INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

In eucaryotic cells, the transcription of a variety of small genes is conducted by RNA polymerase III (PolIII) and requires several auxiliary factors. For yeast tRNA gene (tDNA) activation, preinitiation complexes are assembled in a defined order within and upstream of the transcription unit (18, 27, 52). Transcription factor IIIC (TFIIIC) plays a primary role in this multistep complex assembly by binding to the intragenic promoter elements of tRNA genes (the A and B blocks). Yeast TFIIIC is a remarkably large multisubunit factor made of two protein subassemblies, named A and B, that have distinct DNA binding properties, that can be visualized by electron microscopy in a free or DNA-bound form (46), and that can be cleaved by limited proteolysis (37). The B domain binds tightly to the B block (37) and has been shown to display all the properties of enhancer binding proteins (11). Binding of the A domain to the A block is weaker and mostly B block dependent. Once bound, TFIIIC promotes the binding of transcription factor IIIB (TFIIIB) upstream of the transcription start site (6, 26, 28, 31). The process is similar for yeast 5S RNA gene activation, except that TFIIIC assembly is dependent upon the binding of transcription factor IIIA (TFIIIA) to the internal promoter sequence. TFIIIB by itself does not bind detectably to TATA-less PolIII genes but, once assembled via TFIIIC, interacts intimately with DNA and is sufficient, at least in the yeast system, for directing accurate initiation by PolIII during multiple rounds of transcription in vitro (28, 31). Hence, TFIIIB is the initiation factor required for the activation of all PolIII genes, whereas TFIIIC and TFIIIA act as assembly factors. However, it has been shown that TFIIIC is a multifunctional protein, involved not only in promoter recognition and TFIIIB recruitment but also in the displacement of nucleosomes to relieve the repression of transcription by chromatin (10).

The molecular structure of yeast TFIIIB and TFIIIC has been much investigated. Yeast TFIIIB comprises three components: TBP, the TATA box binding protein, which is also required for transcription by PolI and PolII, and two additional polypeptides, TFIIIB70/BRF1 and TFIIIB90/B", first identified by protein-DNA cross-linking (6). Together with TBP, TFIIIB70 is able to bind to TFIIIC-tDNA complexes (29). The resulting complex becomes competent to recruit PolIII after the assembly of TFIIIB90 (29, 30). Purified yeast TFIIIC comprises six polypeptides, of 138, 131, 95, 91, 60, and 55 kDa (5, 16, 43). Purification of TFIIIC to near homogeneity, protein-DNA cross-linking (5, 9, 16), and coimmunoprecipitation experiments (13, 44) suggested that the four largest polypeptides were subunits of TFIIIC, a suggestion which was confirmed by gene cloning (2, 34, 36, 44, 48). The 138- and 95-kDa components (138 and 95), located in B and A, respectively, are thought to be DNA binding subunits, since they could be specifically cross-linked to a tDNA probe and were mapped at the level of the B block and the A block, respectively (5, 9, 13, 16). 91 was recently shown to cooperate with 138 for TFIIIC-tDNA binding (2) and was mapped at the most 3' location of TFIIIC-5S RNA gene complexes (9). 131 stands as the TFIIIB-assembling subunit based on its upstream gene location, shown by protein-DNA cross-linking (5, 6), and its direct interaction with both TFIIIB70 and TFIIIB90 (12, 32, 45). On the other hand, little is known about the smallest polypeptides, of 60 and 55 kDa, which reproducibly copurify with yeast TFIIIC activity. Both proteins were found among the six polypeptides isolated from TFIIIC-tDNA complexes (16). A 55-kDa polypeptide was located by photo-cross-linking experiments together with 95, on opposite sides of the DNA helix, in the vicinity of the A block of tRNA genes (5, 6). The 60-kDa polypeptide was not cross-linked to DNA.

We report here the cloning and identification of TFC7, an essential gene encoding the 55-kDa subunit of TFIIIC. Analysis of deletion mutants showed that only the C-terminal half of 55 is necessary for TFIIIC transcriptional activity. We found that 55 interacts with 95 and that these two subunits are present in at least two distinct protein complexes.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Yeast strains and methods. YNN281 × YNN282 (22) was used for gene disruption. Preparation of media, tetrad dissection, and other yeast methods were performed by standard techniques (3). Plasmids harboring modified alleles of the TFC7 gene were used to transform the YNM2 haploid strain (ade2-101 lys2-801 ura3-52 trp1-1 his3-200 tfc7-::HIS3 pNM2). The modified copies of TFC7 were substituted for wild-type TFC7 by plasmid shuffling on plates containing 5-fluoro-orotic acid. Viable strains isolated at 30°C were also tested for growth at 37 and 16°C.

