Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3149-3162, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Regulatory Particle of the Saccharomyces
cerevisiae Proteasome
Michael H.
Glickman,1
David M.
Rubin,1
Victor A.
Fried,2 and
Daniel
Finley1,*
Department of Cell Biology, Harvard Medical
School, Boston, Massachusetts 02115,1 and
Department of Cell Biology, New York Medical College, Valhalla,
New York 105952
Received 1 December 1997/Returned for modification 23 January
1998/Accepted 9 March 1998
 |
ABSTRACT |
The proteasome is a multisubunit protease responsible for degrading
proteins conjugated to ubiquitin. The 670-kDa core particle of the
proteasome contains the proteolytic active sites, which face an
interior chamber within the particle and are thus protected from the
cytoplasm. The entry of substrates into this chamber is thought to be
governed by the regulatory particle of the proteasome, which covers the
presumed channels leading into the interior of the core particle. We
have resolved native yeast proteasomes into two electrophoretic
variants and have shown that these represent core particles capped with
one or two regulatory particles. To determine the subunit composition
of the regulatory particle, yeast proteasomes were purified and
analyzed by gradient sodium dodecyl sulfate-polyacrylamide gel
electrophoresis. Resolution of the individual polypeptides revealed 17 distinct proteins, whose identities were determined by amino acid
sequence analysis. Six of the subunits have sequence features of
ATPases (Rpt1 to Rpt6). Affinity chromatography was used to purify
regulatory particles from various strains, each of which
expressed one of the ATPases tagged with hexahistidine. In all cases,
multiple untagged ATPases copurified, indicating that the ATPases
assembled together into a heteromeric complex. Of the remaining 11 subunits that we have identified (Rpn1 to Rpn3 and Rpn5 to Rpn12), 8 are encoded by previously described genes and 3 are encoded by
genes not previously characterized for yeasts. One of the
previously unidentified subunits exhibits limited sequence
similarity with deubiquitinating enzymes. Overall, regulatory
particles from yeasts and mammals are remarkably similar,
suggesting that the specific mechanistic features of the proteasome
have been closely conserved over the course of evolution.
 |
INTRODUCTION |
In eukaryotes, the elimination of
many short-lived proteins requires their covalent attachment to
ubiquitin (43). This pathway is involved in a wide variety
of regulatory mechanisms, with substrates including cyclins and CDK
inhibitors (49), membrane proteins such as CFTR
(104), p53 (84), NF-
B (71), c-Fos,
c-Jun, and luminal components of the endoplasmic reticulum
(9). Multiubiquitin chains target proteins for degradation
by the proteasome, an ~2-MDa proteolytic complex (reviewed in
references 12, 55, 61, and 80).
The mechanism of the proteasome is thought to involve unfolding of a
protein substrate and translocation from one subcompartment of the
enzyme to another prior to degradation. This model is based primarily
on the crystal structure of the proteasomal core particle (CP). The CP
has a barrel-like shape, with the proteolytic active sites facing the
inner chamber, or lumen. In the proteasomal CP from Thermoplasma
acidophilum, openings into the lumen are found only at the ends of
the barrel (59) and are therefore thought to function as
channels for the proteolytic substrate. Because these channels are
narrow, it is likely that proteolytic substrates must be unfolded prior
to entry into the lumen of the CP. Based on electron micrographs of the
proteasome's from various eukaryotes, these channels open out into
multisubunit complexes flanking the CP at one or both ends; these
complexes have been variously termed PA700, the µ particle, the 19S
complex, and the regulatory particle (RP) (15, 72, 73,
99). As the RP confers ATP dependence and ubiquitin
dependence on the CP (15, 47), it is presumed to
function by recognizing substrates, unfolding them, and directing their
translocation through the channel of the CP. The channel observed in
the T. acidophilum particle, however, is not observed in the
crystal structure of the CP from Saccharomyces
cerevisiae (38). This fact suggests that in eukaryotes
the channel is gated, perhaps through the action of the RP. Recent data
also indicate that purified PA700, a mammalian RP complex, can
deubiquitinate proteolytic substrates (53, 54). Because the
subunit composition and crystal structure of the S. cerevisiae CP are known and because yeasts are amenable to genetic
analysis, yeasts provide a useful system for studies of the proteasome
and the role of the RP.
While the RP has been purified from mammals and most of its subunits
have been identified, the RP of S. cerevisiae has not been characterized biochemically. However, many genetic screens have identified genes suggested to encode components of the RP. For example, such genes were identified in screens for mutations that are synthetically lethal in combination with cdc28
mutations (30, 50), mutations that suppress recessive
alleles of GAL4 (94), mutations that increase the
levels of expression of SEN1 fusion proteins
(14), mutations that are deficient in the degradation of
membrane-bound enzyme HMG-coenzyme A reductase (39),
mutations that suppress phenotypes associated with a yme1
deletion mutation (8), and multicopy suppressors of the
nin1-1 mutation (51). While the phenotypic
effects of mutations in these genes are remarkably diverse, the paucity
of biochemical information about the yeast proteasome has limited
the mechanistic insights achievable through analyses of mutants. In
this work, we have identified 17 subunits from the RP of the yeast
proteasome by amino acid sequence analysis. Together with
additional experiments examining the nature of electrophoretic variants
of the proteasome, the assembly of multiple ATPases within a
single RP, and deletion mutations of RP subunits, these studies define
the components of the yeast RP and the complexes that they form.
 |
MATERIALS AND METHODS |
Yeast strains, media, and genetic techniques.
Chromosomal
deletions of RP genes were performed with strain DF5
(MATa/MAT
lys2-801/lys2-801
leu2-3,112/leu2-3,112 ura3-52/ura3-52 his3-
200/his3-
200
trp1-1/trp1-1) (24). Strain SUB62 (MATa
his3-
200 lys2-801 leu2-3,112 trp1-1 ura3-52) (24) was used as a wild-type control, as all phenotypic
analyses were carried out with MATa derivatives
(31). Yeast cultures were grown at 30°C unless otherwise
noted. YPD medium consisted of 1% yeast extract, 2% Bacto Peptone,
and 2% glucose. Synthetic medium consisted of 0.7% Difco yeast
nitrogen base supplemented with amino acids, uracil, and 2% glucose as
described previously (77). Specific nutrients were omitted
as necessary for plasmid selections. Standard techniques were used for
yeast transformations and tetrad analysis (31, 77).
Construction of strains expressing His6-tagged
ATPases.
A plasmid designed to express hexahistidine
(His6)-tagged versions of the proteasomal ATPases from
a single promoter was constructed. Northern blot analysis revealed that
RPT1, RPT2, RPT3, RPT5, and RPT6 express comparable levels of RNA at both 30 and 37°C
(data not shown). We therefore chose to express recombinant forms of these genes from a single plasmid containing the RPT1
promoter and a His6 epitope at the N terminus of the gene
to be expressed. With a two-step PCR protocol (86), a DNA
fragment containing the RPT1 5'-untranslated region, a
multiple cloning site (MCS), and the RPT1 3'-untranslated
region was created. In the first step, the oligonucleotide pairs DR27
(5'-CACTGCTTAAGCTTGTCGACTACCCGCCATTGTTGCAC)-DR29 (5'-CGACGACTGCAGTCGATCTC TAGATTTAATTAAATGGTGATGGTGATGGTGCATTCCGTATAGT TCCTAAC)
and DR30
(5'-GATCGACTGCAGTCGTCGGGATCCCCCGGGTACCCATACGACGTCCCAGACTACGC)-DR31 (5'-CTCAGTGGTACCGTCGACGATTATTCCCAATGTCGGTC)
were used to amplify DNA from pL44CIM5 (containing wild-type
RPT1 [30]) to create two overlapping
fragments. The first fragment contains 500 nucleotides immediately
upstream of the start codon, and the second fragment contains 764 nucleotides immediately downstream. To fuse the fragments via
the overlapping MCS, a second PCR with DR27 and DR31 was performed. The
resulting fragment was digested with HindIII and
KpnI and cloned into YCplac22, a yeast CEN4
shuttle vector marked with TRP1 (32); the
resulting plasmid was called DP1. All six genes were then amplified by
PCR and subcloned into the MCS.
Haploid cells containing a given rpt deletion covered
by a URA3-marked CEN plasmid expressing the
corresponding wild-type gene under the control of an
RPT1 promoter were generated. Plasmids carrying tagged
versions of the ATPase genes were introduced into these
strains, and following 5-fluoro-orotic acid selection (77), the following strains were produced: DY17
(His6-RPT2), DY19
(His6-RPT1), DY40
(His6-RPT6), DY41
(His6-RPT3), and DY178
(His6-RPT5). These strains grow at wild-type
rates. His6-RPT4 was expressed in a wild-type
SUB62 haploid strain (DY196).
Deletion of RPN9.
A strain containing HIS3
in place of the complete RPN9 coding region was constructed.
The transforming DNA fragment was generated by PCR as described
previously (86); the HIS3 gene was amplified from
a plasmid (yDpH) by use of a primer pair with base-pairing sites upstream and downstream of the RPN9 coding sequence:
DR117 (5'-CAAAAAGCAAACAGTG GGCACACGCGAGGAAACCACATTATATTTCGCAAGCTCTTGGCCTC CTCTAGT)-DR118
(5'-TTTATATATATGTGTGCGTGTGTGTTTTATATATAACTGCCAATGGCCTATCGTTCAGAATGACACG). The resulting fragment contains the HIS3 gene and, at either
end, the 5' and 3' sequences that flank the RPN9 coding
sequence. This DNA fragment was transformed into strain DF5, and
several transformants were sporulated. His+ segregants
displayed a uniform slow-growth phenotype. MATa rpn9::HIS3 (MG18) and MAT
rpn9::HIS3 (MG19) segregants were isolated for
subsequent studies. The site of integration was confirmed by PCR with a
primer for the upstream untranslated region of RPN9 and a
primer internal to HIS3: DR123
(5'-AGATCCAAGCTTCAAATTGAAAGATTGTCTATCAATCTGTA) and DR26
(5'-CTGTCATCTTTGCCTTCG). To construct a
rpn9
rpn10 double mutant, a MATa
rpn10::LEU2 strain (102) was mated with MG19. His+ segregants displayed a nearly uniform
slow-growth phenotype. MATa haploids with
histidine and leucine prototrophy were recovered (MG29).
Myc6 tagging of RPN9.
To create a plasmid
carrying Myc6-Rpn9 under the control of its own
promoter, genomic DNA from SUB62 was amplified with the following
primers: DR123
(5'-AGATCCAAGCTTCAAATTGAAAGATTGTCTATCAATCTGTA) and DR116
(5'-GCTGTATCCCTAAACCCAGATGGATTGGCCA). The resulting fragment was cloned into a LEU2-marked CEN
plasmid containing a downstream Myc6 sequence followed by a
stop codon (pNU119). This plasmid was transformed into MG18 to
generate strain MG26.
Purification of the proteasome by conventional
chromatography.
Purification of the proteasome by conventional
chromatography was modified from that described previously
(79). The proteasome was purified from a yeast cell lysate
by the protocol shown in Fig. 1. SUB62
was grown to the stationary phase on YPD in a 12-liter fermentor. After
centrifugation, the cell pellet was resuspended in a threefold volume
of buffer A, containing 50 mM Tris (pH 7.4), 5 mM MgCl2,
10% glycerol, 1 mM ATP (grade 1; Sigma), and 1 mM dithiothreitol
(DTT). For cell resuspension and lysis, buffer A was supplemented with
an additional 4 mM ATP. Cells were lysed with a French press, and the
extract was clarified by centrifugation at 30,000 × g
for 20 min and passage through cheesecloth. The extract was
fractionated on a 100-ml DEAE-Affi-Gel Blue column (Bio-Rad), followed
by anion-exchange chromatography and gel filtration chromatography.
Anion exchange was performed by use of an XK26 column packed with 50 ml
of Resource Q resin (Pharmacia). Proteins were resolved on a 500-ml
gradient of 100 to 500 mM NaCl at 4 ml/min. Fractions (8 ml) were
collected and screened for the ability to hydrolyze Suc-LLVY-AMC
(Bachem). Fractions containing the peak of activity, eluting at 270 to
330 mM NaCl, were pooled, desalted, concentrated to 1 ml by use of
Ultrafree concentrators with a molecular weight cutoff of 30 kDa
(Millipore), and further resolved by gel filtration. For gel
filtration, 100 ml of S-400 resin (Pharmacia) was packed in an XK16
column. Samples were run isocratically in buffer A with 100 mM NaCl at
a flow rate of 1 ml/min. Fractions (2 ml) were collected and screened
for peptidase activity. Fractions from a broad peak of peptidase
activity were pooled into separate aliquots (pools A to D).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Proteasome purification procedure. (A) A yeast lysate
was fractionated on a series of columns containing DEAE-Affi-Gel Blue,
Resource Q resin, or S-400 resin (see Materials and Methods for
details). Fractions containing peptidase activity were combined into
four pools (A to D) in descending molecular mass order. Protein content
and specific peptidase activity at each step are shown in Table 1. (B)
Proteasomes from each pool were visualized by nondenaturing PAGE and
fluorogenic peptide overlay. In pool D, two faster-migrating species
were observed in addition to RP2CP and RP1CP.
The fastest-migrating species was the CP, and the other contained the
CP and a subset of RP subunits (data not shown). (C) Proteasomes from
pool B were tested for the ability to proteolyse multiubiquitinated
125I-labeled lysozyme in the presence or absence of
ATP. Degradation was measured as trichloroacetic acid-soluble
125I counts per minute at a given time point. Background
radioactivity was subtracted from all readings. Error bars indicate
standard deviations.
|
|
Assays of proteasome activity and concentration.
Aliquots
from column fractions were incubated in buffer A with 0.1 mM
Suc-LLVY-AMC for 10 min at 30°C. The reaction was quenched by the
addition of sodium dodecyl sulfate (SDS) to a final concentration of
1%. Fluorescence readings of released 7-amido-4-methylcoumarin (AMC)
were taken at an excitation wavelength of 380 nm and an emission
wavelength of 440 nm and were recorded as arbitrary (fluorescence) units per milligram of protein. Ubiquitin-lysozyme conjugate breakdown assays were performed essentially as described previously
(79) by incubating proteasome with ubiquitinated,
125I-labeled lysozyme for 30 min and recording the
trichloroacetic acid-soluble radioactivity released from the
proteolysed substrate compared to the background. Protein
concentrations in the different fractions were determined by using
Coomassie Plus (Pierce) with bovine serum albumin as a standard.
Proteasome purification by Ni-NTA affinity chromatography.
