Previous Article | Next Article 
Mol Cell Biol, May 1998, p. 2940-2948, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Carbon Source-Dependent Phosphorylation of
Hexokinase PII and Its Role in the Glucose-Signaling Response in
Yeast
Francisca
Randez-Gil,1
Pascual
Sanz,2
Karl-Dieter
Entian,1 and
Jose
Antonio
Prieto2,*
Institut für Mikrobiologie, Johann
Wolfgang Goethe-Universität Frankfurt, Biozentrun Niederursel
D-60489, Frankfurt am Main, Germany,1 and
Departamento de Biotecnología, Instituto de
Agroquímica y Tecnología de los Alimentos, Consejo
Superior de Investigaciones Científicas, 46100 Burjassot,
Valencia, Spain2
Received 10 November 1997/Returned for modification 20 January
1998/Accepted 17 February 1998
 |
ABSTRACT |
The HXK2 gene is required for a variety of regulatory
effects leading to an adaptation for fermentative metabolism in
Saccharomyces cerevisiae. However, the molecular basis of
the specific role of Hxk2p in these effects is still unclear. One
important feature in order to understand the physiological function of
hexokinase PII is that it is a phosphoprotein, since protein
phosphorylation is essential in most metabolic signal transductions in
eukaryotic cells. Here we show that Hxk2p exists in vivo in a
dimeric-monomeric equilibrium which is affected by phosphorylation.
Only the monomeric form appears phosphorylated, whereas the dimer does
not. The reversible phosphorylation of Hxk2p is carbon source
dependent, being more extensive on poor carbon sources such as
galactose, raffinose, and ethanol. In vivo dephosphorylation of Hxk2p
is promoted after addition of glucose. This effect is absent in glucose
repression mutants cat80/grr1, hex2/reg1, and
cid1/glc7. Treatment of a glucose crude extract from
cid1-226 (glc7-T152K) mutant cells with
-phosphatase drastically reduces the presence of phosphoprotein,
suggesting that CID1/GLC7 phosphatase together with its
regulatory HEX2/REG1 subunit are involved in the
dephosphorylation of the Hxk2p monomer. An HXK2 mutation
encoding a serine-to-alanine change at position 15 [HXK2
(S15A)] was to clarify the in vivo function of the
phosphorylation of hexokinase PII. In this mutant, where the Hxk2
protein is unable to undergo phosphorylation, the cells could not
provide glucose repression of invertase. Glucose induction of
HXT gene expression is also affected in cells expressing
the mutated enzyme. Although we cannot rule out a defect in the
metabolic state of the cell as the origin of these phenomena, our
results suggest that the phosphorylation of hexokinase is essential in
vivo for glucose signal transduction.
 |
INTRODUCTION |
Glucose repression is a
transcriptional regulatory mechanism in Saccharomyces
cerevisiae which permits the cell to adapt its metabolism to the
availability of glucose or other fermentable carbon sources (for
reviews, see references 14, 21, and
36). Genetic analysis has identified several
transcription factors and transcriptional regulators of
glucose-repressible genes (22, 25, 31, 35, 44). Furthermore,
it has been shown that glucose transport and phosphorylation are
involved in triggering glucose signaling (21, 34, 35, 37,
42). However, the mechanism of glucose signaling and the links
between the signal and the elements implied in the glucose repression
response have not been elucidated yet.
S. cerevisiae contains three glucose-phosphorylating
enzymes, hexokinase PI (HXK1), hexokinase PII
(HXK2), and glucokinase (GLK1). The
HXK2 gene product appears to play an important role in
glucose-mediated response (8, 26, 37). Mutations in HXK2 abolish catabolite repression of invertase
(8) and other glucose-regulated genes (35),
whereas the deletion of the other sugar kinases does not have this
effect (37). HXK2 is also required for generation
of the induction signal for expression of the HXT gene
encoding for hexose transporters (35). The molecular basis of the specific role of Hxk2p in glucose signaling is still unclear. Initially, glucose repression was inversely correlated to the sugar-phosphorylating activity of Hxk2p (26, 37).
Nevertheless, overexpression of HXK1, but not of
GLK1, restored glucose repression in an hxk2
mutant (37). Recently, it has been shown that the glucose
repression of the SUC2 gene may be resolved into two steps: an early repression response which is mediated through any of the three
hexose-phosphorylating enzymes present in S. cerevisiae and
a long-term response which requires Hxk2p on glucose (40) and either Hxk1p or Hxk2p on fructose (6). Hence,
hexokinases should exhibit any property, not shared by glucokinase,
that relates them to the mechanism of glucose repression.
Hexokinases can exist in vitro either as dimers or as monomers
depending on the binding of glucose and nucleotides (13, 19, 30,
51). In vitro assays also indicate that the hexokinase PII
monomer shows a higher Km for glucose than does
the dimer (50). The relevance of the Hxk2p dimerization for
glucose repression has been questioned since the repression of
invertase by glucose occurs in the presence of a truncated Hxk2p
derivative (lacking the 15 N-terminal amino acids) that is unable to
form a dimer (27).
It has also been reported that both Hxk1p and Hxk2p are phosphoproteins
which are predominantly phosphorylated in conditions of derepression
(23, 48). The in vivo phosphorylation site has been
identified as serine-15, located in a protein kinase A consensus
phosphorylation sequence (23). This residue was phosphorylated in vitro by protein kinase A, whereas an alanine-15 mutant protein (S15A) was not. Attempts to correlate this modification with glucose repression of invertase failed (23). However,
these experiments were carried out with multicopy plasmids resulting in
an unusually high level of hexokinase activity, as was remarked by
Kriegel et al. (23). Neither the physiological significance of the in vivo phosphorylation nor the implied protein kinase and
protein phosphatase are known.
The reversible phosphorylation of proteins depends on the activities of
either protein kinases or protein phosphatases. Both kinases and
phosphatases have been shown to play critical roles in regulating
glucose repression (3, 45). It is known that protein
phosphatase type 1 (PP1) of S. cerevisiae, encoded by the
GLC7/CID1 gene (10, 33), is required to maintain
glucose repression (45). Cid1p appears to function
antagonistically to the kinase Cat1p/Snf1p. Genetic and molecular
approaches have led to the identification of PP1 regulatory subunits
(12, 46). Hex2p/Reg1p has been demonstrated to bind Cid1p,
and it is proposed to direct the activity of Cid1p to the glucose
repression pathway (46), although the target of Cid1p
activity in the signaling cascade has not been identified yet.
