer equilibrium of Hxk2p is affected by phosphorylation. In order to investigate the putative interactions of Hxk2p with other proteins, we analyzed by native gel electrophoresis crude extracts from different glucose phosphorylation mutants grown in galactose medium. Immunoblotting analyses using biotinylated anti-Hxk2p polyclonal antibody allowed the detection of two well-defined specific bands (Fig. 1). In addition, a smear at the top of the blot also appeared, but as this was the only signal present in a triple kinase mutant, hxk1 hxk2 glk1, we assumed that this corresponded to unspecific cross-reaction of the antibody or to biotinylated material present in the crude extract. The polyclonal antibody was also able to recognize Hxk1p. Cells harboring Hxk1p as single hexokinase exhibited two faint bands differing slightly in relative mobility to those observed for Hxk2p. In a wild-type strain the predominant protein detected in galactose medium corresponded to Hxk2p, as based on the relative mobility of the bands.

View larger version (49K): [in this window] [in a new window]   FIG. 1.   Immunoblot analysis of hexokinases from galactose-grown cells. Protein extracts (30 µg) were separated by 7.5% PAGE, subjected to immunoblotting with biotinylated anti-Hxk2p antibody and detected by using the ECL detection system. Relevant genotypes of the strains are indicated.

View larger version (16K): [in this window] [in a new window]   FIG. 2.   Gel filtration chromatography. Results of native gel analysis (PAGE) and corresponding profiles of hexokinase activities of crude extracts from WAY.glk1-5C cells cultivated on galactose are shown. The molecular weights (MW) of the Hxk2p isoforms were calculated from the standard curve. BSA, bovine serum albumin.

View larger version (45K): [in this window] [in a new window]   FIG. 3.   Identification of Hxk2p isoforms by two-dimensional electrophoresis. A protein crude extract from galactose-grown cells was separated in the first dimension by 7.5% native PAGE. A slice from this gel was electrophoresed in the second dimension on an SDS-10% PAGE gel and immunodetected with biotinylated anti-Hxk2p (A) or antiphosphoserine (B) antibodies. The phosphorylated monomer is indicated by the open arrows.

View larger version (20K): [in this window] [in a new window]   FIG. 4.   The Hxk2p monomer is a phosphoprotein. Protein extracts (30 µg) from WAY.glk1-5C cells grown in galactose were incubated for 1 h at 30°C in the presence (+) or absence () of phosphatase inhibitors. As a control, samples were kept on ice. Proteins were separated and analyzed as described in the legend for Fig. 1. UP, unphosphorylated forms; P, phosphorylated form.

Glucose promotes in vivo dephosphorylation of Hxk2p. To study if the relative abundance of Hxk2p isoforms was affected by the addition of glucose, wild-type cells grown exponentially in galactose medium, were transferred to glucose-containing medium, and samples were collected at the times indicated (Fig. 5). After 120 min of incubation, the presence of glucose reduced the abundance of the phosphorylated monomer and increased that of the unphosphorylated forms. Similar results were also found when cells were grown on raffinose or ethanol medium and then transferred to glucose-containing medium (data not shown). In order to determine if this change was exclusively carbon source dependent, wild-type cells growing in galactose were subjected to different stress conditions. Neither heat shock nor oxidative or osmotic stress induced a change in the relative abundance of the two bands of Hxk2p (data not shown).

View larger version (23K): [in this window] [in a new window]   FIG. 5.   Modification of the phosphorylated state of hexokinase upon glucose addition. Wild-type cells (ENY.WA-1A) were grown to mid-log phase on 2% galactose (Gal) medium and then transferred to 2% glucose medium. Samples were taken at the indicated times (min). Proteins (30 µg per lane) were separated and analyzed as indicated in the legend for Fig. 1. UP, unphosphorylated forms; P, phosphorylated form.

The phosphorylation of Hxk2p is affected by Cid1p/Glc7p but not by Cat1p/Snf1p. To further investigate the dependency of the Hxk2p isoform changes on glucose, we analyzed this process in different glucose repression mutants (Fig. 6 and 7). When mig1/cat4 or cyc8/ssn6 mutant cells were shifted from galactose to glucose medium, the unphosphorylated forms of Hxk2p were predominant, as in the wild-type strain. However, the transition of the phosphomonomer to the unphosphorylated dimer-monomer forms was abolished in cat80/grr1, hex2/reg1, and cid1/glc7-T152K mutants. It has been reported that in the cat80/grr1 mutant glucose uptake is affected due to a decrease in the expression of various HXT genes encoding for glucose transporters (35, 47). Therefore, the glucose repression defect in this mutant might be a mere corollary of reduced glucose uptake and glycolytic flux. To test this possibility, the transfer experiment was carried out with maltose as inducer of the Hxk2p changes. Indeed, the transition of Hxk2p forms was observed upon maltose addition to galactose-growing wild-type (Fig. 7A) and cat80 (Fig. 6) cells. However, under the same conditions the transition remained absent in cid1/glc7 mutants (Fig. 7A).

