Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3163-3172, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Increased Expression of Cyclin D2 during Multiple
States of Growth Arrest in Primary and Established Cells
Muthupalaniappan
Meyyappan,1
Howard
Wong,2
Christopher
Hull,3 and
Karl T.
Riabowol3,4,*
Departments of Medical
Science,1
Medical
Biochemistry,3 and
Oncology,4 Southern Alberta Cancer
Research Center, and
Department of Molecular Pathology,
University of Calgary Health Sciences Center,2
Calgary, Alberta, Canada T2N 4N1
Received 10 December 1997/Accepted 18 February 1998
 |
ABSTRACT |
Cyclin D2 is a member of the family of D-type cyclins that is
implicated in cell cycle regulation, differentiation, and oncogenic transformation. To better understand the role of this cyclin in the
control of cell proliferation, cyclin D2 expression was monitored under
various growth conditions in primary human and established murine
fibroblasts. In different states of cellular growth arrest initiated by
contact inhibition, serum starvation, or cellular senescence, marked
increases (5- to 20-fold) were seen in the expression levels of cyclin
D2 mRNA and protein. Indirect immunofluorescence studies showed that
cyclin D2 protein localized to the nucleus in G0,
suggesting a nuclear function for cyclin D2 in quiescent cells. Cyclin
D2 was also found to be associated with the cyclin-dependent kinases
CDK2 and CDK4 but not CDK6 during growth arrest. Cyclin D2-CDK2
complexes increased in amounts but were inactive as histone H1 kinases
in quiescent cells. Transient transfection and needle microinjection of
cyclin D2 expression constructs demonstrated that overexpression of
cyclin D2 protein efficiently inhibited cell cycle progression and DNA
synthesis. These data suggest that in addition to a role in promoting
cell cycle progression through phosphorylation of retinoblastoma family
proteins in some cell systems, cyclin D2 may contribute to the
induction and/or maintenance of a nonproliferative state, possibly
through sequestration of the CDK2 catalytic subunit.
 |
INTRODUCTION |
In eukaryotes, cell proliferation is
regulated by the cooperative activity of a set of cell cycle control
genes (reviewed in references 56 and
57). These genes include those that encode cyclin-dependent kinases (CDKs) and the proteins that regulate their
behavior, cyclins and CDK inhibitors. Analysis of cyclin and CDK
inhibitor expression has indicated that phase-specific oscillations in
the abundance of some of these proteins are responsible, in part, for
the orderly and linear progression of cells through key cell cycle
checkpoints. In mammalian cells, an important cell cycle checkpoint
called the restriction point is located at a position just prior to the
onset of DNA synthesis (51). The expression of a subset of
cell cycle control genes occurs during the G1 phase of the
cycle, placing them in a temporal position to influence this key cell
cycle decision (56). Among such candidate G1
control genes are those encoding cyclins D and E and the CDK inhibitors
belonging to the p21WAF/CIP/SDI and
p16INK4 families.
The D-type cyclins consist of three family members, cyclins D1, D2, and
D3. The cyclin D1 gene was identified as a delayed-early gene that was
inducible by colony-stimulating factor (37), by its ability
to complement G1 cyclin-deficient yeast strains (33, 74), and as the PRAD-1/bcl-1 proto-oncogene that
underwent gene rearrangements, gene amplification, and deregulated
expression in a variety of tumor types (reviewed in reference
43). Microinjection experiments with anti-cyclin D1
antibodies have suggested that cyclin D1 may be required for
progression of cells through G1 (4, 35, 52).
Cyclins D2 and D3 were cloned as a consequence of their homology to
cyclin D1 (25, 30, 37, 44, 74, 75), and cyclin D2 was also
independently identified as encoded by a gene mutated by proviral
insertion (20). Aberrant expression of cyclin D2 has been
linked to human male germ cell tumorigenesis (24).
The G1 regulatory function of D-type cyclins is thought to
be mediated by their interactions with CDK2, -4, and -6 (38, 39,
41, 76) and the retinoblastoma susceptibility gene product, Rb
(9, 12, 27). Phosphorylation of Rb by cyclin D in complexes with CDK4 or CDK6 in mid- to late G1 is believed to trigger
the onset of S phase by inducing the release of E2F transcription factors from growth-inhibitory Rb complexes (67). The free
E2F proteins are then thought to transcriptionally activate genes involved in the activation and maintenance of DNA synthesis. However, given the experimental results obtained from E2F knockout mice, the
precise molecular function of Rb-E2F complexes is currently less clear
(68). Also, cyclin D1 has recently been shown to regulate
gene expression independent of kinase activity (46, 78).
We and others have previously reported that in addition to positively
regulating traverse through specific points of the cell cycle,
overexpression of cyclin D1 in primary human fibroblasts inhibits
proliferation in chronic growth assays and blocks cells from entering
into S phase in acute growth assays (2, 49). Mice lacking
cyclin D1 appear to develop normally except for a subset of cells
within the retina and breast epithelium (13, 58) which may
be related to the high levels of Rb seen in the retina (26)
and the CDK-independent activation of the estrogen receptor by cyclin
D1 (78), respectively. As for cyclin D1, targeted
inactivation of the cyclin D2 gene in mice affects few cell types,
resulting in hypoplastic ovaries and testes (59). Furthermore, the D-type cyclins have been shown to be induced during
exit from the cell cycle seen upon differentiation of a wide variety of
cell types (15), and cyclin D1 has been reported by many
groups to be upregulated during cellular senescence (reviewed in
reference 42). A brain-specific form of cyclin D2
(MN20) has been linked to differentiation of particular neural cell
populations (54, 55), and coexpression of cyclin D2 and
Ha-Ras under low-serum conditions can induce a senescence-like
phenotype (28). These results suggest that D-type cyclins
may have different roles depending on their levels of expression and
cell type, which may be independent of CDK activity. Here we provide
additional evidence that one function of D-type cyclins may be to act
as inhibitors of cell proliferation. Our results demonstrate that
cyclin D2 expression is unique among the D-type cyclins, being
upregulated manyfold under three distinct conditions of growth arrest
in phenotypically normal human and murine fibroblasts. Increased levels
of cyclin D2 preferentially associate with CDK2 and CDK4 but not CDK6,
and these complexes are inactive as histone H1 kinases. Furthermore, ectopic overexpression of cyclin D2 efficiently blocks cell cycle progression, suggesting an alternate role for cyclin D2 in promoting exit from the cell cycle and maintaining cells in a nonproliferative state.
 |
MATERIALS AND METHODS |
Cells and cell culture.
Established NIH 3T3 cells (CRL 1658)
and the Hs68 (CRL 1635) and WI-38 (CCL 75) primary human diploid
fibroblast (HDF) strains were obtained from the American Type Culture
Collection. Forearm epidermal (A2) fibroblasts were a kind gift from S. Goldstein. HDFs were maintained in Dulbecco's modified Eagle's medium
(DMEM; Gibco-BRL) containing low glucose, while NIH 3T3 fibroblasts
were maintained in DMEM containing high glucose. The media for both human and murine cells were supplemented with penicillin-streptomycin (Gibco) and 10% fetal calf serum.
For growth studies, we defined senescence as a state where less than
10% (typically 3 to 5%) of cells enter DNA synthesis in response to
mitogens in a 36-h period (2). Senescence occurs at
different passage numbers for the primary strains used; under our
culture conditions, cells reach this point as follows: Hs68 cells by 80 to 85 mean population doublings (MPDs), WI-38 cells by 45 to 50 MPDs,
and A2 cells by 75 to 80 MPDs. All cell strains and lines were analyzed
during exponential growth unless otherwise stated. Cells were grown in
95% air-5% CO2 and maintained at a temperature of
37°C. For study of cyclin expression during contact inhibition of
growth, ~5 × 104 Hs68 (MPD 32) or NIH 3T3 cells
were seeded on 10-cm-diameter plates in complete medium containing 10%
fetal bovine serum (FBS) and harvested for total RNA and protein at the
intervals indicated. For release from contact inhibition, a single
10-cm-diameter plate of 8-day density-arrested Hs68 fibroblasts
(~5 × 105 cells at 32 MPDs) was split at a ratio of
1:12 (~4 × 104 cells) into 12 10-cm-diameter
plates. Cells were harvested at 2 h following replating and every
3 h thereafter for 30 h. Isolated RNA from each plate,
representing ~0.4 µg of total RNA, was used for cDNA synthesis by
reverse transcription. For serum deprivation/stimulation experiments,
subconfluent Hs68 HDFs (MPD 34) or NIH 3T3 fibroblasts were incubated
in 0.1 to 0.2% FBS for 40 to 48 h prior to harvesting or
stimulation with 10% FBS.
RNA preparation and RT-PCR.