We demonstrate in this work that phosphorylation of Hxk2p is involved
in the mechanism underlying the function of hexokinase in glucose
response. Mutants containing the S15A substitution prevent
phosphorylation in vivo of Hxk2p, lead to derepression of the
SUC2 gene in glucose-growing cells, and abolish the
glucose-induced HXT gene expression. We also report here
genetic evidence that Hxk2p is a target of the protein phosphatase
Cid1p. The physiological implications of these results in respect to
glucose signaling are discussed.
 |
MATERIALS AND METHODS |
Strains and culture conditions.
The yeast strains used in
this work are listed in Table 1. Yeast
cells were grown in YP rich medium (1% yeast extract, 2% peptone)
containing 2% glucose, 2% galactose, 2% maltose, 2% raffinose, 2%
sucrose, or 3% ethanol as carbon source. In some experiments yeast
cells were grown in minimal medium (0.67% yeast nitrogen base without
amino acids [Difco] plus the corresponding carbon source)
supplemented with the appropriate concentrations of histidine, tryptophan, and uracil as described by Sherman et al. (41).
Escherichia coli DH10B was grown in Luria Bertani medium
(1% peptone, 0.5% yeast extract, 0.5% NaCl).
Preparation of yeast extracts.
Cells were harvested, washed
in cold homogenization buffer (10 mM triethanolamine, 0.2 mM EDTA [pH
7.6]), and transferred into a tube containing 0.3 ml of the same
buffer and 1.0 g of glass beads (acid washed, 0.4-mm diameter).
The protease inhibitors pepstatin (1 µg/ml), leupeptin (0.5 µg/ml),
aprotinin (2 µg/ml), and phenylmethylsulfonyl fluoride (1 mM) were
added, and the mixture was vortexed 3 times for 1 min each time with
1-min intervals of resting on ice between each mixing. Finally, the
crude extract was centrifuged at 18,000 × g (4°C)
for 10 min, and the supernatant was used for further analysis.
Electrophoretic analyses.
Polyacrylamide gel electrophoresis
(PAGE) of native proteins and sodium dodecyl sulfate (SDS)-PAGE were
performed on 7.5 and 10% polyacrylamide gels, respectively, with the
buffer systems described by Davis (5) and Laemmli
(24). Two-dimensional electrophoresis was carried out by
running the samples on a polyacrylamide gel as the first dimension.
Then, a gel strip was cut and packed with 1% agarose on the top of an
SDS-PAGE stacking gel as the second dimension.
Gel filtration.
Gel filtration was carried out with a
Superdex 200 pg column (300 ml; Pharmacia) equilibrated with 50 mM
Tris-HCl (pH 7.3). Cells were grown in galactose medium to mid-log
phase, and crude extracts were prepared as described above. Samples
were further clarified by centrifugation at 10,000 × g
(4°C) for 10 min and applied (3.5 ml) onto the column. Fractions (4.8 ml) were collected and analyzed for PAGE mobility and hexokinase
activity. A molecular weight marker mixture containing cytochrome
c (12.3 kDa), ovalbumin (66 kDa),
-amylase (200 kDa), and
apoferritin (443 kDa) was used to generate a standard curve.
Chromatography fractions were subjected to hexokinase test as described
below.
Immunoblotting and antibodies.
Transfer of proteins to a
nitrocellulose membrane was carried out by Western blotting as
described by Towbin et al. (43). Hxk2p was detected by
sequential incubation with crude polyclonal antibody (1:1,500 dilution)
and goat peroxidase-coupled anti-rabbit immunoglobulin G (1:3,000
dilution) or by enhanced chemiluminescence (ECL). ECL detection was
performed by probing the membrane with biotinylated anti-Hxk2p (1:1,500
dilution) and subsequent screening with horseradish peroxidase-labeled
streptavidin (1:2,000 dilution).
Specific anti-Hxk2p serum was raised in rabbits by sequential
immunization with a purified fraction of hexokinase PII. The
crude
serum was purified by standard protocols (
17), and
antibodies
were biotinylated according to the protein biotinylation
module
instructions from Amersham (catalog no. RPN2203). Mouse
antiphosphoserine
monoclonal antibody was from Sigma.
-Phosphatase treatment.
Crude extracts obtained as
described above were treated with
-phosphatase (200 U; New England
Biolabs) with or without the addition of a phosphatase inhibitor
cocktail (5 mM sodium fluoride, 5 mM sodium phosphate [pH 8.0], 10 mM
sodium pyrophosphate, 5 mM EGTA, 5 mM EDTA, 0.1 mM sodium
orthovanadate). Protein samples (30 µg) were incubated in a final
volume of 20 µl for 1 h at 30°C. Incubations at 4°C were
carried out in parallel as control assays.
DNA manipulations.
Standard DNA manipulation techniques were
carried out as described by Sambrook et al. (38).
Restriction enzymes were from Boehringer GmbH (Mannheim, Germany). The
Sure Clone ligation kit was from Pharmacia Biotech. Probes for Southern
blot analyses were radiolabeled with the random primer labeling kit
Ready to Go (Pharmacia Biotech) and [
-32P]dCTP
(Amersham).
Transformants.
Yeast cells were transformed by the lithium
acetate method (20). E. coli was transformed by
electroporation following the manufacturer's instructions (Eppendorf).
Constructions of plasmids and integrative mutants.
The
HXK2 coding region with its corresponding promoter (+1 to
505) was amplified by PCR with S. cerevisiae genomic DNA
and the oligonucleotides Hxk2-1
5'CACATTGGATCCTAGAAATGG3' (BamHI site underlined) and Hxk2-2 5'GATCATAGAATTCATGTTCAC3'
(EcoRI site underlined). The amplified 2.0-kb fragment
was subcloned into the pUC18-SmaI plasmid, resulting in
plasmid pUC-HXK2(S15).
HXK2 point mutation changing serine to alanine at position
15 (S15A) was achieved by overlap extension (
18) with PCR
and
oligonucleotide primers Hxk2-3
5'CCACAAGCCAGAAAGGGT
GCCATGGC3',
including the
desired change of T to G (in boldface), and Hxk2-4
(reverse sequence to
Hxk2-3). Oligonucleotides Hxk2-1 and Hxk2-2
were used as primers for
PCR amplifications with pUC-HXK2(S15)
as template in the first step.
The mutated
HXK2 PCR product was subsequently cloned into
the pUC18-
SmaI plasmid, generating the construct
pUC-HXK2(S15A).
