Department of Immunology, Duke University
Medical Center, Durham, North Carolina 27710
Received 6 January 1998/Returned for modification 20 February
1998/Accepted 9 March 1998
To understand the molecular basis for the dramatic functional
synergy between transcription factors that bind to the minimal T-cell
receptor
enhancer (E
), we analyzed enhancer occupancy in
thymocytes of transgenic mice in vivo by genomic footprinting. We found
that the formation of a multiprotein complex on this enhancer in vivo
results from the occupancy of previously identified sites for CREB/ATF,
TCF/LEF, CBF/PEBP2, and Ets factors as well as from the occupancy of
two new sites 5' of the CRE site, GC-I (which binds Sp1 in vitro) and
GC-II. Significantly, although all sites are occupied on a wild-type
E
, all sites are unoccupied on versions of E
with mutations in
the TCF/LEF or Ets sites. Previous in vitro experiments demonstrated
hierarchical enhancer occupancy with independent binding of LEF-1 and
CREB. Our data indicate that the formation of a multiprotein complex on
the enhancer in vivo is highly cooperative and that no single E
binding factor can access chromatin in vivo to play a unique initiating
role in its assembly. Rather, the simultaneous availability of multiple enhancer binding proteins is required for chromatin disruption and
stable binding site occupancy as well as the activation of transcription and V(D)J recombination.
 |
INTRODUCTION |
Gene regulation in eukaryotic cells
is accomplished through the interplay between transcription factors and
chromatin. Chromatin structure is, in general, inhibitory for
transcriptional activation and plays a critical role in gene regulation
because it prevents transcription factors from accessing their binding
sites within cis-regulatory regions in inappropriate tissues
and at inappropriate times during development (12, 35, 48).
Active cis-regulatory regions are usually mapped as DNase
I-hypersensitive sites that result from a local disruption of the
canonical nucleosome structure (19). Some transcription
factors, including steroid hormone receptors, Pho4, GAL4 and its
derivatives, and GAGA factor, seem capable of accessing their binding
sites in chromatin and initiating alterations in the structure and
stability of underlying or adjacent nucleosomes that result in the
generation of these accessible regions (2, 38). The ability
of these factors to access nucleosomal DNA depends critically on the
positioning of their binding sites with respect to the nucleosome.
Initial factor binding facilitates the loading of additional factors
that otherwise could not access their binding sites in chromatin,
leading ultimately to transcriptional activation. Two classes of
enzymatic activities may be recruited by specific transcription factors
to facilitate nucleosome remodeling and transcription factor binding:
ATP-dependent chromatin-remodeling complexes and histone
acetyltransferases (34, 63, 67).
The minimal human T-cell receptor (TCR)
enhancer (E
) has been
the subject of intensive analysis and represents an excellent paradigm
for the coordinated assembly of and synergistic transcriptional activation by a multiprotein complex on a cis-regulatory
element. This enhancer was initially characterized as a 116-bp segment of DNA that, on the basis of in vitro DNase I footprinting, includes two protein binding regions (T
1 and T
2) (30). The
minimal E
is sufficient to activate transcription in transiently
transfected T-cell lines (30) and V(D)J recombination in
thymocytes of transgenic mice (53). It contains binding
sites for members of the CREB/ATF, TCF/LEF, CBF/PEBP2, and Ets families
of transcription factors, all of which are critical for enhancer
activity (17, 29, 30, 53, 59, 64, 65). The mechanisms by
which these factors act in synergy to activate both transcription and
V(D)J recombination in vivo have yet to be fully elucidated.
A major focus of recent studies has been the role of TCF/LEF family
transcription factors in the assembly of the multiprotein complex on
E
. TCF/LEF transcription factors are members of the sequence-specific class of high-mobility-group (HMG) proteins (7). These proteins are known as "architectural"
transcription factors because of their ability to introduce a sharp
bend in DNA (15, 39). This property has been suggested to
facilitate the assembly of a transcriptionally active multiprotein
complex by promoting interactions between proteins bound on either side of the bend (15, 17, 20, 66). TCF/LEF factors cannot
transactivate transcription by themselves but can do so either in the
context of a specific arrangement of additional transcription factor
binding sites (51, 55, 59, 62, 65) or by interaction with
the transcriptional coactivator
-catenin (5, 51, 60).