Purification of the proteasome by Ni-nitrilotriacetic acid (NTA)
affinity chromatography was performed as described previously (79). Briefly, eluates from the DEAE-Affi-Gel Blue column
were loaded onto Ni-NTA-agarose columns (Qiagen). Nonspecifically
bound proteins were eluted with 100 mM NaCl and 15 mM imidazole in
buffer A. His6-tagged proteasome was eluted with 100 mM
NaCl and 100 mM imidazole in buffer A. Column fractions were tested for
the presence of proteasomal subunits by immunoblotting with appropriate antibodies. Protein samples were also assayed for the ability to
hydrolyze Suc-LLVY-AMC.
Ni-NTA affinity purification of the RP.
Purified proteasome
preparations were dissociated to reveal uncapped CPs after incubation
for 30 min at 30°C in buffer A without ATP and supplemented with
500 mM NaCl. Dissociation of the proteasome was confirmed by comparing
the migration of the sample before and after NaCl incubation on
nondenaturing polyacrylamide gels. Partial purification of the RP was
performed by first-depleting cells of ATP; the cells were then
incubated after harvesting in 1 volume of buffer A without ATP and
supplemented with 0.2 nM dinitrobenzene and 200 mM deoxyglucose for 30 min at 30°C. Subsequent cell lysis and protein purification steps
were performed in the absence of ATP. Clarified cell extract was
applied to DEAE-CL-6B anion-exchange resin (Sigma), rinsed with 100 mM
NaCl, and eluted with 500 mM NaCl in buffer A. Ni-NTA chromatography
was performed as mentioned above for the intact proteasome but in the
absence of ATP. Column fractions were tested for the presence of
Rpt1, Rpt6, and Rpn10 by immunoblotting with specific antibodies.
Denaturing and nondenaturing PAGE.
Except for purposes of
sequence analysis (see below), purified proteasome polypeptides were
resolved by SDS-12% polyacrylamide gel electrophoresis (PAGE) by
standard techniques (52). Proteins were either stained in
the gel with Coomassie blue or transferred to nitrocellulose for
immunoblotting. For identification of proteins by immunoblotting,
samples were resolved by SDS-PAGE and electrotransferred to
nitrocellulose membranes (Whatman) with a semidry transfer system (Owl
Scientific). Immunoblotting was performed with antisera to Rpn10
(generously provided by Steve van Nocker and Richard Vierstra) and to
Rpt1 and Rpt6 (generously provided by Carl Mann). Primary antibodies
were visualized with alkaline phosphatase-labeled goat anti-rabbit
immunoglobulins (Promega) and the substrates nitroblue tetrazolium and
5-bromo-4-chloro-3-indolylphosphate (Promega).
Protein samples were resolved by nondenaturing PAGE by a
modification of the method of Hoffman et al. (
44). We used a
single
gel layer consisting of 0.18 M Tris-borate (pH 8.3), 5 mM
MgCl
2,
1 mM ATP, 1 mM DTT, and 4%
acrylamide-bisacrylamide (at a ratio
of 37.5:1) and polymerized
with 0.1%
N,
N,
N',
N'-tetramethylethylenediamine
(TEMED) and 0.1% ammonium persulfate. The running buffer was the
same
as the gel buffer but without acrylamide. Xylene cyanol was
added to
protein samples prior to loading onto the gels. Nondenaturing
minigels
were run at 100 to 150 mV until the Xylene cyanol eluted
from the gels
(approximately 2 h). The gels were then incubated
in 10 ml of 0.1 mM Suc-LLVY-AMC in buffer A for 10 min. Proteasome
bands were
visualized upon exposure to UV light (360 nm) and photographed
with a
Polaroid camera.
For extracting intact proteasome from a gel, nondenaturing PAGE was
performed as described above except that the usual cross-linker
bisacrylamide mixture in the gel was replaced with the reversible
cross-linker
N,
N'-bisacrylylcystamine
(Bio-Rad). Gels containing
4%
acrylamide-
N,
N'-bisacrylylcystamine at a
ratio of 22:1 were
polymerized with 0.1% TEMED and 0.1% ammonium
persulfate. After
the standard peptidase overlay assay, the
proteolytically active
bands were cut out of the gels and incubated
with 40 µl of 2 M
DTT per 100 µl of gel slice for 30 min at 30°C.
Laemmli loading
buffer (
52) was added, and the samples were
heated to 80°C for
3 min and loaded onto SDS-PAGE minigels. The gels
were then stained
with Coomassie blue, and the resulting protein
banding pattern
was quantitated by densitometry with NIH Image and
LabGel software.
The same methods were used for the quantitation of
immunoblots.
Peptide sequence analysis.
Samples from different proteasome
preparations, containing about 30 µg of purified protein, were
precipitated with methanol-chloroform (105), denatured with
SDS, reduced, and alkylated with iodoacetamide (96). Samples
were then reprecipitated and resuspended in SDS-PAGE loading buffer
(16) for resolution of subunits on an acrylamide gradient
(10 to 20%) minigel (0.75 mm) with a standard Laemmli buffer system
(52). No more than 10 µg of reduced and alkylated protein
was loaded per gel lane to achieve acceptable resolution. After
electrophoresis, the gel was stained with Coomassie blue and destained
by standard protocols (25).
The Coomassie blue-stained subunits of the proteasome were cut from the
gel with a scalpel, digested with trypsin in situ,
and extracted as
described previously (
78). The extracts were
concentrated
under vacuum, resuspended in 0.1% trifluoroacetic
acid, and
fractionated by reverse-phase high-pressure liquid chromatography
(HPLC) on a C
18 column. Proteins were eluted with a
gradient of
acetonitrile containing 0.1% trifluoroacetic acid. The
isolated
peptides were sequenced by automated Edman degradation on a
model
470/900/120A gas-phase sequencer (Applied Biosystems) with
standard
chemistry.
 |
RESULTS |
Purification and characterization of the proteasome.
The
proteasome was purified from cell lysates by the protocol described in
Fig. 1A and Table 1. In the final step of
gel filtration, a broad peak of peptidase activity eluted between 3 and
0.7 MDa. Peak fractions were collected into four pools in descending
molecular mass order as they eluted from the gel filtration column
(pools A to D; Fig. 1B). The proteasome pools were active in the
degradation of ubiquitin-protein conjugates in the presence of ATP
(Fig. 1C and data not shown). Peptidase activity coincided with
proteolytic activity, as assayed with ubiquitin-lysozyme conjugates
(Fig. 1B and C and data not shown).
Each pool was analyzed by nondenaturing PAGE, with proteasome
bands visualized by their ability to hydrolyze the fluorogenic
peptide Suc-LLVY-AMC (Fig.
1B). Two major electrophoretic bands
whose
relative abundance was characteristic from pool to pool
were
observed (Fig.
1B). Mammalian proteasome preparations have
similarly
been resolved into multiple forms by nondenaturing PAGE
(
44,
47,
100). To define the compositions of the two forms,
they were
resolved by nondenaturing PAGE, using a gel that had
been polymerized
with a reversible cross-linker,
N,
N'-bisacrylylcystamine.
The two bands
were excised, the gel matrix was dissolved, and
the protein components
of the particle were resolved by SDS-PAGE.
Similar polypeptide patterns were observed for the two electrophoretic
forms of the proteasome (Fig.
2). The
molecular masses
of the CP subunits in yeast are all between 15 and 30 kDa (
12),
while most RP subunits are larger than 30 kDa (see
below). We
therefore compared the integrated intensity of the protein
bands
in the 30- to 120-kDa region to that in the 15- to 25-kDa region
for the slower-migrating form of the proteasome and then compared
this
ratio to that for the faster-migrating form. The ratio of
the
integrated intensity of the RP subunits to that of the CP
subunits for
the slower-migrating form of the proteasome was approximately
double
that for the faster-migrating form (Fig.
2). The same results
were
obtained for the ratio of the cumulative intensity of all
the RP bands
to the cumulative intensity of all the CP bands and
for the ratio
of individual RP components to individual CP bands
(Fig.
2). We
conclude that the slowest-migrating form on nondenaturing
PAGE
represents doubly-capped proteasomes (RP
2CP), that
the faster-migrating
form (of the two present in pool B) represents
singly-capped proteasomes
(RP
1CP), and that the protein
compositions of the two forms are
otherwise equivalent. Electron
micrographs confirmed the presence
of dumbbell-shaped, doubly-capped
proteasomes and mushroom-shaped,
singly-capped proteasomes in
these preparations (data not shown).
Whether there are significant
functional differences between singly-
and doubly-capped forms of the
proteasome is unknown.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
The proteasome migrates as singly and doubly capped
forms on nondenaturing PAGE. Purified proteasomes from pool B were
resolved by nondenaturing PAGE with a reversible cross-linker,
N,N'-bisacrylylcystamine. The fast- and
slow-migrating forms were excised. Their proteins were extracted from
the gels and resolved by SDS-12% PAGE. The gels were then stained
with Coomassie blue. Densitometric quantitation of the resulting
protein banding pattern is shown for each form. The protein banding
pattern can be compared to that shown in Fig. 3 prior to nondenaturing
PAGE. However, as the two gel systems are different, the comparison
cannot be made on a one-to-one basis. Based on the data in Table 2 (and
data not shown), proteins below 25 kDa were assumed to be CP subunits,
and those above 30 kDa were assigned as be RP subunits. The integrated
intensities of CP and RP subunits are displayed over the corresponding
region of the gel. The ratio of intensity of RP subunits to that of CP
subunits in the slower-migrating form of the proteasome is
approximately double that in the faster-migrating form.
|
|
Subunit composition of the proteasome.
Amino acid sequence
analysis was used to identify the subunits of the RP of the proteasome.
Purified proteasomes were resolved by gradient SDS-PAGE, and the
protein bands were stained with Coomassie blue (Fig.
3). The protein pattern in the 20- to
30-kDa region resembled that of independently purified CP (data not
shown). Protein bands in the higher-molecular-mass region (30 to 120 kDa) with strong or intermediate staining intensities were numbered in
descending molecular mass order from 1 to 17 (Fig. 3). The bands were
excised from the gel and treated with trypsin. Representative peptides
sequenced from each protein are shown in Table
2. The sequence of each peptide matched
completely the deduced sequence from a yeast open reading frame (ORF)
present in the SGD database, allowing the assignment of each protein as
the product of a specific chromosomal locus (Table 2). Given that
the S. cerevisiae genome is entirely known, the peptide
sequence data are sufficient to assign each RP subunit as the product
of a single gene. Although a few residues were not unambiguously
assigned by the sequencer, no amino acid that was assigned differed
from the corresponding yeast ORF-encoded sequence. In summary,
seventeen RP proteins were resolved into 15 electrophoretic bands of
comparable intensities (1 to 6, 8 to 15, and 17) and one more intense
band (band 7), which contained peptides from two different RP subunits
(Table 2). The RP proteins were named as follows: six of the proteins, which are putative ATPases of the AAA family (11), were
designated Rpt1 to Rpt6 (for RP triple-A protein), and the other
proteins were designated Rpn1 to Rpn12 (for RP non-ATPase). We note
that the new nomenclature was arrived at in consultation with other yeast proteasome researchers and that nomenclatural conventions will be
discussed in more detail in a separate communication.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Subunit composition of the proteasome determined by
gradient SDS-PAGE. Proteins from pool B (Fig. 1) were resolved on a 10 to 20% polyacrylamide gradient gel. Protein bands were stained with
Coomassie blue. Seventeen protein bands in the 120- to 30-kDa region
were numbered in descending molecular mass order (masses are shown on
the left). Proteins were excised from the gel and digested with
trypsin. The resulting peptides were separated by reverse-phase HPLC
and subjected to sequence analysis. Peptides sequenced from each band
are shown in Table 2.
|
|
Among bands 1 to 17, only one was found not to be an RP subunit; band
16 was identified as Pre10, a subunit of the CP (
12,
43).
Band 14 yielded peptides from two different proteins: Rpn10,
which we
have previously identified as Mcb1, a proteasome subunit
that can bind
multiubiquitin chains in vitro (
102), and, in some
preparations, Cdc10 (
58). However, Cdc10 is not a component
of the proteasome but rather is a substochiometric contaminant,
since
Cdc10 failed to comigrate with the proteasome upon nondenaturing
PAGE,
as determined by immunoblotting with anti-Cdc10 and anti-Rpt1
antibodies (data not shown). Also, in the final, gel filtration
step of
purification, Cdc10 peak fractions did not coincide with
the proteasome
peak.
Fujimuro et al. (
27) recently showed that the Son1 protein
cofractionates with the proteasome by gel filtration and that
antibodies to Son1 precipitate proteasome subunits. Consistent
with
Son1 being a component of the proteasome, a subset of proteasome
substrates were stabilized in
son1 mutants (
48).
However, we
were unable to detect Son1/Rpn4 in our purified
proteasome preparation
by direct sequencing or by using
antibodies to Son1. Son1 homologs
have not been found in purified
mammalian proteasomes either.
Unlike most proteasome subunits,
Son1 is nonessential (
69).
It is perhaps a loosely
associated component.
Characterization of novel RP subunits.
Table
3 lists the known subunits of the RP of
the proteasome in yeast, their properties, and their homologs in other
species. Two proteins did not have homologs previously identified as
proteasomal subunits in other organisms: Rpn9 is encoded by ORF
YDR427w, which has not been characterized, and Rpn11 is the product of
the MPR1 gene. The mpr1 mutant was isolated as a
suppressor of a defect in mitochondrial tRNA processing; deletion of
the MPR1 gene is lethal (76). After submission of
this manuscript, Rpn11 was identified as a subunit of human and
Schizosaccharomyces pombe proteasomes (91). Like
other Rpn subunits, Rpn9 has clear homologs in other species (Table 3
and Fig. 4). Rpn9 is 29% identical to a
protein encoded by a hypothetical ORF in Caenorhabditis
elegans (Fig. 4), and in various mammals there are expressed
sequence tag (EST) fragments that are 42% identical to the C terminus
of Rpn9 (Fig. 4). The Rpn9 homologs represented by these EST fragments are most likely RP subunits. An additional four of the non-ATPase subunits (Rpn5 to Rpn8), which have not been characterized
biochemically in S. cerevisiae, are homologs of known
mammalian subunits (Table 3). The RPN5/NAS5 and
RPN6/NAS4 genes were recently found to be essential by Saito
and colleagues (82). The six ATPases (Rpt1 to Rpt6), as
well as Rpn1 to Rpn4, Rpn10, and Rpn12, were previously proposed to be
RP subunits, with the nature of the evidence varying from case to case
(Table 3 and references therein).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
Rpn9 is homologous to putative proteasome subunits in
other eukaryotes. Homology of the C terminus of Rpn9 to deduced protein
sequences of the product of a hypothetical ORF in C. elegans
(z49130) and mouse (w34049) and human (aa122133) EST fragments is
shown. The alignment was obtained by the Jotun Hein method with
MegAlign (gap penalty, 11; gap length, 3). The C terminus of Rpn9 was
35, 36, and 42% identical to the C. elegans, mouse, and
human sequences, respectively. Boxes indicate amino acid identities;
dashes indicate gaps in the alignment.
|
|
A precise deletion of the
rpn9 coding sequence resulted in
a slow-growth defect at 30°C (Fig.