The YIplac204 plasmid (
16) was treated with
EcoRI and
BamHI
in order to accommodate the
EcoRI-
BamHI fragments from plasmids
pUC-HXK2(S15)
and pUC-HXK2(S15A), resulting in plasmids YIpHXK2(S15)
and
YIpHXK2(S15A), respectively. Integrative plasmids were digested
with
Bsu36I or
BanII in order to direct the
integration to the
TRP1 locus of the triple kinase mutant
strain WAY.78-1 (ENY.WA
background) or YSH7.4-3C (W303 background),
respectively. Integrative
transformants were selected in glucose
minimal medium lacking
tryptophan and confirmed by Southern blot
analysis.
DNA sequencing.
Inserts present in plasmids YIpHXK2(S15) and
YIpHXK2(S15A) were sequenced by the dideoxy nucleotide chain
termination procedure (39).
Southern blot analysis.
A TRP1 fragment
(EcoRI-PstI) from the YRp7 plasmid was
radiolabeled and used as a probe to hybridize genomic DNAs from
WAY.78-1 and YSH7.4-3c cells transformed with the integrative plasmids after digestion with XmnI or HindIII.
Enzyme determinations.
External invertase was assayed as
described by Gascon and Lampen (15). One unit is defined as
the amount of enzyme that is able to release 1 nmol of glucose per min
under the assay conditions.
Hexokinase activity was carried out as described by Bergmeyer
(
2) with fructose as substrate. One unit is defined as the
amount of enzyme that is able to produce 1 µmol of NADPH per min
under the assay conditions.

-Galactosidase activity was determined in permeabilized cells grown
to mid-log phase as described previously (
35).
 |
RESULTS |
The dimer-monomer equilibrium of Hxk2p is affected by
phosphorylation.
In order to investigate the putative interactions
of Hxk2p with other proteins, we analyzed by native gel electrophoresis crude extracts from different glucose phosphorylation mutants grown in
galactose medium. Immunoblotting analyses using biotinylated anti-Hxk2p
polyclonal antibody allowed the detection of two well-defined specific
bands (Fig. 1). In addition, a smear at
the top of the blot also appeared, but as this was the only signal
present in a triple kinase mutant, hxk1 hxk2 glk1, we
assumed that this corresponded to unspecific cross-reaction of the
antibody or to biotinylated material present in the crude extract. The
polyclonal antibody was also able to recognize Hxk1p. Cells harboring
Hxk1p as single hexokinase exhibited two faint bands differing
slightly in relative mobility to those observed for Hxk2p. In a
wild-type strain the predominant protein detected in galactose medium
corresponded to Hxk2p, as based on the relative mobility of the bands.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 1.
Immunoblot analysis of hexokinases from galactose-grown
cells. Protein extracts (30 µg) were separated by 7.5% PAGE,
subjected to immunoblotting with biotinylated anti-Hxk2p antibody and
detected by using the ECL detection system. Relevant genotypes of the
strains are indicated.
|
|
As has been previously reported, Hxk2p exists in vitro as two isoforms,
a monomer and a dimer (
7,
13). To clarify if
the bands
observed by immunoblot analysis could be assigned to
Hxk2p isoforms, we
carried out gel filtration chromatography of
a galactose-grown crude
extract from WAY.glk1-5C (
glk1 hxk1 HXK2)
cells, and the
corresponding fractions were assayed by PAGE and
hexokinase activity.
The faster-migrating band in the native blot
corresponded to a protein
with an apparent size of 65 kDa (Fig.
2,
fraction 4), whereas the low-mobility band had an apparent
molecular
weight of 98 kDa (Fig.
2, fraction 2), although in this
case,
significant levels of material were also observed in later
fractions
(e.g., fraction 5). These values were in agreement with
the putative
presence of a monomer and dimer forms of hexokinase
and suggested that
the upper band on the PAGE gel could contain
a mixture of the dimer and
monomer of Hxk2p but that only a monomer
would be present in the
faster-migrating band. In coincidence
with this, hexokinase activity
fractionated in a broad peak corresponding
to the elution of
catalytically active Hxk2p. Furthermore, crude
protein extracts from
galactose-grown cells were first separated
in native gels and then
subjected to an SDS-PAGE analysis in the
second dimension (Fig.
3A). The immunoblot confirmed that the
two defined bands in the native first-dimension analysis each
corresponded with Hxk2p subunits. All these results suggested
that
Hxk2p existed in vivo in a dimer-monomer equilibrium represented
in the
upper band on the PAGE gel. As mobility in native gels
is dependent on
both size and charge, the presence of a lower
band on the PAGE gel
could be attributed to differences in charge
between Hxk2p isoforms.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Gel filtration chromatography. Results of native gel
analysis (PAGE) and corresponding profiles of hexokinase activities of
crude extracts from WAY.glk1-5C cells cultivated on galactose are
shown. The molecular weights (MW) of the Hxk2p isoforms were calculated
from the standard curve. BSA, bovine serum albumin.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of Hxk2p isoforms by two-dimensional
electrophoresis. A protein crude extract from galactose-grown cells was
separated in the first dimension by 7.5% native PAGE. A slice from
this gel was electrophoresed in the second dimension on an SDS-10%
PAGE gel and immunodetected with biotinylated anti-Hxk2p (A) or
antiphosphoserine (B) antibodies. The phosphorylated monomer is
indicated by the open arrows.
|
|
It is known that Hxk2p is a phosphoprotein (
23,
48).
Accordingly, we investigated by immunodetection if the two PAGE forms
of Hxk2p also displayed different phosphorylation states. Western
blot
analyses, using antiphosphoserine antibody after a two-dimensional
electrophoresis, showed a clear spot corresponding with the lower
band
on the PAGE gel (Fig.
3B). Additionally, incubation at 30°C
of a
crude protein extract resulted in a drastic change in the
relative
abundance of the forms of Hxk2p (Fig.
4).
The lower band
disappeared, whereas a parallel increase of the upper
band was
observed. The use of phosphatase inhibitors blocked this
transition,
indicating that it was due to the activity of endogenous
protein
phosphatases. These results indicated that the lower band was
a
monomeric phosphorylated isoform of Hxk2p, whereas the upper
band could
be a mixture of the dimer and monomer but was unphosphorylated.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 4.
The Hxk2p monomer is a phosphoprotein. Protein extracts
(30 µg) from WAY.glk1-5C cells grown in galactose were incubated for
1 h at 30°C in the presence (+) or absence ( ) of phosphatase
inhibitors. As a control, samples were kept on ice. Proteins were
separated and analyzed as described in the legend for Fig. 1. UP,
unphosphorylated forms; P, phosphorylated form.
|
|
Glucose promotes in vivo dephosphorylation of Hxk2p.