Context-dependent transcriptional activation results in part from DNA
bending induced by the HMG domain (17, 42) but also depends
on a distinct activation domain in a manner that is independent of DNA
bending (8, 16, 55). The latter suggests that TCF/LEF, in
addition to promoting protein-protein interactions through DNA bending, directly contacts specific proteins via its context-dependent activation domain. One such protein, ALY, is a context-dependent coactivator that appears to facilitate functional interactions with
other factors bound to the minimal E
(6).
-Catenin
interacts with a distinct region of TCF/LEF factors and stimulates
transcription through TCF/LEF binding sites (3, 5, 31, 44, 51,
60) but does not appear to regulate the minimal E
(3). In some cases, a functional role for TCF/LEF is only
apparent in chromatin-integrated templates (23, 55), a
result which has led to the suggestion that its primary role may be to
recruit chromatin-remodeling complexes (34).
The in vitro assembly of a multiprotein complex on the minimal E
has
been studied in two laboratories with both naked DNA and in
vitro-reconstituted chromatin templates (17, 42). In studies
with naked DNA templates, LEF-1 and CREB/ATF proteins were shown to
bind independently. CBF/PEBP2 and Ets-1 were shown to bind
cooperatively, and LEF-1-induced DNA bending and helical phasing of the
CRE site relative to other sites were both found to be important to
further stabilize the binding of CBF/PEBP2 and Ets-1 (17).
It was suggested that stable binding of CBF/PEBP2 and Ets-1 required
LEF-1-induced DNA bending to facilitate the interaction of ATF proteins
and Ets-1. More recently, different results were obtained with in
vitro-reconstituted chromatin templates (42). In this case,
LEF-1 stabilized the binding of CBF/PEBP2 and Ets-1, but this
stabilization did not depend on CREB, which bound independently.
Nevertheless, both sets of in vitro experiments suggested stepwise, or
hierarchical, assembly of transcription factors onto the minimal E
,
with a central organizing role for LEF-1.
In this study, we have analyzed transcriptional activity and
transcription factor occupancy of chromosomally integrated wild-type and mutant versions of the minimal E
in vivo by using thymocytes of
transgenic mice. We show that the minimal E
can direct transcription in vivo and that transcription is dependent on intact binding sites for
TCF/LEF and Ets factors. Importantly, we found that although all
binding sites are occupied on the wild-type enhancer, all binding sites
are unoccupied on enhancers with either a mutated TCF/LEF site or a
mutated Ets site. Our in vivo results therefore support a novel model
for the highly cooperative assembly of a multiprotein complex on the
minimal E
in which no single enhancer binding factor can access its
binding site in native chromatin to potentially serve as an initiator,
or master regulator, of enhancer occupancy. Highly cooperative assembly
may explain both the dramatic functional synergy between E
binding
proteins and the tight regulation of TCR
gene expression in vivo.
 |
MATERIALS AND METHODS |
Northern blotting.
Total RNA was isolated from
unfractionated thymocytes of 4-week-old transgenic mice as described
previously (11). RNA samples (8 µg) were electrophoresed
through a 1.5% agarose gel containing 2.2 M formaldehyde and
transferred to a nylon membrane (Micron Separations, Westboro, Mass.).
C
transcripts were detected with a
32P-labeled C
probe (21), and RNA
loading was assessed with a 32P-labeled
glyceraldehyde-3-phosphate dehydrogenase probe.
DMS and DNase I treatments.
Unfractionated thymocytes from
4-week-old transgenic mice were used for dimethyl sulfate (DMS) and
DNase I analyses. Thymocytes isolated from a single mouse were used for
both in vivo and in vitro treatments performed in parallel. DMS
treatments were performed as described previously (45).