Purification and immunoprecipitation of TFIIIC. TFIIIC was purified starting from 30 g (wet weight) of Saccharomyces cerevisiae cells following the procedure described by Huet et al. (25). Immunoprecipitation was performed as described by Ossipow et al. (39). Cells expressing wild-type or epitope-tagged versions of 138, 131, or 95 (25, 34, 36) were harvested in the exponential phase, and crude extracts were prepared as described by Huet et al. (25), except that protease inhibitors (O-complete; Boehringer) and extraction buffer containing 20 mM HEPES (pH 7.5), 50 mM CH₃COOK, 1 mM EDTA, 1 mM dithiothreitol (DTT), and 10% glycerol were used. Proteins were precipitated with ammonium sulfate, resuspended in 5% of the original crude extract volume in dialysis buffer (25 mM HEPES [pH 7.5], 100 mM KCl, 0.1 mM EDTA, 0.25 mM DTT, 10% glycerol), and dialyzed twice for 2 h each time at 4°C against 250 volumes of the same buffer. Typically, 10 g (wet weight) of yeast cells yielded 2 ml of dialyzed extract containing 15 to 30 mg of protein/ml, as estimated by Bradford analysis (8). Per assay, 1.2 µg of mouse monoclonal antihemagglutinin (HA) antibodies (53) was incubated for 30 min at 10°C with 20 µl of magnetic beads (8 × 10⁸ beads/ml in phosphate-buffered saline containing 0.1% bovine serum albumin [BSA]) coated with rat monoclonal antibodies directed against mouse immunoglobulin G2b (Dynal M450). After extensive washing in phosphate-buffered saline containing 0.1% BSA and then in dialysis buffer, the beads were incubated with gentle shaking at 10°C with 50 µl of dialyzed extract. After 3 h of incubation, the beads were washed three times with 200 µl of washing buffer (25 mM HEPES [pH 7.5], 50 mM KCl, 0.1 mM EDTA, 10% glycerol, 0.1% Triton X-100). Proteins were eluted by incubation for 30 min at room temperature with 16 µl of washing buffer containing 2 mg of a synthetic peptide corresponding to the HA sequence per ml. Immunoprecipitated proteins were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blotting.

Amino acid sequence determination. TFIIIC was purified on a preparative scale following the immunopurification procedure described by Huet et al. (25). Affinity-purified fractions containing TFIIIC DNA binding activity were pooled (133 fractions, 66.5-ml final volume). Proteins were precipitated with cold trichloroacetic acid (10% final concentration) for 40 min in ice and centrifuged at 4°C for 4 h at 17,600 ×g. Pellets were washed with cold acetone, centrifuged (4°C, 20 min, 17,600 × g, and resuspended in 0.6 ml of SDS electrophoresis buffer (3). Proteins were separated by electrophoresis overnight through an 8% polyacrylamide-SDS gel and slightly stained with Coomassie blue. Polypeptides of 138, 131, 95, 91, 80, 75, 60, 55, and 50 kDa were revealed. Starting from 880 g (wet weight) of YCS7 cells expressing an HA-tagged version of 95 (25), about 200 to 250 pmol of TFIIIC was obtained. A gel slice containing the 95-kDa subunit was used for anti-95 production (see below). A gel slice containing the 55-kDa polypeptide was excised, crushed, and incubated with a protease as described previously (48), except that proteinase K was used instead of trypsin. The resulting peptides were separated by reversed-phase high-pressure liquid chromatography and sequenced. Seven peptide sequences (YDNPRM, EIPVY, TYIPF, ELAFPN, ERLVGT, FASPF, and SDRKWV) were determined.

Cloning and disruption of TFC7. Two degenerate oligonucleotides (Ol20 [5'CGGAATTCRTTNGGRAANGCNARYTC] and Ol8 [5'NNTAYGAYAAYCCNMGNATG]) designed from peptides ELAFPN and YDNPRM, respectively, were used to amplify a yeast genomic DNA fragment by "touchdown" PCR (14). A 509-bp DNA fragment was obtained, cloned into pBSKS (Stratagene), sequenced, and found to contain a continuous open reading frame (ORF) encoding the two initial peptides plus three others. The sequence of the entire TFC7 gene was found by searching the Munich Information Centre for Protein Sequences (MIPS) database (GenBank accession no. Z75018).