To study
if the relative abundance of Hxk2p isoforms was affected by the
addition of glucose, wild-type cells grown exponentially in galactose
medium, were transferred to glucose-containing medium, and samples were
collected at the times indicated (Fig.
5). After 120 min of incubation, the
presence of glucose reduced the abundance of the phosphorylated monomer
and increased that of the unphosphorylated forms. Similar results were
also found when cells were grown on raffinose or ethanol medium and
then transferred to glucose-containing medium (data not shown). In
order to determine if this change was exclusively carbon source
dependent, wild-type cells growing in galactose were subjected to
different stress conditions. Neither heat shock nor oxidative or
osmotic stress induced a change in the relative abundance of the two
bands of Hxk2p (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Modification of the phosphorylated state of hexokinase
upon glucose addition. Wild-type cells (ENY.WA-1A) were grown to
mid-log phase on 2% galactose (Gal) medium and then transferred to 2%
glucose medium. Samples were taken at the indicated times (min).
Proteins (30 µg per lane) were separated and analyzed as indicated in
the legend for Fig. 1. UP, unphosphorylated forms; P, phosphorylated
form.
|
|
Therefore, the in vivo Hxk2p isoforms' equilibrium was carbon source
dependent. Cells growing with less easily fermentable
carbon sources
showed similar amounts of the unphosphorylated
and phosphorylated
isoforms, but in the presence of glucose the
unphosphorylated Hxk2p
isoforms were predominant.
The phosphorylation of Hxk2p is affected by Cid1p/Glc7p but not by
Cat1p/Snf1p.
To further investigate the dependency of the Hxk2p
isoform changes on glucose, we analyzed this process in different
glucose repression mutants (Fig. 6 and
7). When mig1/cat4 or
cyc8/ssn6 mutant cells were shifted from galactose to
glucose medium, the unphosphorylated forms of Hxk2p were predominant,
as in the wild-type strain. However, the transition of the
phosphomonomer to the unphosphorylated dimer-monomer forms was
abolished in cat80/grr1, hex2/reg1, and cid1/glc7-T152K mutants. It has been reported that in the
cat80/grr1 mutant glucose uptake is affected due to a
decrease in the expression of various HXT genes encoding for
glucose transporters (35, 47). Therefore, the glucose
repression defect in this mutant might be a mere corollary of reduced
glucose uptake and glycolytic flux. To test this possibility, the
transfer experiment was carried out with maltose as inducer of the
Hxk2p changes. Indeed, the transition of Hxk2p forms was observed upon
maltose addition to galactose-growing wild-type (Fig. 7A) and
cat80 (Fig. 6) cells. However, under the same conditions the
transition remained absent in cid1/glc7 mutants (Fig. 7A).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
Hxk2p dephosphorylation in different catabolite
repression mutants. Cells grown on galactose (Gal) medium were shifted
for 3 h to glucose (G)- or maltose (Mal)-containing medium, as
indicated. In the case of the cat1 mutant, cells were
cultivated on glucose and then transferred for 4 h to Gal or
ethanol (EtOH) medium. Protein samples from wild-type (WT; ENY.WA-1A),
mig1/cat4 (JS88.3-1A), cyc8/ssn6 (ENY/cyc8-2D),
cat80/grr1 (WAY.JF1), hex2/reg1
(ENY.hex2-3A), and cat1/snf1 (CEN.PK130-7B) cells
were treated as described in the legend to Fig. 1. Protein samples were
treated as described in the legend for Fig. 1. UP, unphosphorylated
forms; P, phosphorylated form.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of different carbon sources on the Hxk2p
phosphorylation in wild-type and cid1 mutant cells (top) and
-phosphatase treatment of a cid1 protein extract
(bottom). Cultures were grown in galactose (Gal) medium and then
transferred for 3 h to 2% glucose (G), 2% sucrose (Suc), or 2%
maltose (Mal) medium as indicated. (Lower) Protein extracts (30 µg)
from cid1 mutant cells grown in glucose were incubated for
1 h at 30°C in the absence ( ) or presence (+) of
-phosphatase and phosphatase inhibitors. Proteins were separated and
analyzed as described in the legend for Figure 1. UP, unphosphorylated
forms; P, phosphorylated form.
|
|
Since maltose promoted the dephosphorylation of Hxk2p in a wild-type
strain we tested if this result could be extended to
other rapidly
fermentable carbon sources. In fact, similar results
were found in
wild-type cells transferred to sucrose medium. Nevertheless,
no change
was observed in a
cid1 mutant strain (Fig.
7A).
As an independent approach to determining if the results observed in a
cid1 mutant were a consequence of the absence of the
PP1
function, we treated crude extracts from glucose-grown
cid1 cells with

-phosphatase in the presence or absence of phosphatase
inhibitors. Only under the latter condition was the transition
of Hxk2p
forms observed (Fig.
7B).
These results suggested that Cid1p was involved (directly or
indirectly) in the dephosphorylation of Hxk2p. Consistent with
this
conclusion was the fact that a mutant lacking Hex2p/Reg1p,
known to be
a regulatory subunit of Cid1p, showed the same Hxk2p
isoform pattern as
did
cid1 mutant cells (Fig.
6 and
7). Since
it has been
proposed that Hex2p directs the Cid1p activity towards
substrates in
the glucose repression pathway that are phosphorylated
by Cat1p/Snf1p
(
46), we examined whether the deletion of
CAT1/SNF1 affects the Hxk2p monomer-dimer equilibrium. We
found that when
cat1/snf1 cells were transferred from
glucose to galactose or
ethanol medium, the phosphorylated monomer of
hexokinase appeared
(Fig.
6), so
CAT1/SNF1 was not involved
in the phosphorylation
of Hxk2p.
The phosphorylation of hexokinase PII is required for glucose
signaling.
Since both Hxk2p and the Cid1p-Hex2p complex are
implicated in the glucose response, and in turn the PP1 function was
involved in the phosphorylation state of Hxk2p, we tried to clarify the physiological significance of the Hxk2p dephosphorylation in the in
vivo function of hexokinase PII.
It is known that the in vivo phosphorylation site of Hxk2p is S15
(
23,
48). We constructed integrative plasmids carrying
a
wild-type copy of the
HXK2 gene or a mutant copy encoding a
change at residue 15 from serine to alanine (S15A) to avoid
phosphorylation.
In both cases the protein was expressed under its own
promoter
in order to keep the same gene regulation conditions. Plasmids
were transformed into the triple kinase mutant strains WAY.78-1
(ENY.WA
background) and YSH7.4-3c (W303 background), and we examined
the
effects of this point mutation on in vivo Hxk2p phosphorylation.