For in vivo DNase I treatment, thymocytes were permeabilized with
Nonidet P-40 (52) or lysolecithin (49). Briefly,
5 × 107 to 1 × 108 cells were
resuspended and incubated for 1 min at 37°C in 1 ml of
preequilibrated 150 mM sucrose-80 mM KCl-5 mM
K2HPO4-5 mM MgCl2-0.5 mM
CaCl2-35 mM HEPES (pH 7.4) containing 0.05% (wt/vol)
lysolecithin or 0.2% (vol/vol) Nonidet P-40. After cell
permeabilization, 9 ml of 150 mM sucrose-80 mM KCl-5 mM
K2HPO4-5 mM MgCl2-2 mM
CaCl2-35 mM HEPES (pH 7.4) and 15 to 120 U of DNase I
(Worthington Biochemical Corp., Freehold, N.J.) were added for a 5-min
incubation at 23°C. Cells were then centrifuged at 4°C and lysed by
incubation in 3 ml of lysis buffer (45) containing 300 mM
NaCl, 25 mM EDTA, 50 mM Tris-Cl (pH 8.0), 0.2% sodium dodecyl sulfate,
and 0.2 mg of proteinase K per ml for 5 to 16 h at 37°C. Genomic
DNA from DNase I-treated and untreated cells was obtained as described previously (45). DNA samples were treated with RNase A (100 µg/ml) for 2 h at 37°C followed by proteinase K (200 µg/ml)
for 2 h at 37°C. DNA was then serially extracted with phenol,
phenol-chloroform-isoamyl alcohol (25:24:1), chloroform-isoamyl alcohol
(24:1), and ethyl ether and precipitated by adding a 1/10 volume of 3 M
sodium acetate (pH 7.0) and 2 volumes of cold ethanol. Pellets were
washed in 75% ethanol and resuspended at 1 to 2 µg/ml in 1 mM
EDTA-10 mM Tris-HCl (pH 7.5).
For in vitro DNase I treatment, 50 µl of DNA solution was diluted by
the addition of 400 µl of H2O and 50 µl of 100 mM
MgCl2-20 mM CaCl-500 mM HEPES (pH 7.6), and DNase I
(0.0225 to 0.045 U) was added for a 30- to 90-s incubation at 23°C.
Reactions were stopped by the addition of 175 µl of 143 mM EDTA (pH
8.0)-7.1% sodium dodecyl sulfate. DNA was then extracted and
precipitated as described above.
LM-PCR.
DMS- and DNase I-treated DNA was subjected to
ligation-mediated PCR (LM-PCR) as described previously (45).
The oligonucleotides used for the analysis of the top strand were I-NC
(5'GCTGAGAAGCTCAACTAAAAGACTG), II-NC
(5'CTGATTCTGTTTCAGTCACTCAGGGC), and III-NC
(5'CTGTTTCAGTCACTCAGGGCAGGAAAC). Those used for the analysis
of the bottom strand were P1
(5'CAAGGAGACAGAGTATTACAGATG), P2(
) close (5'GATCCGTTGGGGGCTGGG), and P3(
)close
(5'GTTGGGGGCTGGGGCGGT). The asymmetric linker was identical
to that previously described by Mueller et al. (45).
EMSA.
Preparation of Jurkat cell nuclear extract,
radiolabeling of binding site probes with the Klenow fragment of DNA
polymerase I and [
-32P]dCTP (ICN Radiochemicals,
Irvine, Calif.), and electrophoretic mobility shift assays (EMSA) were
performed as described previously (26, 27, 50). Binding
reaction mixtures for analyzing Jurkat cell nuclear extract contained
2.2 µg of extract, 2 µg of dI-dC, and 5 µg of bovine serum
albumin. Binding reaction mixtures for analyzing pure Sp1 contained 0.1 U of human recombinant Sp1 (Promega, Madison, Wis.), 0.5 µg of dI-dC,
and 10 µg of bovine serum albumin. Anti-Sp1 serum was kindly provided
by J. Horowitz (Duke University, Durham, N.C.), and normal rabbit serum
was obtained from Dako, Carpinteria, Calif.
Plasmids.
To generate T
1,2-V
1-CAT, the
T
1,2 fragment of E
was excised from plasmid E
0.7
(30) by digestion with BstXI and DraI,
blunt ended by treatment with T4 polymerase, and ligated to
XbaI-digested, Klenow fragment- and phosphatase-treated
V
1-CAT (50). With this plasmid as a template,
the Del GC-I and Del GC-I+II enhancer fragments were obtained by PCR
with oligonucleotide 5'-GGGTCTAGACTCCCATTTCCATGACGTCA-3' or
5'-GGGTCTAGAGGTCCCCTCCCATTTCCATG-3' in conjunction with
V
1 promoter oligonucleotide
5'-GAGAGGTAGCCATGCTCT-3'. PCR products were digested with
BamHI and XbaI and ligated to BamHI-
and XbaI-digested, phosphatase-treated
V
1-CAT. Construct structure was confirmed by
dideoxynucleotide sequence analysis.