5). After 48 h at 37°C,
rpn9 mutants failed to form colonies. In a large-scale
analysis of
expressed genes in
S. cerevisiae, the ORF
corresponding to
RPN9 was reported to be nonessential
(
7).
RPN9 is apparently the
only proteasome
subunit gene that confers a temperature-sensitive
phenotype when
deleted, although this phenotype has been observed
for point mutations
in a number of other subunits. Temperature-sensitive
phenotypes have
been observed for
rpn1 and
rpn2 disruptions
(
98,
108), but complete deletions of these genes appear to
be lethal
(
14,
54a,
57a). Aside from
RPN9, the
only other RP genes that
are known to be nonessential are
RPN10/MCB1 (
102) and
RPN4/SON1 (
27).
rpn9
rpn10 double mutants did
not display a marked synthetic
phenotype for vegetative growth
(Fig.
5B and C).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Temperature-sensitive phenotype caused by
rpn9 deletion mutation. (A) Wild-type (SUB62),
myc6-RPN9 (MG26), and rpn9 (MG18)
strains were grown on YPD at 30°C (top panel) or 37°C (bottom
panel). The rpn9 strain was temperature sensitive,
showing no detectable growth after 48 h at 37°C. (After 1 week,
a few small colonies were observed.) The
myc6-tagged version of RPN9 fully
complemented the deletion. (B and C) The rpn9 rpn10
double mutant did not display a marked synthetic phenotype. Wild-type
(SUB62), rpn9 (MG18), rpn10
(102), and rpn9 rpn10 double mutant (MG29)
strains were grown for 48 h on YPD at either 30°C (B) or 37°C
(C).
|
|
To confirm that Rpn9 is a subunit of the proteasome, Rpn9 was tagged at
its C terminus with six copies of the Myc epitope.
Expression of tagged
Rpn9 in a
rpn9 mutant background resulted
in
full complementation (Fig.
5A). Proteasomes from wild-type
and
myc6-RPN9 strains were partially purified on a
DEAE-Affi-Gel
Blue column and further resolved by nondenaturing
gel electrophoresis.
The gel was immunoblotted, and the filter
was probed with anti-Myc
antibodies. Two bands which comigrated with
singly- and doubly-capped
proteasomes were detected (Fig.
6). We conclude that Rpn9 is a
subunit of the proteasome.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Rpn9 is an RP subunit. Proteasomes from wild-type (wt)
and myc6-RPN9 strains were partially purified on
a DEAE-Affi-Gel Blue column and further resolved by nondenaturing
PAGE. (A) Proteasome bands visualized in situ by peptidase activity
against Suc-LLVY-AMC. (B and C) Immunoblots probed with the indicated
antibodies.
|
|
Interestingly, Rpn11/Mpr1 contains a single conserved cysteine which is
flanked by a highly conserved sequence with similarities
to the
active-site "Cys box" seen in many deubiquitinating enzymes
(Tables
4 and
5).
The catalytic triad of many deubiquitinating
enzymes is thought to be
made up of a nucleophile (Cys), a general
base (His), and an acidic
residue (Asp) (
4,
23,
107). In
Rpn11, a number of conserved
aspartates and histidines are present
downstream of the conserved Cys
box and could potentially serve
these functions.
Evolutionary conservation of RP subunits.
All RP subunits
identified in the purified preparation from yeast (Fig. 3) have clear
homologs in other eukaryotes (Table 3). The Rpt subfamily of putative
ATPases shows a greater degree of homology between species than the
Rpn subunits (Fig. 7). The Rpt subunits
are 66 to 76% identical between yeasts and humans, whereas the
non-ATPase subunits show a lower yet significant amount of sequence
identity, varying between 22 and 47% between species. Alone among the
Rpn subunits, Rpn11 is 65% identical to its human counterpart, a level
of identity similar to that observed for the ATPase subunits,
consistent with the suggestion above that it could serve an enzymatic
function within the RP.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
Structural alignment of six proteasomal ATPases.
Comparison of the six Rpt subunits based on their primary structure
shows a highly conserved ATPase module (black box) containing the A
and B loops which form the predicted ATP binding domain (33,
34, 67, 103). The N termini are variable, in some genes
containing a predicted (62) coiled-coil domain (open box).
|
|
A number of RP subunits show homology to each other. The six ATPase
subunits (Rpt1 to Rpt6) are roughly 40% identical to each
other. Among
the non-ATPase subunits, three pairs show close to
20% identity to
each other: Rpn1 with Rpn2 (
6,
60), Rpn5
with Rpn7, and Rpn8
with Rpn11. The same relationship is maintained
among their mammalian
counterparts. Despite the similarity between
Rpn11 and Rpn8, Rpn8 lacks
candidates for a conserved active-site
cysteine. However, another set
of homologous proteins with a greater
level of identity to Rpn11
(~30%) is found in numerous eukaryotes
and contains the Cys
consensus region (Table
5, group II). There
is no evidence that these
proteins are proteasome subunits; however,
the significant level of
homology to both Rpn11 and Rpn8 suggests
that they might play a role in
the ubiquitin-proteasome pathway.
The sequence similarities among
different Rpt and Rpn subunits
raises the possibility that gene
duplication played a major role
in the evolution of the RP. The RP
subunits may have diverged
from a small number of subunits in an
evolutionary precursor to
the proteasome, similar to the apparent
divergence of the 14 subunits
of the CP from two precursors (
12,
43).
Coassembly of Rpt subunits within the proteasome.
The
ATPase subunits of the RP are distinct from the non-ATPase
subunits in that they show a high level of similarity to one another
(Fig. 7). This fact raises the question of whether
interchangeability among the ATPases during assembly may
yield proteasomes with different subunit compositions and functional
properties, as suggested, for example, by studies with Manduca
sexta (13, 95). In Escherichia coli, the
ClpP protease can assemble with multiple ATPase-containing RPs, but each ATPase is found in a different, homomeric assembly (36). In vitro, the mammalian proteasomal ATPases can
interact in a pairwise manner, but assemblies of more than two
ATPases have not been observed in such experiments (75).
We tested whether multiple Rpt subunits are present in the same
proteasome molecule by using Ni-NTA-chelate affinity chromatography of
proteasomes bearing His6-tagged Rpt subunits. Wild-type and
His6-Rpt2-containing proteasomes were partially purified on
DEAE-Affi-Gel Blue columns and then affinity purified with Ni-NTA. The
presence of proteasomes in the His6-Rpt2 eluate was shown
by peptidase activity as well as the copurification of multiple
proteasome subunits (Fig. 8A and B).
Importantly, during affinity purification, the ratios of Rpt1 to Rpt6
in the column load, flowthrough, and eluate remained essentially
constant (1.35, 1.35, and 1.25, respectively; Fig. 8A), indicating that
the purification procedure did not select a specific subset of
proteasomes. Thus, Rpt1 and Rpt6 are both present in Rpt2-containing
proteasomes, and the ratio of Rpt1 to Rpt6 in Rpt2-containing
proteasomes is indistinguishable from that in total proteasomes.
Similar experiments were done with strains expressing
His6-tagged versions of all six ATPases (Fig. 8C).
Tagging of Rpt1, Rpt2, Rpt3, or Rpt4 allowed affinity purification of
proteasomes without significantly altering the relative ratios of Rpt1
and Rpt6 in the column load and eluate (Fig. 8C). These data
demonstrated that an individual proteasome contains multiple ATPases and that affinity purification of proteasomes from
individually tagged ATPases yields proteasomes with similar
compositions. The difficulty in purifying intact proteasomes from
His6-Rpt5- and His6-Rpt6-expressing strains
with Ni-NTA was probably due to the His6 tag being occluded
when the RP was complexed to the CP (see below).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 8.
The proteasome is a heteromeric complex of ATPases.
His6-Rpt2 was expressed in a rpt2 background
(DY17). Extracts from His6-Rpt2-expressing and wild-type
(WT) control strains were partially purified by DEAE-Affi-Gel Blue
chromatography in the presence of 1 mM Mg-ATP. The 150 mM NaCl
eluate was subjected to Ni-NTA affinity chromatography. Column
fractions were immunoblotted (A) and tested for peptidase activity
against Suc-LLVY-AMC (B). The epitope-tagged complex eluted at 100 mM
imidazole, as indicated by immunoblotting against Rpt1, Rpt6, and Rpn10
(A) and by peptidase activity (B). The wild-type proteasome eluted
during low-imidazole rinses. (C) Extracts from strains expressing
His6-tagged versions of each of the six ATPases were
individually purified by Ni-NTA chromatography. Fractions loaded onto
the Ni-NTA column (Load) were compared to fractions from the 100 mM
imidazole eluate (Eluate) by immunoblotting with anti-Rpt1 and
anti-Rpt6 antibodies.
|
|
Because the proteasome can contain one or two RPs (Fig.
3 and
4),
different ATPases may copurify even though they are not
present in
the same RP complex. To test whether distinct ATPases
assembled
into a single RP, we found conditions in which the RP
can be
dissociated from the CP (Fig.
9). The CP
is visualized
as a faster-migrating complex on nondenaturing PAGE after
dissociation
of the proteasome components in the absence of ATP
(Fig.
9A).
The peptidase activity of the proteasome is greater by 1 order
of magnitude than that of the CP alone (Fig.
9B). However, the
peptidase activity of the CP is stimulated by SDS to levels similar
to
that of the proteasome holoenzyme (Fig.
9B).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 9.
Dissociation of the RP from the CP inhibits peptidase
activity. Equal amounts of purified proteasome were incubated for 30 min at 30°C in buffer A or in buffer A without Mg-ATP but with
500 mM NaCl. (A) The two samples were resolved by nondenaturing PAGE
and visualized by activity against the fluorogenic peptide substrate
Suc-LLVY-AMC. After incubation in 500 mM NaCl, both singly- and
doubly-capped forms of the proteasome (RP2CP and
RP1CP, respectively; left lane) disassembled, giving rise
to free CPs (right lane). It is apparent that the CP had lower
peptidase activity than the proteasome on a molar level. The RP was not
visualized by this method, as it contains no intrinsic peptidase
activity. (B) To quantify the difference in peptidase activities
between the proteasome and the CP, approximately equimolar quantities
of the two samples were incubated for 10 min at 30°C in buffer A with
0.1 mM fluorogenic peptide Suc-LLVY-AMC; the fluorescence of released
AMC is shown in the left columns. The two samples were also incubated
for 10 min at 30°C in buffer A with 0.1 mM Suc-LLVY-AMC and 0.02%
SDS (right columns). The CP exhibited a lower level of peptidase
activity and a higher level of SDS stimulation than the intact
proteasome.
|
|
Components of the RP were affinity purified after dissociation from the
CP; column profiles of wild-type and His
6-Rpt1-expressing
strains are shown in Fig.
10A and B. By
tagging Rpt1 with His
6 we purified a complex that contained
Rpt6 and Rpn10, as shown
by immunoblotting of the column fractions
(Fig.
10A). That the
CP was not retained on the column was shown by the
absence of
peptidase activity in the eluate (Fig.
10B). The ratios of
Rpt1
to Rpt6 in the column load, flowthrough, and eluate remained
essentially
constant for the His
6-Rpt1-containing cell
extract (1.25, 1.40,
and 1.20, respectively; Fig.
10A), indicating that
the purification
procedure did not select a specific subset of RPs.
Indistinguishable
results were obtained for His
6-tagged
versions of each Rpt subunit
(Fig.
10C). Thus, each Rpt subunit
coassembles with multiple Rpt
subunits into complexes with similar
ratios of Rpt1 to Rpt6. These
data strongly suggest that each RP
contains all six ATPases.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 10.
Proteasomal ATPases associate into a heteromeric
complex. His6-Rpt1 was expressed in a rpt1
background (DY19). Extracts from His6-Rpt1-expressing and
wild-type (WT) control strains were partially purified on DEAE-CL-6B
resin in the absence of ATP. The 500 mM NaCl eluate was
fractionated on Ni-NTA affinity columns. Column fractions were
subjected to immunoblotting (A) and tested for peptidase activity
against Suc-LLVY-AMC (B). The epitope-tagged complex eluting at 100 mM
imidazole contained a number of RP subunits (Rpt1, Rpt6, and Rpn10) (A)
but lacked peptidase activity (B). The wild-type complex eluted
during low-imidazole rinses. (C) Extracts from strains
expressing His6-tagged versions of each of the six
ATPases were also purified by Ni-NTA chromatography. Fractions
loaded onto the Ni-NTA column (Load) were compared to fractions from
the 100 mM imidazole eluate (Eluate) by immunoblotting with anti-Rpt1
and anti-Rpt6 antibodies.
|
|
 |
DISCUSSION |
Previous work on the proteasome of S. cerevisiae
focused on the CP, culminating in the solution of its crystal structure
(38). However, CPs fail to degrade physiological substrates
of the proteasome, and their activity is not stimulated by ubiquitin or
ATP. Thus, substrate selection and other key early steps in protein
breakdown by the proteasome must be studied with the holoenzyme form of the complex. Here we report the biochemical characterization of the
proteasome holoenzyme from S. cerevisiae. By amino acid
sequence analysis, we directly identified 17 subunits that form the RP of the yeast proteasome. Genes encoding a number of these subunits or
their homologs were originally identified through a wide variety of
genetic screens (8, 14, 30, 35, 39, 50, 51, 76, 89, 94),
only a few of which were designed to detect proteolysis mutants
(14, 39). These data point to the breadth of the regulatory
functions of the proteasome. The assembly of these proteins into the
same complex provides a common explanation for the disparate and in
many cases unexpected phenotypes. These genetic studies also suggest
that substrate-specific effects on protein turnover can result from
mutations in any of a large number of RP subunit genes, a suggestion
which has interesting mechanistic implications.