View larger version (35K): [in this window] [in a new window]   FIG. 6.   Hxk2p dephosphorylation in different catabolite repression mutants. Cells grown on galactose (Gal) medium were shifted for 3 h to glucose (G)- or maltose (Mal)-containing medium, as indicated. In the case of the cat1 mutant, cells were cultivated on glucose and then transferred for 4 h to Gal or ethanol (EtOH) medium. Protein samples from wild-type (WT; ENY.WA-1A), mig1/cat4 (JS88.3-1A), cyc8/ssn6 (ENY/cyc8-2D), cat80/grr1 (WAY.JF1), hex2/reg1 (ENY.hex2-3A), and cat1/snf1 (CEN.PK130-7B) cells were treated as described in the legend to Fig. 1. Protein samples were treated as described in the legend for Fig. 1. UP, unphosphorylated forms; P, phosphorylated form.

View larger version (35K): [in this window] [in a new window]   FIG. 7.   Effects of different carbon sources on the Hxk2p phosphorylation in wild-type and cid1 mutant cells (top) and -phosphatase treatment of a cid1 protein extract (bottom). Cultures were grown in galactose (Gal) medium and then transferred for 3 h to 2% glucose (G), 2% sucrose (Suc), or 2% maltose (Mal) medium as indicated. (Lower) Protein extracts (30 µg) from cid1 mutant cells grown in glucose were incubated for 1 h at 30°C in the absence () or presence (+) of -phosphatase and phosphatase inhibitors. Proteins were separated and analyzed as described in the legend for Figure 1. UP, unphosphorylated forms; P, phosphorylated form.

The phosphorylation of hexokinase PII is required for glucose signaling. Since both Hxk2p and the Cid1p-Hex2p complex are implicated in the glucose response, and in turn the PP1 function was involved in the phosphorylation state of Hxk2p, we tried to clarify the physiological significance of the Hxk2p dephosphorylation in the in vivo function of hexokinase PII.

View larger version (24K): [in this window] [in a new window]   FIG. 8.   Hxk2p(S15A) is unable to undergo phosphorylation. Triple null hexokinase mutants (WAY.78-1) carrying a single copy of HXK2(S15) or HXK2(S15A) were grown on 2% galactose (Gal) medium and then transferred to 2% glucose (G) medium for 3 h. A total of 30 µg of crude protein extracts was separated by PAGE (A) or by SDS-PAGE (B) and immunodetected with ECL (A) or peroxidase-conjugated antibody (B). (C), Crude protein extracts from galactose-grown transformants [HXK2(S15A)] were separated by two-dimensional electrophoresis and immunodetected with antiphosphoserine antibody. The open arrow indicates the position in which the upper band on the PAGE gel migrates in the second dimension (see also Fig. 3). UP, unphosphorylated forms; P, phosphorylated form.

1

1

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

We show in this work that the association-dissociation equilibrium of yeast hexokinase existed in vivo. This equilibrium was affected by phosphorylation-dephosphorylation of the protein in response to carbon source. Phosphorylation of hexokinases had been shown previously (23, 48), but no relationship between this modification and the conformational state of Hxk2p had been established yet. We also show that the Hxk2p phosphoprotein was a monomer that underwent dephosphorylation triggered by glucose addition.

Easily fermentable carbon sources such as glucose, maltose, and sucrose were able to trigger the dephosphorylation of Hxk2p. Conversely, when cells were grown with poorly fermentable or nonfermentable carbon sources like raffinose, galactose, and ethanol both phosphorylated and dephosphorylated forms appeared in similar amounts. These results were consistent with the in vivo ³²P-labeling experiments of hexokinases which showed the most extensive phosphorylation in galactose or low-glucose medium (23, 48).

The phosphorylated state of hexokinase was affected by the carbon source, but this dependence was not regulated by the general mechanism of glucose repression. As in wild-type cells, glucose-induced Hxk2p transition was observed in mutants with defects in transcription factors or effectors involved in glucose repression (cyc8/ssn6 [22, 49] and mig1/cat4 [31]), indicating that this effect was not a final result of the glucose repression pathway. However, in mutants with defects affecting the primary steps of the pathway (cat80/grr1 [1, 4, 9], hex2/reg1 [9, 29], and cid1/glc7 [32]), the ratio of Hxk2p phosphorylated forms was not altered by the presence of glucose, indicating that the transition was a specific response to glucose sensing, as we confirmed in a cat80/grr1 mutant using maltose as the inductor of Hxk2p transition. On maltose the dephosphorylation of hexokinases occurred in this mutant, which confirmed that on glucose, cat80/grr1 mutants did not provide sufficient glucose to trigger dephosphorylation because of a reduced glucose uptake.

