Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3112-3119, Vol. 18, No. 6
Department of Molecular Biology,
Received 15 December 1997/Returned for modification 29 January
1998/Accepted 26 February 1998
Vascular endothelial growth factor (VEGF) is a hypoxia-inducible
angiogenic growth factor that promotes compensatory angiogenesis in
circumstances of oxygen shortage. The requirement for translational regulation of VEGF is imposed by the cumbersome structure of the 5'
untranslated region (5'UTR), which is incompatible with efficient translation by ribosomal scanning, and by the physiologic requirement for maximal VEGF production under conditions of hypoxia, where overall
protein synthesis is compromised. Using bicistronic reporter gene
constructs, we show that the 1,014-bp 5'UTR of VEGF contains a
functional internal ribosome entry site (IRES). Efficient
cap-independent translation is maintained under hypoxia, thereby
securing efficient production of VEGF even under unfavorable stress
conditions. To identify sequences within the 5'UTR required for maximal
IRES activity, deletion mutants were analyzed. Elimination of the
majority (851 nucleotides) of internal 5'UTR sequences not only
maintained full IRES activity but also generated a significantly more
potent IRES. Activity of the 163-bp long "improved" IRES element
was abrogated, however, following substitution of a few bases near the
5' terminus as well as substitutions close to the translation start
codon. Both the full-length 5'UTR and its truncated version function as
translational enhancers in the context of a monocistronic mRNA.
Vascular endothelial growth factor
(VEGF) plays a key role in the initiation of blood vessel formation.
VEGF is produced by and secreted from the tissue toward which new blood
vessels eventually extend. A large body of evidence supports the notion
that the amount of VEGF produced determines the magnitude of the
angiogenic response through interaction with cognate receptors
expressed on nearby endothelial cells. VEGF expression is tightly
regulated in vivo, and a deviation from the normal levels of VEGF might be detrimental to the vasculature. For example, a reduction of VEGF
gene dosage by one-half (in mice heterozygous for an inactivating mutation in VEGF) leads to severe vascular defects and early embryonic death (6, 9). Conversely, overexpression of VEGF may lead to
pathologies like retinopathy, underlined by excessive proliferation of
blood vessels (1, 28).
VEGF expression can be modulated in vitro by a variety of agents,
including a number of cytokines, growth factors, and steroid hormones.
However, from a physiological point of view, regulation of VEGF by
hypoxia is the most significant. Insufficient vascular supply and the
resultant reduction in tissue oxygen tension often lead to compensatory
neovascularization acting to satisfy the metabolic needs of the tissue.
Hypoxia-induced VEGF was found to be the key mediator of this feedback
response (30, 33). VEGF is regulated by hypoxia at both the
transcriptional and posttranscriptional levels. Transcriptional
regulation of VEGF is mediated by the transcription factor
hypoxia-inducible factor 1, which accumulates under conditions of
hypoxia and activates VEGF transcription through binding to specific
promoter sequences (10). Hypoxia also leads to stabilization
of VEGF mRNA (13, 32, 36). The intrinsically short half-life
of VEGF mRNA (approximately 30 min) is significantly extended under
stress, presumably through hypoxia-augmented binding of an unidentified
protein(s) to its 3' untranslated region (3'UTR) (22). Both
mechanisms act to increase the steady-state levels of VEGF mRNA.
However, it is not known whether the production of VEGF is also
regulated at the level of mRNA translation or, in particular, whether
the mode or extent of VEGF translation is affected by hypoxia.
Initiation of eukaryotic protein synthesis involves about 10 initiation
factors (eIFs). The members of the eIF4 group of initiation factors
collectively catalyze the recognition of the mRNA cap, the unwinding of
mRNA secondary structure, and the binding of mRNA to the 43S
preinitiation complex (27). The selection of a particular
mRNA from the pool of translatable RNAs is determined by the relative
efficiency by which eIF4E binds to the cap structure, and the
efficiency of translation initiation by ribosome scanning is governed
largely by the composition and structure of the 5'UTR of the mRNA
(19, 35).
The 5'UTR of VEGF has several features which are incompatible with
efficient ribosomal scanning. First, it is considerably longer (1,014 nucleotides in the mouse) than most eukaryotic 5'UTRs. Second, it has a
high G+C content (comprising 64% of 5'UTR sequences and 80% of the
100 nucleotides preceding the translation initiation codon) and can
potentially form complex, stable secondary structures. Third, the 5'UTR
contains a short open reading frame bounded by in-frame initiation and
termination codons. The inherent difficulty for efficient ribosome
scanning, in conjunction with findings that certain cellular genes may
also use internal ribosome entry sites (IRESs), has prompted us to
examine the possibility that VEGF mRNA is translated in a
cap-independent mode.
IRES elements were first discovered in picornavirus mRNAs,
which are naturally uncapped but nonetheless efficiently translated (15, 29). Subsequently, it was found that some cellular RNAs which are normally capped can also be translated by an internal ribosome binding mechanism. The list of cellular genes shown to contain
sequences mediating internal initiation within their 5'UTR includes the
immunoglobulin heavy-chain binding protein (BiP) (24),
antennapedia (26), fibroblast growth factor (39), platelet-derived growth factor B (PDGF-B) (4), insulin-like growth factor II (38), and the translation initiation factor eIF4G (12). We present evidence here that the 5'UTR of VEGF mRNA directs internal translation initiation in vivo.
The option of internal initiation is an advantage for competition with
other mRNAs when a certain component of the eIF4 complex becomes rate
limiting and provides a given mRNA with the ability to be translated at
times when cap-dependent translation is compromised. Such circumstances
may develop under conditions of hypoxia, when overall protein synthesis
is significantly inhibited (20). Paradoxically, however,
VEGF ought to be maximally produced during hypoxia to fulfill its
function as a mediator of hypoxia-driven angiogenesis and to rescue the
tissue from ischemic injury. These considerations have led us to
examine the performance of the 5'UTR under conditions of hypoxic
stress.
Construction of bicistronic and monocistronic expression
plasmids.
The basic bicistronic vector (designated B/0) and basic
monocistronic vector (designated M/0) used in this study for insertion of 5'UTR elements were provided by QBI Enterprises (Nes-Ziona, Israel).
Their structures are shown in Fig. 1A and
B.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Translation of Vascular Endothelial Growth Factor
mRNA by Internal Ribosome Entry: Implications for Translation
under Hypoxia
Hadassah Medical School,
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (26K):
[in a new window]
FIG. 1.
Vectors and constructs used in this study. (A) A
bicistronic expression vector in which expression of a bicistronic mRNA
is driven by a CMV promoter. A firefly luciferase (LUC) is translated
from the first cistron, and a SeAP is translated from the second
cistron. Putative IRES elements are inserted into the intercistronic
space (ICS). (B) A monocistronic expression vector in which SeAP
expression is driven by a CMV promoter. Sequence elements tested for a
translation-modulating activity are inserted upstream of the SeAP
coding region. (C) Designations of bicistronic and monocistronic
constructs used in this study (see Materials and Methods for details).
The nucleotide numbers inside the rectangles represent the insert
length. ND, not done.
Cell culture and DNA transfections. C6 cells, a clonal glial cell line derived from a rat glial tumor (3), were grown in Dulbecco modified Eagle medium (DMEM) containing 5% fetal calf serum and antibiotics. The human cell line 293 (adenovirus-transformed fetal kidney cells), mouse NIH 3T3 cells, and rat primary astrocytes were maintained in DMEM containing 10% fetal calf serum and antibiotics. Primary rat astrocytes were prepared as described previously (11).
The cells were exposed to hypoxia by being placed in 1% oxygen in a CO2/O2 incubator (Forma Scientific), in which oxygen levels are monitored and adjusted automatically, except for the experiment in Fig. 3C, for which the cells were incubated for 20 h in a GasPak Plus anaerobic culture chamber (BBL Microbiology Systems) utilizing hydrogen and a palladium catalyst to remove all traces of oxygen. Transfections were performed with Lipofectin (Gibco BRL) as follows. Cells were plated at a density of 1 × 105 to 2 × 105 cells per 60-mm plate and grown for 24 h. Medium was replaced with serum-free DMEM, and 200 µl of DNA-Lipofectin suspension (containing 2 µg of supercoiled plasmid and 15 µg of Lipofectin, preincubated at room temperature for 40 min) was added in a dropwise manner. The medium was replaced 14 h later with a medium supplemented with serum and antibiotics, and the cells were incubated for an additional 48 h before being split into a selection medium containing G418 (2 mg/ml). Selection continued for 10 to 14 days, and more than 50 individual G418-resistant clones were pooled for each plasmid. For transient transfections, cells were seeded at a density of 2 × 105 cells per 1-cm well and transfected 24 h later with 1 µg of DNA per well by the calcium phosphate procedure (17). Cells and media were harvested 36 h posttransfection. Cell extracts were analyzed for luciferase (LUC) activity or used for mRNA preparation (in the latter case, 10 µg of DNA was used to transfect 2 × 106 to 2.5 × 106 cells per 100-mm plate), while the medium was used for analysis of SeAP activity.RNA analysis. Total RNA was prepared by the guanidinium thiocyanate/phenol-chloroform extraction procedure (7).