Total cellular RNA from HDFs and
NIH 3T3 cells was extracted from cells and processed for reverse
transcription and primer-dropping PCR essentially as described
elsewhere (71). Primer sequences used for detection of both
human and murine cyclin D2 transcripts were, from 5' to 3',
TACTTCAAGTGCGTGCAGAAGGAC for the sense primer and
TCCCACACTTCCAGTTGCGATCAT for the antisense primer, resulting in a predicted PCR product of 497 bp. The specificity of the primers was confirmed by amplification of the appropriate size product from a
human cyclin D2 cDNA and by sequencing of the PCR product (data not
shown). Primer sequences and amplification conditions for cyclins B1
and E and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) have been
described previously (71). Primer-dropping reverse
transcription-PCRs (RT-PCRs) were performed in 50-µl reaction volumes, using PCR tubes with screw-cap lids (Sarstedt) as described previously (71). Optimal PCR cycle numbers required for
exponential amplification for each primer set were determined by
preliminary range-finding experiments. Total amplification in each
multiplex reaction was kept below saturation levels to permit the
products to remain within the exponential range of the amplification
curve and thereby provide semiquantitative data. All reactions shown in
each panel of PCR results were performed under the same reaction conditions. Typically, visualization of GAPDH required 20 to 23 PCR
cycles and cyclin D2 mRNA required 24 to 32 cycles, depending on cell
type. Gels were illuminated with UV light, photographed with Polaroid
film, and analyzed by digital image analysis using a Hewlett-Packard
ScanJet IIc scanner and the NIH Image program. The intensities of the
ethidium bromide fluorescence signals were determined from the area
under the curve for each peak. All PCRs were repeated at least three
times to verify results.
Western blotting.
Cells washed with phosphate-buffered
saline (PBS) were harvested in 0.5 ml of lysis buffer (50 mM Tris-HCl
[pH 7.4]-50 µM pepstatin A-0.2 mM leupeptin-10 mM EDTA-1%
Triton X-100 containing freshly added 1 mM phenylmethylsulfonyl
fluoride), sonicated, and stored at
20°C until required. Protein
concentrations were determined by the Bradford assay and/or Coomassie
staining after polyacrylamide gel electrophoresis, and 80 µg of
boiled protein in 2× sample buffer was loaded per lane for
electrophoresis through sodium dodecyl sulfate-12.5% polyacrylamide
gels. Equal loading of protein samples was confirmed visually by
Coomassie brilliant blue staining. Proteins were transferred to
Polyscreen polyvinylidene difluoride membranes (NEN Research Products)
for 2 h at 20 V. The membranes were blocked overnight in PBS
containing 10% low-fat milk and 0.1% Tween 20, incubated with rat
monoclonal anti-cyclin D2 antibody (Oncogene Science) (1:1,000 dilution
in PBS containing 0.1% Tween 20 and 5% milk) for 2 h at room
temperature, followed by incubation with a sheep anti-rat
immunoglobulin (Ig) biotinylated conjugate (1:1,000) (Amersham) and
then strepavidin-horseradish peroxidase conjugate (1:1,000) (Amersham)
for 1 h each. The blots were washed for 30 min with PBS-Tween 20 following each incubation. The membrane-bound cyclin D2 protein was
detected by enhanced chemiluminescence as instructed by the
manufacturer (Amersham).
Indirect immunofluorescence.
NIH 3T3 and Hs68 fibroblasts
were plated on glass coverslips at 20 to 40% confluence in complete
medium and incubated for 2 to 3 days for analysis of exponentially
proliferating cells. For study of cell cycle expression patterns,
plated cells were incubated for 1 day and then starved for 36 to
48 h in 0.1% FBS prior to stimulation with 10% FBS for the time
indicated. For detection of cyclin D2 protein and nonspecific rabbit
IgG, cells on coverslips were fixed by sequential immersion for 10 min
each in 3.7% formaldehyde (in PBS) and 0.5% Triton X-100 (in PBS) at room temperature. For detecting nuclear bromodeoxyuridine (BrdU) staining, additional incubations in 3 N HCl for 10 min and sodium borate (0.1 M, pH 8.0) for 1 min were done. Coverslips were washed by
immersion in PBS for 10 min followed by incubation with primary antibodies in a humidified chamber at 37°C. Cyclin D2 was detected with a rat monoclonal antibody (1:100; AB-1; Oncogene Science), BrdU
was detected with a mouse monoclonal antibody (1:300; Sigma), and
rabbit nonspecific antibodies were detected with a sheep anti-rabbit IgG-Texas red conjugate (1:100; Amersham). Secondary and tertiary antibodies for cyclin D2 detection were biotinylated sheep anti-rat Ig
(1:100; Amersham) followed by strepavidin-fluorescein conjugate (1:100;
Amersham). BrdU was detected with goat anti-mouse IgG-Texas red
conjugate (1:100; Amersham). For assaying DNA synthesis, BrdU was added
to a final concentration of 5 µg/ml 2 h after serum stimulation,
and cells were fixed and stained either 12 or 20 h later.
Following antibody incubation, coverslips were mounted on glass slides
and photographed in a Zeiss Axiophot microscope, using a Neofluar 40×
lens and Kodak Tri-X pan 400 film.
Immunoprecipitation-Western blot and immunoprecipitation-kinase
assays.
Lysates from exponentially growing, contact-inhibited, or
serum-deprived fibroblasts were prepared by scraping and lysis in radioimmunoprecipitation assay buffer under nondenaturing conditions as
described previously (2). Equal amounts of lysates
quantitated by Coomassie staining after polyacrylamide gel
electrophoresis were incubated for 4 h in antibody excess with
rabbit anti-CDK2, anti-CDK4, anti-CDK6, anti-glutathione
S-transferase (GST) (all from Santa Cruz Biotechnology
Inc.), or anti-cyclin D1 (a gift from Y. Xiong) or rat anti-cyclin D2
(Calbiochem) at 4°C with gentle rocking. Solutions were pelleted for
2 min at 14,000 × g, and supernatants were transferred
to fresh tubes containing 20 µl of protein G-agarose beads for
incubation at 4°C with rocking for 30 min. Pellets were collected by
brief centrifugation, and remaining supernatant was aspirated. Pellets
were washed four times with ice-cold radioimmunoprecipitation assay
buffer, and the final pellet was boiled in 2× Laemmli sample buffer
for subsequent Western analysis or in 1× kinase buffer for kinase
assays. Immunoprecipitates were electrophoresed and detected by Western
blotting as described above. Histone H1 assays of immunoprecipitates
were done with 1 µg of histone (Sigma) each as described previously
(64).
Microinjection experiments.
Microinjection experiments were
performed essentially as described previously (2). In brief,
log-phase or synchronized HDFs plated on glass coverslips were needle
microinjected in the nucleus with either cytomegalovirus (CMV)-driven
expression constructs encoding cyclin D1, D2, E or B1, or the parental
RcCMV plasmid and/or rabbit nonspecific antibodies. The CMV-cyclin D2
construct was obtained as a generous gift from E. Kerkhoff; for other
expression vectors, see reference 2. Three
independent trials for each plasmid construct were performed where a
minimum of 100 cells per coverslip were microinjected and cells were
scored for BrdU incorporation 24 h later. Microinjection of
nonspecific antibodies was used to control for microinjection trauma in
individual experiments. Tests with nonspecific antibodies showed that
greater than 90% of cells survive microinjection and approximately
95% of these were able to incorporate BrdU over a 24-h period.
Transient transfection and FACS analysis.
Hs68 HDFs (MPD 30)
were plated at a density of 106 cells per 150-mm-diameter
plate. Cells were trypsinized and spun at 800 rpm for 5 min. Cell
pellets were resuspended in 400 µl of DMEM without FBS and
transferred to 4-mm gap cuvettes (BTX Inc., San Diego, Calif.). Thirty
micrograms of plasmid CMV-cyclin D2, CMV-antisense cyclin D2, CMV-p16,
or RcCMV vector control was added together with 10 µg of CMV-CD20
surface marker and 10 µg of salmon sperm DNA to make a total DNA
content of 50 µg per cuvette. Electroporations were done with a
Bio-Rad gene pulser at 250 V and 960 µF, and each was transferred to
a 10-cm-diameter plate; 48 h after electroporation, cells were
prepared for fluorescence-activated cell sorting (FACS) analysis.
For FACS analysis, electroporated cells were trypsinized and spun at
800 rpm for 5 min. The cell pellet was resuspended in 100 µl of
complete medium (DMEM) and 20 µl of fluorescein isothiocyanate-CD20 antibody (Becton Dickinson) and incubated at 4°C with gentle rocking for 30 min. The cells were then spun down as described above, washed
two times with 1× PBS, and fixed in 1 ml of 0.01% formaldehyde (in
PBS) overnight at 4°C. After fixation, the cells were spun and
rewashed twice with 1× PBS, 1 ml of ice-cold digitonin (10 µg/ml in
95% ethanol) was added, and cells were incubated for 5 min on ice. The
cells were centrifuged as described above and washed twice with 1×
PBS, and the resulting pellet was resuspended in 500 µl of 1× PBS
containing 250 µg of RNase A and 6 µg of propidium iodide. After a
30-min incubation in the dark at room temperature, the cells were
analyzed in a Becton Dickinson FACScan, and cell cycle analyses were
performed for cells gated for positive CD20 surface marker. In
experiments where transient transfections were not performed, the cells
were prepared essentially as described above, omitting the addition of
CD20 antibody.
 |
RESULTS |
Contact-inhibited cells express high levels of cyclin D2.