Transient transfections and chloramphenicol acetyltransferase
assays.
The human leukemia T-cell line Jurkat was cultured and
transfected with CsCl-purified plasmid DNA as described previously (27). pRSV-luciferase (0.2 µg) was cotransfected with test
plasmids to control for transfection efficiency. Luciferase activity
was measured with a luciferase assay system (Promega). For
chloramphenicol acetyltransferase assays, the acetylation of
[14C]chloramphenicol (Dupont-New England Nuclear, Boston,
Mass.) was assayed as described previously (26) and
quantified with a PhosphorImager (Molecular Dynamics, Sunnyvale,
Calif.).
 |
RESULTS |
The minimal E
can activate transcription in vivo.
cis-regulatory elements such as enhancers and promoters
determine the developmental activation of V(D)J recombination within the TCR and immunoglobulin loci (57) by modulating chromatin structure so as to provide local accessibility to the recombinase machinery (43, 58). We previously studied enhancer control of V(D)J recombination in transgenic mice containing a chromosomally integrated, unrearranged human TCR
gene minilocus (37).
This construct is composed of germ line V, D, J, and C gene segments, with test enhancers inserted between J and C (Fig.
1). The initial V-to-D step of transgene
rearrangement occurs in an enhancer-independent fashion, whereas the
second step of transgene rearrangement, VD to J, depends critically
upon the presence of a functional enhancer between J and C (28,
37, 53). This behavior reflects the fact that V and D segment
accessibility is maintained even in the absence of an enhancer, whereas
J segment accessibility is provided by the enhancer (43).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of transgenic minilocus constructs. Human TCR
gene minilocus constructs containing wild-type or mutant versions
of the minimal E were previously described (53). Solid
boxes represent exons, and open boxes represent protein binding
sites.
|
|
We recently showed that the 116-bp minimal E
is competent to
activate the enhancer-dependent step of V(D)J recombination in this
system and that intact binding sites for TCF/LEF and Ets family
transcription factors are essential for its activity (53). In the present study, we analyzed transcription and enhancer occupancy in 10 previously studied lines of transgenic mice that included either
the wild-type minimal E
(T
1,2 lines T2, T3, T5, and T7), the
minimal E
with a mutated TCF/LEF binding site (T
1,2mTCF/LEF lines
JI, JJ, and JK), or the minimal E
with a mutated Ets binding site
(T
1,2mEts lines JN, JO, and JR) (Fig. 1 and Table
1). In our previous study
(53), we found that the enhancer-independent V-to-D step and
the enhancer-dependent VD-to-J step of transgene rearrangement both
occurred in T
1,2 lines T2, T5, and T7 but did not occur in T
1,2
line T3 (Table 1). In all lines containing mutated enhancers, the
enhancer-independent V-to-D rearrangement step occurred, but the
enhancer-dependent VD-to-J step did not. We previously suggested that
the absence of both VD and VDJ rearrangements in line T3 reflects
transgene integration into an inhibitory site in chromatin.
To determine whether the minimal E
directs transcription as well as
V(D)J recombination in a chromosomally integrated context, we analyzed
C
-containing mRNA transcripts in transgenic thymocytes by Northern blotting (Fig. 2). Previous
studies identified four major transcripts originating from the
endogenous human TCR
gene, two differentially polyadenylated
transcripts originating from VDJ rearranged templates, and two
differentially polyadenylated transcripts originating from germ line
templates (21). Corresponding transcripts originating from
VDJ rearranged and unrearranged templates were readily detected in
thymocytes of T
1,2 lines T2, T5, and T7 but were not detected in
line T3. Furthermore, these transcripts were undetectable in thymocytes
of T
1,2mTCF/LEF and T
1,2mEts transgenic mice. These differences
are not readily attributable to differences in transgene copy number,
as the different lines only varied by from one to four copies of the
minilocus in transgenic thymocytes (Table 1). Therefore, these data, in
conjunction with our previous results (53), indicate that
the minimal E
can activate both transcription and V(D)J
recombination in vivo and that TCF/LEF and Ets binding sites are
critical for both processes. The ability of the enhancer to activate
transcription correlates precisely with its ability to activate V(D)J
recombination in the various lines.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of transgenic minilocus transcription by
Northern blotting. Thymocyte RNA samples were analyzed on Northern
blots hybridized with 32P-labeled C and
glyceraldehyde-3-phosphate dehydrogenase probes. Filled and open
arrowheads indicate differentially polyadenylated transcripts
originating from VDJ rearranged and germ line templates,
respectively.