(i) Analysis of mRNA in polysomal fractions.
Protein
synthesis was instantaneously arrested by treating the culture with
cycloheximide (90 µg/ml) for 10 min. Cells were collected, washed
with phosphate-buffered saline, and kept at 
70°C until analyzed.
Cell lysis, size fractionation of polysomes by sedimentation through
sucrose gradients, and preparation of ribosome-associated RNAs were
performed as described previously (25).
(ii) Northern blotting. RNA was denatured in glyoxal and electrophoresed through a 1.0% agarose gel. RNAs were transferred onto a nylon-based membrane (GeneScreen Plus; NEN) by the capillary blot procedure and were hybridized with the indicated cDNAs labeled with 32P by randomly primed DNA synthesis. For standardization, rRNAs were visualized by staining with methylene blue before hybridization. For relative quantification, autoradiograms were scanned with a phosphorimager (FUJIX BAS 1000 bioimaging analyzer). The hybridization probes used were Luciferase (a 1.7-kb cDNA fragment including all of the coding region of firefly luciferase) and SeAP (a 1.5-kb cDNA fragment including the coding region of the human SeAP).
(iii) RT-PCR. Semiquantitative RT-PCR was performed with a single-tube, one-step RT-PCR system (Access RT-PCR system; Promega) and 20 cycles of amplification. The oligonucleotide primers used for reverse transcription and amplification of the various splicing variants of VEGF mRNA were 5'GAGAGAATGAGCTTCCTACAG3' and 5'TCACCGCCTTGGCTTGTCACA3' (derived from the common fourth and eighth exons, respectively). PCR products were resolved by agarose gel electrophoresis and detected by blot hybridization with a VEGF-specific, 32P-labeled cDNA probe (a 0.6-kb mouse cDNA fragment encoding VEGF165 [33rsqb;).
LUC and SeAP analysis.
LUC enzymatic activity in cell
extracts was determined by using a commercial LUC assay system
(Promega) and the procedure recommended by the supplier. The light
generated was measured with a Lumac/3M BIOCOUNTER M2010 luminometer.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
To evaluate the efficiency at which VEGF mRNA is translated, cytoplasmic extracts were prepared from primary astrocytes and fractionated by centrifugation through a sucrose gradient into subpolysomal and polysomal fractions. The relative abundance of VEGF mRNA in these fractions was determined by quantitative RT-PCR. As shown in Fig. 2B, the bulk of VEGF mRNA was associated with polyribosomes, indicating that the majority of VEGF mRNA is engaged in active protein synthesis. This result suggested that VEGF mRNA is efficiently translated under normal growth conditions despite its cumbersome 5'UTR.
|
To determine whether translation of VEGF mRNA is inhibited under conditions of severe hypoxia, a similar analysis was carried out with astrocytes grown in culture under 1% oxygen for 16 h. Astrocytes were chosen for this study since they are the first cells to respond to hypoxia of neuronal tissues in vivo by upregulating VEGF mRNA expression and are therefore the cells responsible for the feedback angiogenic response (37). As shown in Fig. 2A, the fraction of RNA associated with polyribosomes was reduced by 50% in comparison with that in cells grown under normoxia. Metabolic labeling experiments, measuring the incorporation of [35S]methionine into newly made proteins, showed that under the same hypoxic conditions, protein synthesis was reduced by 55% (data not shown). This result is consistent with previous observations that hypoxia causes about 30 to 50% inhibition in overall protein synthesis (20). Despite the general impairment of protein synthesis, the majority of VEGF RNA remained associated with polysomes (Fig. 2B). Notably, all isoforms of VEGF mRNA remained associated with the polyribosomal fraction, including the shortest, VEGF121, which can accommodate no more than three or four ribosomes when translated at a theoretically maximal rate. In contrast, the fraction of polysome-associated mRNA encoding a reference ribosomal protein L19 was reduced twofold following exposure to hypoxia (as determined by densitometry of the respective hybridizations in the subpolysomal and polysomal fractions). These results suggest that the translation machinery can handle most, if not all, VEGF mRNA, even when the amount of available mRNA increases by 1 order of magnitude due to hypoxia (33).
The fact that translation of VEGF mRNA is very efficient despite its length and high G+C content prompted us to examine whether VEGF mRNA can be translated by internal ribosome entry. Bicistronic mRNAs have been effectively used in vivo to demonstrate the existence of IRESs in both picornavirus (29) and cellular (4, 24, 39) mRNAs. A eukaryotic expression vector was constructed in which a cytomegalovirus (CMV) promoter drives the expression of a bicistronic RNA. The first cistron in the bicistronic mRNA used in this study, encoding LUC, should be translated by a conventional cap-dependent scanning mechanism. As ribosomes fail to continue scanning through the intercistronic region, the second cistron, encoding SeAP, should be translated only if preceded by an IRES. The SeAP cistron was chosen as the downstream cistron since secretion of the enzyme into the culture medium allows accurate quantification and continuous monitoring of protein synthesis. To prevent leaky translation into the second cistron, the intercistronic region included termination codons in all possible reading frames. Furthermore, the fact that the protein translated from the first cistron is an intracellular protein whereas the protein translated from the second cistron is secreted ruled out the possibility of a fused protein retaining both enzymatic activities. The 5'UTR of VEGF was subcloned by precise PCR amplification, inserted into the intercistronic spacer region, and transfected into a C6 rat glioma cell line. Pools of stably transfected clones were prepared, each composed of at least 50 individual clones. Analysis of pools ensured that possible differences in gene expression due to different integration sites were averaged. The reporter gene activity in transfectants obtained with the bicistronic vector alone (designated B/0) and with the bicistronic vector containing the VEGF 5'UTR (designated B/UTR) was determined.
The two constructs expressed a bicistronic mRNA from which LUC was translated with a comparable efficiency. Analysis of the downstream cistron, however, revealed that B/0 produced a negligible amount of SeAP activity, confirming minimal, if any, readthrough of ribosomes from the LUC to the SeAP cistron (Fig. 3). In contrast, B/UTR directed the production of high levels of SeAP in a continuous manner, indicating that the 5'UTR of VEGF contains a functional IRES element. To appreciate the relative strength of the VEGF IRES, a comparison was made with the well-characterized cellular IRES contained in the 5'UTR of BiP mRNA (24). To this end, the 5'UTR of BiP was inserted into the same site of the bicistronic vector and pools of stable transfectants were prepared and similarly analyzed for LUC and SeAP production. As shown in Fig. 3B, the VEGF IRES was fivefold more efficient than the BiP IRES in directing SeAP production.
|
While there is a clear rationale for the use of internal initiation in viruses, the advantage of internal initiation in cellular mRNAs is not always clear. In the case of VEGF, however, the capacity for cap-independent translation might be particularly advantageous during hypoxia, when overall protein synthesis is compromised. Therefore, we have also examined the translation of the bicistronic mRNA in cultures grown under hypoxia. Under conditions of hypoxic stress, when translation of LUC from the upstream cistron was reduced, the rate of SeAP production, presumably by internal initiation, was unaffected (Fig. 3C) and SeAP was secreted into the culture medium at the same constant rate as under normoxic conditions (Fig. 3A).