Cyclin D2 mRNA expression as a function of cell density was examined by
semiquantitative RT-PCR (71). After plating of Hs68 fibroblasts at low density, cells were harvested up to 6 days later
under conditions where cells began to reach confluence by 3 days. As
shown in Fig. 1A, the expression levels
of cyclin D2 mRNA progressively increased, attaining 20- to 30-fold
higher levels over 6 days as estimated by scanning densitometry. The expression of cyclin B, which is required for progression through mitosis, was downregulated, while cyclin E, another G1
cyclin, remained relatively unchanged in the same samples. To confirm that cells plated for 2 days were at low density and were exponentially proliferating compared to cells at day 6, FACS analysis was performed. As expected, a significantly higher S-phase fraction was present in day
2 cells (32%) than in day 6 cells (4%). Human lung WI-38, IMR-90, and
human skin (epidermal) A2 HDFs also exhibited a similar upregulation of
cyclin D2 mRNA in response to contact inhibition (data not shown).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Increased expression of cyclin D2 during contact
inhibition. (A) Primary human diploid fibroblasts at low passage
numbers (Hs68, MPD 32) were split at a ratio of 1:8 and harvested daily
over a 6-day period starting on the second day. Each sample was tested
for cyclin B1, E, and D2 mRNA expression by using primer-dropping
RT-PCR, with GAPDH as an internal control (71). Initially
subconfluent NIH 3T3 murine fibroblasts were harvested at the days
shown and analyzed for cyclin D2 expression by RT-PCR (B) and by
Western immunoblotting using a monoclonal antibody against cyclin D2
protein (C). Amplification of cyclin D2 mRNA from NIH 3T3 cells
consistently required five to six fewer PCR cycles than for similar
detection of the transcript from HDFs. Assuming 80% efficiency for the
PCR, this represents a 25- to 50-fold difference in abundance. (D) For
Western blots, approximately 80 µg of total protein was loaded per
lane, and equivalent protein loading of lanes was confirmed by
Coomassie blue staining of gels.
|
|
Since the mouse homolog of cyclin D2 (CYL2) was cloned from NIH 3T3
cells (
37), suggesting that its levels might be higher
in
this established cell line than in HDFs, and because NIH 3T3
fibroblasts are well known to contact inhibit, we also tested
for
changes in cyclin D2 expression in these cells. As shown in
Fig.
1B,
cyclin D2 mRNA levels increased to a similar degree in
response to
contact inhibition as seen for HDFs. Immunoblotting
experiments with
whole-cell lysates from NIH 3T3 cells confirmed
that cyclin D2 protein
levels also increased approximately 20-fold
as estimated by scanning
densitometry (Fig.
1C). These results
demonstrate that cyclin D2
expression is highly sensitive to the
degree of cell contact in both
primary human and established murine
fibroblasts.
We next examined whether the cell density-related increase in cyclin D2
expression was a reversible event. Hs68 cells were
released from
contact inhibition by replating confluent HDFs (day
8 cells) at low
density (1:12) and allowing them to synchronously
reenter the cell
cycle. Total RNA for analysis of mRNA expression
patterns and whole
cells for flow cytometry experiments were harvested
in parallel at 1- to 3-h intervals following replating. Results
from flow cytometry are
plotted in Fig.
2A, which shows the high
degree of synchrony of cells progressing through the cell cycle
when
released from contact inhibition. Figure
2B presents the
results of
RT-PCR amplifications for cyclins D2, E, and B1. Release
from contact
inhibition resulted in the continuous downregulation
of cyclin D2
expression during the first 15 h. A comparison of
cyclin D2
expression kinetics with FACS data indicated that reduction
of cyclin
D2 mRNA occurred continually through G
1, reaching low
steady-state levels during S-phase and thereafter. As controls,
cyclins
E and B1 were analyzed from the same pool of cDNA samples
and were
expressed at levels similar to those previously reported
(
48,
71,
72). These results show that cyclin D2 expression
is
downregulated in response to release from contact inhibition.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Kinetics of cyclin D2 mRNA expression upon release from
contact inhibition. (A) Flow cytometry analysis of Hs68 fibroblasts
released from contact inhibition. To perform the time course study, one
10-cm-diameter plate of day 8, contact-inhibited HDF cells (Hs68, MPD
36) were trypsinized and split equally into 12 plates containing fresh
medium and 10% FBS. Cells were harvested at the time points shown. (B)
In a parallel experiment, total RNA was harvested at the times
indicated and analyzed for cyclin D2, E, and B1 mRNA expression
patterns from the same pool of cDNA by RT-PCR.
|
|
Serum deprivation induces cyclin D2 expression.
We next
examined cyclin D2 expression by RT-PCR and Western immunoblotting in
NIH 3T3 cells made quiescent by serum deprivation. As shown in Fig.
3, relative to exponentially
proliferating cells, serum-starved (quiescent) cells express elevated
levels of both cyclin D2 mRNA (Fig. 3A) and protein (Fig. 3B), although
the increase was not as great as that seen in contact-inhibited cells.
Upregulation of cyclin D2 in quiescent and contact-inhibited cells
appeared unique among the D-type cyclins, with cyclin D1 showing
decreased levels and cyclin D3 changing little in serum-deprived or
contact-inhibited NIH 3T3 cells (Fig. 3B).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Cyclin D2 expression is upregulated in serum-deprived
cells. NIH 3T3 fibroblasts were analyzed for cyclin D2 expression by
RT-PCR (A) and by Western immunoblotting of cells that were
exponentially proliferating, serum deprived for 40 to 48 h in
0.2% FBS (Quiescent), or contact inhibited (B). Subconfluent quiescent
HDFs (MPD ~26) (C), NIH 3T3 fibroblasts (D), and murine macrophages
(E) were stimulated by the addition of serum to induce entry into the
cell cycle. Total RNA was harvested at the time points shown and
assayed for cyclin D2 mRNA expression.
|
|
We next examined whether accumulation of cyclin D2 in response to serum
deprivation was reversible. When subconfluent or low-density
cells were
serum deprived for 48 h and restimulated with 10% serum
to induce
cells to exit G
0 and reenter the cell cycle, cyclin
D2 mRNA
expression was downregulated in primary Hs68 fibroblasts
(Fig.
3C),
established NIH 3T3 cells (Fig.
3D), and established
murine macrophages
(strain J774 [Fig.
3E]). Similar patterns of
repression of cyclin D2
expression by serum addition were seen
in three other primary HDF
strains (WI38, A2, and HF [data not
shown]). Consistent with these
data, other groups have reported
that both cyclin D2 protein and mRNA
levels are lower in S phase
than during G
1, although in
these studies levels of cyclin D2
were not examined during quiescence
(
1,
30,
36).
Cyclin D2 levels increase during cellular senescence.
As
cyclin D2 levels were consistently upregulated during contact
inhibition and quiescence, we tested whether a similar upregulation occurs during cellular senescence (22) where primary cells
lose their proliferative capacity and become irreversibly growth
arrested with a 2N DNA content, presumably within the G1
phase of the cell cycle (17). As shown in Fig.
4A, all strains of primary HDFs examined
showed 5- to 20-fold increases in cyclin D2 mRNA levels as cells became
senescent, similar to the changes previously reported for cyclin D1
(2, 10, 34) and the CDK inhibitors
p21WAF/CIP/SDI (2, 47) and
p16INK4 (21, 72). As in
contact-inhibited cells, the increase in mRNA resulted in increased
levels of the cyclin D2 protein in senescent cells as shown for two
primary HDF strains in Fig. 4B, although signals are relatively weak
due to low levels of this cyclin in primary cells (4, 63).
To determine the kinetics of cyclin D2 expression in relationship to in
vitro age, Hs68 fibroblasts were assayed at several passage numbers
indicated in Fig. 4C. This experiment revealed that readily detectable
upregulation of cyclin D2 mRNA was first observed in "middle-aged"
cells (MPD 52 to 60) and continued to progressively increase with
greater passage numbers. Coincidental with the increase in cyclin D2
expression, a reduction in the rate of cellular proliferation (assayed
as described in Materials and Methods), increases in the proportion of
cells possessing a large flat morphology, and increased expression of
the p16INK4 and p33ING1
genes (data not shown), both of which accompany the process of replicative senescence (16, 72), were observed. In summary, these experiments show that states of cellular growth arrest induced by
three distinct physiological conditions, growth factor deprivation, contact inhibition, and cellular senescence, are accompanied by increased expression of cyclin D2 mRNA and protein in all
phenotypically normal primary and immortal cell types examined.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Overexpression of cyclin D2 during cellular senescence.
(A) Cyclin D2 primers were used to monitor the relative mRNA expression
levels from three independent HDF strains at the MPDs shown,
representing young (low-MPD) and old, near-senescent (high-MPD) cells.
In each case, RNA was harvested from subconfluent cells grown under
exponential growth conditions. (B) Western blot of cyclin D2 expression
in WI38 and A2 fibroblasts at different population doublings. (C)
Cyclin D2 mRNA expression levels assayed in Hs68 HDFs at increasing
passage numbers.
|
|
Cyclin D2 protein is localized to the nucleus during growth
arrest.
As growth-arrested cells exhibited enhanced levels of
cyclin D2 mRNA and protein, we next determined the distribution of
cyclin D2 protein within fibroblasts made quiescent by serum starvation and contact inhibition, using indirect immunofluorescence. As shown in
Fig. 5A and B, cyclin D2 protein
localized to the nucleus in both serum-starved and contact-inhibited
NIH 3T3 fibroblasts. Cyclin D2 protein in subconfluent, near-senescent
HDFs (MPD 84) also showed a nuclear staining pattern, but the overall
immunofluorescent signal was very weak (data not shown), likely due to
the relatively low levels of expression in primary fibroblasts (4,
63). Thus, nuclear cyclin D2 protein was closely associated with
all three states of growth arrest.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 5.
Localization of cyclin D2 protein in growth-arrested and
proliferating fibroblasts by indirect immunofluorescence. Fibroblasts
plated on glass coverslips were fixed and stained for cyclin D2
protein, BrdU, or nonspecific rabbit IgG. (A) Localization of cyclin D2
in serum-deprived NIH 3T3 fibroblasts. (B) Cyclin D2 in
contact-inhibited (day 6) NIH 3T3 fibroblasts. (C) Cyclin D2 in NIH 3T3
cells at the G1/S boundary. (D) Cells shown in panel C
stained for BrdU. Quiescent NIH 3T3 cells were stimulated for 14 h
with serum prior to fixing and staining for cyclin D2 protein and BrdU.