|
|
Analysis of wild-type minimal E
occupancy in vivo by genomic
footprinting.
To investigate the molecular basis for minimal E
function in vivo, we analyzed the occupancy of wild-type and mutant
versions of the enhancer in thymocytes of transgenic mice by genomic
footprinting with DMS as a chemical probe. This approach is widely used
for genomic footprinting because living cells are permeable to DMS and
DNA wound over nucleosomal core histones is freely accessible to react
with it. We treated both intact thymocytes and purified thymocyte DNA
with DMS to methylate guanines at the N7 position, cleaved DNA from
both treatment regimens at methylated guanines by using piperidine, and
performed LM-PCR as described by Mueller et al. (45) to
visualize cleavage products. Analysis of both strands of the wild-type
minimal E
in total thymocytes of T
1,2 transgenic line T2 is
presented in Fig. 3. Identical footprints were obtained with T
1,2 transgenic lines T5 and T7 (see Fig. 7A and
B; also data not shown). Occupancy of the CRE site was clearly
visualized as two protected guanines on the top strand and two
protected guanines on the bottom strand (Fig. 3A). Occupancy of the
upstream CBF/PEBP2 binding site was detected as two protected guanines
and one hypersensitive guanine on the bottom strand, whereas occupancy
of the downstream CBF/PEBP2 binding site was detected as one protected
guanine on the top strand and three protected guanines on the bottom
strand. Occupancy of the Ets binding site was detected as three
protected guanines on the bottom strand. TCF/LEF binding is not easy to
detect with DMS as a probe, because TCF/LEF primarily contacts DNA in
the minor groove (17, 39, 61). However, we detected a weakly
protected guanine and a hypersensitive guanine at one end of the
TCF/LEF binding site on the top strand. These changes are presumably a
consequence of TCF/LEF binding because purified LEF-1 protects these
bases from DNase I digestion (14, 17, 59).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of in vivo occupancy of the wild-type minimal
E by genomic footprinting. Transgenic thymocyte DNA from the T 1,2
line T2 was methylated with DMS either as naked (N) DNA in vitro or as
chromosomal (C) DNA in intact cells in vivo. Methylated DNA samples
were treated with piperidine and subjected to LM-PCR. Protected
guanines are indicated by plain arrows, and hypersensitive guanines are
indicated by tagged (with a dot) arrows. Protein binding sites are
indicated by brackets. (A) Top- and bottom-strand analyses of the
minimal E . (B) Higher-resolution top-strand analysis of the GC-I
box. (C) PhosphorImager scan of top-strand analysis of the GC-I box.
Solid line, naked DNA; broken line, chromosomal DNA.
|
|
In addition to these previously characterized binding sites within the
enhancer, we detected two other sites. One of these was not detected by
previous in vitro DNase I footprinting (30). It is defined
by five protected guanines and one hypersensitive guanine on the top
strand, upstream of the CRE site (Fig. 3A; Fig. 3B shows a
higher-resolution view). The sequence of this new site is
GGGGGCTGGGGCGG, and we refer to it as the GC-I box. The
second binding site is defined by strong protection of three guanines
and hypersensitivity at another guanine on the bottom strand, between
the GC-I box and the CRE site (Fig. 3A). This site is included in the
T
1 footprint initially detected by in vitro DNase I footprinting
(30) (see Fig. 4). Its sequence is CCCCTCCC, and
we refer to it as the GC-II box.