To rule out the possibility that in B/UTR-transfected cells the protein encoded by the second cistron is translated from a monocistronic SeAP mRNA, an RNA blot hybridization analysis was carried out with both a LUC-specific probe and a SeAP-specific probe (Fig. 4). A single band of RNA was detected in each case, corresponding to the expected size of the respective bicistronic transcript (the larger size of hybridized mRNA in B/UTR-transfected cells is due to the addition of 1,014 bp of 5'UTR sequence, and the slightly larger size in B/BiP is due to the addition of 221 bp of 5'UTR sequence). Hybridization with both a LUC-specific probe and a SeAP-specific probe detected a single mRNA species of a comparable size in each case, indicating that both cistrons are contained in a single transcript. While a limited electrophoretic resolution prevents the conclusion of an identical transcript, we note the failure to detect more than one transcript. Importantly, the failure to detect a band corresponding in size to that of a presumptive monocistronic SeAP mRNA ruled out the possibility that a significant amount of SeAP is translated from a monocistronic SeAP mRNA. Also, the inclusion of the 5'UTR had no significant effect on the steady-state level of the bicistronic mRNA expressed, indicating that differences in measured LUC and SeAP activities are due mostly to differences in translation efficiencies. Nevertheless, the steady-state level of the bicistronic mRNA was determined in each transfectant by densitometry of Northern blots and was used for normalizing enzymatic activity.
|
A deletion analysis of the VEGF 5'UTR was carried out to identify sequences within the 5'UTR that are both necessary and sufficient for internal ribosome entry. This analysis was greatly facilitated by the isolation of an RT-PCR-amplified DNA fragment representing a truncated version of the 5'UTR. The 163-nucleotide sequence, designated SP163, is shown in Fig. 5. SP163 is composed of the 5' cap-containing segment of 31 (or 32) nucleotides juxtaposed to the 132 (or 131) nucleotides preceding the initiator AUG codon. Although it is not known whether this particular truncated version of the 5'UTR represents a naturally occurring variant of the 5'UTR or an RT-PCR artifact, it was nevertheless instrumental in elucidating a structure-function relationship for the VEGF IRES.
|
To determine whether the SP163 element can direct internal ribosome entry, it was inserted into the ICS region of the same bicistronic vector used to analyze the full-length 5'UTR. This plasmid, designated B/SP163, was transfected into the human 293 cell line alongside plasmid B/0 (serving as a negative control) and plasmid B/UTR (for comparison of relative IRES strength). The proteins encoded by the first and second cistrons were quantified following a transient transfection (Fig. 6). Consistent with the results of the stable transfections (Fig. 3), the full-length 5'UTR also directed a significant production of SeAP in cells of human origin. Remarkably, SP163 was 4.4-fold more efficient as an IRES element than was the full-length 5'UTR.
|
RNA blot hybridization analysis was performed to ensure that SP163-directed translation of SeAP occurred from a bicistronic mRNA. As shown in Fig. 6 (inset), a single mRNA species, corresponding in size to a bicistronic B/SP163 mRNA, cohybridized with the LUC-specific probe and the SeAP-specific probe and no mRNA corresponding in size to a monocistronic SeAP mRNA could be detected. This result indicated that SeAP was translated from a bicistronic RNA by using SP163 for internal ribosome entry.
The finding that SP163 functions as an IRES much better than does the
full-length 5'UTR is of interest considering that, in terms of
sequence, the former is a subset of the latter. Moreover, the
relatively small size of SP163 rendered it a better substrate for
mutational analysis of IRES function than the full-length 5'UTR. To
identify SP163 sequences required for IRES activity, we first deleted
the 5'-terminal 31 nucleotides spliced to the downstream 5'UTR segment
and analyzed the resultant element (designated B/
SP163) for LUC and
SeAP activities. As shown in Fig. 6, this construct, while permitting
translation of the first cistron, was inactive in directing the
translation of the second cistron, indicating that nucleotides within
the first 31 nucleotides from the cap site are essential for formation
of the SP163 IRES. A finer structure-function analysis of SP163 was
performed with substitutions instead of a deletion. Nucleotides chosen
for substitution were selected on the basis of a computer-aided folding
model of SP163, which predicted that a particular pattern of base
pairing brings the 5' terminus and the initiator ATG codon into
proximity, and were intended to disrupt this secondary structure.
Indeed, substituting a cluster of 9 nucleotides in a region close to
the 5' terminus (solid arrows in Fig. 5) completely abolished IRES activity (Fig. 6). Likewise, translation of the downstream cistron was
abolished as a result of substituting a cluster of 5 nucleotides in a
region close to the initiator ATG codon (open arrows in Fig. 5). These
results suggested that sequences residing close to both termini are
essential for the formation of the SP163 IRES.
Previous studies with picornaviruses, as well as a functional analysis of the cellular fibroblast growth factor IRES, have suggested that these regulatory elements may also act as translational enhancers in the context of a monocistronic mRNA (16, 39). We examined the possibility that the 5'UTR of VEGF (both the full-length form and the truncated version) acts as a translational enhancer by testing its ability to augment the translation of a monocistronic mRNA. To this end, the full-length 5'UTR or SP163 was inserted between a CMV promoter and the coding region of SeAP in the context of a monocistronic vector (Fig. 1). These constructs, designated M/UTR and M/SP163, respectively, were transfected into C6 cells and analyzed for SeAP production in pools of stably transfected clones. Analysis of RNA extracted from transfected cells showed similar levels of SeAP-containing mRNA, which was represented in each case by a single band of the expected size (Fig. 7, inset). In contrast, the amount of SeAP activity released into the culture medium varied greatly according to the nature of the insert. Thus, the full-length 5'UTR augmented the translation of SeAP fivefold and SP163 enhanced SeAP translation much more. In the experiment in Fig. 7, enhancement by SP163 was 25-fold, and in other experiments (data not shown), enhancement was up to 40-fold.
|
Considerations discussed above led us to examine whether these elements also function as translational enhancers under conditions of hypoxic stress. As shown in Fig. 7, enhancement of SeAP translation was unaffected by growth under conditions of severe hypoxia.
To demonstrate that SP163 is a strong translational enhancer in additional cell types, the same constructs were also transfected into human 293 cells and CHO cells. SP163 acted as a translation enhancer in these cells as well, augmenting SeAP production to a level comparable to that shown for C6 cells (data not shown).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Despite the key role that VEGF plays in the formation and maintenance of vascular networks and although it is tightly regulated in vivo, surprisingly little is known about its translational regulation. Here we show that, in contrast to the prediction based on the complex structure of its 5'UTR, VEGF is very efficiently translated. This is shown by the fact that the majority of VEGF mRNA expressed by cultured cells is associated with polyribosomes (Fig. 2). Importantly, translation of VEGF is not impaired under conditions of severe hypoxia, i.e., when overall translation was reduced. These findings are consistent with the physiological requirement that translation of VEGF mRNA not be adversely affected by insults that impede protein synthesis in general and be refractory to hypoxia in particular. These observations and rationales led us to explore a possible mechanism(s) acting to secure efficient translation of VEGF, particularly under conditions of hypoxic stress.
To determine whether the 5'UTR of VEGF can direct internal ribosome entry, we used a bicistronic mRNA assay. Of the various operational criteria that have been applied to examine internal initiation, including the use of cap analogs and analysis of poliovirus-infected cells, the bicistronic mRNA assay is considered the most valid test (14). It is only valid, however, if complemented by a clear demonstration that the second (downstream) cistron is indeed translated from a bicistronic mRNA. The experiments in Fig. 3 and 4 provided compelling evidence that the 5'UTR of VEGF contains a functional IRES. The possibility that the inserted 5'UTR acted to facilitate reinitiation has not been ruled out. However, the finding that translation of the downstream cistron is abolished as a result of mutations in noncontiguous regions of the 5'UTR makes this possibility less likely. Another feature of at least some known IRES elements is the activity as a translational enhancer in the context of a monocistronic RNA. The experiments in Fig. 7 demonstrate that the 5'UTR of VEGF possesses this activity.
In the case of VEGF, internal ribosome entry might improve the competition with other mRNAs which, otherwise, would have rendered the translation of this mRNA (distinguished by an exceptionally long, highly structured 5'UTR) an inefficient process (19, 35). The notion that VEGF mRNA may not compete well with other cellular mRNAs for recruitment of cap-binding proteins is supported by the finding that overexpression of eIF4E (which, as the least abundant of the initiation factors, is a rate-limiting factor in translational regulation of "weak" mRNAs) upregulates the translation of VEGF mRNA (18). Among its many functions, VEGF plays an important role in maintaining vascular homeostasis and controlling vascular permeability (31). Notably, its unscheduled downregulation at critical developmental timings may cause pathologic regression of existing vessels (2). Thus, the option of internal ribosome entry may prevent the deleterious consequences of VEGF deficiency in circumstances where cap-dependent translation is even transiently compromised.