Of the known mammalian RP subunits, only S5b/p50.5 (17, 18)
appears absent from yeast. We found no evidence for an S5b homolog in
purified yeast proteasomes; in agreement with this result, no clear S5b
homologs are identifiable in the yeast genome database. Our survey of
yeast proteasome components also did not identify proteins homologous
to the proteasome activator PA28 (63), a result which is
similarly supported by the lack of close PA28 homologs in the yeast
genome. Yeast proteasomes appear to be more uniform than those of
mammals in several ways: they do not appear to associate with PA28-like
activator proteins that can replace the RP complex, and each of the 32 known subunits is apparently encoded by a single gene. The
heterogeneity of the mammalian proteasome appears to regulate the
nature of peptide end products of degradation rather than substrate
selection and may be linked to the role of the proteasome in antigen
processing (12). The relevance of subunit interchangeability
to antigen processing is best exemplified by the LMP proteins, which
interchange with other proteolytically active
subunits of the CP to
alter the cleavage site specificity of the proteasome (12).
Possible interchangeability among the ATPases is suggested both by
their strong sequence similarity to one another and by evidence that
the ratio of one ATPase to another in the proteasome may change
during the course of programmed cell death in M. sexta, with
possible replacement of one ATPase subunit for another (13, 95). The simplest model for interchangeability among the
ATPases, which has a precedent in prokaryotic ATP-dependent
proteases (36), is that each RP contains a single type of
ATPase and thus that the various ATPases define distinct
proteasome populations. The results of the His6 tagging
experiments shown in Fig. 10 exclude this and related models. The data
indicate that the six ATPases of the proteasome are present in the
same complex, further suggesting that the subunit composition of the
yeast proteasome may be uniform from particle to particle. The presence
of six ATPases within a given proteasome is consistent with their
assembly into a six-member ATPase ring structure analogous to those
found in the simple ATP-dependent proteases of prokaryotes
(36, 93). The same analogy suggests that this ring is
situated in contact with the CP and that substrates pass through the
center of this ring as they translocate into the CP. This model is
consistent with the ATP dependence of proteasome assembly from the
RP and CP complexes (3, 15, 45;unpublished data). A strictly determined site of assembly for each ATPase is
suggested both by the coassembly of ATPases into a single particle and by the requirement for each ATPase in yeast (30, 81,
85).
The 17 subunit assignments proposed here all have a high degree of
confidence. For example, for 29 peptides sequenced, all amino acids
assigned were in agreement with predictions from the sequence of the
yeast genome. Moreover, most of the subunits identified were homologs
of known subunits of the mammalian RP (PA700). However, the existence
of additional RP subunits in yeast remains a distinct possibility,
which could best be addressed by two-dimensional isoelectric focusing
and SDS-PAGE. In particular, the low-molecular-mass region of the
one-dimensional gels that we used contained many CP-derived bands,
which could comigrate with as-yet-unidentified RP subunits. In mammals,
PA700 is a stable complex which has been purified and found to
associate with the CP to produce a complex that is competent for the
degradation of ubiquitin-protein conjugates (1, 15, 64). We
have also partially purified a particle from yeast that can, when added
to CPs, similarly reconstitute the degradation of ubiquitin-protein
conjugates (unpublished data). However, it has yet to be established
that PA700 is identical to the RP dissociated from purified proteasomes
(83). As suggested above, certain components of the
proteasome may be loosely associated and thus underrepresented in
purified preparations.
The percentages of identities between sequences of yeast and human
homologs of the various RP subunits are given in Table 3. The
ATPases are exceptionally conserved, showing 66 to 76% identity,
while identity scores for the non-ATPase Rpn subunits are much
lower. The only exception is Rpn11/Mpr1, which is 65% identical
between yeast and humans. Interestingly, the amino acid sequence
surrounding Cys-117 within Rpn11 shows similarity to sequences flanking
the active-site cysteine which serves as the nucleophile in
deubiquitinating enzymes (Table 4). No other RP subunit thus far
identified shows significant similarity to known deubiquitinating
enzymes. All known Rpn11 homologs contain extended regions of
identity to one another surrounding Cys-117 in Rpn11 (Table 5). It is
plausible that Rpn11 and its homologs from other species function as a
new class of deubiquitinating enzymes (Table 5, group I), potentially
accounting for the deubiquitinating activity detected in preparations
of the mammalian PA700 complex (53, 54). The predicted
molecular masses of Rpn11 and its homologs are consistent with
estimates based on active-site labeling of the bovine PA700
deubiquitinating factor (54). However, our proteasome
preparations had low activity in several deubiquitination assays (data
not shown) (52a), despite containing apparently intact
Rpn11. It is possible that the ubiquitin conjugates tested thus far are
not the preferred substrates of Rpn11 and that other substrates will
allow the detection of Rpn11-dependent isopeptidase activity in yeast
proteasomes.
Lam and coworkers have suggested that isopeptidase activity within the
proteasome may serve to inhibit the degradation of certain conjugates
by progressively trimming their ubiquitin chains from the distal end
(53). We suggest that proteasomal isopeptidase activity may
also, depending on the substrate, accelerate conjugate breakdown by
removing ubiquitin groups that prevent translocation of the proteolytic
substrate through the channel of the CP. Stimulatory effects of
removing ubiquitin groups from the substrate may be particularly
dramatic for substrates in which ubiquitin groups are bound to multiple
lysine residues within the target protein, rather than being assembled
into a single chain. Assuming that the tertiary structure of ubiquitin
is too stable to be unfolded by the proteasome, as suggested by
structural studies (57), every ubiquitin group that is
directly bound to the substrate is expected to prevent access
of the substrate polypeptide to the CP in the region surrounding the
ubiquitination site. Deubiquitinating enzymes that reverse such
linkages would be expected to facilitate degradation, perhaps
accounting for the observed simulatory effects of the deubiquitinating
enzyme UCH-3 on in vitro ubiquitin-protein conjugate degradation
(42). Consistent with this hypothesis, such results were
obtained with a UbK48R derivative of ubiquitin which is deficient in
chain formation.
It is presently unclear whether any of the remaining Rpn subunits
possess enzymatic activity, since they lack sequence similarities to
known enzymes. They are likely to function in the binding of proteolytic substrates, in the binding of soluble cofactors of the
proteasome, or as scaffolding proteins that maintain the architecture of the RP complex. Another possible function is to target the proteasome to specific subcellular sites, although recent
photobleaching studies with green fluorescent protein-tagged
proteasomes indicated that >90% of proteasomes are freely diffusible
in both the nucleus and the cytoplasm (74). Among Rpn
subunits other than Rpn11, the only significant sequence motif
identified thus far is a ninefold repeat covering approximately 400 residues in both Rpn1 and Rpn2 (60). The repeat motif is
similar to previously described leucine-rich repeats which have been
implicated in specific protein binding. One possible role for these
repeats therefore may be binding of the proteolytic substrate, as
suggested by Lupas and Baumeister (60).
The only Rpn subunit that has been extensively studied is Rpn10/Mcb1
and its homologs in Arabidopsis thaliana (Mbp1),
Drosophila melanogaster (p54), and humans (S5a). Rpn10
homologs from all of these species are capable of binding
multiubiquitin chains in vitro. The universality of this binding
interaction strongly suggests its functional significance, and
Rpn10/Mcb1/S5a has consequently been proposed to be the
multiubiquitin chain receptor of the proteasome (17, 18).
However, yeast mutants in which the RPN10/MCB1 gene has been
deleted are viable and competent for the degradation of many ubiquitin
conjugates (102). Only the model substrate ubiquitin-Pro-
-galactosidase has been found to be stabilized in
the rpn10 deletion strain. To test whether Rpn10 functions as a ubiquitin receptor, the in vitro ubiquitin chain binding site of Rpn10 was localized. When mutants in which the in vitro ubiquitin chain binding site was deleted were assayed for
ubiquitin-Pro-
-galactosidase degradation in vivo, they
were found to be fully competent (26). These data indicate
that the role of Rpn10 in protein degradation is probably independent
of its ability to bind multiubiquitin chains, at least in S. cerevisiae. Nonetheless, a comparison of the sequences of Rpn10
and its homologs across eukaryotes indicates that the in vitro
ubiquitin chain binding site is stringently conserved evolutionarily
(26, 41, 109), suggesting that it may have a role in
proteasome function that has yet to be identified. The mechanistic role
of Rpn10/Mcb1 in protein breakdown remains problematic but should
emerge from additional genetic analysis.
 |
ACKNOWLEDGMENTS |
We thank Olivier Coux, Alfred Goldberg, and Inge Wefes for
assistance in refining the proteasome purification procedure; Keiji Tanaka and Akio Toh-e for providing unpublished data; Chris Larsen for constructing the His6-Rpt4 plasmid; Chris Larsen
and Seth Sadis for useful discussions and comments; an
anonymous reviewer for helpful comments on the text; Michel
Ghislain and Carl Mann for the rpt1 knockout construct and
polyclonal antibodies to Rpt1 and Rpt6; Richard Diaz, Olivier Coux, and
Fred Goldberg for ubiquitin-lysozyme conjugates; Steve van Nocker and
Richard Vierstra for the polyclonal antibody to Rpn10; Akio Toh-e
for antibodies to Rpn3, Rpn4, and Rpn12; Michelle Mischke and
John Chant for anti-Cdc10 antibodies; and Andrei Lupas and Takashi Toda
for helpful discussions.
This work was supported by NIH grant GM43601 (to D.F.) and by
fellowships from the NIH and the Massachusetts Division of the American
Cancer Society (to D.M.R.) and the Damon Runyon Walter Winchell Cancer
foundation (to M.H.G.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cell Biology, Harvard Medical School, 200 Longwood Ave., Boston, MA
02115. Phone: (617) 432-3492. Fax: (617) 432-1144. E-mail:
finleydj{at}warren.med.harvard.edu.
 |
REFERENCES |
| 1.
|
Adams, G. M.,
S. Falke,
A. L. Goldberg,
C. A. Slaughter,
G. N. DeMartino, and E. P. Gogol.
1997.
Structural and functional effects of PA700 and modulator protein on proteasomes.
J. Mol. Biol.
273:646-657[Medline].
|
| 2.
|
Akiyama, K.,
K. Yokota,
S. Kagawa,
N. Shimbara,
G. N. DeMartino,
C. A. Slaughter,
C. Noda, and K. Tanaka.
1995.
cDNA cloning of a new putative ATPase subunit p45 of the human 26S proteasome, a homolog of yeast Sug1.
FEBS Lett.
363:151-156[Medline].
|
| 3.
|
Armon, T.,
D. Ganoth, and A. Hershko.
1990.
Assembly of the 26S complex that degrades proteins ligated to ubiquitin is accompanied by the formation of ATPase activity.
J. Biol. Chem.
265:20723-20726[Abstract/Free Full Text].
|
| 4.
|
Baker, R. T.,
J. W. Tobias, and A. Varshavsky.
1992.
Ubiquitin-specific proteases of S. cerevisiae. Cloning of UBP2 and UBP3 and functional analysis of the UBP gene family.
J. Biol. Chem.
267:23364-23375[Abstract/Free Full Text].
|
| 5.
|
Bauer, V. W.,
J. C. Swaffield,
S. A. Johnston, and M. T. Andrews.
1996.
CADp44: a novel regulatory subunit of the 26S proteasome and the mammalian homolog of ySug2p.
Gene
181:63-69[Medline].
|
| 6.
|
Boldin, M. P.,
I. L. Mett, and D. Wallach.
1995.
A protein related to a proteasomal subunit binds to the intracellular domain of the p55 TNF receptor upstream to its death domain.
FEBS Lett.
367:39-44[Medline].
|
| 7.
|
Burns, N.,
B. Grimwade,
P. B. Ross-MacDonald,
E. Y. Choi,
K. Finberg,
G. S. Roeder, and M. Snyder.
1994.
Large-scale analysis of gene expression, protein localization, and gene disruption in S. cerevisiae.
Genes Dev.
8:1087-1105[Abstract/Free Full Text].
|
| 8.
|
Campbell, C. L.,
N. Tanaka,
K. H. White, and P. E. Thorsness.
1994.
Mitochondrial morphological and functional defects in yeast caused by yme1 are suppressed by mutation of a 26S protease subunit homologue.
Mol. Biol. Cell
5:899-905[Abstract].
|
| 9.
|
Ciechanover, A.
1994.
The ubiquitin-proteasome proteolytic pathway.
Cell
79:13-21[Medline].
|
| 10.
|
Claret, F. X.,
M. Hibi,
S. Dhut,
T. Toda, and M. Karin.
1996.
A new group of conserved coactivators that increase the specificity of AP-1 transcription factors.
Nature
383:453-457[Medline].
|
| 11.
|
Confalonieri, F., and M. Duguet.
1995.
A 200-amino acid ATPase module in search of a basic function.
Bioessays
17:639-650[Medline].
|
| 12.
|
Coux, O.,
K. Tanaka, and A. L. Goldberg.
1996.
Structure and functions of the 20S and 26S proteasomes.
Annu. Rev. Biochem.
65:801-847[Medline].
|
| 13.
|
Dawson, S. P.,
J. E. Arnold,
N. J. Mayer,
S. E. Reynolds,
M. A. Billett,
C. Gordon,
L. Colleaux,
P. M. Kloetzel,
K. Tanaka, and R. J. Mayer.
1995.
Developmental changes of the 26S proteasome in abdominal intersegmental muscles of Manduca sexta during programmed cell death.
J. Biol. Chem.
270:1850-1858[Abstract/Free Full Text].
|
| 14.
|
DeMarini, D. J.,
F. R. Papa,
S. Swaminathan,
D. Ursic,
T. P. Rasmussen,
M. R. Culbertson, and M. Hochstrasser.
1995.
The yeast SEN3 gene encodes a regulatory subunit of the 26S proteasome complex required for ubiquitin-dependent protein degradation in vivo.
Mol. Cell. Biol.
15:6311-6321[Abstract].
|
| 15.
|
DeMartino, G. N.,
C. R. Moomaw,
O. P. Zagnitko,
R. J. Proske,
C. P. Ma,
S. J. Afendis,
J. C. Swaffield, and C. A. Slaughter.
1994.
PA700, an ATP-dependent activator of the 20S proteasome, is an ATPase containing multiple members of a nucleotide binding protein family.
J. Biol. Chem.
269:20878-20884[Abstract/Free Full Text].
|
| 16.
|
Deshpande, K. L.,
V. A. Fried,
M. E. Ando, and R. G. Webster.
1987.
Glycosylation affects cleavage of an H6N2 influenza virus hemagglutinin and regulates virulence.
Proc. Natl. Acad. Sci. USA
84:36-40[Abstract/Free Full Text].
|
| 17.
|
Deveraux, Q.,
C. Jensen, and M. Rechsteiner.
1995.
Molecular cloning and expression of a 26S proteasome subunit enriched in dileucine repeats.
J. Biol. Chem.
270:23726-23729[Abstract/Free Full Text].
|
| 18.
|
Deveraux, Q.,
V. Ustrell,
C. Pickart, and M. Rechsteiner.
1994.