Arrowheads in panel D indicate cells that stained positively for
nuclear cyclin D2 protein but had not progressed into S phase, as
determined by lack of BrdU staining. (E) NIH 3T3 cells in
G2/M phase stained for cyclin D2 protein and photographed
with long exposure times. (F) Cells from panel E stained for BrdU.
Quiescent NIH 3T3 cells were stimulated for 20 to 22 h with serum
and BrdU and were fixed and stained for cyclin D2 protein and BrdU. (G)
Hs68 HDFs microinjected with cyclin D2 expression constructs and
nonspecific antibodies. The cells shown are stained for nonspecific
rabbit IgGs. (H) HDFs from panel G stained for ectopic overexpression
of cyclin D2 protein. Arrowheads in panel H show microinjected cells
staining brightly for cyclin D2 protein that localized to either the
nucleus or the cytoplasm.
|
|
Cyclin D2 was not, however, confined to the nucleus during all phases
of the cell cycle. As shown in Fig.
5C, NIH 3T3 cells
in late
G
1/early S phase expressed highly variable levels of cyclin
D2 protein, and cells that stained brightly for nuclear cyclin
D2 had
not progressed through S phase, as determined by a lack
of BrdU
staining (Fig.
5D), similar to staining patterns reported
for a variety
of human cell types (
36). Following DNA replication
as
evidenced by BrdU incorporation and staining (Fig.
5F), fibroblasts
showed an overall lower intensity of cyclin D2 staining that was
predominantly cytoplasmic (Fig.
5E). However, because it was formally
possible that the cytoplasmic staining following entry into S
phase was
nonspecific, we microinjected Hs68 fibroblasts that
express low
endogenous levels of cyclin D2 with a CMV promoter-driven
human cyclin
D2 expression construct together with nonspecific
rabbit antibodies to
identify microinjected cells. Cells injected
with expression constructs
(Fig.
5G) showed distinct nuclear and
cytoplasmic cyclin D2 staining
patterns (Fig.
5H), indicating
that these cells possess the capacity to
actively partition the
protein. We could not determine the position in
the cell cycle
of these microinjected cells by using BrdU costaining
because
overexpression of exogenous cyclin D2 protein interfered with
DNA synthesis (see Fig.
7). Nevertheless, although total cyclin
D2
expression does not change appreciably from S to M phases of
the cell
cycle (Fig.
3), these data support the idea that removal
of the protein
from the nucleus might be required to allow the
G
1-S phase
transition and progression through S phase as suggested
previously for
D-type cyclins (
4,
35,
36).
Cyclin D2 associates with CDK2 (in a catalytically inactive
complex) and with CDK4 during contact inhibition.
To assess the
relative levels of CDKs that might interact with cyclin D2, we
performed a series of immunoprecipitation-Western assays. Cyclin D2
Western blots against cell lysates from rapidly growing (lanes G) and
contact-inhibited (lanes Cl) cells, or against immunoprecipitations
from such lysates with control (anti-GST) or the indicated CDK
antibodies, are shown in Fig. 6.
Consistent with earlier blots (Fig. 1C and Fig. 3B), the levels of
cyclin D2 were higher in contact-inhibited than in growing cells (Fig. 6A and B), and relatively high levels of cyclin D2 binding to CDK4 but
not CDK6 were seen in both growing and contact-inhibited cell lysates
(Fig. 6A). Although generally not considered to be a major binding
partner of cyclin D2, CDK2 has been reported to bind cyclin D2 in some
human breast epithelial cells (62). Consistent with this
report, we found increased binding of CDK2 with cyclin D2 in
contact-inhibited cells as shown in Fig. 6B in independent trials. No
signal was seen in GST immunoprecipitates, indicating that the cyclin
D2-CDK2 signal was specific. To determine if the CDK2 bound to cyclin
D2 was active as a kinase, a series of immunoprecipitations were done
with lysates from growing and contact-inhibited cells and antibodies
directed against cyclin D2, CDK2 (as a positive control), as well as
ones recognizing GST and cyclin D1 (as negative controls).
Immunoprecipitates were then used in kinase assays using histone H1 as
the substrate. As shown in Fig. 6C, anti-CDK2 immunoprecipitates from
growing but not contact-inhibited cells contained very high levels of
kinase activity, whereas anti-cyclin D2 immunoprecipitates, as well as
negative control immunoprecipitates, contained no detectable activity
in either growing or contact-inhibited cells.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
CDK associations with cyclin D2. (A) Whole-cell lysates
or immunoprecipitates (IP) from growing (lanes G) or contact-inhibited
(lanes CI) NIH 3T3 cells were immunoblotted with a cyclin D2 monoclonal
antibody as described in Materials and Methods. The anti-GST ( -GST)
antibody served as a negative control, and the lysate served as a
positive control. (B) Cyclin D2 immunoblot of cell lysates and
immunoprecipitates using anti-GST and anti-CDK2 antibodies. In the case
of anti-CDK2, two independent immunoprecipitations are shown. (C)
Kinase assays of immunoprecipitates from growing and contact-inhibited
cells, using histone H1 as the substrate. The autoradiogram was
overexposed in order to detect very low amounts of activity as seen for
contact-inhibited cells in the -CDK2 lane.
|
|
Overexpression of cyclin D2 inhibits DNA synthesis in HDFs.
Because cyclin D2 expression correlated with multiple states of growth
arrest, we examined whether its overexpression might prevent
proliferation-competent primary HDFs from progressing through the cell
cycle. HDFs were starved for 48 h and stimulated by the addition
of 10% FBS to synchronously enter the cell cycle. Two to four hours
later, cells were microinjected with a CMV-cyclin D2 expression
construct, 1 h later BrdU was added to monitor DNA synthesis, and
cells were fixed and stained for coinjected IgG and for incorporation
of BrdU 24 to 30 h after stimulation. In parallel, similar
microinjection experiments were conducted with a cyclin D1, cyclin E,
or cyclin B1 expression construct, the empty control vector (RcCMV),
and rabbit nonspecific IgG (to assess the degree of trauma from
microinjection). Cells microinjected with cyclin D2 plasmids exhibited
a large flat cell morphology similar to that of senescent fibroblasts
(Fig. 7A) and failed to incorporate BrdU
(Fig. 7B), whereas neighboring uninjected cells were BrdU positive.
These observations indicate that cells microinjected with cyclin D2
expression constructs were unable to efficiently replicate their DNA.
In contrast, cells microinjected with the CMV-cyclin E construct (Fig.
7C) readily incorporated BrdU (Fig. 7D).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Ectopic overexpression of cyclin D2 inhibits S-phase
progression. Serum-synchronized HDFs microinjected with CMV-cyclin D2
(A) and CMV-cyclin E expression constructs (C) and analyzed for BrdU
incorporation (B and D, respectively). The microinjected cells were
detected by staining for cyclin D2 protein (A) or nonspecific IgG (C).
Arrowheads in panels B and D indicate cells injected with cyclin D2 and
cyclin E expression constructs, respectively. (E) Effect on DNA
synthesis (as determined by BrdU incorporation) in HDFs microinjected
with the control plasmid (RcCMV) or with a CMV construct expressing
cyclin B1, D1, D2, or E. Each microinjection experiment was performed
at least three times with approximately 100 cells injected in total for
each experiment. (F) Inhibition of entry into the S phase of the cell
cycle by transient transfection of expression constructs encoding p16,
cyclin D2, and anti-sense cyclin D2. Results are plotted relative to
RcCMV vector controls for cells positive for CD20 surface marker
staining. Bars represent the averages and standard deviations of three
independent transfections.
|
|
Each of the microinjection experiments was performed in three
independent trials, results of which are graphically presented
in Fig.
7E. Cyclin D2 expression blocked BrdU incorporation in
more than 90%
of the cells. Ectopic expression of cyclin D1 in
HDFs also efficiently
inhibited S-phase progression, in agreement
with previous reports
(
2,
49). Cyclins B and E appeared to
have minimal effects on
BrdU incorporation, although cyclin E
injection resulted in a slight
increase in cells entering S phase,
consistent with this cyclin playing
a positive role in cell cycle
regulation (
48,
53). Injection
of the control vector itself
inhibited the ability of cells to
incorporate BrdU somewhat, but
this effect was not seen when injecting
vector at concentrations
lower than 0.02 µg/µl.
To further confirm our results obtained from microinjection
experiments, transient transfections of Hs68 HDFs were performed
with
expression vectors encoding cyclin D2, antisense-cyclin D2,
and
p16
INK4. The combined FACS analysis results from
three independent experiments
(Fig.
7F) show that ectopic expression of
cyclin D2 decreased
the S-phase fraction by 45 to 50% compared to the
control plasmid.