The list of cellular mRNAs with a demonstrable IRES is expanding and is likely to continue to do so in the future. However, the rationale for maintaining both modes of translation is not fully understood in all cases. Recent studies have shown that in certain systems a transition from a cap-dependent to a cap-independent mode of translation is a regulated process. For example, utilization of the anntenapedia and ultrabithorax IRESs is spatially and temporally regulated during Drosophila development (40) and the PDGF-B IRES is specifically used upon megakaryocytic differentiation (4). A physiological situation in which the predominant mode of translation can switch from cap dependent to cap independent is heat shock, where the synthesis of non-heat shock proteins (non-HSPs) decreases but the synthesis of HSPs remains the same or increases (23). While there is no definite proof that HSP70 has a functional IRES, BiP, which can be translated by internal initiation (24), has partial sequence homology to HSP70 and its level becomes elevated during certain stress conditions (e.g., hypoxia and hypoglycemia).
Hypoxia is a major cellular stress, leading to upregulation of a cohort of genes. The VEGF gene is a prominent example of a hypoxia-induced gene whose function is to allow the organism to respond better to this harmful situation. We have previously used a multicell spheroid system to simulate a continuum of microenvironments with increasing hypoxia and/or hypoglycemia and have used the system to define conditions of stress conducive for upregulation of VEGF expression (34). Interestingly, under conditions of extreme stress, VEGF mRNA expression was inhibited rather than enhanced, suggesting that excessively stressed cells are unable to elicit this compensatory response. Therefore, in a realistic setting of progressive ischemia, maximal levels of the mRNA template are available for translation during a restricted time window in which cap-dependent translation might be suboptimal. This situation underscores the need for efficient translation of VEGF, so that a sufficient amount of the protein is produced (and new blood vessels are recruited) before an ischemic injury is inflicted. Data presented here show that one solution to the problem is the use of an IRES. Importantly, we showed that internal ribosome entry is not affected by hypoxia. By way of extrapolation, it is possible that a similar mode of translation is used by other hypoxia-regulated genes.
The analysis of deleted versions of the 5'UTR may shed more light on the poorly understood structure-function relationship of IRES elements in general. The picornavirus IRESs are about 450 nucleotides long, and phylogenetic comparisons within each group suggest that most of the 450 nucleotides are required (8, 14). Among cellular IRESs, it has been shown that the complete 5'UTR of the exceedingly long (>1,500-nucleotide) antennapedia element is required for maximum IRES activity and that fragments of the 5'UTR are considerably less efficient (26). In contrast, the SP163 sequence, which is a subset of the full-length VEGF 5'UTR, gave a much better IRES activity than the full-length 5'UTR did (Fig. 6). The relatively short size of SP163 makes it a most suitable substrate for further mutational analysis aimed at elucidating the structure-function relationship.
In terms of the sequence, there is no obvious resemblance among the
known cellular IRESs, nor do any of the cellular IRESs show a
significant homology to picornavirus IRESs. For example, none of the
cellular IRESs has a pyrimidine-rich tract located 25 nucleotides
upstream of the initiation site, as in the picornavirus IRESs
(8). VEGF has considerable sequence homology to another cellular gene with an IRES element, namely, the PDGF gene. However, a
search for sequence homology between the respective 5'UTRs has shown
that despite a similarity in length and overall high G+C content, there
is no significant homology in the primary sequences. The lack of
significant sequence homology among cellular IRESs, on the one hand,
and the realization that RNA interactions with trans-acting
proteins are likely to involve the specific recognition of sequence
and/or structural elements, on the other hand, have encouraged the
search for common structural motifs folded within cellular IRESs. These
studies resulted in the identification of a putative common RNA
structural motif that is conserved in several IRES elements and is
characterized by the presence of a Y-type unusual folding region close
to the initiator AUG (21). Interestingly, almost the entire
SP163 element can be folded into a stable (256.3 kJ at 37°C)
Y-shaped structure in which half of the nucleotides form G · C
pairs and the initiator AUG codon is preceded by a short nonpaired
sequence (not shown). The functional significance of this folding
pattern, however, is not clear and awaits the scrutiny of a detailed
mutational analysis. The preliminary analysis shown in Fig. 6 supports
the notion that sequences residing close to both termini are required
for IRES activity of this element.
Finally, the strong translation enhancer activity of SP163 can be used, in principle, for biotechnological applications designed to maximize the production of genes of interest.
| |
ACKNOWLEDGMENTS |
|---|
We thank Oded Meyuhas for advice.
E.K. is the incumbent of the Woll Sisters and Brothers Chair in Cardiovascular Diseases at the Hebrew University.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Molecular Biology, The Hebrew UniversityHadassah Medical School,
Jerusalem 91120, Israel. Phone: (972) 2-6758496. Fax: (972) 2-6757195. E-mail: keshet{at}cc.huji.ac.il.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Aiello, L. P.,
R. L. Avery,
P. G. Arrigg,
B. A. Keyt,
H. D. Jampel,
S. T. Shah,
L. R. Pasquale,
H. Thieme,
M. A. Iwamoto,
J. E. Park, et al.
1994.
Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders.
N. Engl. J. Med.
331:1480-1487 |
| 2. | Alon, T., I. Hemo, A. Itin, J. Pe'er, J. Stone, and E. Keshet. 1995. Vascular endothelial growth factor acts as a survival factor for newly formed retinal vessels and has implications for retinopathy of prematurity. Nat. Med. 1:1024-1028[Medline]. |
| 3. |
Benda, P.,
J. Lightbody,
G. Sato,
L. Levine, and W. Sweet.
1968.
Differentiated rat glial cell strain in tissue culture.
Science
161:370-374 |
| 4. |
Bernstein, J.,
O. Sella,
S.-U. Le, and O. Elroy-Stein.
1997.
PDGF2/c-sis mRNA leader contains a differentiation-linked internal ribosomal entry site (D-IRES).
J. Biol. Chem.
272:9356-9362 |
| 5. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline]. |
| 6. | Carmeliet, P., V. Ferreira, G. Breier, S. Pollefeyt, L. Kieckens, M. Gertsenstein, M. Fahrig, A. Vandenhoeck, K. Harpal, C. Eberhardt, C. Declercq, J. Pawling, L. Moons, D. Collen, W. Risau, and A. Nagy. 1996. Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380:435-439[Medline]. |
| 7. | Chirgwin, J. M., A. E. Przybyla, R. J. McDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299[Medline]. |
| 8. | Ehrenfeld, E. 1996. Initiation of translation by picornavirus RNAs, p. 549-573. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 9. | Ferrara, N., K. Carver Moore, H. Chen, M. Dowd, L. Lu, K. S. O'Shea, L. Powell Braxton, K. J. Hillan, and M. W. Moore. 1996. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380:439-442[Medline]. |
| 10. | Forsythe, J. A., B. H. Jiang, N. V. Iyer, F. Agani, S. W. Leung, R. D. Koos, and G. L. Semenza. 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 16:4604-4613[Abstract]. |
| 11. | Frangakis, M. V., and H. K. Kimelberg. 1984. Dissociation of neonatal rat brain by dispase for preparation of primary astrocyte cultures. Neurochem. Res. 9:1689-1698[Medline]. |
| 12. |
Gan, W., and R. E. Rhoads.
1996.
Internal initiation of translation directed by the 5'-untranslated region of the mRNA for eIF4G, a factor involved in the picornavirus-induced switch from cap-dependent to internal initiation.
J. Biol. Chem.
271:623-626 |
| 13. |
Ikeda, E.,
M. G. Achen,
G. Breier, and W. Risau.
1995.
Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells.
J. Biol. Chem.
270:19761-19766 |
| 14. | Jackson, R. J. 1996. A comparative view of initiation site selection mechanisms, p. 71-112. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 15. |
Jang, S. K.,
H.-G. Krausslich,
M. J. H. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643 |
| 16. |
Jang, S. K.,
M. V. Davies,
R. J. Kaufman, and E. Wimmer.
1989.
Initiation of protein synthesis by internal entry of ribosomes into the 5' nontranslated region of encephalomyocarditis virus RNA in vivo.
J. Virol.
63:1651-1660 |
| 17. |
Jordan, M.,
A. Schallhorn, and F. M. Wurm.
1996.
Transfecting mammalian cells: optimization of critical parameters affecting calcium-phosphate precipitate formation.
Nucleic Acids Res.
24:596-601 |
| 18. | Kevil, C. G., A. De Benedetti, D. K. Payne, L. L. Coe, F. S. Laroux, and J. S. Alexander. 1996. Translational regulation of vascular permeability factor by eukaryotic initiation factor 4E: implications for tumor angiogenesis. Int. J. Cancer 65:785-790[Medline]. |
| 19. |
Kozak, M.
1991.
An analysis of vertebrate mRNA sequences: intimations of translational control.