Construction of plasmids. The 2.6-kb EcoRI/KpnI DNA fragment from cosmid cospEOA273 containing the coding and flanking sequences of TFC7 was cloned into plasmid YEplac195 (19), creating pNM2. The sequence encoding a methionine residue followed by the YPYDVPDYA epitope (HA epitope) derived from the influenza virus HA protein (53) was added just before the initiation codon of TFC7 by PCR-mediated mutagenesis of plasmid pNM2. Two oligonucleotides, NM8 (5'-TCCTTTTCAATACATATGTATCCTTACGACGTTCCTGATTATGCCATGGTGGTGAACAC) and NM7 (5'-TCAGCGGGATCCTTACATAGGGCGGACATTGC), were used for mutagenesis. NM8 contains the epitope coding sequence (boldface letters) and nucleotides that are mostly complementary to TFC7 DNA and that create NdeI and NcoI restriction sites. NM7 is complementary to TFC7 and harbors a BamHI restriction site (boldfaced) just after the stop codon. The amplified DNA fragment was cloned into the pGEM-T vector (Promega), creating pNM8. The NdeI/BamHI or NcoI/BamHI fragments from pNM8 were cloned into pET28a (Novagen), pAS2, and pACT2 (21), creating pNM11, pAS-55, and pACT-55, respectively.

Expression of TFC7 in Escherichia coli. Recombinant TFC7 protein (rTFC7p) tagged at its N-terminal end with six histidines and with the HA epitope was expressed from plasmid pNM11 in E. coli BL21(pLysS). Crude extract preparation and protein purification on Ni²⁺-nitrilotriacetic acid (NTA)-agarose (Qiagen) under native conditions were performed as described by Chaussivert et al. (12).

Anti-55, -95, and -131 polyclonal antibodies. rTFC7p and recombinant 131TPR2 (12) were expressed as hexahistidine fusions, purified on Ni²⁺-NTA-agarose, and loaded on a preparative SDS-8% polyacrylamide gel. Gel slices containing the recombinant 55 or 131 derivatives or the 95-kDa subunit from the preparative SDS-polyacrylamide gel used for the 55 amino acid sequence determination (see above) were excised and injected into rabbits (three to six injections at 3-week intervals) for the production of antibodies. Preimmune antibodies or antibodies directed to TFIIIC subunits were purified on protein A-Sepharose as described previously (20), and the protein concentration was estimated by Bradford analysis (8).

Interaction of 55 with ³⁵S-labeled 95. Far-Western experiments were performed as described previously (24), except that rTFC7p was denatured-renatured on filters before incubation with the labeled probe. Plasmid pCS5, harboring the TFC1 gene encoding 95 (48), was linearized with StuI. The gene was transcribed in vitro with T7 RNA polymerase in wheat germ extracts (Promega) in the presence of [³⁵S]methionine. Recombinant 55 was subjected to SDS-PAGE, blotted onto nitrocellulose, and denatured-renatured according to the method of Papavassiliou and Bohmann (42). The filters were incubated with ³⁵S-labeled 95, washed, and autoradiographed. Recombinant 55 was located by use of anti-HA antibodies, and immune complexes were visualized with an ECL kit (Amersham).

Two-hybrid assays. The expression of GAL4(1-147)-55 and GAL4(768-881)-55 fusion proteins from plasmids pAS-55 and pACT-55, respectively, was verified by Western blot analysis of yeast crude extracts with polyclonal antibodies directed against GAL4. GAL1-LacZ activation assays were performed as described previously (12) after transformation of a yeast strain with combinations of plasmids. Transcriptional activation of the lacZ reporter gene was assayed by growing the transformed cells on selective medium and overlaying them with 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-Gal) agar. -Galactosidase activity in yeast extracts was measured exactly as described previously (51), at 30°C for at least three independent transformants. The interaction between TFIIIB70 and 131 (12) was used as a reference.