Under the same conditions, a 55 to 70% decrease in
S-phase fraction
was seen for p16
INK4 expressed
from the same vector and a 10 to 20% increase in S-phase
fraction was
seen for antisense cyclin D2. Thus, in this normal
diploid primary cell
strain, cyclin D2 was approximately as effective
as p16 in blocking
cell growth. Taken together, these results
indicate that ectopic
overexpression of cyclin D2 in normal diploid
fibroblasts blocks
progression through G
1 and entry into S phase.
 |
DISCUSSION |
In this study, we present evidence that cyclin D2 may function as
a negative regulator of growth during the G0 and early
G1 phases of the fibroblast cell cycle. First, cyclin D2
mRNA and protein expression were upregulated in primary human diploid
and murine fibroblasts during growth arrest induced by contact
inhibition, serum starvation, and cellular senescence. Conversely,
cyclin D2 is downregulated in cells synchronously exiting
G0 as a result of release from contact inhibition or serum
stimulation. Second, cyclin D2 localizes to the nucleus in quiescent
cells, where it is believed to be active and is cleared from the
nucleus during the G1-S phase transition, consistent with
previous reports suggesting that subcellular relocalization may be a
prerequisite to permit cells to progress through S phase (4, 35,
36, 49). Third, an increased association of cyclin D2 with CDK2
is seen during contact inhibition, but the cyclin D2-CDK2 complex has
no histone H1 kinase activity. Fourth, overexpression of cyclin D2 in
human primary fibroblasts by needle microinjection or transient
transfection of expression constructs strongly inhibits entry into S
phase and DNA synthesis. Thus, in addition to the previously proposed role in mediating transit through the restriction point via
phosphorylation of Rb family members, cyclin D2 may also function as a
negative regulator of growth by inducing exit from the cell cycle and
by helping to maintain cells in a nonproliferative state.
It has been suggested that D-type cyclins may be multifunctional growth
factor sensors, responsible for inactivating Rb in late G1,
thus providing G1 checkpoint function, and functioning as
S-phase regulators preventing unwarranted DNA replication and repair
synthesis by means of titrating essential replication factors such as
proliferating cell nuclear antigen (49). Presumably D-type
cyclins may have differing roles depending on their relative abundance
and the particular cell type. Indeed, the most extensively studied
D-type cyclin, cyclin D1, has been reported to accelerate transit
through G1 but inhibit S-phase traverse when moderately upregulated in some cell types (52, 53), while ectopic
overexpression of cyclin D1 in normal HDFs, mammary cell lines, Dami
megakaryocytic cells, and rat embryo fibroblasts inhibits DNA synthesis
and cell growth (2, 18, 19, 28, 49, 70). In this and other studies, overexpression of other classes of cyclins generally has
growth-promoting effects, underscoring fundamental differences in their
roles within the cell. Subsets of D-type cyclins are also upregulated
in irreversibly growth-arrested cells such as during replicative
senescence (2, 10, 34, 72), terminal differentiation
(6, 23, 29, 65, 70, 77), and apoptosis (14),
lending further weight to the idea that they provide growth-suppressive functions.
Additional links between D-type cyclins and growth suppression are
provided by correlations to tumor suppressor activity. Expression of
the p53 tumor suppressor gene causes cell cycle arrest in
G1 (32), in part due to the transcriptional
upregulation of p21WAF/CIP/SDI by p53
(11). p21WAF/CIP/SDI, in turn,
inhibits CDK activity and prevents the phosphorylation and inactivation
of Rb that normally occurs in late G1 (67). In
murine cells, in addition to p21WAF/CIP/SDI,
cyclin D1 expression is also upregulated by the inducible expression of
p53, using temperature-sensitive mutants or a steroid hormone-inducible system (7, 8, 60), and by ectopic expression of Rb
(45). Changes in the expression patterns of a number of cell
cycle-regulatory genes during replicative senescence, some of which are
thought to contribute to the senescent phenotype, have been described (42, 69). For example,
p21WAF/CIP/SDI, p16INK4,
and p33ING1 are cell cycle inhibitors that are
upregulated during replicative senescence and may have roles in
maintaining or inducing cell cycle arrest associated with a senescence
or cellular aging program (2, 16, 21, 47, 72).
Interestingly, we and others have found that the activity of p53
increases in senescent fibroblasts (3, 66), perhaps
providing a molecular mechanism for the upregulation of D-type cyclins
during cellular aging. Since senescent cells possess constitutively
activated hypophosphorylated Rb (61), the high levels of
D-type cyclins seen during cellular senescence may be the result of the
combined activities of both p53 and Rb tumor suppressors in a
growth-inhibitory feedback loop.
In spite of their many similarities, D-type cyclins exhibit a number of
distinctive properties as well. For example, the three cyclin D genes
are more highly conserved between species than they are to each other
(25), are differentially expressed in various cell lineages
(5, 35, 37, 41, 50), exhibit distinctive induction kinetics
(1, 4, 35, 36), and behave differently with respect to their
interaction with, and phosphorylation of, Rb (9, 12, 27).
These observations suggest that their functions are not fully
redundant. Indeed, although we have observed upregulation of cyclin D2
during quiescence in several independent primary fibroblast strains and
in murine cell lines under conditions of serum starvation, cyclins D1
and D3 were not similarly upregulated. However, all three of the D-type
cyclins were found to be upregulated during cellular senescence
(references 2 and 10 and data not
shown), indicating that growth arrest mediated by quiescence and
senescence have overlapping but distinct gene expression patterns. Cyclin D2 expression has also been shown to increase during in vitro
differentiation of P19 embryonal carcinoma cells, with a concomitant
increase in hypophosphorylated Rb (31). Similarly, differentiation of myoblasts into myotubes resulted in increased expression of cyclins D2 and D3 (29). It is also important
to note that MN20, whose expression is restricted to postmitotic neurons in the brain, shows significant homology to cyclin D2 and is
believed to function in the neuronal differentiation pathway (54). In addition, of the three D-type cyclins, expression
of cyclin D2 appears to be least frequently detected in assays of a
large array of cells grown in culture (5, 41, 63). For example, we find that normal HDFs express much lower levels of cyclin
D2 mRNA than NIH 3T3 fibroblasts or primary T cells (data not shown).
However, as shown in Fig. 1 and 3, the patterns of cyclin D2 expression
are essentially identical between HDFs and NIH 3T3 cells in response to
different stimuli, suggesting similar functions in these different cell
types, although in the highly transforming growth factor
(TGF-
)-sensitive established Mv1Lu line, both TGF-
and contact
inhibition were reported to inhibit cyclin D2 expression
(73). Finally, in contrast to cultured cells, our
preliminary results indicate that high levels of cyclin D2 are
expressed in a variety of normal human tissues, including brain,
breast, and lymphoid tissues (data not shown). The fact that these
tissues are composed primarily of nonproliferating contact-inhibited
cells is consistent with the upregulation of cyclin D2 seen in growth
arrested cells grown in vitro.
The mechanism for the upregulation of cyclin D2 during growth arrest is
presently unclear. It is possible that the increase in cyclin D2 mRNA
is transcriptionally and/or posttranscriptionally regulated. Our
preliminary results of assays using the transcriptional inhibitor
actinomycin D suggest that the D-type cyclin transcripts are relatively
stable over extended (6- to 12-h) time courses in young versus
senescent and in growing versus contact-inhibited cells. Thus, a
transcriptional mechanism for the upregulation of cyclins D1 and D2
during growth arrest appears a likely possibility.
The results presented here clearly illustrate that cyclin D2 expression
is upregulated in quiescent cells. Our data further suggest that cyclin
D2 sequesters CDK2 in a catalytically inactive complex, perhaps
preventing it from being activated by other cyclins such as cyclin E,
which is expressed at levels which are similar in quiescent and growing
cells. This could serve a function in maintaining cells in a quiescent
state, consistent with the observed effects of overexpressing cyclin
D2. However, the major binding partner of cyclin D2 in quiescent cells
appears to be CDK4, although we have been unable to detect kinase
activity in this complex that is beyond background levels in assays
using a number of substrates, including Rb. Nevertheless, given the
close functional relationship between the D-type cyclins and the Rb
family of pocket proteins (72), it is possible that an
Rb-related protein can act as a target for cyclin D2 kinase activity.
One such candidate may be the Rb-related protein p130, which is
upregulated in G0 and exists in complexes containing E2F-4
and E2F-5 transcription factors (8, 25, 70). Indeed, both
p130 and E2F-4 are known to be differentially phosphorylated during
early and late phases of the cycle (43, 70), and p130 exists
in distinct forms during the early portion of the cell cycle. These
early G1 forms accumulate in cells made quiescent by serum
starvation, contact inhibition, and treatment of cells with TGF-
(40), suggesting that a kinase that recognizes p130 is
activated during the transition from G1 to G0.
Hence, given the correlation between the expression pattern of cyclin
D2 and the G0 forms of p130, it is reasonable to speculate that a cyclin D2 kinase activity may target p130 or a p130 complex containing E2F proteins. Whether quiescent cells possess such a cyclin
D2 kinase activity specific for the p130 complex is currently being
tested.
 |
ACKNOWLEDGMENTS |
We thank R. Johnston and Y. Xiong for helpful discussions, L. Robertson for FACS analysis, and C. Veillette for expert technical assistance.
This work was supported by grants to K.R. from the Canadian Breast
Cancer Foundation and the National Cancer Institute of Canada. M.M. and
C.H. are recipients of the Alberta Heritage Foundation for Medical
Research (AHFMR) studentship awards, and K.R. is an AHFMR Senior
Scholar.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Biochemistry, University of Calgary Health Sciences Center,
3330 Hospital Dr. NW, Calgary, Alberta, Canada T2N 4N1. Phone: (403) 220-8695. Fax: (403) 270-0834. E-mail:
kriabowo{at}acs.ucalgary.ca.
 |
REFERENCES |
| 1.
|
Ajchenbaum, F.,
K. Ando,
J. A. DeCaprio, and J. D. Griffin.
1993.