J. Cell Biol.
115:887-903 |
| 20. | Kraggerud, S. M., J. A. Sandvik, and E. O. Pettersen. 1995. Regulation of protein synthesis in human cells exposed to extreme hypoxia. Anticancer Res. 15:683-686[Medline]. |
| 21. |
Le, S.-Y., and J. V. Maizel, Jr.
1997.
A common RNA structural motif involved in the internal initiation of translation of cellular mRNAs.
Nucleic Acids Res.
25:362-369 |
| 22. |
Levy, A. P.,
N. S. Levy, and M. A. Goldberg.
1996.
Hypoxia-inducible protein binding to vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein.
J. Biol. Chem.
271:25492-25497 |
| 23. | Lindquist, S. 1986. The heat-shock response. Annu. Rev. Biochem. 55:1151-1191[Medline]. |
| 24. | Macejak, D. G., and P. Sarnow. 1991. Internal initiation of translation mediated by the 5' leader of a cellular mRNA. Nature 353:90-94[Medline]. |
| 25. |
Meyuhas, O.,
E. A. Thompson, Jr., and R. P. Perry.
1987.
Glucocorticoids selectively inhibit translation of ribosomal protein mRNAs in P1798 lymphosarcoma cells.
Mol. Cell. Biol.
7:2691-2699 |
| 26. |
Oh, S.-K.,
M. P. Scott, and P. Sarnow.
1992.
Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding.
Genes Dev.
6:1643-1653 |
| 27. | Pain, V. M. 1996. Initiation of protein synthesis in eukaryotic cells. Eur. J. Biochem. 236:747-771[Medline]. |
| 28. | Pe'er, J., D. Shweiki, A. Itin, I. Hemo, H. Gnessin, and E. Keshet. 1995. Hypoxia-induced expression of vascular endothelial growth factor by retinal cells is a common factor in neovascularizing ocular diseases. Lab. Invest. 72:638-645[Medline]. |
| 29. | Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334:320-325[Medline]. |
| 30. | Plate, K. H., G. Breier, H. A. Weich, and W. Risau. 1992. Vascular endothelial growth factor is a potential tumour angiogenesis factor in human gliomas in vivo. Nature 359:845-848[Medline]. |
| 31. | Senger, D. R., L. Van de Water, L. F. Brown, J. A. Nagy, K. T. Yeo, T. K. Yeo, B. Berse, R. W. Jackman, A. M. Dvorak, and H. F. Dvorak. 1993. Vascular permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev. 12:303-324[Medline]. |
| 32. | Shima, D. T., U. Deutsch, and P. A. D'Amore. 1995. Hypoxic induction of vascular endothelial growth factor (VEGF) in human epithelial cells is mediated by increases in mRNA stability. FEBS Lett. 370:203-208[Medline]. |
| 33. | Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359:843-845[Medline]. |
| 34. |
Shweiki, D.,
M. Neeman,
A. Itin, and E. Keshet.
1995.
Induction of vascular endothelial growth factor expression by hypoxia and by glucose deficiency in multicell spheroids: implications for tumor angiogenesis.
Proc. Natl. Acad. Sci. USA
92:768-772 |
| 35. | Sonenberg, N. 1996. mRNA 5' cap-binding protein eIF4E and control of cell growth, p. 245-269. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. | Stein, I., M. Neeman, D. Shweiki, A. Itin, and E. Keshet. 1995. Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes. Mol. Cell. Biol. 15:5363-5368[Abstract]. |
| 37. | Stone, J., A. Itin, T. Alon, J. Pe'er, H. Gnessin, T. Chan Ling, and E. Keshet. 1995. Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia. J. Neurosci. 15:4738-4747[Abstract]. |
| 38. | Teerink, H., H. O. Voorma, and A. A. M. Thomas. 1995. The human insulin-like growth factor II leader 1 contains an internal ribosomal entry site. Biochim. Biophys. Acta 1264:403-408[Medline]. |
| 39. | Vagner, S., M. C. Gensac, A. Maret, F. Bayard, F. Amalric, H. Prats, and A. C. Prats. 1995. Alternative translation of human fibroblast growth factor 2 mRNA occurs by internal entry of ribosomes. Mol. Cell. Biol. 15:35-44[Abstract]. |
| 40. | Ye, X., P. Fong, N. Iizuka, D. Choate, and D. R. Cavener. 1997. Ultrabithorax and Antennapedia 5' untranslated regions promote developmentally regulated internal translation initiation. Mol. Cell. Biol. 17:1714-1721[Abstract]. |
Mol Cell Biol, June 1998, p. 3112-3119, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Li, M., Edamatsu, H., Kitazawa, R., Kitazawa, S., Kataoka, T.
(2009). Phospholipase C{varepsilon} promotes intestinal tumorigenesis of ApcMin/+ mice through augmentation of inflammation and angiogenesis. Carcinogenesis
30: 1424-1432
[Abstract] [Full Text] -
Sun, J., Hopkins, B. D., Tsujikawa, K., Perruzzi, C., Adini, I., Swerlick, R., Bornstein, P., Lawler, J., Benjamin, L. E.
(2009). Thrombospondin-1 modulates VEGF-A-mediated Akt signaling and capillary survival in the developing retina. Am. J. Physiol. Heart Circ. Physiol.
296: H1344-H1351
[Abstract] [Full Text] -
Ruiz de Almodovar, C., Lambrechts, D., Mazzone, M., Carmeliet, P.
(2009). Role and Therapeutic Potential of VEGF in the Nervous System. Physiol. Rev.
89: 607-648
[Abstract] [Full Text] -
Karaa, Z. S., Iacovoni, J. S., Bastide, A., Lacazette, E., Touriol, C., Prats, H.
(2009). The VEGF IRESes are differentially susceptible to translation inhibition by miR-16. RNA
15: 249-254
[Abstract] [Full Text] -
Birk, D. M., Barbato, J., Mureebe, L., Chaer, R. A.
(2009). Basic Science Review: Current Insights on the Biology and Clinical Aspects of VEGF Regulation. VASC ENDOVASCULAR SURG
42: 517-530
[Abstract] -
Kazadi, K., Loeuillet, C., Deutsch, S., Ciuffi, A., Munoz, M., Beckmann, J. S., Moradpour, D., Antonarakis, S. E., Telenti, A.
(2008). Genomic determinants of the efficiency of internal ribosomal entry sites of viral and cellular origin. Nucleic Acids Res
36: 6918-6925
[Abstract] [Full Text] -
Kaiser, C., Dobrikova, E. Y., Bradrick, S. S., Shveygert, M., Herbert, J. T., Gromeier, M.
(2008). Activation of cap-independent translation by variant eukaryotic initiation factor 4G in vivo. RNA
14: 2170-2182
[Abstract] [Full Text] -
Weinzierl, A. O., Maurer, D., Altenberend, F., Schneiderhan-Marra, N., Klingel, K., Schoor, O., Wernet, D., Joos, T., Rammensee, H.-G., Stevanovic, S.
(2008). A Cryptic Vascular Endothelial Growth Factor T-Cell Epitope: Identification and Characterization by Mass Spectrometry and T-Cell Assays. Cancer Res.
68: 2447-2454
[Abstract] [Full Text] -
Baranick, B. T., Lemp, N. A., Nagashima, J., Hiraoka, K., Kasahara, N., Logg, C. R.
(2008). Splicing mediates the activity of four putative cellular internal ribosome entry sites. Proc. Natl. Acad. Sci. USA
105: 4733-4738
[Abstract] [Full Text] -
Vumbaca, F., Phoenix, K. N., Rodriguez-Pinto, D., Han, D. K., Claffey, K. P.
(2008). Double-Stranded RNA-Binding Protein Regulates Vascular Endothelial Growth Factor mRNA Stability, Translation, and Breast Cancer Angiogenesis. Mol. Cell. Biol.
28: 772-783
[Abstract] [Full Text] -
Forooghian, F., Razavi, R., Timms, L.
(2007). Hypoxia-inducible factor expression in human RPE cells. Br J Ophthalmol
91: 1406-1410
[Abstract] [Full Text] -
Dhar, D., Roy, S., Das, S.
(2007). Translational control of the interferon regulatory factor 2 mRNA by IRES element. Nucleic Acids Res
0: gkm524v1-13
[Abstract] [Full Text] -
Reboll, M. R., Oumard, A., Gazdag, A. C., Renger, I., Ritter, B., Schwarzer, M., Hauser, H., Wood, M., Yamada, M., Resch, K., Nourbakhsh, M.