DNA binding and transcription assays. The transcription factor-tDNA interaction was monitored by a gel retardation assay essentially as described previously (35). TFIIIC was partially purified from wild-type or mutant crude extracts by chromatography on an Ultrogel-heparin A4R (Sepracor) column as described previously (25). Heparin-purified TFIIIC fractions (1 µl, 0.5 µg of protein) were incubated with a ³²P-labeled DNA probe (3 to 10 fmol; 3,000 to 10,000 cpm) in 15 µl of binding buffer containing 10 mM Tris-HCl (pH 8), 1 mM EDTA, 150 mM KCl, 10% glycerol, 50 µg of BSA, and 1 µg of competitor DNA. The probe was a 200-bp PCR-amplified fragment from plasmid pUC-Glu (17), carrying the yeast tRNA₃^Glu gene, or a 200-bp PCR-amplified fragment from plasmid pGE2 (4), harboring only the B block of the yeast tRNA₃^Leu gene. Complexes were analyzed by nondenaturing gel electrophoresis and revealed by autoradiography (25).

Nucleotide sequence accession number. The GenBank accession number for TFC7 is Z75018.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Isolation and disruption of the TFC7 gene. Yeast TFIIIC is a multisubunit protein that comprises six polypeptides, of 138, 131, 95, 91, 60, and 55 kDa. In order to clone the gene encoding the 55-kDa subunit, TFIIIC was purified on a preparative scale from crude extracts by an immunoaffinity and DNA affinity purification procedure (25). TFIIIC components were separated by preparative SDS-PAGE and stained with Coomassie blue. The TFIIIC fraction contained the six polypeptides consistently found in affinity-purified fractions plus three additional polypeptides, of 80, 75, and 50 kDa. The 75-kDa polypeptide, occasionally found in purified TFIIIC fractions, was recently shown to be immunologically related to the 91-kDa protein (2). The 80- and 50-kDa polypeptides were found to be contaminants that can be easily separated from TFIIIC with a linear gradient of ammonium sulfate instead of a salt elution step for the DNA affinity column. The fraction containing the 50- and 80-kDa polypeptides had RNase activity that we did not explore further.

View larger version (68K): [in this window] [in a new window]   FIG. 1.   Sequence analysis of TFC7. (A) Schematic representation of duplication block 50 as defined by Wolfe and Shields (54). The locations on chromosomes XIV and XV of the duplicated genes (TFC7 and HUF) are indicated by shading. (B) The regions of sequence similarities among TFC7p, HUFp, and Syn H are schematically represented. (C) Sequence similarities to TFC7p. The N-terminal part of TFC7p (amino acids 1 to 278) was aligned with the following protein sequences: HUFp, S. cerevisiae 30.7-kDa hypothetical protein; Syn H, Synechocystis hypothetical protein; PGM, S. cerevisiae PGM; FbPase, S. cerevisiae FbPase; and Cob C, S. typhimurium -ribazole-5'-phosphate phosphatase (GenBank accession no. Z75018, Z71385, D64002, P00950, S42124, and U12808, respectively). Complete sequences are shown only for Syn H and PGM. The flanking portions of the other proteins, which showed no homology to TFC7p, are not included. The amino acid positions for each sequence are indicated on the right. Identical residues are boxed, and conserved substitutions are shaded. Conserved active-site residues of PGM, FbPase, and Cob C enzymes are indicated by stars.

TFC7 encodes the 55-kDa subunit of TFIIIC. The TFC7 gene was engineered to add six histidine residues and an epitope derived from the influenza virus HA protein (HA epitope) at the N terminus of the protein. The tagged protein was expressed in E. coli cells and purified as a histidine fusion under nondenaturing conditions on Ni²⁺-NTA-agarose. Western blot analysis of the purified protein fraction was performed with monoclonal antibodies directed against the HA epitope. The HA-tagged recombinant protein (predicted M_r, 50,000) migrated on an SDS-polyacrylamide gel with an apparent size of 56 kDa, suggesting that TFC7p is not posttranslationally modified.

View larger version (37K): [in this window] [in a new window]   FIG. 2.   TFC7 encodes a subunit of TFIIIC. TFIIIC was purified by heparin chromatography and assayed by gel retardation with a labeled tDNA3Glu probe. Preformed TFIIIC-tDNA3Glu complexes (lane 1) were incubated with 250 or 500 ng of preimmune antibodies (lanes 4 and 5) or anti-rTFC7p antibodies (lanes 2 and 3). Complexes were separated by nondenaturing electrophoresis and revealed by autoradiography. C1, position of TFIIIC-tDNA complexes; C2, position of complexes bound by anti-rTFC7p antibodies; F, free labeled tDNA.