Independent regulation of human D-type cyclin gene expression during G1 phase in primary human T lymphocytes.
J. Biol. Chem.
268:4113-4119[Abstract/Free Full Text].
|
| 2.
|
Atadja, P.,
H. Wong,
C. Veillette, and K. Riabowol.
1995.
Overexpression of cyclin D1 blocks proliferation of normal diploid fibroblasts.
Exp. Cell Res.
217:205-216[Medline].
|
| 3.
|
Atadja, P.,
H. Wong,
I. Garkavtev,
C. Veillette, and K. Riabowol.
1995.
Increased activity of p53 in senescing fibroblasts.
Proc. Natl. Acad. Sci. USA
92:8348-8352[Abstract/Free Full Text].
|
| 4.
|
Baldin, V.,
J. Lukas,
M. J. Marcote,
M. Pagano, and G. Draetta.
1993.
Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
7:812-821[Abstract/Free Full Text].
|
| 5.
|
Buckley, M. F.,
K. J. E. Sweeney,
J. A. Hamilton,
R. L. Sini,
D. L. Manning,
R. I. Nicholson,
A. deFazio,
C. W. K. Watts,
E. A. Musgrove, and R. L. Sutherland.
1993.
Expression and amplification of cyclin genes in human breast cancer.
Oncogene
8:2127-2133[Medline].
|
| 6.
|
Burger, C.,
M. Wick, and R. Muller.
1994.
Lineage-specific regulation of cell cycle gene expression in differentiating myeloid cells.
J. Cell Sci.
107:2047-2054[Abstract].
|
| 7.
|
Chen, X.,
J. Bargonetti, and C. Prives.
1995.
p53, through p21 (WAF1/CIP1), induces cyclin D1 synthesis.
Cancer Res.
55:4257-4263[Abstract/Free Full Text].
|
| 8.
|
Del Sal, G.,
M. Murphy,
E. M. Ruaro,
D. Lararevic,
A. J. Levine, and C. Schneider.
1996.
Cyclin D1 and p21/waf1 are both involved in p53 growth suppression.
Oncogene
12:177-185[Medline].
|
| 9.
|
Dowdy, S. F.,
P. W. Hinds,
K. Louie,
S. I. Reed,
A. Arnold, and R. A. Weinberg.
1993.
Physical interaction of the retinoblastoma protein with human D cyclins.
Cell
73:499-511[Medline].
|
| 10.
|
Dulic, V.,
L. F. Drullinger,
E. Lees,
S. I. Reed, and G. H. Stein.
1993.
Altered regulation of G1 cyclins in senescent human diploid fibroblasts: accumulation of inactive E-Cdk2 and cyclin D1-Cdk2 complexes.
Proc. Natl. Acad. Sci. USA
90:11034-11038[Abstract/Free Full Text].
|
| 11.
|
El-Deiry, W. S.,
T. Tokino,
V. E. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[Medline].
|
| 12.
|
Ewen, M.,
H. K. Sluss,
C. J. Sherr,
H. Matsushime,
J.-Y. Kato, and D. M. Livingston.
1993.
Functional interactions of the retinoblastoma protein with mammalian D-type cyclins.
Cell
73:487-497[Medline].
|
| 13.
|
Fantl, V.,
G. Stamp,
A. Andrews,
I. Rosewell, and C. Dickson.
1995.
Mice lacking cyclin D1 are small and show defects in eye and mammary gland development.
Genes Dev.
9:2364-2372[Abstract/Free Full Text].
|
| 14.
|
Freeman, R. S.,
S. Estus, and E. M. Johnson.
1994.
Analysis of cell cycle-regulated gene expression in post mitotic neurons: selective induction of cyclin D1 during programmed cell death.
Neuron
12:343-355[Medline].
|
| 15.
|
Gao, C. Y., and P. S. Zelenka.
1997.
Cyclins, cyclin-dependent kinases and differentiation.
Bioessays
19:307-315[Medline].
|
| 16.
|
Garkavtsev, I., and K. Riabowol.
1997.
Extension of the replicative lifespan of human diploid fibroblasts by inhibition of the p33ING1 candidate tumor suppressor.
Mol. Cell. Biol.
17:2014-2019[Abstract].
|
| 17.
|
Goldstein, S.
1990.
Replicative senescence: the human fibroblast comes of age.
Science
249:1129-1133[Abstract/Free Full Text].
|
| 18.
|
Han, E. K.-H.,
A. Sgambato,
W. Jiang,
Y.-J. Zhang,
R. M. Santella,
Y. Doki,
A. M. Cacace,
I. Schieren, and I. B. Weinstein.
1995.
Stable overexpression of cyclin D1 in a human mammary epithelial cell line prolongs the S-phase and inhibits growth.
Oncogene
10:953-961[Medline].
|
| 19.
|
Han, E. K.-H.,
M. Begemann,
A. Sgambato,
J.-W. Soh,
Y. Doki,
W.-Q. Xing,
W. Liu, and I. B. Weinstein.
1996.
Increased expression of cyclin D1 in murine mammary epithelial cell line induces p27kip1, inhibits growth, and enhances apoptosis.
Cell Growth Differ.
7:699-710[Abstract].
|
| 20.
|
Hanna, Z.,
M. Jankowski,
P. Tremblay,
J. Xiaoyan,
A. Milatovich,
U. Francke, and P. Jolicoeur.
1993.
The vin-1 gene, identified by proviral insertional mutagenesis, corresponds to the G1-phase cyclin D2.
Oncogene
8:1661-1667[Medline].
|
| 21.
|
Hara, E.,
R. Smith,
D. Parry,
H. Tahara,
S. Stone, and G. Peters.
1996.
Regulation of p16CDKN2 expression and its implications for cell immortalization and senescence.
Mol. Cell. Biol.
16:859-867[Abstract].
|
| 22.
|
Hayflick, L.
1965.
The limited in vitro lifetime of human diploid fibroblasts.
Exp. Cell Res.
37:614-636[Medline].
|
| 23.
|
Horiguchi-Yamada, J.,
H. Yamada,
S. Nakada,
K. Ochi, and T. Nemoto.
1994.
Changes of G1 cyclins, cdk2, and cyclin A during differentiation of HL60 cells induced by TPA.
Mol. Cell. Biochem.
132:31-37[Medline].
|
| 24.
|
Houldsworth, J.,
V. Reuter,
G. J. Bosl, and R. S. Chaganti.
1997.
Aberrant expression of cyclin D2 is an early event in human male germ cell tumorigenesis.
Cell Growth Differ.
8:293-299[Abstract].
|
| 25.
|
Inaba, T.,
H. Matsushime,
M. Valentine,
M. Roussel,
C. J. Sherr, and A. T. Look.
1992.
Genomic organization, and independent expression of human cyclin D genes.
Genomics
13:565-574[Medline].
|
| 26.
|
Jiang, Z.,
E. Zacksenhaus,
B. L. Gallie, and R. A. Phillips.
1997.
The retinoblastoma gene family is differentially expressed during embryogenesis.
Oncogene
14:1789-1797[Medline].
|
| 27.
|
Kato, J.-Y.,
H. Matsushime,
S. W. Hiebert,
M. E. Ewen, and C. J. Sherr.
1993.
Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4.
Genes Dev.
7:331-342[Free Full Text].
|
| 28.
|
Kerkhoff, E., and E. B. Ziff.
1995.
Cyclin D2 and Ha-ras transformed rat embryo fibroblasts exhibit a novel deregulation of cell size control and early S phase arrest in low serum.
EMBO J.
14:1892-1903[Medline].
|
| 29.
|
Kiess, M.,
R. M. Gill, and P. A. Hamel.
1995.
Expression of the positive regulator of cell cycle progression, cyclin D3, is induced during differentiation of myoblasts into quiescent myotubes.
Oncogene
10:159-166[Medline].
|
| 30.
|
Kiyokawa, H.,
X. Busquets,
C. T. Powell,
L. Ngo,
R. A. Rifkind, and P. A. Marks.
1992.
Cloning of a D-type cyclin from murine erythroleukemia cells.
Proc. Natl. Acad. Sci. USA
89:2444-2447[Abstract/Free Full Text].
|
| 31.
|
Kranenburg, O.,
R. P. De Groot,
A. J. van der Eb, and A. Zantema.
1995.
Differentiation of P19 EC cells leads to differential modulation of cyclin-dependent kinase activities and to changes in the cell cycle profile.
Oncogene
10:87-95[Medline].
|
| 32.
|
Levine, A. J.
1993.
The tumor suppressor genes.
Annu. Rev. Biochem.
62:623-651[Medline].
|
| 33.
|
Lew, D. J.,
V. Dulic, and S. I. Reed.
1991.
Isolation of three novel human cyclins by rescue of G1 cyclin (Cln) function in yeast.
Cell
66:1197-1206[Medline].
|
| 34.
|
Lucibello, F. C.,
A. Sewing,
S. Brusselbach,
C. Burger, and R. Muller.
1993.
Deregulation of cyclins D1 and E and suppression of cdk2 and cdk4 in senescent human fibroblasts.
J. Cell Sci.
105:123-133[Abstract].
|
| 35.
|
Lukas, J.,
M. Pagano,
Z. Staskova,
G. Draetta, and J. Bartek.
1994.
Cyclin D1 protein oscillates and is essential for cell cycle progression in human tumor cell lines.
Oncogene
9:707-718[Medline].
|
| 36.
|
Lukas, J.,
J. Bartkova,
M. Welcker,
O. W. Peterson,
G. Peters,
M. Strauss, and J. Bartek.
1995.