Figure
8A shows the PAGE pattern of Hxk2p from
HXK2(
S15) and
HXK2(
S15A)
cells grown on galactose and transferred to glucose. As we expected,
cells containing a mutated enzyme, unable to undergo phosphorylation,
revealed a single band corresponding with unphosphorylated Hxk2p
forms.
In contrast, samples from the triple mutant strain WAY.78-1
transformed
with the wild-type gene
HXK2(
S15) exhibited the
same
bands as we described above (Fig.
6). The absence of
phosphorylation
in the mutated enzyme was also confirmed by
immunodetection with
antiphosphoserine antibody after a two-dimensional
electrophoresis
(Fig.
8C). Furthermore, crude protein extracts from
these transformant
cells were compared to their wild-type counterparts
by Western
blot analysis after SDS-PAGE (Fig.
8B). The S15A mutant
protein
showed the same relative mobility as wild-type Hxk2p.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
Hxk2p(S15A) is unable to undergo phosphorylation. Triple
null hexokinase mutants (WAY.78-1) carrying a single copy of
HXK2(S15) or HXK2(S15A)
were grown on 2% galactose (Gal) medium and then transferred to 2%
glucose (G) medium for 3 h. A total of 30 µg of crude protein
extracts was separated by PAGE (A) or by SDS-PAGE (B) and
immunodetected with ECL (A) or peroxidase-conjugated antibody (B). (C),
Crude protein extracts from galactose-grown transformants
[HXK2(S15A)] were separated by two-dimensional
electrophoresis and immunodetected with antiphosphoserine antibody. The
open arrow indicates the position in which the upper band on the PAGE
gel migrates in the second dimension (see also Fig. 3). UP,
unphosphorylated forms; P, phosphorylated form.
|
|
Since both the wild-type and the mutated enzyme were properly
expressed, we further examined the level of invertase activity
in these
transformants and in different sugar kinase mutants grown
on glucose
and raffinose (Table
2). Interestingly,
when Hxk2p
was unable to undergo phosphorylation (S15A), the cells
could
not provide glucose repression, as showed by the high invertase
values obtained under repressing conditions (Table
2). In light
of these results, we tested if this repression defect could be
extended
to other glucose-induced phenomena.
HXK2 is required for full induction of
HXT genes
by both high and low levels of glucose (
35). Therefore, we
studied the
glucose-induced expression of the hexose transporters
HXT1,
HXT2,
and
HXT4 in our
HXK2(
S15) and
HXK2(
S15A)
strains (Table
3). We
transformed
YIpHXK2(S15) and YIpHXK2(S15A) cells with plasmids
pBM2636,
pBM2717, and pBM2800 (
35), containing the
lacZ
gene
fused to the promoters of the
HXT1,
HXT2,
and
HXT4 genes, respectively.
Consistent with the high
invertase levels showed above, expression
of
HXT2 and
HXT4 in
HXK2(
S15A) transformants was
about fourfold
higher in cells grown on 4% glucose in comparison with
their
HXK2(
S15)
counterparts, while induction on
raffinose was reduced. Induction
of the
HXT1 gene by high
levels of glucose was also abolished
in cells with a mutated enzyme
(Table
3). Thus, the in vivo phosphorylation
of Hxk2p appeared to be
required both in the induction and repression
mechanisms of hexose
transporter genes.
Since the correlation between the sugar-phosphorylating activity of
hexokinase II and glucose repression is well documented
(
26,
37), we were interested in determining the catalytic
activity on
different carbon sources for wild-type and mutant
enzymes. As shown in
Table
4, crude extracts from
HXK2(
S15A)
cells grown on glucose exhibited a
lower in vitro hexokinase activity
than strains expressing the
wild-type enzyme. This was also true
for cells grown on raffinose or
galactose, although the particular
level of activity varied for each
carbon source and strain tested
(Table
4).
These results raised the possibility that the glucose-signaling defects
observed in the
HXK2(
S15A) transformant could be
the
result of a less enzymatically active form of Hxk2p. However,
Km determinations for the Hxk2(S15) and
Hxk2(S15A) enzymes from
glucose extracts did not reveal large
differences i.e. 2.1 ± 0.1
mM and 2.7 ± 0.3 mM,
respectively. On galactose, the
Km value
for the
wild-type enzyme increased (to 3.7 ± 0.2 mM), probably
as a
consequence of the variations in Hxk2p isoforms showed above.
In
consonance with this, no differences were found in the kinetic
constants for the mutated enzyme in all media tested. Growing
rates for
both transformants were also very similar [0.361 and
0.357 h
1 on glucose and 0.272 and 0.277 h
1 on
raffinose for
HXK2(
S15) and
HXK2(
S15A) transformants, respectively].
Therefore, both forms of Hxk2p displayed similar affinities for
their
substrate and provided enough sugar-phosphorylating activity
to support
growth at similar rates.
 |
DISCUSSION |
We show in this work that the association-dissociation equilibrium
of yeast hexokinase existed in vivo. This equilibrium was affected by
phosphorylation-dephosphorylation of the protein in response to carbon
source. Phosphorylation of hexokinases had been shown previously
(23, 48), but no relationship between this modification and
the conformational state of Hxk2p had been established yet. We also
show that the Hxk2p phosphoprotein was a monomer that underwent
dephosphorylation triggered by glucose addition.
Easily fermentable carbon sources such as glucose, maltose, and sucrose
were able to trigger the dephosphorylation of Hxk2p. Conversely, when
cells were grown with poorly fermentable or nonfermentable carbon
sources like raffinose, galactose, and ethanol both phosphorylated and
dephosphorylated forms appeared in similar amounts. These results were
consistent with the in vivo 32P-labeling experiments of
hexokinases which showed the most extensive phosphorylation in
galactose or low-glucose medium (23, 48).
The phosphorylated state of hexokinase was affected by the carbon
source, but this dependence was not regulated by the general mechanism
of glucose repression. As in wild-type cells, glucose-induced Hxk2p
transition was observed in mutants with defects in transcription factors or effectors involved in glucose repression
(cyc8/ssn6 [22, 49] and
mig1/cat4 [31]), indicating that this
effect was not a final result of the glucose repression pathway.
However, in mutants with defects affecting the primary steps of the
pathway (cat80/grr1 [1, 4, 9],
hex2/reg1 [9, 29], and cid1/glc7 [32]), the ratio of Hxk2p phosphorylated forms was not
altered by the presence of glucose, indicating that the transition was a specific response to glucose sensing, as we confirmed in a
cat80/grr1 mutant using maltose as the inductor of Hxk2p
transition. On maltose the dephosphorylation of hexokinases occurred in
this mutant, which confirmed that on glucose, cat80/grr1
mutants did not provide sufficient glucose to trigger dephosphorylation
because of a reduced glucose uptake.