(2007). NRF IRES activity is mediated by RNA binding protein JKTBP1 and a 14-nt RNA element. RNA
13: 1328-1340
[Abstract] [Full Text] -
Thomas, J. D., Johannes, G. J.
(2007). Identification of mRNAs that continue to associate with polysomes during hypoxia. RNA
13: 1116-1131
[Abstract] [Full Text] -
Chang, Q., Bhatia, D., Zhang, Y., Meighan, T., Castranova, V., Shi, X., Chen, F.
(2007). Incorporation of an Internal Ribosome Entry Site-Dependent Mechanism in Arsenic-Induced GADD45{alpha} Expression. Cancer Res.
67: 6146-6154
[Abstract] [Full Text] -
Wouters, A., Pauwels, B., Lardon, F., Vermorken, J. B.
(2007). Review: Implications of In Vitro Research on the Effect of Radiotherapy and Chemotherapy Under Hypoxic Conditions. The Oncologist
12: 690-712
[Abstract] [Full Text] -
Origanti, S., Shantz, L. M.
(2007). Ras Transformation of RIE-1 Cells Activates Cap-Independent Translation of Ornithine Decarboxylase: Regulation by the Raf/MEK/ERK and Phosphatidylinositol 3-Kinase Pathways. Cancer Res.
67: 4834-4842
[Abstract] [Full Text] -
Petz, M., Kozina, D., Huber, H., Siwiec, T., Seipelt, J., Sommergruber, W., Mikulits, W.
(2007). The leader region of Laminin B1 mRNA confers cap-independent translation. Nucleic Acids Res
35: 2473-2482
[Abstract] [Full Text] -
Bornes, S., Prado-Lourenco, L., Bastide, A., Zanibellato, C., Iacovoni, J. S., Lacazette, E., Prats, A.-C., Touriol, C., Prats, H.
(2007). Translational Induction of VEGF Internal Ribosome Entry Site Elements During the Early Response to Ischemic Stress. Circ. Res.
100: 305-308
[Abstract] [Full Text] -
Blais, J. D., Addison, C. L., Edge, R., Falls, T., Zhao, H., Wary, K., Koumenis, C., Harding, H. P., Ron, D., Holcik, M., Bell, J. C.
(2006). Perk-Dependent Translational Regulation Promotes Tumor Cell Adaptation and Angiogenesis in Response to Hypoxic Stress. Mol. Cell. Biol.
26: 9517-9532
[Abstract] [Full Text] -
Milkiewicz, M., Hudlicka, O., Shiner, R., Egginton, S., Brown, M. D.
(2006). Vascular endothelial growth factor mRNA and protein do not change in parallel during non-inflammatory skeletal muscle ischaemia in rat. J. Physiol.
577: 671-678
[Abstract] [Full Text] -
Baird, S. D., Turcotte, M., Korneluk, R. G., Holcik, M.
(2006). Searching for IRES. RNA
12: 1755-1785
[Abstract] [Full Text] -
Merrill, M. K., Gromeier, M.
(2006). The Double-Stranded RNA Binding Protein 76:NF45 Heterodimer Inhibits Translation Initiation at the Rhinovirus Type 2 Internal Ribosome Entry Site. J. Virol.
80: 6936-6942
[Abstract] [Full Text] -
Koumenis, C., Wouters, B. G.
(2006). "Translating" Tumor Hypoxia: Unfolded Protein Response (UPR)-Dependent and UPR-Independent Pathways. Mol Cancer Res
4: 423-436
[Abstract] [Full Text] -
Bert, A. G., Grepin, R., Vadas, M. A., Goodall, G. J.
(2006). Assessing IRES activity in the HIF-1{alpha} and other cellular 5' UTRs. RNA
12: 1074-1083
[Abstract] [Full Text] -
Connolly, E., Braunstein, S., Formenti, S., Schneider, R. J.
(2006). Hypoxia Inhibits Protein Synthesis through a 4E-BP1 and Elongation Factor 2 Kinase Pathway Controlled by mTOR and Uncoupled in Breast Cancer Cells. Mol. Cell. Biol.
26: 3955-3965
[Abstract] [Full Text] -
Cherradi, N., Lejczak, C., Desroches-Castan, A., Feige, J.-J.
(2006). Antagonistic Functions of Tetradecanoyl Phorbol Acetate-Inducible-Sequence 11b and HuR in the Hormonal Regulation of Vascular Endothelial Growth Factor Messenger Ribonucleic Acid Stability by Adrenocorticotropin. Mol. Endocrinol.
20: 916-930
[Abstract] [Full Text] -
Schepens, B., Tinton, S. A., Bruynooghe, Y., Beyaert, R., Cornelis, S.
(2005). The polypyrimidine tract-binding protein stimulates HIF-1{alpha} IRES-mediated translation during hypoxia. Nucleic Acids Res
33: 6884-6894
[Abstract] [Full Text] -
Kozak, M.
(2005). A second look at cellular mRNA sequences said to function as internal ribosome entry sites. Nucleic Acids Res
33: 6593-6602
[Abstract] [Full Text] -
Hong, G. K., Kumar, P., Wang, L., Damania, B., Gulley, M. L., Delecluse, H.-J., Polverini, P. J., Kenney, S. C.
(2005). Epstein-Barr Virus Lytic Infection Is Required for Efficient Production of the Angiogenesis Factor Vascular Endothelial Growth Factor in Lymphoblastoid Cell Lines. J. Virol.
79: 13984-13992
[Abstract] [Full Text] -
Croley, A. N., Zwetsloot, K. A., Westerkamp, L. M., Ryan, N. A., Pendergast, A. M., Hickner, R. C., Pofahl, W. E., Gavin, T. P.
(2005). Lower capillarization, VEGF protein, and VEGF mRNA response to acute exercise in the vastus lateralis muscle of aged vs. young women. J. Appl. Physiol.
99: 1872-1879
[Abstract] [Full Text] -
Hundsdoerfer, P., Thoma, C., Hentze, M. W.
(2005). Eukaryotic translation initiation factor 4GI and p97 promote cellular internal ribosome entry sequence-driven translation. Proc. Natl. Acad. Sci. USA
102: 13421-13426
[Abstract] [Full Text] -
Mitchell, S. A., Spriggs, K. A., Bushell, M., Evans, J. R., Stoneley, M., Le Quesne, J. P.C., Spriggs, R. V., Willis, A. E.
(2005). Identification of a motif that mediates polypyrimidine tract-binding protein-dependent internal ribosome entry. Genes Dev.
19: 1556-1571
[Abstract] [Full Text] -
Park, E.-H., Lee, J. M., Blais, J. D., Bell, J. C., Pelletier, J.
(2005). Internal Translation Initiation Mediated by the Angiogenic Factor Tie2. J. Biol. Chem.
280: 20945-20953
[Abstract] [Full Text] -
Cornelis, S., Tinton, S. A., Schepens, B., Bruynooghe, Y., Beyaert, R.
(2005). UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein. Nucleic Acids Res
33: 3095-3108
[Abstract] [Full Text] -
Dobson, T., Minic, A., Nielsen, K., Amiott, E., Krushel, L.
(2005). Internal initiation of translation of the TrkB mRNA is mediated by multiple regions within the 5' leader. Nucleic Acids Res
33: 2929-2941
[Abstract] [Full Text] -
Rezai, K. A., Eliott, D., Ferrone, P. J., Kim, R. W.
(2005). Near Confluent Laser Photocoagulation for the Treatment of Threshold Retinopathy of Prematurity. Arch Ophthalmol
123: 621-626
[Abstract] [Full Text] -
Ouchi, N., Shibata, R., Walsh, K.
(2005). AMP-Activated Protein Kinase Signaling Stimulates VEGF Expression and Angiogenesis in Skeletal Muscle. Circ. Res.
96: 838-846
[Abstract] [Full Text] -
Pages, G., Pouyssegur, J.
(2005). Transcriptional regulation of the Vascular Endothelial Growth Factor gene-a concert of activating factors. Cardiovasc Res
65: 564-573
[Abstract] [Full Text] -
Sun, J. F., Phung, T., Shiojima, I., Felske, T., Upalakalin, J. N., Feng, D., Kornaga, T., Dor, T., Dvorak, A. M., Walsh, K., Benjamin, L. E.
(2005). Microvascular patterning is controlled by fine-tuning the Akt signal. Proc. Natl. Acad. Sci. USA
102: 128-133
[Abstract] [Full Text] -
Liang, S.-H., Hassett, C., Omiecinski, C. J.