Cyclin D2 is a moderately oscillating nucleoprotein required for G1 phase progression in specific cell types.
Oncogene
10:2115-2134.
|
| 37.
|
Matsushime, H.,
M. Roussel,
R. A. Ashmun, and C. J. Sherr.
1991.
Colony-stimulating factor regulates novel cyclins during the G1 phase of the cell cycle.
Cell
65:701-713[Medline].
|
| 38.
|
Matsushime, H.,
M. E. Ewen,
D. K. Strom,
J.-Y. Kato,
S. K. Hanks,
M. Roussel, and C. J. Sherr.
1992.
Identification and properties of an atypical catalytic subunit (p34PSK-J3/cdk4) for mammalian D type G1 cyclins.
Cell
71:323-334[Medline].
|
| 39.
|
Matsushime, H.,
D. E. Quelle,
S. A. Shurtleff,
M. Shibuya,
C. J. Sherr, and J.-Y. Kato.
1994.
D-type cyclin-dependent kinase activity in mammalian cells.
Mol. Cell. Biol.
14:2066-2076[Abstract/Free Full Text].
|
| 40.
|
Mayol, X.,
J. Garriga, and X. Grana.
1996.
G1 cyclin/CDK-independent phosphorylation and accumulation of p130 during the transition from G1 to G0 lead to its association with E2F-4.
Oncogene
13:237-246[Medline].
|
| 41.
|
Meyerson, M., and E. Harlow.
1994.
Identification of G1 kinase activity for cdk6, a novel cyclin D partner.
Mol. Cell. Biol.
14:2077-2086[Abstract/Free Full Text].
|
| 42.
|
Meyyappan, M.,
P. W. Atadja, and K. T. Riabowol.
1996.
Regulation of gene expression and transcription factor binding activity during cellular aging.
Biol. Signals
5:130-138[Medline].
|
| 43.
|
Motokura, T., and A. Arnold.
1993.
Cyclin D and oncogenesis.
Curr. Opin. Genet. Dev.
3:5-10[Medline].
|
| 44.
|
Motokura, T.,
K. Keyomarsi,
H. M. Kronenberg, and A. Arnold.
1992.
Cloning and characterization of human cyclin D3, a cDNA closely related in sequence to the PRAD1/cyclin D1 proto-oncogene.
J. Biol. Chem.
267:20412-20415[Abstract/Free Full Text].
|
| 45.
|
Muller, H.,
J. Lukas,
A. Schneider,
P. Warthoe,
J. Bartek,
M. Eilers, and M. Strauss.
1994.
Cyclin D1 expression is regulated by the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
91:2945-2949[Abstract/Free Full Text].
|
| 46.
|
Neuman, E.,
M. H. Ladha,
N. Lin,
T. M. Upton,
S. J. Miller,
J. DiRenzo,
R. G. Pestell,
P. W. Hinds,
S. F. Dowdy,
M. Brown, and M. E. Ewen.
1997.
Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4.
Mol. Cell. Biol.
17:5338-5347[Abstract].
|
| 47.
|
Noda, A.,
Y. Ning,
S. F. Venable,
O. M. Pereira-Smith, and J. R. Smith.
1994.
Cloning of senescent cell-derived inhibitors of DNA synthesis using an expression screen.
Exp. Cell Res.
211:90-98[Medline].
|
| 48.
|
Ohtsubo, M., and J. M. Roberts.
1993.
Cyclin-dependent regulation of G1 in mammalian fibroblasts.
Science
259:1908-1911[Abstract/Free Full Text].
|
| 49.
|
Pagano, M.,
A. M. Theodoras,
S. W. Tam, and G. F. Draetta.
1994.
Cyclin D1-mediated inhibition of repair and replicative DNA synthesis in human fibroblasts.
Genes Dev.
8:1627-1639[Abstract/Free Full Text].
|
| 50.
|
Palmero, I.,
A. Holder,
A. J. Sinclair,
C. Dickson, and G. Peters.
1993.
Cyclins D1 and D2 are differentially expressed in human B-lymphoid cell lines.
Oncogene
8:1049-1054[Medline].
|
| 51.
|
Pardee, A. B.
1989.
G1 events and regulation of cell proliferation.
Science
246:603-608[Abstract/Free Full Text].
|
| 52.
|
Quelle, D. E.,
R. A. Ashmun,
S. A. Shurtleff,
J.-Y. Kato,
D. Bar-Sagi,
M. F. Roussel, and C. J. Sherr.
1993.
Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts.
Genes Dev.
7:1559-1571[Abstract/Free Full Text].
|
| 53.
|
Resnitzky, D.,
M. Gossen,
H. Bujard, and S. I. Reed.
1994.
Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol.
14:1669-1679[Abstract/Free Full Text].
|
| 54.
|
Ross, M. E., and M. Risken.
1994.
MN20, a D2 cyclin found in brain, is implicated in neural differentiation.
J. Neurosci.
14:6394-6391.
|
| 55.
|
Ross, M. E.,
M. L. Carter, and J. H. Lee.
1996.
MN20, a D2 cyclin, is transiently expressed in selected neural populations during embryogenesis.
J. Neurosci.
16:210-219[Abstract/Free Full Text].
|
| 56.
|
Sherr, C. J.
1993.
Mammalian G1 cyclins.
Cell
73:1059-1065[Medline].
|
| 57.
|
Sherr, C. J.
1994.
G1 phase progression: cycling on cue.
Cell
79:551-555[Medline].
|
| 58.
|
Sicinski, P.,
J. L. Donaher,
S. B. Parker,
T. Li,
A. Fazeli,
H. Gardner,
S. Z. Haslam,
R. T. Bronson,
S. J. Elledge, and R. A. Weinberg.
1995.
Cyclin D1 provides a link between development and oncogenesis in the retina and breast.
Cell
82:621-630[Medline].
|
| 59.
|
Sicinski, P.,
J. L. Donaher,
Y. Geng,
S. B. Parker,
H. Gardner,
M. Y. Park,
R. L. Robker,
J. S. Richards,
L. K. McGinnis,
J. D. Biggers,
J. J. Eppig,
R. T. Bronson,
S. J. Elledge, and R. A. Weinberg.
1996.
Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis.
Nature
384:470-474[Medline].
|
| 60.
|
Spikovsky, D.,
P. Steiner,
R. V. Gopalkrishnan,
M. Eilers, and P. Jansen-Durr.
1995.
The role of p53 in coordinated regulation of cyclin D1 and p21 gene expression by the adenovirus E1A and E1B oncogenes.
Oncogene
10:2421-2425[Medline].
|
| 61.
|
Stein, G. H.,
M. Beeson, and L. Gordon.
1990.
Failure to phosphorylate the retinoblastoma gene product in senescent human fibroblasts.
Science
249:666-669[Abstract/Free Full Text].
|
| 62.
|
Sweeney, K. J.,
B. Sarcevic,
R. L. Sutherland, and E. A. Musgrove.
1997.
Cyclin D2 activates cdk2 in preference to cdk4 in human breast epithelial cells.
Oncogene
14:1329-1340[Medline].
|
| 63.
|
Tam, S. W.,
A. M. Theodoras,
J. W. Shay,
G. F. Draetta, and M. Pagano.
1994.
Differential expression and regulation of cyclin D1 protein in normal and tumor human cells: association with Cdk4 is required for cyclin D1 function in G1 progression.
Oncogene
9:2663-2674[Medline].
|
| 64.
|
Tsai, L. H.,
E. Lees,
B. Faha,
E. Harlow, and K. Riabowol.
1993.
The cdk2 kinase is required for the G1-to-S transition in mammalian cells.
Oncogene
8:1593-1602[Medline].
|
| 65.
|
Van Grunsven, L. A.,
A. Thomas,
J. L. Urdiales,
S. Machenaud,
P. Choler,
I. Durand, and B. B. Rudkin.
1996.
Nerve growth factor-induced accumulation of PC12 cells expressing cyclin D1: evidence for a G1 phase block.
Oncogene
12:855-862[Medline].
|
| 66.
|
Vaziri, H.,
M. D. West,
R. C. Allsopp,
T. S. Davison,
Y. S. Wu,
C. H. Arrowsmith,
G. S. Poirier, and S. Benchimol.
1997.
ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerase.
EMBO J.
16:6018-6033[Medline].
|
| 67.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[Medline].
|
| 68.
|
Weinberg, R. A.
1996.
E2F and cell proliferation: a world turned upside down.
Cell
85:457-459[Medline].
|
| 69.
|
Wheaton, K.,
P. Atadja, and K. Riabowol.
1996.
Regulation of transcription factor activity during cellular aging.
Biochem. Cell Biol.
74:523-534[Medline].
|
| 70.
|
Wilhide, C. C.,
C. V. Dang,
J. Dipersio,
A. A. Kenedy, and P. F. Bray.
1995.
Overexpression of cyclin D1 in the Dami Megakaryocytic cell line causes growth arrest.
Blood
86:294-304[Abstract/Free Full Text].
|
| 71.
|
Wong, H.,
W. D. Anderson,
T. Cheng, and K. T. Riabowol.
1994.
Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method.
Anal. Biochem.
223:251-258[Medline].
|
| 72.
|
Wong, H., and K. T. Riabowol.
1996.
Differential CDK-inhibitor gene expression in aging human diploid fibroblasts.
Exp. Gerontol.
31:311-325[Medline].
|
| 73.
|
Wu, F.,
S. Buckley,
K. C. Bui,
A. Yee,
H. Y. Wu,
J. Liu, and D. Warburton.
1996.