An important finding was that in cid1/glc7 and
hex2/reg1 mutants the dephosphorylation of hexokinase did
not take place under any condition studied, suggesting that Hxk2p was a
direct or indirect target of the CID1/GLC7 protein
phosphatase.
Conversely to the results of previous studies on the functional role of
the phosphorylation of Hxk2p (23, 27), our experiments with
single-copy plasmids of the HXK2 gene controlled under its own promoter showed that this modification is key in the
glucose-signaling pathways. Both glucose repression and glucose-induced
expression of hexose transporters and glucose repression of invertase
were affected in cells expressing a Hxk2(S15A)-mutated protein, in a
similar manner to the defects reported for a null hxk2
mutant (8, 35). This observation was confirmed in different
genetic backgrounds.
In vitro hexokinase activity data showed less sugar phosphorylation in
crude extracts from HXK2(S15A) cells, raising the
possibility that those regulatory defects could be the result of a
reduced glucose metabolism. However, growth rate measurements indicated that the in vivo catalytic activity of the Hxk2(S15A) protein was very
similar to that of the wild type. It is worth pointing out that
previous studies have shown an inverse correlation between growth rate
and level of glucose repression, supporting the hypothesis that the
catalytic activity of hexokinase PII was correlated to its function in
glucose repression (26). Kinetic assessment results also
make it unlikely that large differences exist between wild-type and
mutant enzymes. The lower in vitro sugar-phosphorylating activity found
in HXK2(S15A) strains could be explained at least in part by shelf regulatory defects of the HXK2 gene.
Expression studies of hexose kinases have shown that HXK2 is
induced by glucose (6, 28). This response could be abolished
in HXK2(S15A) transformants in the same way
as we demonstrated for HXT genes. In the present study, this
possibility was well correlated with some differences observed in the
amount of Hxk2p detectable by PAGE and SDS-PAGE in extracts from cells
of wild-type and mutant enzyme (Fig. 8). Hence, the phenotype presented
in this work for the HXK2(S15A) transformants
could be ascribed to a glucose-signaling defect. Although, we cannot
rule out completely a metabolic problem as the origin of this
phenotype, the evidence presented here leads us to suggest that the
lower hexokinase activity values found are a secondary consequence of
this signaling defect and not the origin of it.
In contrast to an earlier hypothesis placing Hxk2p as a part of a
putative glucose sensor (for review, see reference
42), our results suggest that hexokinase PII is
involved in the transduction of glucose signals. In this role, the
phosphorylated monomer of Hxk2p would be a key element, being able to
receive the signal and to transmit it. How the phosphorylation state of
Hxk2p controls the on-off switching of the signal is still an open
question. The genetic evidence presented in this work shows that Hxk2p
is a direct or indirect target of the protein phosphatase Cid1p-Hex2p complex, suggesting a putative interaction between the Hxk2p
phosphorylated monomer and this protein complex. As a result of this
interaction downstream elements would be activated in the transmission
of the glucose signal. In this model, the phosphate group would likely be critical for controlling the affinity of the interaction site of
Hxk2p with the Cid1p-Hex2p complex. By removing the phosphate, the
strength of the interaction would be decreased, making the signal
transduction weaker. Thus, the Hxk2(S15A) mutant protein would still be
able to interact in some manner with such a complex, giving a certain
grade of glucose sensitivity (Table 2). By overexpressing the
Hxk2(S15A) protein, the interaction could be improved and the glucose
repression signal transmitted as previously reported (23,
27).
To make the phosphorylation reversible there clearly must be a specific
protein kinase. Our results exclude the possibility that Cat1p/Snf1p
could be the kinase of Hxk2p. Phosphorylation of hexokinase by protein
kinase A has also been dismissed (48) even though the
phosphorylation site (Ser 15) has been located in a protein kinase A
consensus phosphorylation sequence. It remains possible that in vivo
phosphorylation of hexokinase could be the result of substrate-induced
autophosphorylation, as has been investigated previously
(11).
We hypothesize that the specific role of hexokinase PII in the glucose
response is mediated by phosphorylation-dephosphorylation. Our future
efforts will seek to identify downstream targets of Hxk2p and to
further clarify the connections between Cid1p-Hex2p and Hxk2p in
glucose signal transduction. Experiments to further investigate these
issues are now in progress.
 |
ACKNOWLEDGMENTS |
We are very grateful to M. Johnston for providing the
HXT::lacZ plasmids and to J. M. Thevelein for
the yeast strains W303-1A, YSH7.4-11A, and YSH7.4-3C. We thank the
members of the K.-D.E. laboratory for helpful discussion.
This work was supported by Conselleria de Educacion y Ciencia,
Generalitat Valenciana Project GV-3125/95. F.R.G. is supported by a
fellowship from the MEC of Spain.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Biotecnología, Instituto de Agroquímica y
Tecnología de los Alimentos, Consejo Superior de
Investigaciones Científicas, P.O. Box 73, 46100 Burjassot,
Valencia, Spain. Phone: 34 6 3900022. Fax: 34 6 3636301. E-mail:
Prieto{at}iata.csic.es.
 |
REFERENCES |
| 1.
|
Bailey, R. B., and A. Woodward.
1984.
Isolation and characterization of a pleiotropic glucose repression resistant mutant of Saccharomyces cerevisiae.
Mol. Gen. Genet.
193:507-512[Medline].
|
| 2.
|
Bergmeyer, H. U.
1974.
In
Methods of enzymatic analysis, 2nd ed., p. 473.
Verlag Chemie GmbH, Weinheim, Germany.
|
| 3.
|
Celenza, J. L., and M. Carlson.
1986.
A yeast gene that is essential for release from glucose repression encodes a protein kinase.
Science
233:1175-1180[Abstract/Free Full Text].
|
| 4.
|
Conklin, D. S.,
C. Kung, and M. R. Culbertson.
1993.
The COT2 gene is required for glucose-dependent divalent cation transport in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:2041-2049[Abstract/Free Full Text].
|
| 5.
|
Davis, B. J.
1964.
Disc electrophoresis. II. Method and application to human serum proteins.
Ann. N.Y. Acad. Sci.
121:404-427.
|
| 6.
|
De Winde, J. H.,
M. Crauwels,
S. Hohmann,
J. M. Thevelein, and J. Winderickx.
1996.
Differential requirements of the yeast sugar kinases for sugar sensing in establishing the catabolite-repressed state.