A 26S subunit that binds ubiquitin conjugates.
J. Biol. Chem.
269:7059-7061[Abstract/Free Full Text].
|
| 19.
|
Dubiel, W.,
K. Ferrell,
R. Dumdey,
S. Standera,
S. Prehn, and M. Rechsteiner.
1995.
Molecular cloning and expression of subunit 12: a non-MCP and non-ATPase subunit of the 26S protease.
FEBS Lett.
363:97-100[Medline].
|
| 20.
|
Dubiel, W.,
K. Ferrell,
G. Pratt, and M. Rechsteiner.
1992.
Subunit 4 of the 26S protease is a member of a novel eukaryotic ATPase family.
J. Biol. Chem.
267:22669-22702.
|
| 21.
|
Dubiel, W.,
K. Ferrell, and M. Rechsteiner.
1993.
Peptide sequencing identifies MSS1, a modulator of HIV Tat-mediated transactivation, as subunit 7 of the 26S protease.
FEBS Lett.
323:276-278[Medline].
|
| 22.
|
Dubiel, W.,
K. Ferrell, and M. Rechsteiner.
1995.
Subunits of the regulatory complex of the 26S proteasome.
Mol. Biol. Rep.
21:27-34[Medline].
|
| 23.
|
Falquet, L.,
N. Paquet,
S. Frutiger,
G. J. Hughes,
K. Hoang-Van, and J. C. Jaton.
1995.
cDNA cloning of a human 100 kDa deubiquitinating enzyme: the deubiquitinase belongs to the ubiquitin C-terminal hydrolase family 2 (UCH2).
FEBS Lett.
376:233-237[Medline].
|
| 24.
|
Finley, D.,
E. Özkaynak, and A. Varshavsky.
1987.
The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses.
Cell
48:1035-1046[Medline].
|
| 25.
|
Fried, V. A.
1981.
Membrane biogenesis: evidence that a soluble chimeric polypeptide can serve as a precursor of a mutant lac permease in E. coli.
J. Biol. Chem.
256:244-252[Abstract/Free Full Text].
|
| 26.
|
Fu, H.,
S. Sadis,
D. M. Rubin,
M. H. Glickman,
S. van Nocker,
D. Finley, and R. D. Vierstra.
1998.
Multiubiquitin chain binding and protein degradation are mediated by distinct domains within the 26S proteasome subunit Mcb1.
J. Biol. Chem.
273:1970-1989[Abstract/Free Full Text].
|
| 27.
|
Fujimuro, M.,
K. Tanaka,
H. Yokosawa, and A. Toh-e.
1998.
Son1p is a component of the 26S proteasome of the yeast Saccharomyces cerevisiae.
FEBS Lett.
423:149-154[Medline].
|
| 28.
|
Fujiwara, T.,
T. K. Watanabe,
K. Tanaka,
C. A. Slaughter, and G. N. DeMartino.
1996.
cDNA cloning of p42, a shared subunit of two proteasome regulatory proteins, reveals a novel member of the AAA protein family.
FEBS Lett.
387:184-188[Medline].
|
| 29.
|
Gerlinger, U. M.,
M. Hoffmann,
D. H. Wolf, and W. Hilt.
1997.
Yeast cycloheximide-resistant crl mutants are proteasome mutants defective in protein degradation.
Mol. Biol. Cell
8:2487-2499[Abstract/Free Full Text].
|
| 30.
|
Ghislain, M.,
A. Udvardy, and C. Mann.
1993.
S. cerevisiae 26S protease mutants arrest cell division in G2/metaphase.
Nature
366:358-361[Medline].
|
| 31.
|
Gietz, R. D.,
R. H. Schiestl,
A. R. Willems, and R. A. Woods.
1995.
Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.
Yeast
11:355-360[Medline].
|
| 32.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-E. coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[Medline].
|
| 33.
|
Gorbalenya, A. E., and E. V. Koonin.
1989.
Viral proteins containing the NTP binding pattern.
Nucleic Acids Res.
17:8413-8437[Abstract/Free Full Text].
|
| 34.
|
Gorbalenya, A. E.,
E. V. Koonin,
A. P. Donchenko, and V. M. Blinov.
1989.
Two related superfamilies of putative helicases involved in replication, repair, and expression of DNA and RNA genomes.
Nucleic Acids Res.
17:4713-4729[Abstract/Free Full Text].
|
| 35.
|
Gordon, C.,
G. McGurk,
P. Dillon,
C. Rosen, and N. D. Hastie.
1993.
Defective mitosis due to a mutation in the gene for a fission yeast 26S protease subunit.
Nature
366:355-357[Medline].
|
| 36.
|
Gottesmann, S.,
S. Wickner, and M. R. Maurizi.
1997.
Protein quality control: triage by chaperones and proteases.
Genes Dev.
11:815-823[Free Full Text].
|
| 37.
|
Gridley, T.,
R. Jaenisch, and M. G. Maguire.
1991.
The murine Mov-34 gene: full length cDNA and genomic organization.
Genomics
11:501-507[Medline].
|
| 38.
|
Groll, M.,
L. Ditzel,
J. Löwe,
D. Stock,
M. Bochtler,
H. D. Bartunik, and R. Huber.
1997.
Structure of 20S proteasome from yeast at a 2.4 Å resolution.
Nature
386:463-471[Medline].
|
| 39.
|
Hampton, R. Y.,
R. G. Gardner, and J. Rine.
1996.
Role of 26S proteasome and HRD genes in the degradation of 3-hydroxy-3-methylglutaryl-CoA reductase, an integral endoplasmic reticulum membrane protein.
Mol. Biol. Cell
7:2029-2044[Abstract].
|
| 40.
|
Haracska, L., and A. Udvardy.
1995.
Cloning and sequencing a non-ATPase subunit of the regulatory complex of the Drosophila 26S protease.
Eur. J. Biochem.
231:720-725[Medline].
|
| 41.
|
Haracska, L., and A. Udvardy.
1997.
Mapping the ubiquitin-binding domains in the p54 regulatory complex subunit of the Drosophila 26S protease.
FEBS Lett.
412:331-336[Medline].
|
| 42.
|
Hegde, A. N.,
K. Inokuchi,
W. Pei,
A. Casadio,
M. Ghirardi,
E. R. Kandel, and J. H. Schwartz.
1997.
Ubiquitin C-terminal hydrolase is an immediate early gene essential for long term facilitation in Aplysia.
Cell
89:115-126[Medline].
|
| 43.
|
Hochstrasser, M.
1996.
Ubiquitin-dependent protein degradation.
Annu. Rev. Genet.
30:405-439[Medline].
|
| 44.
|
Hoffman, L.,
G. Pratt, and M. Rechsteiner.
1992.
Multiple forms of the 20S multicatalytic and the 26S ubiquitin/ATP-dependent proteases from rabbit reticulocyte lysate.
J. Biol. Chem.
267:22362-22368[Abstract/Free Full Text].
|
| 45.
|
Hoffman, L., and M. Rechsteiner.
1994.
Activation of the multicatalytic protease.
J. Biol. Chem.
269:16890-16895[Abstract/Free Full Text].
|
| 46.
|
Hoffman, L., and M. Rechsteiner.
1997.
Molecular cloning of subunit 9 of the 26S proteasome.
FEBS Lett.
404:179-184[Medline].
|
| 47.
|
Hoffman, L., and M. Rechsteiner.
1996.
Nucleotidase activities of the 26S proteasome and its regulatory complex.
J. Biol. Chem.
271:32538-32545[Abstract/Free Full Text].
|
| 48.
|
Johnson, E. S.,
P. C. Ma,
I. M. Ota, and A. Varshavsky.
1995.
A proteolytic pathway that recognizes ubiquitin as a degradation signal.
J. Biol. Chem.
270:17442-17456[Abstract/Free Full Text].
|
| 49.
|
King, R. W.,
R. J. Deshaies,
J. M. Peters, and M. W. Kirshner.
1996.
How proteolysis drives the cell cycle.
Science
274:1652-1659[Abstract/Free Full Text].
|
| 50.
|
Kominami, K.,
G. N. DeMartino,
C. R. Moomaw,
C. A. Slaughter,
N. Shimbara,
M. Fujimuro,
H. Yokosawa,
H. Hisamatsu,
N. Tanahashi,
Y. Shimizu,
K. Tanaka, and A. Toh-e.
1995.
Nin1p, a regulatory subunit of the 26S proteasome, is necessary for activation of Cdc28 kinase of S. cerevisiae.
EMBO J.
14:3105-3115[Medline].
|
| 51.
|
Kominami, K.,
N. Okura,
M. Kawamura,
G. N. DeMartino,
C. A. Slaughter,
N. Shimbara,
C. H. Chung,
M. Fujimura,
H. Yokosawa,
Y. Shimizu,
N. Tanahashi,
K. Tanaka, and A. Toh-e.
1997.
Yeast counterparts of subunits S5a and p58 (S3) of the human 26S proteasome are encoded by two multicopy suppressors of nin1-1.
Mol. Biol. Cell
8:171-187[Abstract].
|
| 52.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 52a.
| Lam, A., and R. Cohen. Personal communication.
|
| 53.
|
Lam, Y. A.,
G. N. DeMartino,
C. M. Pickart, and R. E. Cohen.
1997.
Specificity of the ubiquitin isopeptidase in the PA700 regulatory complex of the 26S proteasome.
J. Biol. Chem.
272:28438-28446[Abstract/Free Full Text].
|
| 54.
|
Lam, Y. A.,
W. Xu,
G. N. DeMartino, and R. E. Cohen.
1997.
Editing of ubiquitin conjugates by an isopeptidase in the 26S proteasome.
Nature
385:737-740[Medline].
|
| 54a.
| Larsen, C., and S. Sadis. Personal
communication.
|
| 55.
|
Larsen, C. N., and D. Finley.
1997.
Protein translocation channels in the proteasome and other proteases.
Cell
91:431-434[Medline].
|
| 56.
|
Lee, J. W.,
H. S. Choi,
J. Gyuris,
R. Brent, and D. D. Moore.
1995.
Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor.
Mol. Endocrinol.
9:243-254[Abstract/Free Full Text].
|
| 57.
|
Lenkinski, R. E.,
D. M. Chen,
J. D. Glickson, and G. Goldstein.
1977.
Nuclear magnetic resonance studies of the denaturation of ubiquitin.
Biochim. Biophys. Acta
494:126-130[Medline].
|
| 57a.
| Levin, D. Personal communication.
|
| 58.
|
Longtine, M. S.,
D. J. DeMarini,
M. L. Valencik,
O. S. Al-Awar,
H. Fares,
C. De Virgilio, and J. R. Pringle.
1996.
The septins: roles in cytokinesis and other processes.
Curr. Opin. Cell Biol.
8:106-119[Medline].
|
| 59.
|
Löwe, J.,
D. Stock,
B. Jap,
P. Zwickl,
W. Baumeister, and R. Huber.
1995.
Crystal structure of the 20S proteasome from the archeon T. acidophilum at 3.4 Å resolution.
Science
268:533-539[Abstract/Free Full Text].
|
| 60.
|
Lupas, A., and W. Baumeister.
1997.
A repetitive sequence in subunits of the 26S proteasome and 20S cyclosome (APC).
Trends Biochem. Sci.
22:195-196[Medline].
|
| 61.
|
Lupas, A.,
J. M. Flanagan,
T. Tamura, and W. Baumeister.
1997.
Self compartmentalizing proteases.
Trends Biochem. Sci.
22:399-404[Medline].
|
| 62.
|
Lupas, A.,
M. van Dyke, and J. Stock.
1991.
Predicted coiled-coils from protein sequences.
Science
252:1162-1164[Free Full Text].
|
| 63.
|
Ma, C. P.,
C. A. Slaughter, and G. N. DeMartino.
1992.
Identification, purification, and characterization of a protein activator (PA28) of the 20S proteasome.
J. Biol. Chem.
267:10515-10523[Abstract/Free Full Text].
|
| 64.
|
Ma, C. P.,
J. H. Vu,
R. J. Proske,
C. A. Slaughter, and G. N. DeMartino.
1994.
Identification, purification, and characterization of a high molecular weight ATP-dependent activator (PA700) of the 26S proteasome.
J. Biol. Chem.
269:3539-3547[Abstract/Free Full Text].
|
| 65.
|
McCusker, J. H., and J. E. Haber.
1988.
Cycloheximide-resistant temperature-sensitive lethal mutations of S. cerevisiae.
Genetics
119:303-315[Abstract/Free Full Text].
|
| 66.
|
McDonald, H. B., and B. Byers.
1997.
A proteasome cap subunit required for spindle pole body duplication in yeast.
J. Cell Biol.
137:539-553[Abstract/Free Full Text].
|
| 67.
|
Mian, I. S.
1993.
Sequence similarities between cell regulation factors, heat shock proteins and RNA helicases.
Trends Biochem. Sci.
18:125-127[Medline].
|
| 68.
|
Nelbrock, P.,
P. J. Dillon,
A. Perkins, and C. R. Rosen.
1990.
A cDNA for a protein that interacts with the human immunodeficiency virus Tat transactivator.
Science
248:1650-1654[Abstract/Free Full Text].
|
| 69.
|
Nelson, M. K.,
T. Kurihara, and P. A. Silver.
1993.
Extragenic suppressors of mutations in the cytoplasmic C terminus of SEC63 define five genes in Saccharomyces cerevisiae.
Genetics
134:159-173[Abstract].
|
| 70.
|
Ohana, B.,
P. A. Moore,
S. M. Ruben,
C. D. Southgate,
M. R. Green, and C. A. Rosen.
1993.
The type 1 human immunodeficiency virus Tat binding protein is a transcription activator belonging to an additional family of evolutionarily conserved genes.
Proc. Natl. Acad. Sci. USA
90:138-142[Abstract/Free Full Text].
|
| 71.
|
Palombella, V. J.,
O. J. Rando,
A. L. Goldberg, and T. Maniatis.
1994.
The ubiquitin proteasome pathway is required for processing the NF- B1 precursor protein and activation of NF- B.
Cell
78:773-785[Medline].
|
| 72.
|
Peters, J. M.,
W. W. Franke, and J. A. Kleinschmidt.
1994.
Distinct 19S and 20S subcomplexes of the proteasome and their distribution in the nucleus and the cytoplasm.
J. Biol. Chem.
269:7709-7718[Abstract/Free Full Text].
|
| 73.
|
Rechsteiner, M.,
L. Hoffman, and W. Dubiel.
1993.
The multicatalytic and 26S proteases.