An important finding was that in cid1/glc7 and hex2/reg1 mutants the dephosphorylation of hexokinase did not take place under any condition studied, suggesting that Hxk2p was a direct or indirect target of the CID1/GLC7 protein phosphatase.

Conversely to the results of previous studies on the functional role of the phosphorylation of Hxk2p (23, 27), our experiments with single-copy plasmids of the HXK2 gene controlled under its own promoter showed that this modification is key in the glucose-signaling pathways. Both glucose repression and glucose-induced expression of hexose transporters and glucose repression of invertase were affected in cells expressing a Hxk2(S15A)-mutated protein, in a similar manner to the defects reported for a null hxk2 mutant (8, 35). This observation was confirmed in different genetic backgrounds.

In vitro hexokinase activity data showed less sugar phosphorylation in crude extracts from HXK2(S15A) cells, raising the possibility that those regulatory defects could be the result of a reduced glucose metabolism. However, growth rate measurements indicated that the in vivo catalytic activity of the Hxk2(S15A) protein was very similar to that of the wild type. It is worth pointing out that previous studies have shown an inverse correlation between growth rate and level of glucose repression, supporting the hypothesis that the catalytic activity of hexokinase PII was correlated to its function in glucose repression (26). Kinetic assessment results also make it unlikely that large differences exist between wild-type and mutant enzymes. The lower in vitro sugar-phosphorylating activity found in HXK2(S15A) strains could be explained at least in part by shelf regulatory defects of the HXK2 gene. Expression studies of hexose kinases have shown that HXK2 is induced by glucose (6, 28). This response could be abolished in HXK2(S15A) transformants in the same way as we demonstrated for HXT genes. In the present study, this possibility was well correlated with some differences observed in the amount of Hxk2p detectable by PAGE and SDS-PAGE in extracts from cells of wild-type and mutant enzyme (Fig. 8). Hence, the phenotype presented in this work for the HXK2(S15A) transformants could be ascribed to a glucose-signaling defect. Although, we cannot rule out completely a metabolic problem as the origin of this phenotype, the evidence presented here leads us to suggest that the lower hexokinase activity values found are a secondary consequence of this signaling defect and not the origin of it.

In contrast to an earlier hypothesis placing Hxk2p as a part of a putative glucose sensor (for review, see reference 42), our results suggest that hexokinase PII is involved in the transduction of glucose signals. In this role, the phosphorylated monomer of Hxk2p would be a key element, being able to receive the signal and to transmit it. How the phosphorylation state of Hxk2p controls the on-off switching of the signal is still an open question. The genetic evidence presented in this work shows that Hxk2p is a direct or indirect target of the protein phosphatase Cid1p-Hex2p complex, suggesting a putative interaction between the Hxk2p phosphorylated monomer and this protein complex. As a result of this interaction downstream elements would be activated in the transmission of the glucose signal. In this model, the phosphate group would likely be critical for controlling the affinity of the interaction site of Hxk2p with the Cid1p-Hex2p complex. By removing the phosphate, the strength of the interaction would be decreased, making the signal transduction weaker. Thus, the Hxk2(S15A) mutant protein would still be able to interact in some manner with such a complex, giving a certain grade of glucose sensitivity (Table 2). By overexpressing the Hxk2(S15A) protein, the interaction could be improved and the glucose repression signal transmitted as previously reported (23, 27).

To make the phosphorylation reversible there clearly must be a specific protein kinase. Our results exclude the possibility that Cat1p/Snf1p could be the kinase of Hxk2p. Phosphorylation of hexokinase by protein kinase A has also been dismissed (48) even though the phosphorylation site (Ser 15) has been located in a protein kinase A consensus phosphorylation sequence. It remains possible that in vivo phosphorylation of hexokinase could be the result of substrate-induced autophosphorylation, as has been investigated previously (11).

We hypothesize that the specific role of hexokinase PII in the glucose response is mediated by phosphorylation-dephosphorylation. Our future efforts will seek to identify downstream targets of Hxk2p and to further clarify the connections between Cid1p-Hex2p and Hxk2p in glucose signal transduction. Experiments to further investigate these issues are now in progress.