Cell cycle arrest in G0/G1 phase by contact inhibition and TGF- 1 in mink Mv1Lu lung epithelial cells.
Am. J. Physiol.
270:L879-L888[Abstract/Free Full Text].
|
| 74.
|
Xiong, Y.,
T. Connolly,
B. Futcher, and D. Beach.
1991.
Human D-type cyclin.
Cell
65:691-699[Medline].
|
| 75.
|
Xiong, Y.,
J. Menninger,
D. Beach, and D. C. Ward.
1992.
Molecular cloning and chromosomal mapping of CCND genes encoding human D-type cyclins.
Genomics
13:575-584[Medline].
|
| 76.
|
Xiong, Y.,
H. Zhang, and D. Beach.
1992.
D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA.
Cell
71:505-514[Medline].
|
| 77.
|
Yan, G.-Z., and E. B. Ziff.
1995.
NGF regulates the PC12 cell cycle machinery through specific inhibition of the Cdk kinases and induction of cyclin D1.
J. Neurosci.
15:6200-6212[Abstract].
|
| 78.
|
Zwijsen, R. M. L.,
E. Wientjens,
R. Klompmaker,
J. van der Sman,
R. Bernards, and R. J. A. M. Michalides.
1997.
CDK-independent activation of estrogen receptor by cyclin D1.
Cell
88:405-415[Medline].
|
Mol Cell Biol, June 1998, p. 3163-3172, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Susaki, E., Nakayama, K., Nakayama, K. I.
(2007). Cyclin D2 Translocates p27 out of the Nucleus and Promotes Its Degradation at the G0-G1 Transition. Mol. Cell. Biol.
27: 4626-4640
[Abstract]
[Full Text]
-
Sen, C. K., Khanna, S., Roy, S.
(2006). Perceived hyperoxia: Oxygen-induced remodeling of the reoxygenated heart. Cardiovasc Res
71: 280-288
[Abstract]
[Full Text]
-
El Wakil, A., Francius, C., Wolff, A., Pleau-Varet, J., Nardelli, J.
(2006). The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors. Development
133: 2155-2165
[Abstract]
[Full Text]
-
Tan, K.A.L., Turner, K.J., Saunders, P.T.K., Verhoeven, G., De Gendt, K., Atanassova, N., Sharpe, R.M.
(2005). Androgen Regulation of Stage-Dependent Cyclin D2 Expression in Sertoli Cells Suggests a Role in Modulating Androgen Action on Spermatogenesis. Biol. Reprod.
72: 1151-1160
[Abstract]
[Full Text]
-
Sherr, C. J., Roberts, J. M.
(2004). Living with or without cyclins and cyclin-dependent kinases. Genes Dev.
18: 2699-2711
[Abstract]
[Full Text]
-
Alaminos, M., Davalos, V., Cheung, N.-K. V., Gerald, W. L., Esteller, M.
(2004). Clustering of Gene Hypermethylation Associated With Clinical Risk Groups in Neuroblastoma. JNCI J Natl Cancer Inst
96: 1208-1219
[Abstract]
[Full Text]
-
Harada, H., Nakagawa, H., Oyama, K., Takaoka, M., Andl, C. D., Jacobmeier, B., von Werder, A., Enders, G. H., Opitz, O. G., Rustgi, A. K.
(2003). Telomerase Induces Immortalization of Human Esophageal Keratinocytes Without p16INK4a Inactivation. Mol Cancer Res
1: 729-738
[Abstract]
[Full Text]
-
Grumolato, L., Elkahloun, A. G., Ghzili, H., Alexandre, D., Coulouarn, C., Yon, L., Salier, J.-P., Eiden, L. E., Fournier, A., Vaudry, H., Anouar, Y.
(2003). Microarray and Suppression Subtractive Hybridization Analyses of Gene Expression in Pheochromocytoma Cells Reveal Pleiotropic Effects of Pituitary Adenylate Cyclase-Activating Polypeptide on Cell Proliferation, Survival, and Adhesion. Endocrinology
144: 2368-2379
[Abstract]
[Full Text]
-
Matsubayashi, H., Sato, N., Fukushima, N., Yeo, C. J., Walter, K. M., Brune, K., Sahin, F., Hruban, R. H., Goggins, M.
(2003). Methylation of Cyclin D2 Is Observed Frequently in Pancreatic Cancer but Is Also an Age-related Phenomenon in Gastrointestinal Tissues. Clin. Cancer Res.
9: 1446-1452
[Abstract]
[Full Text]
-
Berardi, P., Meyyappan, M., Riabowol, K. T.
(2003). A Novel Transcriptional Inhibitory Element Differentially Regulates the Cyclin D1 Gene in Senescent Cells. J. Biol. Chem.
278: 7510-7519
[Abstract]
[Full Text]
-
Roy, S., Khanna, S., Bickerstaff, A. A., Subramanian, S. V., Atalay, M., Bierl, M., Pendyala, S., Levy, D., Sharma, N., Venojarvi, M., Strauch, A., Orosz, C. G., Sen, C. K.
(2003). Oxygen Sensing by Primary Cardiac Fibroblasts: A Key Role of p21Waf1/Cip1/Sdi1. Circ. Res.
92: 264-271
[Abstract]
[Full Text]
-
Lehmann, U., Langer, F., Feist, H., Glockner, S., Hasemeier, B., Kreipe, H.
(2002). Quantitative Assessment of Promoter Hypermethylation during Breast Cancer Development. Am. J. Pathol.
160: 605-612
[Abstract]
[Full Text]
-
Chaffin, C. L., Schwinof, K. M., Stouffer, R. L.
(2001). Gonadotropin and Steroid Control of Granulosa Cell Proliferation During the Periovulatory Interval in Rhesus Monkeys. Biol. Reprod.
65: 755-762
[Abstract]
[Full Text]
-
Said, T. K., Moraes, R. C. B., Singh, U., Kittrell, F. S., Medina, D.
(2001). Cyclin-dependent Kinase (cdk) Inhibitors/cdk4/cdk2 Complexes in Early Stages of Mouse Mammary Preneoplasia. Cell Growth Differ.
12: 285-295
[Abstract]
[Full Text]
-
Evron, E., Umbricht, C. B., Korz, D., Raman, V., Loeb, D. M., Niranjan, B., Buluwela, L., Weitzman, S. A., Marks, J., Sukumar, S.
(2001). Loss of Cyclin D2 Expression in the Majority of Breast Cancers Is Associated with Promoter Hypermethylation. Cancer Res.
61: 2782-2787
[Abstract]
[Full Text]
-
Jackson, S. K., DeLoose, A., Gilbert, K. M.
(2001). Induction of Anergy in Th1 Cells Associated with Increased Levels of Cyclin-Dependent Kinase Inhibitors p21Cip1 and p27Kip1 1. J. Immunol.
166: 952-958
[Abstract]
[Full Text]
-
Dulic, V., Beney, G.-E., Frebourg, G., Drullinger, L. F., Stein, G. H.
(2000). Uncoupling between Phenotypic Senescence and Cell Cycle Arrest in Aging p21-Deficient Fibroblasts. Mol. Cell. Biol.
20: 6741-6754
[Abstract]
[Full Text]
-
Ravanko, K., Järvinen, K., Paasinen-Sohns, A., Hölttä, E.
(2000). Loss of p27Kip1 from Cyclin E/Cyclin-dependent Kinase (CDK) 2 but not from Cyclin D1/CDK4 Complexes in Cells Transformed by Polyamine Biosynthetic Enzymes. Cancer Res.
60: 5244-5253
[Abstract]
[Full Text]
-
Solvason, N., Wu, W. W., Parry, D., Mahony, D., Lam, E. W.-F., Glassford, J., Klaus, G. G. B., Sicinski, P., Weinberg, R., Liu, Y. J., Howard, M., Lees, E.
(2000). Cyclin D2 is essential for BCR-mediated proliferation and CD5 B cell development. Int Immunol
12: 631-638
[Abstract]
[Full Text]
-
Chen, D., Heath, V., O'Garra, A., Johnston, J., McMahon, M.
(1999). Sustained Activation of the Raf-MEK-ERK Pathway Elicits Cytokine Unresponsiveness in T Cells. J. Immunol.
163: 5796-5805
[Abstract]
[Full Text]
-
Carlson, B., Lahusen, T., Singh, S., Loaiza-Perez, A., Worland, P. J., Pestell, R., Albanese, C., Sausville, E. A., Senderowicz, A. M.
(1999). Down-Regulation of Cyclin D1 by Transcriptional Repression in MCF-7 Human Breast Carcinoma Cells Induced by Flavopiridol. Cancer Res.
59: 4634-4641
[Abstract]
[Full Text]
-
Tanguay, D. A., Colarusso, T. P., Pavlovic, S., Irigoyen, M., Howard, R. G., Bartek, J., Chiles, T. C., Rothstein, T. L.
(1999). Early Induction of Cyclin D2 Expression in Phorbol Ester-responsive B-1 Lymphocytes. JEM
189: 1685-1690
[Abstract]
[Full Text]
-
Rots, N. Y., Iavarone, A., Bromleigh, V., Freedman, L. P.
(1999). Induced Differentiation of U937 Cells by 1,25-dihydroxyvitamin D3 Involves Cell Cycle Arrest in G1 That Is Preceded by a Transient Proliferative Burst and an Increase in Cyclin Expression. Blood
93: 2721-2729
[Abstract]
[Full Text]