Analysis of 55 mutants. The similarity of the N-terminal half of TFC7p to a cyanobacterial protein or to enzymes related to the glycolytic pathway was intriguing. To define 55 domains that were necessary for TFIIIC activity, N-terminal and C-terminal deletions (Fig. 3A) in an HA-tagged version of 55 were generated as described in Materials and Methods. Centromeric plasmids harboring mutant copies of the TFC7 gene were tested for their ability to functionally replace a chromosomally disrupted copy of TFC7. The resulting strains were grown at different temperatures in medium containing either glucose or glycerol as a carbon source. As shown in Fig. 3A, deletion of the C-terminal domain (55-C) was lethal, suggesting that this domain is essential for TFIIIC function. In contrast, deletion of the whole N-terminal domain (55-N3), homologous to HUFp, resulted in a wild-type phenotype (Fig. 3B). This in vivo result was confirmed by in vitro studies. Wild-type and 55-N3 TFIIIC factors were purified by heparin chromatography and tested for tDNA binding activity by gel retardation assays or for their ability to promote the transcription of different templates in the presence of TFIIIB and RNA PolIII. Figure 4A shows that the deletion form of TFIIIC was able to form a complex with the tRNA₃^Glu gene. The migration of the TFIIIC-tDNA₃^Glu complexes formed could be altered by anti-HA antibodies, showing that epitope-tagged 55-N3 associated with the other subunits to form TFIIIC (data not shown). Deletion of the N-terminal half of 55 noticeably increased the rate of migration of TFIIIC-tDNA₃^Glu complexes, and the same increase in migration rate was observed when a DNA fragment harboring only the B block of the tRNA₃^Leu gene was used as a probe (Fig. 4A). This difference in migration between the wild-type and mutant TFIIIC-tDNA complexes is not easily explained by the 5% difference in molecular mass between wild-type and mutant factors (30 kDa of 600 kDa) and could reflect different conformational states of the factor.

View larger version (45K): [in this window] [in a new window]   FIG. 3.   Deletion analysis of 55. (A) Deletion mutants were constructed as described in Materials and Methods from an HA-tagged version of 55 (55-WT). 55-WT and 55 deletions are schematically represented. The positions of deleted amino acids (inclusive) for each construct are indicated in parentheses. Centromeric plasmids harboring a deletion mutant copy of TFC7, expressed from its own promoter, were tested for their ability to functionally replace, at different temperatures and either in glucose (Glu)- or in glycerol (Gly)-containing medium, a chromosomally disrupted copy of TFC7. A summary of the viability and thermal sensitivity of the strains is shown; lethal (), wild-type (+), and temperature-sensitive (ts) phenotypes are indicated; ND, not determined. (B) Viability and thermal sensitivity of yeast strains harboring wild-type 55 or deletion variants of 55. Growth at 30 and 37°C in glucose- or glycerol-containing medium of the wild-type or viable 55 deletion strains is shown.

View larger version (40K): [in this window] [in a new window]   FIG. 4.   DNA binding and transcriptional activities of 55-N3 TFIIIC. TFIIIC was purified by heparin chromatography from the wild-type strain (WT) or the mutant strain expressing only the C-terminal part of 55 (55-N3). (A) Formation of TFIIIC-DNA complexes. Factor-DNA complexes were formed as described in Materials and Methods by incubating wild-type or 55-N3 TFIIIC with DNA probes harboring either the tRNA3Glu gene or the B block of the tRNA3Leu gene, as indicated. Complexes were analyzed by electrophoresis and autoradiography and quantified by scanning. (B) Transcription of various class III genes by 55-N3 TFIIIC. Wild-type or 55-N3 TFIIIC was incubated with three tRNA genes in reconstituted transcription mixtures as described in Materials and Methods. The different templates are indicated. The RNA products were isolated by electrophoresis, revealed by autoradiography, and quantified by scanning. For the Glu3 template, only the upper RNA band was taken into account, whereas for the SUP4 and Leu3 templates, both RNA bands, corresponding to primary and mature transcripts, were quantified. The different relative yields of primary and mature transcripts depended on the level of maturase activity present in the heparin-purified TFIIIC fraction.