J. Biol. Chem.
268:6065-6068[Free Full Text].
|
| 74.
|
Reits, E. A. J.,
A. M. Benham,
J. Neefjes, and J. Trowsdale.
1997.
Dynamics of proteasome distribution in living cells.
EMBO J.
16:6087-6094[Medline].
|
| 75.
|
Richmond, C.,
C. Gorbea, and M. Rechsteiner.
1997.
Specific interactions between ATPase subunits of the 26S proteasome.
J. Biol. Chem.
272:13403-13411[Abstract/Free Full Text].
|
| 76.
|
Rinaldi, T.,
M. Bolotin-Fukuhara, and L. Frontali.
1995.
A Saccharomyces cerevisiae gene essential for viability has been conserved in evolution.
Gene
160:135-136[Medline].
|
| 77.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
In
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 78.
|
Rosenfeld, J.,
J. Capdevielle,
J. C. Guillemont, and P. Ferrara.
1992.
In-gel digestion of proteins for internal sequence analysis after one- or two-dimensional electrophoresis.
Anal. Biochem.
203:173-179[Medline].
|
| 79.
|
Rubin, D. M.,
O. Coux,
I. Wefes,
C. Hengartner,
R. A. Young,
A. L. Goldberg, and D. Finley.
1996.
Identification of the gal4 suppressor Sug1 as a subunit of the yeast 26S proteasome.
Nature
379:655-657[Medline].
|
| 80.
|
Rubin, D. M., and D. Finley.
1995.
The proteasome: a protein degrading organelle?
Curr. Biol.
5:854-858[Medline].
|
| 81.
|
Russell, S. J.,
U. G. Sathyanarayana, and S. A. Johnston.
1996.
Isolation and characterization of SUG2: a novel ATPase family component of the yeast 26S proteasome.
J. Biol. Chem.
271:32810-32817[Abstract/Free Full Text].
|
| 82.
|
Saito, A.,
T. K. Watanabe,
Y. Shimada,
T. Fujiwara,
C. A. Slaughter,
G. N. DeMartino,
N. Tanahashi, and K. Tanaka.
1997.
cDNA cloning and functional analysis of p44.5 and p55, two regulatory subunits of the proteasome.
Gene
203:241-250[Medline].
|
| 83.
|
Sawada, H.,
T. Akaishi,
M. Katsu, and H. Yokosawa.
1997.
Difference between PA700-like proteasome activator complex and the regulatory complex dissociated from the 26S proteasome implies the involvement of modulating factors in the 26S proteasome assembly.
FEBS Lett.
412:521-525[Medline].
|
| 84.
|
Scheffner, M.,
J. Huibregste,
R. D. Vierstra, and P. M. Howley.
1993.
The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53.
Cell
75:495-500[Medline].
|
| 85.
|
Schnall, R.,
G. Mannhaupt,
R. Stuka,
R. Tauer,
S. Ehnle,
C. Schwarzlose,
I. Vetter, and H. Feldmann.
1994.
Identification of a set of yeast genes coding for a novel family of putative ATPases with high similarity to constituents of the 26S protease complex.
Yeast
10:1141-1155[Medline].
|
| 86.
|
Schneider, B. L.,
W. Seufert,
B. Steiner,
Q. H. Yang, and A. B. Futcher.
1995.
Use of polymerase chain reaction epitope tagging for protein tagging in S. cerevisiae.
Yeast
11:1265-1274[Medline].
|
| 87.
|
Seeger, M.,
C. Gordon,
K. Ferrell, and W. Dubiel.
1996.
Characteristics of 26S proteases from fission yeast mutants which arrest in mitosis.
J. Mol. Biol.
263:423-431[Medline].
|
| 88.
|
Shibuya, H.,
K. Irie,
J. Ninomiya-Tsuji,
M. Goebl,
T. Taniguchi, and K. Matsumoto.
1992.
New human gene encoding a positive modulator of HIV Tat-mediated transactivation.
Nature
357:700-702[Medline].
|
| 89.
|
Shimanuki, M.,
Y. Saka,
M. Yanagida, and T. Toda.
1995.
A novel essential fission yeast gene pad1(+) positively regulates pap1(+)-dependent transcription and is implicated in the maintenance of chromosome structure.
J. Cell Sci.
108:569-579[Abstract].
|
| 90.
|
Song, H. Y.,
J. D. Dunbar,
Y. X. Zhang,
D. Guo, and D. B. Donner.
1995.
Identification of a protein with homology to hsp90 that binds the type 1 tumor necrosis factor receptor.
J. Biol. Chem.
270:3574-3581[Abstract/Free Full Text].
|
| 91.
|
Spataro, V.,
T. Toda,
R. Craig,
M. Seeger,
W. Dubiel,
A. L. Harris, and C. Norbury.
1997.
Resistance to diverse drugs and UV light conferred by overexpression of a novel 26S proteasome subunit.
J. Biol. Chem.
272:30470-30475[Abstract/Free Full Text].
|
| 92.
|
Sun, D.,
J. C. Swaffield,
S. A. Johnston,
C. E. Milligan,
R. T. Zoeller, and L. M. Schwartz.
1997.
Identification of a phylogenetically conserved Sug1 CAD member that is differentially expressed in the mouse nervous system.
J. Neurobiol.
33:877-890[Medline].
|
| 93.
|
Suzuki, C. K.,
M. Rep,
J. M. van Dijl,
K. Suda,
L. A. Grivell, and G. Schatz.
1997.
ATP dependent proteases that also chaperone protein biogenesis.
Trends Biochem. Sci.
22:118-123[Medline].
|
| 94.
|
Swaffield, J. C.,
J. F. Bromberg, and S. A. Johnston.
1992.
Alterations in a yeast protein resembling HIV Tat-binding protein relieve requirement for an acidic activation domain in GAL4.
Nature
357:700-702.
|
| 95.
|
Takayanagi, K.,
S. Dawson,
S. E. Reynolds, and R. J. Mayer.
1996.
Specific developmental changes in the regulatory subunits of the 26S proteasome in intersegmental muscles preceding eclosion in Manduca sexta.
Biochem. Biophys. Res. Commun.
228:517-523[Medline].
|
| 96.
|
Talmadge, K. L.,
J. Kaufman, and W. Gilbert.
1980.
Bacteria mature preproinsulin to insulin.
Proc. Natl. Acad. Sci. USA
77:3988-3992[Abstract/Free Full Text].
|
| 96a.
| Toh-e, A., and K. Tanaka. Personal communication.
|
| 97.
|
Tsurumi, C.,
G. N. DeMartino,
C. A. Slaughter,
N. Shimbara, and K. Tanaka.
1995.
cDNA cloning of p40, a regulatory subunit of the human 26S proteasome, and a homolog of the Mov-34 gene product.
Biochem. Biophys. Res. Commun.
210:600-608[Medline].
|
| 98.
|
Tsurumi, C.,
Y. Shimizu,
M. Seki,
S. Kato,
G. N. DeMartino,
C. A. Slaughter,
M. Fujimuro,
H. Yokosawa,
M. Yamasaki,
K. B. Hendil,
A. Toh-e, and N. Tanahashi.
1996.
cDNA cloning and functional analysis of the p97 subunit of the 26S proteasome, a polypeptide identical to the type-1 tumor necrosis-factor-receptor-associated protein 2/55.11.
Eur. J. Biochem.
239:912-921[Medline].
|
| 99.
|
Udvardy, A.
1993.
Purification and characterisation of a multiprotein component of the Drosophila 26S proteolytic complex.
J. Biol. Chem.
268:9055-9062[Abstract/Free Full Text].
|
| 100.
|
Ugai, S. I.,
T. Tamura,
N. Tanahashi,
S. Takai,
N. Komi,
C. H. Chung,
K. Tanaka, and A. Ichihara.
1993.
Purification and characterisation of the 26S proteasome complex catalysing ATP dependent breakdown of ubiquitin ligated proteins from rat liver.
J. Biochem.
113:754-768[Abstract/Free Full Text].
|
| 101.
|
van Nocker, S.,
Q. Deveraux,
M. Rechsteiner, and R. D. Vierstra.
1996.
Arabidopsis MBP1 gene encodes a conserved ubiquitin recognition component of the 26S proteasome.
Proc. Natl. Acad. Sci. USA
93:856-860[Abstract/Free Full Text].
|
| 102.
|
van Nocker, S.,
S. Sadis,
D. M. Rubin,
M. H. Glickman,
H. Fu,
O. Coux,
I. Wefes,
D. Finley, and R. D. Vierstra.
1996.
The multiubiquitin chain binding protein Mcb1 is a component of the 26S proteasome in Saccharomyces cerevisiae and plays a nonessential, substrate-specific role in protein turnover.
Mol. Cell. Biol.
11:6020-6028.
|
| 103.
|
Walker, J. E.,
M. Sarasate,
M. J. Runswick, and N. J. Gay.
1982.
Distantly related sequences in the - and -subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold.
EMBO J.
1:945-951[Medline].
|
| 104.
|
Ward, C. L.,
S. Omura, and R. R. Kopito.
1995.
Degradation of CFTR by the ubiquitin proteasome pathway.
Cell
83:121-127[Medline].
|
| 105.
|
Wessel, D., and U. I. Flugge.
1984.
A method for the quantitative recovery of protein in a dilute solution in the presence of detergents and lipids.
Anal. Biochem.
138:141-143[Medline].
|
| 106.
|
Wilkinson, C. R. M.,
M. Wallace,
M. Seeger,
W. Dubiel, and C. Gordon.
1997.
Mts4, a non-ATPase subunit of the 26S protease in fission yeast, is essential for mitosis and interacts directly with the ATPase subunit Mts2.
J. Biol. Chem.
272:25768-25777[Abstract/Free Full Text].
|
| 107.
|
Wilkinson, K. D.,
V. L. Tashayev,
L. B. O'Connor,
C. N. Larsen,
E. Kasperel, and C. M. Pickart.
1995.
Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T.
Biochemistry
34:14535-14546[Medline].
|
| 108.
|
Yokota, K.,
S. Kagawa,
Y. Shimizu,
H. Akioka,
C. Tsurumi,
C. Noda,
M. Fujimuro,
H. Yokosawa,
T. Fujiwara,
E. Takahashi,
M. Ohba,
M. Yamasaki,
G. N. DeMartino,
C. A. Slaughter,
A. Toh-e, and K. Tanaka.
1996.
cDNA cloning of p112, the largest regulatory subunit of the human 26S proteasome, and functional analysis of its yeast homologue, Sen3p.
Mol. Biol. Cell
7:853-870[Abstract].
|
| 109.
|
Young, P.,
Q. Deveraux,
R. E. Beal,
C. M. Pickart, and M. Rechsteiner.
1998.
Characterization of two polyubiquitin binding sites in the 26 S protease subunit 5a.
J. Biol. Chem.
273:5461-5467[Abstract/Free Full Text].
|
Mol Cell Biol, June 1998, p. 3149-3162, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tsvetkov, P., Reuven, N., Prives, C., Shaul, Y.
(2009). Susceptibility of p53 Unstructured N Terminus to 20 S Proteasomal Degradation Programs the Stress Response. J. Biol. Chem.
284: 26234-26242
[Abstract]
[Full Text]
-
Medalia, N., Beer, A., Zwickl, P., Mihalache, O., Beck, M., Medalia, O., Navon, A.
(2009). Architecture and Molecular Mechanism of PAN, the Archaeal Proteasome Regulatory ATPase. J. Biol. Chem.
284: 22952-22960
[Abstract]
[Full Text]
-
Zhang, L., Feng, D., Fang, W., Ouyang, H., Luo, Y., Du, T., Jin, C.
(2009). Comparative proteomic analysis of an Aspergillus fumigatus mutant deficient in glucosidase I (AfCwh41). Microbiology
155: 2157-2167
[Abstract]
[Full Text]
-
Bousquet-Dubouch, M.-P., Baudelet, E., Guerin, F., Matondo, M., Uttenweiler-Joseph, S., Burlet-Schiltz, O., Monsarrat, B.
(2009). Affinity Purification Strategy to Capture Human Endogenous Proteasome Complexes Diversity and to Identify Proteasome-interacting Proteins. Mol. Cell. Proteomics
8: 1150-1164
[Abstract]
[Full Text]
-
Liu, Y., Shah, S. V., Xiang, X., Wang, J., Deng, Z.-b., Liu, C., Zhang, L., Wu, J., Edmonds, T., Jambor, C., Kappes, J. C., Zhang, H.-G.
(2009). COP9-Associated CSN5 Regulates Exosomal Protein Deubiquitination and Sorting. Am. J. Pathol.
174: 1415-1425
[Abstract]
[Full Text]
-
Gallois, J.-L., Guyon-Debast, A., Lecureuil, A., Vezon, D., Carpentier, V., Bonhomme, S., Guerche, P.
(2009). The Arabidopsis Proteasome RPT5 Subunits Are Essential for Gametophyte Development and Show Accession-Dependent Redundancy. Plant Cell
21: 442-459
[Abstract]
[Full Text]
-
Wang, X., Xu, H., Ju, D., Xie, Y.
(2008). Disruption of Rpn4-Induced Proteasome Expression in Saccharomyces cerevisiae Reduces Cell Viability Under Stressed Conditions. Genetics
180: 1945-1953
[Abstract]
[Full Text]
-
Gillette, T. G., Kumar, B., Thompson, D., Slaughter, C. A., DeMartino, G. N.
(2008). Differential Roles of the COOH Termini of AAA Subunits of PA700 (19 S Regulator) in Asymmetric Assembly and Activation of the 26 S Proteasome. J. Biol. Chem.
283: 31813-31822
[Abstract]
[Full Text]
-
Yamano, T., Mizukami, S., Murata, S., Chiba, T., Tanaka, K., Udono, H.
(2008). Hsp90-mediated Assembly of the 26 S Proteasome Is Involved in Major Histocompatibility Complex Class I Antigen Processing. J. Biol. Chem.
283: 28060-28065
[Abstract]
[Full Text]
-
Medicherla, B., Goldberg, A. L.
(2008). Heat shock and oxygen radicals stimulate ubiquitin-dependent degradation mainly of newly synthesized proteins. JCB
182: 663-673
[Abstract]
[Full Text]
-
Yamano, T., Sugahara, H., Mizukami, S., Murata, S., Chiba, T., Tanaka, K., Yui, K., Udono, H.
(2008). Allele-Selective Effect of PA28 in MHC Class I Antigen Processing. J. Immunol.
181: 1655-1664
[Abstract]
[Full Text]
-
Lipson, C., Alalouf, G., Bajorek, M., Rabinovich, E., Atir-Lande, A., Glickman, M., Bar-Nun, S.