(2005). Alternative Promoters Determine Tissue-Specific Expression Profiles of the Human Microsomal Epoxide Hydrolase Gene (EPHX1). Mol. Pharmacol.
67: 220-230
[Abstract] [Full Text] -
Jang, G. M., Leong, L. E.-C., Hoang, L. T., Wang, P. H., Gutman, G. A., Semler, B. L.
(2004). Structurally Distinct Elements Mediate Internal Ribosome Entry within the 5'-Noncoding Region of a Voltage-gated Potassium Channel mRNA. J. Biol. Chem.
279: 47419-47430
[Abstract] [Full Text] -
Eltzschig, H. K., Collard, C. D.
(2004). Vascular ischaemia and reperfusion injury. Br Med Bull
70: 71-86
[Abstract] [Full Text] -
Knies-Bamforth, U. E., Fox, S. B., Poulsom, R., Evan, G. I., Harris, A. L.
(2004). c-Myc Interacts with Hypoxia to Induce Angiogenesis In vivo by a Vascular Endothelial Growth Factor-Dependent Mechanism. Cancer Res.
64: 6563-6570
[Abstract] [Full Text] -
Blais, J. D., Filipenko, V., Bi, M., Harding, H. P., Ron, D., Koumenis, C., Wouters, B. G., Bell, J. C.
(2004). Activating Transcription Factor 4 Is Translationally Regulated by Hypoxic Stress. Mol. Cell. Biol.
24: 7469-7482
[Abstract] [Full Text] -
Segrelles, C., Ruiz, S., Santos, M., Martinez-Palacio, J., Lara, M. F., Paramio, J. M.
(2004). Akt mediates an angiogenic switch in transformed keratinocytes. Carcinogenesis
25: 1137-1147
[Abstract] [Full Text] -
Vannay, A., Fekete, A., Adori, C., Toth, T., Losonczy, G., Laszlo, L., Vasarhelyi, B., Tulassay, T., Szabo, A.
(2004). Divergence of renal vascular endothelial growth factor mRNA expression and protein level in post-ischaemic rat kidneys. Exp Physiol
89: 435-444
[Abstract] [Full Text] -
VAN EDEN, M. E., BYRD, M. P., SHERRILL, K. W., LLOYD, R. E.
(2004). Demonstrating internal ribosome entry sites in eukaryotic mRNAs using stringent RNA test procedures. RNA
10: 720-730
[Abstract] [Full Text] -
Jones, C. A., Vial, C., Sellers, L. A., Humphrey, P. P. A., Evans, R. J., Chessell, I. P.
(2004). Functional Regulation of P2X6 Receptors by N-Linked Glycosylation: Identification of a Novel {alpha}{beta}-Methylene ATP-Sensitive Phenotype. Mol. Pharmacol.
65: 979-985
[Abstract] [Full Text] -
Wei, D., Wang, L., He, Y., Xiong, H. Q., Abbruzzese, J. L., Xie, K.
(2004). Celecoxib Inhibits Vascular Endothelial Growth Factor Expression in and Reduces Angiogenesis and Metastasis of Human Pancreatic Cancer via Suppression of Sp1 Transcription Factor Activity. Cancer Res.
64: 2030-2038
[Abstract] [Full Text] -
VAN EDEN, M. E., BYRD, M. P., SHERRILL, K. W., LLOYD, R. E.
(2004). Translation of cellular inhibitor of apoptosis protein 1 (c-IAP1) mRNA is IRES mediated and regulated during cell stress. RNA
10: 469-481
[Abstract] [Full Text] -
Bieleski, L., Hindley, C., Talbot, S. J.
(2004). A polypyrimidine tract facilitates the expression of Kaposi's sarcoma-associated herpesvirus vFLIP through an internal ribosome entry site. J. Gen. Virol.
85: 615-620
[Abstract] [Full Text] -
Kobayashi, N., Saeki, K., Yuo, A.
(2003). Granulocyte-macrophage colony-stimulating factor and interleukin-3 induce cell cycle progression through the synthesis of c-Myc protein by internal ribosome entry site-mediated translation via phosphatidylinositol 3-kinase pathway in human factor-dependent leukemic cells. Blood
102: 3186-3195
[Abstract] [Full Text] -
Lodhi, K. M., Ozdener, M. H., Shayiq, R. M.
(2003). The Upstream Open Reading Frame Mediates Constitutive Effects on Translation of Cytochrome P-450c27 from the Seventh In-frame AUG Codon in Rat Liver. J. Biol. Chem.
278: 40647-40657
[Abstract] [Full Text] -
Rabadan-Diehl, C., Volpi, S., Nikodemova, M., Aguilera, G.
(2003). Translational Regulation of the Vasopressin V1b Receptor Involves an Internal Ribosome Entry Site. Mol. Endocrinol.
17: 1959-1971
[Abstract] [Full Text] -
Shui, Y.-B., Wang, X., Hu, J. S., Wang, S.-P., Garcia, C. M., Potts, J. D., Sharma, Y., Beebe, D. C.
(2003). Vascular Endothelial Growth Factor Expression and Signaling in the Lens. IOVS
44: 3911-3919
[Abstract] [Full Text] -
Arsham, A. M., Howell, J. J., Simon, M. C.
(2003). A Novel Hypoxia-inducible Factor-independent Hypoxic Response Regulating Mammalian Target of Rapamycin and Its Targets. J. Biol. Chem.
278: 29655-29660
[Abstract] [Full Text] -
Bates, D. O., Jones, R. O. P.
(2003). The Role of Vascular Endothelial Growth Factor in Wound Healing. INT J LOW EXTREM WOUNDS
2: 107-120
[Abstract] -
Turcotte, S., Desrosiers, R. R., Beliveau, R.
(2003). HIF-1{alpha} mRNA and protein upregulation involves Rho GTPase expression during hypoxia in renal cell carcinoma. J. Cell Sci.
116: 2247-2260
[Abstract] [Full Text] -
Roguin, A., Avivi, A., Nitecki, S., Rubinstein, I., Levy, N. S., Abassi, Z. A., Resnick, M. B., Lache, O., Melamed-Frank, M., Joel, A., Hoffman, A., Nevo, E., Levy, A. P.
(2003). Restoration of blood flow by using continuous perimuscular infiltration of plasmid DNA encoding subterranean mole rat Spalax ehrenbergi VEGF. Proc. Natl. Acad. Sci. USA
100: 4644-4648
[Abstract] [Full Text] -
Nevins, T. A., Harder, Z. M., Korneluk, R. G., Holcik, M.
(2003). Distinct Regulation of Internal Ribosome Entry Site-mediated Translation following Cellular Stress Is Mediated by Apoptotic Fragments of eIF4G Translation Initiation Factor Family Members eIF4GI and p97/DAP5/NAT1. J. Biol. Chem.
278: 3572-3579
[Abstract] [Full Text] -
Kullmann, M., Gopfert, U., Siewe, B., Hengst, L.
(2002). ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. Genes Dev.
16: 3087-3099
[Abstract] [Full Text] -
Schoch, H. J., Fischer, S., Marti, H. H.
(2002). Hypoxia-induced vascular endothelial growth factor expression causes vascular leakage in the brain. Brain
125: 2549-2557
[Abstract] [Full Text] -
Mauro, V. P., Edelman, G. M.
(2002). The ribosome filter hypothesis. Proc. Natl. Acad. Sci. USA
99: 12031-12036
[Abstract] [Full Text] -
Connor, J. H., Lyles, D. S.
(2002). Vesicular Stomatitis Virus Infection Alters the eIF4F Translation Initiation Complex and Causes Dephosphorylation of the eIF4E Binding Protein 4E-BP1. J. Virol.
76: 10177-10187
[Abstract] [Full Text] -
Morrish, B. C., Rumsby, M. G.
(2002). The 5' Untranslated Region of Protein Kinase C{delta} Directs Translation by an Internal Ribosome Entry Segment That Is Most Active in Densely Growing Cells and during Apoptosis. Mol. Cell. Biol.
22: 6089-6099
[Abstract] [Full Text] -
Grobe, K., Esko, J. D.
(2002). Regulated Translation of Heparan Sulfate N-Acetylglucosamine N-Deacetylase/N-Sulfotransferase Isozymes by Structured 5'-Untranslated Regions and Internal Ribosome Entry Sites. J. Biol. Chem.
277: 30699-30706
[Abstract] [Full Text] -
Abcouwer, S. F., Marjon, P. L., Loper, R. K., Vander Jagt, D. L.