Our qualitative assessments of the various protected and hypersensitive
guanine residues were confirmed by quantitative analyses with a
PhosphorImager (Fig. 3C; see also Fig. 7C and D) and are summarized in
Fig. 4. Protection ranged from 30 to 80%
at different guanines. These levels of protection are typical of those
observed in other studies in which homogeneous cell populations were
examined (9, 13, 33, 41, 46) and are therefore consistent
with the minimal E
being occupied in the majority of transgenic
thymocytes.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
Summary of protected and hypersensitive guanines within
the minimal E . Protected guanines are indicated by plain arrows, and
hypersensitive guanines by tagged (with a dot) arrows. Factor binding
sites are indicated by brackets. The T 1 and T 2 regions defined by
in vitro footprinting (30) are indicated by double lines.
Protection ranged from 30 to 80%, as quantified by PhosphorImager
analysis.
|
|
Sp1 binds specifically to the functionally relevant GC-I box.
The GC-I box appears to contain two overlapping binding sites for Sp1,
denoted Sp1(1) and Sp1(2) (Fig. 5A). Of
these, the Sp1(1) site is occupied in vivo, whereas the Sp1(2) is not
(Fig. 3A and B and 4). The characteristics of the footprint over the Sp1(1) site, with several protected guanines followed by a
hypersensitive guanine at the end of the binding site, are typical of
Sp1 binding, as reported previously (10, 41, 69). In order
to investigate whether Sp1 can bind to the GC-I box, we used wild-type
and mutant double-stranded GC-I oligonucleotides in EMSA (Fig. 5).
Incubation of recombinant human Sp1 protein with a radiolabeled
double-stranded GC-I oligonucleotide in the presence of a control
antiserum yielded a single protein-DNA complex (Fig. 5B, lane 1). The
same complex was formed in the presence of a labeled GC-I
oligonucleotide with a mutation in the Sp1(1) site [GC-I-mSp1(1)]
(Fig. 5B, lane 5) or a mutation in the Sp1(2) site [GC-I-mSp1(2)]
(lane 9) but was not formed in the presence of an oligonucleotide with
mutations in both sites [GC-I-mSp1(1+2)] (lane 13). That this complex
indeed contained Sp1 was confirmed by the fact that the formation of the complex was dramatically inhibited by preincubation of proteins with an anti-Sp1 serum (Fig. 5B, lanes 2, 6, and 10). Thus, both the
Sp1(1) and the Sp1(2) sites can serve as binding sites for purified
Sp1.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro binding of Sp1 to the GC-I box. (A) Wild-type
and mutant GC-I boxes were tested. The actual binding site probes used
included flanking BamHI overhangs to facilitate
radiolabeling. (B) Radiolabeled binding site probes were incubated with
pure Sp1 protein or Jurkat cell nuclear extracts in the presence of a
control serum or an anti-Sp1 rabbit serum. DNA-protein complexes were
resolved by electrophoresis. The Sp1-containing DNA-protein complex is
marked.
|
|
To determine whether these sites could bind Sp1 from T-cell nuclear
extracts, we incubated the labeled GC-I oligonucleotide with nuclear
extracts from the leukemia T-cell line Jurkat. Several complexes were
detected in the presence of a control antiserum (Fig. 5B, lane 3). The
most prominent of these displayed the same mobility as the complex
formed with recombinant Sp1 (compare lanes 1 and 3 of Fig. 5B), and its
formation was inhibited by the anti-Sp1 serum (lane 4). Identical
results were obtained with labeled GC-I-mSp1(1) and GC-I-mSp1(2)
oligonucleotides (Fig. 5B, lanes 7, 8, 11, and 12). However, this
complex was not formed by incubation with labeled GC-I-mSp1(1+2)
oligonucleotide (Fig. 5B, lane 15). Thus, Sp1 is the predominant
protein in T-cell nuclear extracts that binds to the GC-I box. Because
none of the other complexes detected with the GC-I oligonucleotide were
affected by the anti-Sp1 serum, they probably do not contain Sp1 (Fig.
5B, lanes 3 and 4). However, the fact that they were also detected by
the GC-I-mSp1(1) and GC-I-mSp1(2) oligonucleotides but not by the
GC-I-mSp1(1+2) oligonucleotide suggests that they have a sequence
specificity that is similar to that of Sp1 (Fig. 5B, lanes 7, 11, and
15). Their identities are unclear at present.