(2008). A Proteasomal ATPase Contributes to Dislocation of Endoplasmic Reticulum-associated Degradation (ERAD) Substrates. J. Biol. Chem.
283: 7166-7175
[Abstract]
[Full Text]
-
Liu, S., Liu, Z., Xie, Z., Pang, J., Yu, J., Lehmann, E., Huynh, L., Vukosavljevic, T., Takeki, M., Klisovic, R. B., Baiocchi, R. A., Blum, W., Porcu, P., Garzon, R., Byrd, J. C., Perrotti, D., Caligiuri, M. A., Chan, K. K., Wu, L.-C., Marcucci, G.
(2008). Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-{kappa}B-dependent DNA methyltransferase activity in acute myeloid leukemia. Blood
111: 2364-2373
[Abstract]
[Full Text]
-
Romero-Perez, L., Li Chen, L., Lambertson, D., Madura, K.
(2007). Sts1 Can Overcome the Loss of Rad23 and Rpn10 and Represents a Novel Regulator of the Ubiquitin/Proteasome Pathway. J. Biol. Chem.
282: 35574-35582
[Abstract]
[Full Text]
-
Yi, H., Friedman, J. L., A. Ferreira, P.
(2007). The Cyclophilin-like Domain of Ran-binding Protein-2 Modulates Selectively the Activity of the Ubiquitin-Proteasome System and Protein Biogenesis. J. Biol. Chem.
282: 34770-34778
[Abstract]
[Full Text]
-
Scott, C. M., Kruse, K. B., Schmidt, B. Z., Perlmutter, D. H., McCracken, A. A., Brodsky, J. L.
(2007). ADD66, a Gene Involved in the Endoplasmic Reticulum-associated Degradation of {alpha}-1-Antitrypsin-Z in Yeast, Facilitates Proteasome Activity and Assembly. Mol. Biol. Cell
18: 3776-3787
[Abstract]
[Full Text]
-
Vernace, V. A., Arnaud, L., Schmidt-Glenewinkel, T., Figueiredo-Pereira, M. E.
(2007). Aging perturbs 26S proteasome assembly in Drosophila melanogaster. FASEB J.
21: 2672-2682
[Abstract]
[Full Text]
-
Ghaboosi, N., Deshaies, R. J.
(2007). A Conditional Yeast E1 Mutant Blocks the Ubiquitin-Proteasome Pathway and Reveals a Role for Ubiquitin Conjugates in Targeting Rad23 to the Proteasome. Mol. Biol. Cell
18: 1953-1963
[Abstract]
[Full Text]
-
Fukui, H., Moraes, C. T.
(2007). Extended polyglutamine repeats trigger a feedback loop involving the mitochondrial complex III, the proteasome and huntingtin aggregates. Hum Mol Genet
16: 783-797
[Abstract]
[Full Text]
-
Yi, J. J., Ehlers, M. D.
(2007). Emerging Roles for Ubiquitin and Protein Degradation in Neuronal Function. Pharmacol. Rev.
59: 14-39
[Abstract]
[Full Text]
-
Isono, E., Nishihara, K., Saeki, Y., Yashiroda, H., Kamata, N., Ge, L., Ueda, T., Kikuchi, Y., Tanaka, K., Nakano, A., Toh-e, A.
(2007). The Assembly Pathway of the 19S Regulatory Particle of the Yeast 26S Proteasome. Mol. Biol. Cell
18: 569-580
[Abstract]
[Full Text]
-
Ferdous, A., Sikder, D., Gillette, T., Nalley, K., Kodadek, T., Johnston, S. A.
(2007). The role of the proteasomal ATPases and activator monoubiquitylation in regulating Gal4 binding to promoters. Genes Dev.
21: 112-123
[Abstract]
[Full Text]
-
Depre, C., Wang, Q., Yan, L., Hedhli, N., Peter, P., Chen, L., Hong, C., Hittinger, L., Ghaleh, B., Sadoshima, J., Vatner, D. E., Vatner, S. F., Madura, K.
(2006). Activation of the Cardiac Proteasome During Pressure Overload Promotes Ventricular Hypertrophy. Circulation
114: 1821-1828
[Abstract]
[Full Text]
-
Huang, W., Pi, L., Liang, W., Xu, B., Wang, H., Cai, R., Huang, H.
(2006). The Proteolytic Function of the Arabidopsis 26S Proteasome Is Required for Specifying Leaf Adaxial Identity. Plant Cell
18: 2479-2492
[Abstract]
[Full Text]
-
Sikder, D., Johnston, S. A., Kodadek, T.
(2006). Widespread, but Non-identical, Association of Proteasomal 19 and 20 S Proteins with Yeast Chromatin. J. Biol. Chem.
281: 27346-27355
[Abstract]
[Full Text]
-
Ogburn, K. D., Figueiredo-Pereira, M. E.
(2006). Cytoskeleton/Endoplasmic Reticulum Collapse Induced by Prostaglandin J2 Parallels Centrosomal Deposition of Ubiquitinated Protein Aggregates. J. Biol. Chem.
281: 23274-23284
[Abstract]
[Full Text]
-
Wang, Z., Aris, V. M., Ogburn, K. D., Soteropoulos, P., Figueiredo-Pereira, M. E.
(2006). Prostaglandin J2 Alters Pro-survival and Pro-death Gene Expression Patterns and 26 S Proteasome Assembly in Human Neuroblastoma Cells. J. Biol. Chem.
281: 21377-21386
[Abstract]
[Full Text]
-
Muller, D., Nagel, A. C., Maier, D., Preiss, A.
(2006). A molecular link A molecular link between Hairless and Pros26.4, a member of the AAA-ATPase subunits of the proteasome 19S regulatory particle in Drosophila. J. Cell Sci.
119: 250-258
[Abstract]
[Full Text]
-
Qian, S.-B., Princiotta, M. F., Bennink, J. R., Yewdell, J. W.
(2006). Characterization of Rapidly Degraded Polypeptides in Mammalian Cells Reveals a Novel Layer of Nascent Protein Quality Control. J. Biol. Chem.
281: 392-400
[Abstract]
[Full Text]
-
Chuang, S.-M., Madura, K.
(2005). Saccharomyces cerevisiae Ub-Conjugating Enzyme Ubc4 Binds the Proteasome in the Presence of Translationally Damaged Proteins. Genetics
171: 1477-1484
[Abstract]
[Full Text]
-
Chen, Q., Thorpe, J., Keller, J. N.
(2005). {alpha}-Synuclein Alters Proteasome Function, Protein Synthesis, and Stationary Phase Viability. J. Biol. Chem.
280: 30009-30017
[Abstract]
[Full Text]
-
Mani, A., Gelmann, E. P.
(2005). The Ubiquitin-Proteasome Pathway and Its Role in Cancer. JCO
23: 4776-4789
[Abstract]
[Full Text]
-
Chen, L., Madura, K.
(2005). Increased Proteasome Activity, Ubiquitin-Conjugating Enzymes, and eEF1A Translation Factor Detected in Breast Cancer Tissue. Cancer Res.
65: 5599-5606
[Abstract]
[Full Text]
-
Chuang, S.-M., Chen, L., Lambertson, D., Anand, M., Kinzy, T. G., Madura, K.
(2005). Proteasome-Mediated Degradation of Cotranslationally Damaged Proteins Involves Translation Elongation Factor 1A. Mol. Cell. Biol.
25: 403-413
[Abstract]
[Full Text]
-
Wang, L., Mao, X., Ju, D., Xie, Y.
(2004). Rpn4 Is a Physiological Substrate of the Ubr2 Ubiquitin Ligase. J. Biol. Chem.
279: 55218-55223
[Abstract]
[Full Text]
-
Ortolan, T. G., Chen, L., Tongaonkar, P., Madura, K.
(2004). Rad23 stabilizes Rad4 from degradation by the Ub/proteasome pathway. Nucleic Acids Res
32: 6490-6500
[Abstract]
[Full Text]
-
Funakoshi, M., Li, X., Velichutina, I., Hochstrasser, M., Kobayashi, H.
(2004). Sem1, the yeast ortholog of a human BRCA2-binding protein, is a component of the proteasome regulatory particle that enhances proteasome stability. J. Cell Sci.
117: 6447-6454
[Abstract]
[Full Text]
-
Wendler, P., Lehmann, A., Janek, K., Baumgart, S., Enenkel, C.
(2004). The Bipartite Nuclear Localization Sequence of Rpn2 Is Required for Nuclear Import of Proteasomal Base Complexes via Karyopherin {alpha}{beta} and Proteasome Functions. J. Biol. Chem.
279: 37751-37762
[Abstract]
[Full Text]
-
Sone, T., Saeki, Y., Toh-e, A., Yokosawa, H.
(2004). Sem1p Is a Novel Subunit of the 26 S Proteasome from Saccharomyces cerevisiae. J. Biol. Chem.
279: 28807-28816
[Abstract]
[Full Text]
-
Kim, I., Mi, K., Rao, H.
(2004). Multiple Interactions of Rad23 Suggest a Mechanism for Ubiquitylated Substrate Delivery Important in Proteolysis. Mol. Biol. Cell
15: 3357-3365
[Abstract]
[Full Text]
-
Ueda, M., Matsui, K., Ishiguro, S., Sano, R., Wada, T., Paponov, I., Palme, K., Okada, K.
(2004). The HALTED ROOT gene encoding the 26S proteasome subunit RPT2a is essential for the maintenance of Arabidopsis meristems. Development
131: 2101-2111
[Abstract]
[Full Text]
-
Gillette, T. G., Gonzalez, F., Delahodde, A., Johnston, S. A., Kodadek, T.
(2004). Physical and functional association of RNA polymerase II and the proteasome. Proc. Natl. Acad. Sci. USA
101: 5904-5909
[Abstract]
[Full Text]
-
Ramos, P. C., Marques, A. J., London, M. K., Dohmen, R. J.
(2004). Role of C-terminal Extensions of Subunits {beta}2 and {beta}7 in Assembly and Activity of Eukaryotic Proteasomes. J. Biol. Chem.
279: 14323-14330
[Abstract]
[Full Text]
-
Borkovich, K. A., Alex, L. A., Yarden, O., Freitag, M., Turner, G. E., Read, N. D., Seiler, S., Bell-Pedersen, D., Paietta, J., Plesofsky, N., Plamann, M., Goodrich-Tanrikulu, M., Schulte, U., Mannhaupt, G., Nargang, F. E., Radford, A., Selitrennikoff, C., Galagan, J. E., Dunlap, J. C., Loros, J. J., Catcheside, D., Inoue, H., Aramayo, R., Polymenis, M., Selker, E. U., Sachs, M. S., Marzluf, G. A., Paulsen, I., Davis, R., Ebbole, D. J., Zelter, A., Kalkman, E. R., O'Rourke, R., Bowring, F., Yeadon, J., Ishii, C., Suzuki, K., Sakai, W., Pratt, R.
(2004). Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism. Microbiol. Mol. Biol. Rev.
68: 1-108
[Abstract]
[Full Text]
-
Yang, P., Fu, H., Walker, J., Papa, C. M., Smalle, J., Ju, Y.-M., Vierstra, R. D.
(2004). Purification of the Arabidopsis 26 S Proteasome: BIOCHEMICAL AND MOLECULAR ANALYSES REVEALED THE PRESENCE OF MULTIPLE ISOFORMS. J. Biol. Chem.
279: 6401-6413
[Abstract]
[Full Text]
-
Guterman, A., Glickman, M. H.
(2004). Complementary Roles for Rpn11 and Ubp6 in Deubiquitination and Proteolysis by the Proteasome. J. Biol. Chem.
279: 1729-1738
[Abstract]
[Full Text]
-
Chernova, T. A., Allen, K. D., Wesoloski, L. M., Shanks, J. R., Chernoff, Y. O., Wilkinson, K. D.
(2003). Pleiotropic Effects of Ubp6 Loss on Drug Sensitivities and Yeast Prion Are Due to Depletion of the Free Ubiquitin Pool. J. Biol. Chem.
278: 52102-52115
[Abstract]
[Full Text]
-
Wang, C. C., Bozdech, Z., Liu, C.-l., Shipway, A., Backes, B. J., Harris, J. L., Bogyo, M.
(2003). Biochemical Analysis of the 20 S Proteasome of Trypanosoma brucei. J. Biol. Chem.
278: 15800-15808
[Abstract]
[Full Text]
-
Snyder, H., Mensah, K., Theisler, C., Lee, J., Matouschek, A., Wolozin, B.
(2003). Aggregated and Monomeric alpha -Synuclein Bind to the S6' Proteasomal Protein and Inhibit Proteasomal Function. J. Biol. Chem.
278: 11753-11759
[Abstract]
[Full Text]
-
Hoyt, M. A., Zhang, M., Coffino, P.
(2003). Ubiquitin-independent Mechanisms of Mouse Ornithine Decarboxylase Degradation Are Conserved between Mammalian and Fungal Cells. J. Biol. Chem.
278: 12135-12143
[Abstract]
[Full Text]
-
Szlanka, T., Haracska, L., Kiss, I., Deak, P., Kurucz, E., Ando, I., Viragh, E., Udvardy, A.
(2003). Deletion of proteasomal subunit S5a/Rpn10/p54 causes lethality, multiple mitotic defects and overexpression of proteasomal genes in Drosophila melanogaster. J. Cell Sci.
116: 1023-1033
[Abstract]
[Full Text]
-
Santamaria, P. G., Finley, D., Ballesta, J. P. G., Remacha, M.
(2003). Rpn6p, a Proteasome Subunit from Saccharomyces cerevisiae, Is Essential for the Assembly and Activity of the 26 S Proteasome. J. Biol. Chem.
278: 6687-6695
[Abstract]
[Full Text]
-
Tone, Y., Toh-e, A.
(2002). Nob1p is required for biogenesis of the 26S proteasome and degraded upon its maturation in Saccharomyces cerevisiae. Genes Dev.
16: 3142-3157
[Abstract]
[Full Text]
-
Li, Z., Wang, C. C.
(2002). Functional Characterization of the 11 Non-ATPase Subunit Proteins in the Trypanosome 19 S Proteasomal Regulatory Complex. J. Biol. Chem.
277: 42686-42693
[Abstract]
[Full Text]
-
McDonald, H. B., Helfant, A. H., Mahony, E. M., Khosla, S. K., Goetsch, L.
(2002). Mutational Analysis Reveals a Role for the C Terminus of the Proteasome Subunit Rpt4p in Spindle Pole Body Duplication in Saccharomyces cerevisiae. Genetics
162: 705-720
[Abstract]
[Full Text]
-
Liu, C.-w., Millen, L., Roman, T. B., Xiong, H., Gilbert, H. F., Noiva, R., DeMartino, G. N., Thomas, P. J.