(2002). Response of VEGF Expression to Amino Acid Deprivation and Inducers of Endoplasmic Reticulum Stress. IOVS
43: 2791-2798
[Abstract] [Full Text] -
Chung, J., Bachelder, R. E., Lipscomb, E. A., Shaw, L. M., Mercurio, A. M.
(2002). Integrin ({alpha}6{beta}4) regulation of eIF-4E activity and VEGF translation: a survival mechanism for carcinoma cells. JCB
158: 165-174
[Abstract] [Full Text] -
Byrd, M. P., Zamora, M., Lloyd, R. E.
(2002). Generation of Multiple Isoforms of Eukaryotic Translation Initiation Factor 4GI by Use of Alternate Translation Initiation Codons. Mol. Cell. Biol.
22: 4499-4511
[Abstract] [Full Text] -
Takahashi, A., Kureishi, Y., Yang, J., Luo, Z., Guo, K., Mukhopadhyay, D., Ivashchenko, Y., Branellec, D., Walsh, K.
(2002). Myogenic Akt Signaling Regulates Blood Vessel Recruitment during Myofiber Growth. Mol. Cell. Biol.
22: 4803-4814
[Abstract] [Full Text] -
Shiroki, K., Ohsawa, C., Sugi, N., Wakiyama, M., Miura, K.-i., Watanabe, M., Suzuki, Y., Sugano, S.
(2002). Internal ribosome entry site-mediated translation of Smad5 in vivo: requirement for a nuclear event. Nucleic Acids Res
30: 2851-2861
[Abstract] [Full Text] -
Milanini-Mongiat, J., Pouyssegur, J., Pages, G.
(2002). Identification of Two Sp1 Phosphorylation Sites for p42/p44 Mitogen-activated Protein Kinases. THEIR IMPLICATION IN VASCULAR ENDOTHELIAL GROWTH FACTOR GENE TRANSCRIPTION. J. Biol. Chem.
277: 20631-20639
[Abstract] [Full Text] -
Lang, K. J. D., Kappel, A., Goodall, G. J.
(2002). Hypoxia-inducible Factor-1alpha mRNA Contains an Internal Ribosome Entry Site That Allows Efficient Translation during Normoxia and Hypoxia. Mol. Biol. Cell
13: 1792-1801
[Abstract] [Full Text] -
Woods, S. L., Whitelaw, M. L.
(2002). Differential Activities of Murine Single Minded 1 (SIM1) and SIM2 on a Hypoxic Response Element. CROSS-TALK BETWEEN BASIC HELIX-LOOP-HELIX/Per-Arnt-Sim HOMOLOGY TRANSCRIPTION FACTORS. J. Biol. Chem.
277: 10236-10243
[Abstract] [Full Text] -
UPALAKALIN, J.N., HEMO, I., DEHIO, C., KESHET, E., BENJAMIN, L.E.
(2002). Survival Mechanisms of VEGF and PlGF during Microvascular Remodeling. Cold Spring Harb Symp Quant Biol
67: 181-188
[Abstract] -
Huez, I., Bornes, S., Bresson, D., Creancier, L., Prats, H.
(2001). New Vascular Endothelial Growth Factor Isoform Generated by Internal Ribosome Entry Site-Driven CUG Translation Initiation. Mol. Endocrinol.
15: 2197-2210
[Abstract] [Full Text] -
Wille, S., Szekeres, A., Majdic, O., Prager, E., Staffler, G., Stockl, J., Kunthalert, D., Prieschl, E. E., Baumruker, T., Burtscher, H., Zlabinger, G. J., Knapp, W., Stockinger, H.
(2001). Characterization of CDw92 as a Member of the Choline Transporter-Like Protein Family Regulated Specifically on Dendritic Cells. J. Immunol.
167: 5795-5804
[Abstract] [Full Text] -
Mazumder, B., Seshadri, V., Imataka, H., Sonenberg, N., Fox, P. L.
(2001). Translational Silencing of Ceruloplasmin Requires the Essential Elements of mRNA Circularization: Poly(A) Tail, Poly(A)-Binding Protein, and Eukaryotic Translation Initiation Factor 4G. Mol. Cell. Biol.
21: 6440-6449
[Abstract] [Full Text] -
Blancher, C., Moore, J. W., Robertson, N., Harris, A. L.
(2001). Effects of ras and von Hippel-Lindau (VHL) Gene Mutations on Hypoxia-inducible Factor (HIF)-1{alpha}, HIF-2{alpha}, and Vascular Endothelial Growth Factor Expression and Their Regulation by the Phosphatidylinositol 3'-Kinase/Akt Signaling Pathway. Cancer Res.
61: 7349-7355
[Abstract] [Full Text] -
Bruick, R. K., McKnight, S. L.
(2001). Building better vasculature. Genes Dev.
15: 2497-2502
[Full Text] -
Elson, D. A., Thurston, G., Huang, L. E., Ginzinger, D. G., McDonald, D. M., Johnson, R. S., Arbeit, J. M.
(2001). Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1{alpha}. Genes Dev.
15: 2520-2532
[Abstract] [Full Text] -
Hennecke, M., Kwissa, M., Metzger, K., Oumard, A., Kroger, A., Schirmbeck, R., Reimann, J., Hauser, H.
(2001). Composition and arrangement of genes define the strength of IRES-driven translation in bicistronic mRNAs. Nucleic Acids Res
29: 3327-3334
[Abstract] [Full Text] -
Hellen, C. U.T., Sarnow, P.
(2001). Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev.
15: 1593-1612
[Full Text] -
Dor, Y., Porat, R., Keshet, E.
(2001). Vascular endothelial growth factor and vascular adjustments to perturbations in oxygen homeostasis. Am. J. Physiol. Cell Physiol.
280: C1367-C1374
[Abstract] [Full Text] -
Martínez-Salas, E., Ramos, R., Lafuente, E., López de Quinto, S.
(2001). Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol.
82: 973-984
[Full Text] -
Hellstrom, M., Gerhardt, H., Kalen, M., Li, X., Eriksson, U., Wolburg, H., Betsholtz, C.
(2001). Lack of Pericytes Leads to Endothelial Hyperplasia and Abnormal Vascular Morphogenesis. JCB
153: 543-554
[Abstract] [Full Text] -
Siafakas, N.M., Jordan, M., Wagner, H., Breen, E.C., Benoit, H., Wagner, P.D.
(2001). Diaphragmatic angiogenic growth factor mRNA responses to increased ventilation caused by hypoxia and hypercapnia. Eur Respir J
17: 681-687
[Abstract] [Full Text] -
Benjamin, L. E.
(2001). Glucose, VEGF-A, and Diabetic Complications. Am. J. Pathol.
158: 1181-1184
[Full Text] -
Créancier, L., Mercier, P., Prats, A.-C., Morello, D.
(2001). c-myc Internal Ribosome Entry Site Activity Is Developmentally Controlled and Subjected to a Strong Translational Repression in Adult Transgenic Mice. Mol. Cell. Biol.
21: 1833-1840
[Abstract] [Full Text] -
Huss, W. J., Hanrahan, C. F., Barrios, R. J., Simons, J. W., Greenberg, N. M.
(2001). Angiogenesis and Prostate Cancer: Identification of A Molecular Progression Switch. Cancer Res.
61: 2736-2743
[Abstract] [Full Text] -
Bieleski, L., Talbot, S. J.
(2001). Kaposi's Sarcoma-Associated Herpesvirus vCyclin Open Reading Frame Contains an Internal Ribosome Entry Site. J. Virol.
75: 1864-1869
[Abstract] [Full Text] -
Pinkstaff, J. K., Chappell, S. A., Mauro, V. P., Edelman, G. M., Krushel, L. A.
(2001). Internal initiation of translation of five dendritically localized neuronal mRNAs. Proc. Natl. Acad. Sci. USA
10.1073/pnas.051623398v1
[Abstract] [Full Text] -
Owens, G. C., Chappell, S. A., Mauro, V. P., Edelman, G. M.
(2001). Identification of two short internal ribosome entry sites selected from libraries of random oligonucleotides. Proc. Natl. Acad. Sci. USA
98: 1471-1476
[Abstract] [Full Text] -
Zhou, W., Edelman, G. M., Mauro, V. P.
(2001). Transcript leader regions of two Saccharomyces cerevisiae mRNAs contain internal ribosome entry sites that function in living cells. Proc. Natl. Acad. Sci. USA
98: 1531-1536
[Abstract] [Full Text] -
Robinson, C., Stringer, S.
(2001). The splice variants of vascular endothelial growth factor (VEGF) and their receptors. J. Cell Sci.
114: 853-865
[Abstract]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»