Eur. J. Biochem.
241:633-643[Medline].
|
| 7.
|
Easterby, J. S., and M. A. Rosemeyer.
1972.
Purification and subunit interactions of yeast hexokinase.
Eur. J. Biochem.
28:241-252[Medline].
|
| 8.
|
Entian, K.-D.
1980.
Genetic and biochemical evidence for hexokinase PII as a key enzyme involved in catabolite repression in yeast.
Mol. Gen. Genet.
178:633-637[Medline].
|
| 9.
|
Entian, K.-D., and F. K. Zimmermann.
1980.
Glycolytic enzymes and intermediates in carbon catabolite repression mutants of Saccharomyces cerevisiae.
Mol. Gen. Genet.
177:345-350[Medline].
|
| 10.
|
Feng, Z.,
S. E. Wilson,
Z. Y. Peng,
K. K. Schlender,
E. M. Reiman, and R. J. Trumbly.
1991.
The yeast GLC7 gene required for glycogen accumulation encodes a type 1 protein phosphatase.
J. Biol. Chem.
266:23796-23801[Abstract/Free Full Text].
|
| 11.
|
Fernández, R.,
P. Herrero,
E. Fernández,
M. T. Fernández,
Y. S. López-Boado, and F. Moreno.
1988.
Autophosphorylation of yeast hexokinase PII.
J. Gen. Microbiol.
134:2493-2498[Medline].
|
| 12.
|
Frederick, D. L., and K. Tatchell.
1996.
The REG2 gene of Saccharomyces cerevisiae encodes a type 1 protein phosphatase-binding protein that functions with Reg1p and the Snf1 protein kinase to regulate growth.
Mol. Cell. Biol.
16:2922-2931[Abstract].
|
| 13.
|
Furman, T. C., and K. E. Neet.
1983.
Association equilibria and reacting enzyme gel filtration of yeast hexokinase.
J. Biol. Chem.
258:4930-4936[Abstract/Free Full Text].
|
| 14.
|
Gancedo, J. M.
1992.
Carbon catabolite repression in yeast.
Eur. J. Biochem.
206:297-313[Medline].
|
| 15.
|
Gascon, S., and J. O. Lampen.
1968.
Purification of the internal invertase of yeast.
J. Biol. Chem.
243:1573-1577[Abstract/Free Full Text].
|
| 16.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[Medline].
|
| 17.
|
Goding, J. W.
1986.
In
Monoclonal antibodies: principles and practice, 2nd ed.
Academic Press, New York, N.Y.
|
| 18.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 19.
|
Hoggett, G., and G. L. Kellett.
1992.
Kinetics of the monomer-dimer reaction of yeast hexokinase PI.
Biochem. J.
287:567-572.
|
| 20.
|
Ito, H.,
K. Jukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 21.
|
Johnston, M., and M. Carlson.
1992.
Regulation of carbon and phosphate utilization, p. 193-28.
In
J. Brosch, et al. (ed.), Gene expression: the molecular and cellular biology of the yeast Saccharomyces, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Keleher, C. A.,
M. J. Redd,
J. Schultz,
M. Carlson, and A. D. Johnson.
1992.
Ssn6-Tup1 is a general repressor of transcription in yeast.
Cell
68:708-719.
|
| 23.
|
Kriegel, T. M.,
J. Rush,
A. B. Vojtek,
D. Clifton, and D. G. Fraenkel.
1994.
In vivo phosphorylation site of hexokinase 2 in Saccharomyces cerevisiae.
Biochemistry
33:148-152[Medline].
|
| 24.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 25.
|
Lutfiyya, L. L., and M. Johnston.
1996.
Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression.
Mol. Cell. Biol.
16:4790-4797[Abstract].
|
| 26.
|
Ma, H.,
L. M. Bloom,
C. T. Walsh, and D. Botstein.
1989.
The residual enzymatic phosphorylation activity of hexokinase II mutants is correlated with glucose repression in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:5643-5649[Abstract/Free Full Text].
|
| 27.
|
Ma, H.,
L. M. Bloom,
S. Dakin,
C. T. Walsh, and D. Botstein.
1989.
The 15 N-terminal amino acids of hexokinase II are not required for in vivo function: analysis of a truncated form of hexokinase II in Saccharomyces cerevisiae.
Proteins
5:218-223[Medline].
|
| 28.
|
Martínez-Campa, C.,
P. Herrero,
M. Ramírez, and F. Moreno.
1996.
Molecular analysis of the promoter region of the hexokinase 2 gene of Saccharomyces cerevisiae.
FEMS Lett.
137:69-74.
|
| 29.
|
Matsumoto, K.,
T. Yoshimatsu, and Y. Oshima.
1983.
Recessive mutations conferring resistance to carbon catabolite repression of galactokinase synthesis in Saccharomyces cerevisiae.
J. Bacteriol.
153:1405-1414[Abstract/Free Full Text].
|
| 30.
|
Mayes, E. L.,
J. G. Hoggett, and G. L. Kellett.
1983.
The binding of glucose to native and proteolytically modified yeast hexokinase PI.
Eur. J. Biochem.
133:127-134[Medline].
|
| 31.
|
Nehlin, J. O., and H. Ronne.
1990.
Yeast MIG1 repressor is related to the mammalian early growth response and Wilm's tumour finger proteins.
EMBO J.
9:2891-2898[Medline].
|
| 32.
|
Neigeborn, L., and M. Carlson.
1987.
Mutations causing constitutive invertase synthesis in yeast: genetic interactions with snf mutations.
Genetics
115:247-253[Abstract/Free Full Text].
|
| 33.
|
Ohkura, H.,
N. Kinoshita,
S. Minatani,
S. Toda, and M. Yanagida.
1989.
The fission yeast dis2+ gene required for chromosome disjoining encodes one of two putative type 1 protein phosphatases.
Cell
57:997-1007[Medline].
|
| 34.
|
Özcan, S.,
K. Freidel,
A. Leuker, and M. Ciriacy.
1993.
Glucose uptake and catabolite repression in dominant HTR1 mutants of Saccharomyces cerevisiae.
J. Bacteriol.
175:5520-5528[Abstract/Free Full Text].
|
| 35.
|
Özcan, S., and M. Johnston.
1995.
Three different regulatory mechanisms enable yeast hexose transporter (HXT) genes to be induced by different levels of glucose.
Mol. Cell. Biol.
15:1564-1572[Abstract].
|
| 36.
|
Ronne, H.
1995.
Glucose repression in fungi.
Trends Genet.
11:12-17[Medline].
|
| 37.
|
Rose, M.,
W. Albig, and K.-D. Entian.
1991.