(2002). Conformational Remodeling of Proteasomal Substrates by PA700, the 19 S Regulatory Complex of the 26 S Proteasome. J. Biol. Chem.
277: 26815-26820
[Abstract]
[Full Text]
-
Chen, L., Madura, K.
(2002). Rad23 Promotes the Targeting of Proteolytic Substrates to the Proteasome. Mol. Cell. Biol.
22: 4902-4913
[Abstract]
[Full Text]
-
Li, Z., Zou, C.-B., Yao, Y., Hoyt, M. A., McDonough, S., Mackey, Z. B., Coffino, P., Wang, C. C.
(2002). An Easily Dissociated 26 S Proteasome Catalyzes an Essential Ubiquitin-mediated Protein Degradation Pathway in Trypanosoma brucei. J. Biol. Chem.
277: 15486-15498
[Abstract]
[Full Text]
-
Gonzalez, F., Delahodde, A., Kodadek, T., Johnston, S. A.
(2002). Recruitment of a 19S Proteasome Subcomplex to an Activated Promoter. Science
296: 548-550
[Abstract]
[Full Text]
-
Guttmann-Raviv, N., Martin, S., Kassir, Y.
(2002). Ime2, a Meiosis-Specific Kinase in Yeast, Is Required for Destabilization of Its Transcriptional Activator, Ime1. Mol. Cell. Biol.
22: 2047-2056
[Abstract]
[Full Text]
-
Glickman, M. H., Ciechanover, A.
(2002). The Ubiquitin-Proteasome Proteolytic Pathway: Destruction for the Sake of Construction. Physiol. Rev.
82: 373-428
[Abstract]
[Full Text]
-
Dawson, S., Apcher, S., Mee, M., Higashitsuji, H., Baker, R., Uhle, S., Dubiel, W., Fujita, J., Mayer, R. J.
(2002). Gankyrin Is an Ankyrin-repeat Oncoprotein That Interacts with CDK4 Kinase and the S6 ATPase of the 26 S Proteasome. J. Biol. Chem.
277: 10893-10902
[Abstract]
[Full Text]
-
Bays, N. W., Wilhovsky, S. K., Goradia, A., Hodgkiss-Harlow, K., Hampton, R. Y.
(2001). HRD4/NPL4 Is Required for the Proteasomal Processing of Ubiquitinated ER Proteins. Mol. Biol. Cell
12: 4114-4128
[Abstract]
[Full Text]
-
Ceccarelli, E., Mann, C.
(2001). A Cdc28 Mutant Uncouples G1 Cyclin Phosphorylation and Ubiquitination from G1 Cyclin Proteolysis. J. Biol. Chem.
276: 41725-41732
[Abstract]
[Full Text]
-
CAGNEY, G., UETZ, P., FIELDS, S.
(2001). Two-hybrid analysis of the Saccharomyces cerevisiae 26S proteasome. Physiol. Genomics
7: 27-34
[Abstract]
[Full Text]
-
Hitchcock, A. L., Krebber, H., Frietze, S., Lin, A., Latterich, M., Silver, P. A.
(2001). The Conserved Npl4 Protein Complex Mediates Proteasome-dependent Membrane-bound Transcription Factor Activation. Mol. Biol. Cell
12: 3226-3241
[Abstract]
[Full Text]
-
Buschmann, T., Potapova, O., Bar-Shira, A., Ivanov, V. N., Fuchs, S. Y., Henderson, S., Fried, V. A., Minamoto, T., Alarcon-Vargas, D., Pincus, M. R., Gaarde, W. A., Holbrook, N. J., Shiloh, Y., Ronai, Z.'e.
(2001). Jun NH2-Terminal Kinase Phosphorylation of p53 on Thr-81 Is Important for p53 Stabilization and Transcriptional Activities in Response to Stress. Mol. Cell. Biol.
21: 2743-2754
[Abstract]
[Full Text]
-
Xie, Y., Varshavsky, A.
(2001). RPN4 is a ligand, substrate, and transcriptional regulator of the 26S proteasome: A negative feedback circuit. Proc. Natl. Acad. Sci. USA
98: 3056-3061
[Abstract]
[Full Text]
-
Peng, Z., Staub, J. M., Serino, G., Kwok, S. F., Kurepa, J., Bruce, B. D., Vierstra, R. D., Wei, N., Deng, X.-W.
(2001). The Cellular Level of PR500, a Protein Complex Related to the 19S Regulatory Particle of the Proteasome, Is Regulated in Response to Stresses in Plants. Mol. Biol. Cell
12: 383-392
[Abstract]
[Full Text]
-
Stitzel, M. L., Durso, R., Reese, J. C.
(2001). The proteasome regulates the UV-induced activation of the AP-1-like transcription factor Gcn4. Genes Dev.
15: 128-133
[Abstract]
[Full Text]
-
Lommel, L., Chen, L., Madura, K., Sweder, K.
(2000). The 26S proteasome negatively regulates the level of overall genomic nucleotide excision repair. Nucleic Acids Res
28: 4839-4845
[Abstract]
[Full Text]
-
Jelinsky, S. A., Estep, P., Church, G. M., Samson, L. D.
(2000). Regulatory Networks Revealed by Transcriptional Profiling of Damaged Saccharomyces cerevisiae Cells: Rpn4 Links Base Excision Repair with Proteasomes. Mol. Cell. Biol.
20: 8157-8167
[Abstract]
[Full Text]
-
Verma, R., Chen, S., Feldman, R., Schieltz, D., Yates, J., Dohmen, J., Deshaies, R. J.
(2000). Proteasomal Proteomics: Identification of Nucleotide-sensitive Proteasome-interacting Proteins by Mass Spectrometric Analysis of Affinity-purified Proteasomes. Mol. Biol. Cell
11: 3425-3439
[Abstract]
[Full Text]
-
Tabb, M. M., Tongaonkar, P., Vu, L., Nomura, M.
(2000). Evidence for Separable Functions of Srp1p, the Yeast Homolog of Importin alpha (Karyopherin alpha ): Role for Srp1p and Sts1p in Protein Degradation. Mol. Cell. Biol.
20: 6062-6073
[Abstract]
[Full Text]
-
Holzl, H., Kapelari, B., Kellermann, J., Seemuller, E., Sumegi, M., Udvardy, A., Medalia, O., Sperling, J., Muller, S. A., Engel, A., Baumeister, W.
(2000). The Regulatory Complex of Drosophila melanogaster 26s Proteasomes: Subunit Composition and Localization of a Deubiquitylating Enzyme. JCB
150: 119-130
[Abstract]
[Full Text]
-
Tongaonkar, P., Chen, L., Lambertson, D., Ko, B., Madura, K.
(2000). Evidence for an Interaction between Ubiquitin-Conjugating Enzymes and the 26S Proteasome. Mol. Cell. Biol.
20: 4691-4698
[Abstract]
[Full Text]
-
Wilkinson, C. R. M., Ferrell, K., Penney, M., Wallace, M., Dubiel, W., Gordon, C.
(2000). Analysis of a Gene Encoding Rpn10 of the Fission Yeast Proteasome Reveals That the Polyubiquitin-binding Site of This Subunit Is Essential When Rpn12/Mts3 Activity Is Compromised. J. Biol. Chem.
275: 15182-15192
[Abstract]
[Full Text]
-
Lutz, M. S., Ellis, S. R., Martin, N. C.
(2000). Proteasome Mutants, pre4-2 and ump1-2, Suppress the Essential Function but Not the Mitochondrial RNase P Function of the Saccharomyces cerevisiae Gene RPM2. Genetics
154: 1013-1023
[Abstract]
[Full Text]
-
Strickland, E., Hakala, K., Thomas, P. J., DeMartino, G. N.
(2000). Recognition of Misfolding Proteins by PA700, the Regulatory Subcomplex of the 26 S Proteasome. J. Biol. Chem.
275: 5565-5572
[Abstract]
[Full Text]
-
Luders, J., Demand, J., Hohfeld, J.
(2000). The Ubiquitin-related BAG-1 Provides a Link between the Molecular Chaperones Hsc70/Hsp70 and the Proteasome. J. Biol. Chem.
275: 4613-4617
[Abstract]
[Full Text]
-
Gorbea, C., Taillandier, D., Rechsteiner, M.
(2000). Mapping Subunit Contacts in the Regulatory Complex of the 26 S Proteasome. S2 AND S5b FORM A TETRAMER WITH ATPase SUBUNITS S4 and S7. J. Biol. Chem.
275: 875-882
[Abstract]
[Full Text]
-
Brown, M. P. S., Grundy, W. N., Lin, D., Cristianini, N., Sugnet, C. W., Furey, T. S., Ares, M. Jr., Haussler, D.
(2000). Knowledge-based analysis of microarray gene expression data by using support vector machines. Proc. Natl. Acad. Sci. USA
97: 262-267
[Abstract]
[Full Text]
-
Chillarón, J., Haas, I. G.
(2000). Dissociation from BiP and Retrotranslocation of Unassembled Immunoglobulin Light Chains Are Tightly Coupled to Proteasome Activity. Mol. Biol. Cell
11: 217-226
[Abstract]
[Full Text]
-
Wilkinson, K. D.
(1999). Ubiquitin-Dependent Signaling: The Role of Ubiquitination in the Response of Cells to Their Environment.. J. Nutr.
129: 1933-1936
[Abstract]
[Full Text]
-
Takeuchi, J., Fujimuro, M., Yokosawa, H., Tanaka, K., Toh-e, A.
(1999). Rpn9 Is Required for Efficient Assembly of the Yeast 26S Proteasome. Mol. Cell. Biol.
19: 6575-6584
[Abstract]
[Full Text]
-
Bailly, E., Reed, S. I.
(1999). Functional Characterization of Rpn3 Uncovers a Distinct 19S Proteasomal Subunit Requirement for Ubiquitin-Dependent Proteolysis of Cell Cycle Regulatory Proteins in Budding Yeast. Mol. Cell. Biol.
19: 6872-6890
[Abstract]
[Full Text]
-
Horwich, A. L., Weber-Ban, E. U., Finley, D.
(1999). Chaperone rings in protein folding and degradation. Proc. Natl. Acad. Sci. USA
96: 11033-11040
[Abstract]
[Full Text]
-
Zwickl, P., Ng, D., Woo, K. M., Klenk, H.-P., Goldberg, A. L.
(1999). An Archaebacterial ATPase, Homologous to ATPases in the Eukaryotic 26 S Proteasome, Activates Protein Breakdown by 20 S Proteasomes. J. Biol. Chem.
274: 26008-26014
[Abstract]
[Full Text]
-
Hastings, R. A., Eyheralde, I., Dawson, S. P., Walker, G., Reynolds, S. E., Billett, M. A., Mayer, R. J.
(1999). A 220-kDa Activator Complex of the 26 S Proteasome in Insects and Humans. A ROLE IN TYPE II PROGRAMMED INSECT MUSCLE CELL DEATH AND CROSS-ACTIVATION OF PROTEASOMES FROM DIFFERENT SPECIES. J. Biol. Chem.
274: 25691-25700
[Abstract]
[Full Text]
-
Lambertson, D., Chen, L., Madura, K.
(1999). Pleiotropic Defects Caused by Loss of the Proteasome-Interacting Factors Rad23 and Rpn10 of Saccharomyces cerevisiae. Genetics
153: 69-79
[Abstract]
[Full Text]
-
Girod, P.-A., Fu, H., Zryd, J.-P., Vierstra, R. D.
(1999). Multiubiquitin Chain Binding Subunit MCB1 (RPN10) of the 26S Proteasome Is Essential for Developmental Progression in Physcomitrella patens. Plant Cell
11: 1457-1472
[Abstract]
[Full Text]
-
Russell, S. J., Steger, K. A., Johnston, S. A.
(1999). Subcellular Localization, Stoichiometry, and Protein Levels of 26 S Proteasome Subunits in Yeast. J. Biol. Chem.
274: 21943-21952
[Abstract]
[Full Text]
-
Kaiser, P., Moncollin, V., Clarke, D. J., Watson, M. H., Bertolaet, B. L., Reed, S. I., Bailly, E.
(1999). Cyclin-dependent kinase and Cks/Suc1 interact with the proteasome in yeast to control proteolysis of M-phase targets. Genes Dev.
13: 1190-1202
[Abstract]
[Full Text]
-
Perkins, E. L., Sterling, J. F., Hashem, V. I., Resnick, M. A.
(1999). Yeast and human genes that affect the Escherichia coli SOS response. Proc. Natl. Acad. Sci. USA
96: 2204-2209
[Abstract]
[Full Text]
-
Papa, F. R., Amerik, A. Y., Hochstrasser, M.
(1999). Interaction of the Doa4 Deubiquitinating Enzyme with the Yeast 26S Proteasome. Mol. Biol. Cell
10: 741-756
[Abstract]
[Full Text]
-
Kisselev, A. F., Akopian, T. N., Woo, K. M., Goldberg, A. L.
(1999). The Sizes of Peptides Generated from Protein by Mammalian 26 and 20 S Proteasomes. IMPLICATIONS FOR UNDERSTANDING THE DEGRADATIVE MECHANISM AND ANTIGEN PRESENTATION. J. Biol. Chem.
274: 3363-3371
[Abstract]
[Full Text]
-
Rinaldi, T., Ricci, C., Porro, D., Bolotin-Fukuhara, M., Frontali, L.
(1998). A Mutation in a Novel Yeast Proteasomal Gene, RPN11/MPR1, Produces a Cell Cycle Arrest, Overreplication of Nuclear and Mitochondrial DNA, and an Altered Mitochondrial Morphology. Mol. Biol. Cell
9: 2917-2931
[Abstract]
[Full Text]
-
Emmerich, N. P. N., Nussbaum, A. K., Stevanovic, S., Priemer, M., Toes, R. E. M., Rammensee, H.-G., Schild, H.
(2000). The Human 26 S and 20 S Proteasomes Generate Overlapping but Different Sets of Peptide Fragments from a Model Protein Substrate. J. Biol. Chem.
275: 21140-21148
[Abstract]
[Full Text]
-
Russell, S. J., Johnston, S. A.
(2001). Evidence That Proteolysis of Gal4 Cannot Explain the Transcriptional Effects of Proteasome ATPase Mutations. J. Biol. Chem.
276: 9825-9831
[Abstract]
[Full Text]
-
Chang, C., Gonzalez, F., Rothermel, B., Sun, L., Johnston, S. A., Kodadek, T.
(2001). The Gal4 Activation Domain Binds Sug2 Protein, a Proteasome Component, in Vivo and in Vitro. J. Biol. Chem.
276: 30956-30963
[Abstract]
[Full Text]