55 interacts with 95. To gain some insight into the function of the 55-kDa subunit of TFIIIC, we used the two-hybrid system to study the interactions between 55 and all the components of the PolIII system cloned so far. This method previously revealed interactions of 131 with TFIIIB70 (12) as well as with TFIIIB90 (45). The TFC7 ORF was fused to the DNA binding domain [GAL4(1-147)] or to the transcriptional activation domain [GAL4(768-881)] of the yeast GAL4 protein. All combinations between these 55 fusion proteins and the TFIIIB (TFIIIB70, TFIIIB90, and TBP), TFIIIC (138, 131, 95, and 91), TFIIIA, and PolIII (C160, C128, C82, C53, AC40, C34, C31, C27, AC19, ABC10, and ABC10) complementary fusion proteins were assayed (2, 12, 51). Activation of the lacZ reporter gene was estimated by -galactosidase assays of selected transformants. The interaction between TFIIIB70 and 131 (12) was used as a reference. Significant levels of -galactosidase activity were detected when 55 fused to the transcriptional activation domain was assayed with the 95 complementary fusion (Table 1). This observation suggested that 55 and 95 interacted in the cell. The reciprocal combination gave lower but significant levels of -galactosidase activity (data not shown). Next, we investigated the interaction between 95 and deletion versions of 55. The truncated fragments of 55 shown in Fig. 3A were fused to the DNA binding or transcriptional activation domain of GAL4 and assayed with the reciprocal 95 fusions. Deletions of the N-terminal domain of 55 did not alter significantly the 55-95 interaction. On the other hand, deletion of the C-terminal domain of 55 gave background -galactosidase levels (data not shown). This result suggested that the C-terminal part of 55 is essential for its interaction with 95.

View this table: [in this window] [in a new window]   TABLE 1.   In vivo interaction of 55 with 95 in the two-hybrid system

View larger version (42K): [in this window] [in a new window]   FIG. 5.   55 interacts with 95. Recombinant 55, expressed as an HA-tagged hexahistidine fusion, was purified from E. coli cells under native conditions. Eluted polypeptides (1 and 5 µg; respectively, lanes 1 and 2) were subjected to SDS-PAGE, transferred to a membrane, denatured-renatured, and probed with 35S-labeled 95 as described in Materials and Methods. Labeled polypeptides were revealed by autoradiography (lanes 1 and 2). The same membrane was incubated with anti-HA antibodies (lanes 3 and 4), and immune complexes were visualized with an ECL kit. The molecular masses of marker polypeptides are indicated in kilodaltons.

Existence of a 55-95 subcomplex distinct from TFIIIC. In other work on the purification of TFIIIC from yeast crude extracts, we observed that a -galactosidase-95 fusion protein eluted in two peaks during heparin chromatography (12a). The 95-kDa subunit was present in fractions that contained the tDNA binding activity of TFIIIC but also in fractions eluting at lower salt concentrations and that contained no detectable tDNA binding activity. We decided to study more precisely the elution profile of the different TFIIIC subunits during heparin chromatography to correlate the presence of TFIIIC subunits to the factor tDNA binding activity. Extracts from wild-type or various epitope-tagged yeast strains were chromatographed on heparin columns, and proteins were eluted with an ammonium sulfate gradient. Fractions were assayed for salt and protein concentrations as well as for DNA binding activity on a ³²P-labeled tDNA (Fig. 6A). Eluted proteins were then subjected to SDS-PAGE, transferred to nitrocellulose membranes, and probed with polyclonal antibodies directed against 55 or 95. Anti-HA antibodies were used to reveal epitope-tagged 91, 131, or 138 subunits. As shown in Fig. 6B, 55, 91, 95, 131, and 138 eluted in fractions (76 to 92) containing 300 to 350 mM ammonium sulfate, with the tDNA binding activity. In contrast to 91, 131, or 138, both 55 and 95 also coeluted at lower salt concentrations (200 to 250 mM ammonium sulfate), in fractions 52 to 68, which did not contain detectable TFIIIC-tDNA binding activity. These results suggested that 55 and 95 exist in two forms: either associated with TFIIIC or as a subcomplex potentially containing other proteins but not TFIIIB. TFIIIB70 (Fig. 6B) and TFIIIB (data not shown) transcriptional activities coeluted in fractions 68 to 92, well after the 55-95 complex (fractions 52 to 68).