Glucose repression in Saccharomyces cerevisiae is directly associated with hexose phosphorylation by hexokinases PI and PII.
Eur. J. Biochem.
199:511-518[Medline].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 40.
|
Sanz, P.,
A. Nieto, and J. A. Prieto.
1996.
Glucose repression may involve processes with different sugar kinase requirements.
J. Bacteriol.
178:4721-4723[Abstract/Free Full Text].
|
| 41.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
In
Methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 42.
|
Thevelein, J. M., and S. Hohmann.
1995.
Trehalose synthase: guard to the gate of glycolysis in yeast.
Trends Biochem. Sci.
20:3-10[Medline].
|
| 43.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. U.S.A.
76:4350-4354[Abstract/Free Full Text].
|
| 44.
|
Treitel, M. A., and M. Carlson.
1995.
Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein.
Proc. Natl. Acad. Sci. USA
92:3132-3136[Abstract/Free Full Text].
|
| 45.
|
Tu, J., and M. Carlson.
1994.
The GLC7 type 1 protein phosphatase is required for glucose repression in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:6789-6796[Abstract/Free Full Text].
|
| 46.
|
Tu, J., and M. Carlson.
1995.
REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae.
EMBO J.
14:5939-5946[Medline].
|
| 47.
|
Vallier, L. G.,
D. Coons,
L. F. Bisson, and M. Carlson.
1994.
Altered regulatory responses to glucose are associated with a glucose transport defect in grr1 mutants of Saccharomyces cerevisiae.
Genetics
136:1279-1285[Abstract].
|
| 48.
|
Vojtek, A. B., and D. G. Fraenkel.
1990.
Phosphorylation of yeast hexokinases.
Eur. J. Biochem.
190:371-375[Medline].
|
| 49.
|
Williams, F. E.,
U. Varanasi, and R. J. Trumbly.
1991.
The CYC8 and TUP1 proteins involved in glucose repression in Saccharomyces cerevisiae are associated with a protein complex.
Mol. Cell. Biol.
11:3307-3316[Abstract/Free Full Text].
|
| 50.
|
Womack, F., and S. P. Colowick.
1978.
Catalytic activity with associated and dissociated forms of the yeast hexokinases.
Arch. Biochem. Biophys.
191:742-747[Medline].
|
| 51.
|
Woolfitt, A. R.,
G. L. Kellett, and J. G. Hoggett.
1988.
The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.
Biochim. Biophys. Acta
952:238-243[Medline].
|
Mol Cell Biol, May 1998, p. 2940-2948, Vol. 18, No. 5
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kingsbury, J. M., Goldstein, A. L., McCusker, J. H.
(2006). Role of Nitrogen and Carbon Transport, Regulation, and Metabolism Genes for Saccharomyces cerevisiae Survival In Vivo. Eukaryot Cell
5: 816-824
[Abstract]
[Full Text]
-
Santangelo, G. M.
(2006). Glucose Signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
70: 253-282
[Abstract]
[Full Text]
-
Lemaire, M., Wesolowski-Louvel, M.
(2004). Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis. Genetics
168: 723-731
[Abstract]
[Full Text]
-
Blanc, G., Wolfe, K. H.
(2004). Functional Divergence of Duplicated Genes Formed by Polyploidy during Arabidopsis Evolution. Plant Cell
16: 1679-1691
[Abstract]
[Full Text]
-
CEULEMANS, H., BOLLEN, M.
(2004). Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button. Physiol. Rev.
84: 1-39
[Abstract]
[Full Text]
-
Bar, D., Golbik, R., Hubner, G., Lilie, H., Muller, E.-C., Naumann, M., Otto, A., Reuter, R., Breunig, K. D., Kriegel, T. M.
(2003). The Unique Hexokinase of Kluyveromyces lactis: MOLECULAR AND FUNCTIONAL CHARACTERIZATION AND EVALUATION OF A ROLE IN GLUCOSE SIGNALING. J. Biol. Chem.
278: 39280-39286
[Abstract]
[Full Text]
-
Horak, J., Regelmann, J., Wolf, D. H.
(2002). Two Distinct Proteolytic Systems Responsible for Glucose-induced Degradation of Fructose-1,6-bisphosphatase and the Gal2p Transporter in the Yeast Saccharomyces cerevisiae Share the Same Protein Components of the Glucose Signaling Pathway. J. Biol. Chem.
277: 8248-8254
[Abstract]
[Full Text]
-
Diderich, J. A., Raamsdonk, L. M., Kruckeberg, A. L., Berden, J. A., Van Dam, K.
(2001). Physiological Properties of Saccharomyces cerevisiae from Which Hexokinase II Has Been Deleted. Appl. Environ. Microbiol.
67: 1587-1593
[Abstract]
[Full Text]
-
Petit, T., Diderich, J. A., Kruckeberg, A. L., Gancedo, C., Van Dam, K.
(2000). Hexokinase Regulates Kinetics of Glucose Transport and Expression of Genes Encoding Hexose Transporters in Saccharomyces cerevisiae. J. Bacteriol.
182: 6815-6818
[Abstract]
[Full Text]
-
Ashe, M. P., De Long, S. K., Sachs, A. B.
(2000). Glucose Depletion Rapidly Inhibits Translation Initiation in Yeast. Mol. Biol. Cell
11: 833-848
[Abstract]
[Full Text]
-
Sanz, P., Alms, G. R., Haystead, T. A. J., Carlson, M.
(2000). Regulatory Interactions between the Reg1-Glc7 Protein Phosphatase and the Snf1 Protein Kinase. Mol. Cell. Biol.
20: 1321-1328
[Abstract]
[Full Text]
-
de Groot, E., Bebelman, J.-p., Mager, W. H., Planta, R. J.
(2000). Very low amounts of glucose cause repression of the stress-responsive gene HSP12 in Saccharomyces cerevisiae. Microbiology
146: 367-375
[Abstract]
[Full Text]
-
Lalonde, S., Boles, E., Hellmann, H., Barker, L., Patrick, J. W., Frommer, W. B., Ward, J. M.
(1999). The Dual Function of Sugar Carriers: Transport and Sugar Sensing. Plant Cell
11: 707-726
[Full Text]
-
Munoz-Alonso, M. J., Guillemain, G., Kassis, N., Girard, J., Burnol, A.-F., Leturque, A.
(2000). A Novel Cytosolic Dual Specificity Phosphatase, Interacting with Glucokinase, Increases Glucose Phosphorylation Rate. J. Biol. Chem.
275: 32406-32412
[Abstract]
[Full Text]