View larger version (36K): [in this window] [in a new window]   FIG. 6.   Elution profile for TFIIIC subunits during chromatography on a heparin column. (A) Cell extracts from the wild-type strain or strains expressing HA-91, HA-131, or HA-138 were chromatographed on a heparin column as described previously (25). Eluted fractions were assayed for ammonium sulfate (+) or protein () concentrations. The DNA binding activity of TFIIIC assayed by gel retardation is indicated by the hatched zone. The data correspond to the results obtained with fractions from the wild-type strain. Similar results were obtained with fractions from the epitope-tagged strains. (B) Heparin fractions (20 µl) were subjected to SDS-PAGE, proteins were transferred to membranes, and filters were incubated with antibodies. Immune complexes were revealed with an ECL kit. Heparin fractions from the wild-type strain were probed with polyclonal antibodies directed against 55 (row 1) and then with polyclonal antibodies directed against 95 (row 2) or TFIIIB70 (row 6). Heparin fractions from HA-131 (row 3), HA-138 (row 4), or HA-91 (row 5) were probed with anti-HA antibodies.

View larger version (20K): [in this window] [in a new window]   FIG. 7.   55 is stably associated with 95. Cell extracts from strains expressing HA-95 or wild-type 95 were chromatographed on a heparin column as described previously (25). (A) Heparin fractions eluting at 200 to 250 mM ammonium sulfate and containing both HA-95 and 55 were pooled (30 ml) and further chromatographed on a 4-ml anti-HA column as described previously (25). Proteins were eluted (1-ml fractions) by competition with the synthetic HA peptide (0.1 mg/ml). Protein samples (40 µl) were subjected to SDS-PAGE, transferred to a nitrocellulose membrane, and probed with anti-HA antibodies or polyclonal antibodies directed to 55. Immune complexes were revealed with an ECL kit. Lanes: 1 (L), heparin fraction loaded onto the anti-HA column; 2 (FT), flowthrough fraction; 3 to 7, eluted fractions. (B) Heparin fractions (1.5 ml) containing untagged 95 and 55 were chromatographed on an anti-HA column (0.15 ml) as described above. Proteins were eluted batchwise (0.1-ml fraction) by competition with the synthetic HA peptide. Protein samples (40 µl) were analyzed by Western blotting with antibodies directed to 55. Lanes are as in panel A.

View larger version (82K): [in this window] [in a new window]   FIG. 8.   Coimmunoprecipitation of TFIIIC subunits from crude extracts. Immunoprecipitations with anti-HA antibodies were performed as described in Materials and Methods with crude extracts from the wild-type (WT) strain or strains expressing HA-tagged versions of 138, 131, and 95 (HA-138, HA-131, and HA-95, respectively). Proteins eluting with the synthetic peptides were subjected to SDS-PAGE, transferred to a membrane, and probed successively with polyclonal antibodies directed against 95, 55, 131, and 91. Immune complexes were revealed with an ECL kit and quantified by scanning. A value of 1 was arbitrarily given to the amounts of 95, 55, 131, and 91 subunits immunoprecipitated from the HA-138 crude extract and was used as a reference. On the left are indicated molecular masses (in kilodaltons) of the polypeptides probed by the antibodies noted on the right. The 75-kDa polypeptide revealed by anti-91 antibodies was immunologically related to 91 (2).

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Yeast TFIIIC is a multifunctional protein required for promoter binding, TFIIIB recruitment, and chromatin antirepression. We have pursued the characterization of this multisubunit factor and report here the isolation of an essential gene, named TFC7, encoding its smallest subunit. It appears that this polypeptide is a chimeric protein that belongs to different protein complexes.

Based on biochemical data and gene cloning, it is now well established that the four largest polypeptides, of 138, 131, 95, and 91 kDa, contained in highly purified TFIIIC fractions are subunits of TFIIIC. The two smallest polypeptides (60 and 55 kDa) have also been consistently found in TFIIIC fractions from different laboratories (5, 16, 43). Using peptide sequences obtained from the gel-purified protein, we have identified the TFC7 gene encoding the 55-kDa polypeptide. Polyclonal antibodies directed to rTFC7p were able to supershift TFIIIC-tDNA complexes, thus confirming the presence of the 55-kDa polypeptide within the factor-tDNA complex. Like all the genes encoding components of the yeast PolIII transcription system and isolated so far, TFC7 is an essential gene.

Searches in databases revealed the chimeric structure of TFC7p. The N-terminal part of TFC7p showed intriguing similarities to other proteins unrelated to transcription and was highly similar to a yeast hypothetical protein of unknown function (named HUFp). On the other hand, no significant sequence similarities could be detected with the C-terminal part of TFC7p. In fact, the coding sequences for the N-terminal part of TFC7p and for HUFp are located just at the border of duplication block 50 present on both chromosome XIV and chromosome XV (54). One hypothesis is that the chimeric structure of 55 resulted from a fusion between an ancestral transcription factor subunit (corresponding to the C-terminal part of 55 that is not included in the duplication block) and another protein of still unknown function (encoded by ancestral HUF and corresponding to the N-terminal part of 55). This hypothesis, which may explain the intriguing sequence similarities between a TFIIIC subunit and a cyanobacterial protein (Syn H), is supported by our results from 55 deletion mutant analysis. Indeed, only the C-terminal part of 55 was necessary for interaction with 95 and was sufficient for transcription factor activity. Whereas the deletion of the C-terminal part of 55 was lethal, the mutant form of TFIIIC entirely deprived of the N-terminal half of 55 (55-N3) supported normal cell growth, was able to bind to tDNA promoter sequences in vitro, and, once bound, recruited TFIIIB productively and as efficiently as the wild-type factor. However, although the whole N-terminal domain of 55 was dispensable for TFIIIC activity, a partial deletion of this domain (55-N1) impaired 55 function at a high temperature. The residual presence of a truncated N-terminal fragment may have interfered with 55 folding or led to a defect in TFIIIC assembly or stability.

The N-terminal part of 55 showed sequence similarities to different enzymes that catalyze similar phosphotransfer reactions, more specifically, enzymes related to the glycolytic pathway (PGM or FbPase) and acid phosphatase. Since residues important for the catalytic activity of these enzymes were conserved in 55, we assayed TFIIIC and rTFC7p for enzymatic activity. No PGM or phosphatase activities were detected (results not shown). Nevertheless, partial deletions of the N-terminal domain of 55 resulted in a reduced growth rate at 30°C (55-N1) or in a thermosensitive phenotype (55-N1 and 55-N2) in glycerol- or ethanol-containing medium. These growth defects, which were revealed only in medium containing glycerol or ethanol instead of glucose, suggest a possible relationship between PolIII transcription and metabolic pathways which deserves to be investigated further.

The direct interaction between 55 and 95 observed in vitro and in vivo agrees well with the photo-cross-linking mapping of these two polypeptides on opposite sides of the DNA helix, in the vicinity of the A block of tRNA genes (5, 6). Our inability to alter the migration of B-tDNA complexes with anti-55 antibodies (data not shown) further argues in favor of the localization of 55 in A, the TFIIIC domain that binds to the A block of tRNA genes. However, sequence analysis of 55 did not reveal known DNA binding motifs, and our attempts to demonstrate, by gel retardation assays or Southwestern blotting, that 55 or 95 binds to DNA, even nonspecifically, failed (results not shown) (44, 48). One could imagine that the interaction of A with the A block of tRNA genes requires the association of both 95 and 55. However, no tDNA binding activity or transcriptional activation (or inhibition) was found to be associated with a partially purified 55-95 subcomplex (results not shown). From this point of view, the presence of two TFIIIC components in two distinct complexes is reminiscent of but not equivalent to the chromatographic separation of silkworm or human TFIIIC into distinct, complementary activities. TFIIIC activity from silkworm cells can be separated into two fractions, both of which are required to form a complex on a tRNA gene (41). For human TFIIIC, two fractions, named TFIIIC1 and TFIIIC2, are both necessary to reconstitute full TFIIIC DNA binding and transcriptional activities: TFIIIC2, a multisubunit protein (33, 50, 56), binds strongly by itself to the B block of tRNA genes, but A block binding and gene transcription require TFIIIC1 (50, 55). Furthermore, TFIIIC1 can be chromatographically separated from an additional activity, TFIIIC0, that is able to partially substitute for TFIIIC1 activity (38). The situation is different here, since the 55-95 complex (with possible associated components) is not required for TFIIIC activity. The existence of a 55-95 complex distinct from TFIIIC suggests a dual role for these two subunits. This complex is possibly endowed with regulatory functions or has other roles unrelated to transcription. The subcellular localization of this complex and the identification of associated proteins, if any, may shed some light on its function. It will also be of interest to uncover the phenotype(s) caused by the deletion of HUFp, which is highly similar to the N-terminal part of 55. HUFp is distantly homologous to enzymes related to the glycolytic pathway. This similarity suggests a connection with cell metabolism that is also supported by the altered growth phenotype of 55-N1 and 55-N2 mutant cells in glycerol- or ethanol-containing medium. The level of PolIII transcription is known to vary according to the cell growth rate in human, mouse, and yeast cells (15, 23, 47, 49). TFIIIC components may play a role in such coordinated regulation.