Our results argue against simultaneous occupancy of the two Sp1 sites
on a wild-type GC-I box, because the mobility of the Sp1 complex formed
with the GC-I probe (containing two Sp1 sites) was identical to the
mobility of the Sp1 complexes formed with the GC-I-mSp1(1) and
GC-I-mSp1(2) probes (containing only one Sp1 site each). In addition,
cross-competition experiments indicated that Sp1 binds with a higher
affinity to the Sp1(1) site than to the Sp1(2) site (data not shown).
Both of these results are consistent with the genomic footprinting
experiments, which revealed occupancy of only the Sp1(1) site in vivo.
In order to evaluate the functional significance of protein binding to
the GC-I and GC-II boxes, two minimal E
deletion mutants were
generated. In one, the GC-I box [containing both the Sp1(1) and the
Sp1(2) sites] was deleted (Del GC-I), and in the other, both the GC-I
and the GC-II boxes were deleted (Del GC-I+II). The wild-type and
mutant minimal E
's were subcloned upstream of the V
1
promoter in the enhancer-dependent test construct V
1-CAT, and plasmids were transiently transfected into
Jurkat cells to measure their activities (Fig.
6). Strikingly, both mutants displayed
about 50% the activity of the wild-type enhancer. Hence, the GC-I box
is functionally relevant, whereas the GC-II box is either inert, active
only in the context of the GC-I box, or functionally redundant with
other elements of the minimal enhancer. We conclude that an Sp1 site is
occupied in vivo in a functionally relevant GC-I box within the minimal
E
.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 6.
Transcriptional activation by wild-type and mutant
versions of the minimal E . Enhancer fragments were cloned upstream
of the V 1 promoter in plasmid V 1-CAT.
Test constructs were transfected along with an internal control plasmid
into Jurkat cells, and normalized values for percentages of
chloramphenicol acetylation were averaged and expressed as fold
induction relative to V 1-CAT. The data represent the
mean ± standard deviation for 5 to 12 determinations. CAT,
chloramphenicol acetyltransferase.
|
|
The minimal E
is unoccupied in vivo in the absence of either
TCF/LEF or Ets binding.
Our data indicate that TCF/LEF and Ets
factors function in a highly synergistic fashion to activate both V(D)J
recombination and transcription within the minilocus construct in vivo.
To investigate the molecular basis for functional synergy, we compared
the in vivo occupancy of wild-type and mutant enhancers by genomic
footprinting. Wild-type T
1,2 lines T2, T5, and T7 yielded identical
footprint patterns (Fig. 7A and B and
data not shown), indicating that the wild-type enhancer
was fully occupied in these lines. However, no footprints were detected
for T
1,2 line T3. The lack of enhancer occupancy in line T3
correlates with the absence of transcription (Fig. 2) and the absence
of even enhancer-independent V-to-D rearrangement events in this line
(53), supporting our contention that the transgene is
integrated into an inhibitory site in chromatin that prevents factor
access.

View larger version (32K):
[in this window]
[in a new window]

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 7.
The minimal E is unoccupied in vivo in the absence of
either TCF/LEF or Ets binding. Transgenic thymocyte DNA samples were
analyzed by genomic footprinting as naked (N) DNA in vitro or
chromosomal (C) DNA in vivo. Protected guanines are indicated by plain
arrows, and hypersensitive guanines are indicated by tagged (with a dot)
arrows. Protein binding sites are indicated by brackets. (A and B)
Top-strand and bottom-strand analyses. (C and D) PhosphorImager scans
of top-strand and bottom-strand analyses. Solid lines, naked DNA;
broken lines, chromosmal DNA.
|
|
Genomic footprinting analysis of lines carrying mutated enhancers
(T
1,2mTCF/LEF lines JI and JK and T
1,2mEts lines JN and JO)
indicated that all binding sites were unoccupied in each line. These
qualitative assessments of enhancer occupancy were confirmed by a
quantitative analysis with a PhosphorImager (Fig. 7C and D). The lack
of enhancer occupancy is not, as in line T3, secondary to integration
into an inhibitory site in chromatin that prevents factor access
because, unlike in line T3, enhancer-independent V-to-D rearrangement
proceeds quite efficiently in the lines carrying mutant enhancers
(53). Therefore, our data indicate that in the absence of
either TCF/LEF binding or Ets binding, none of the other binding sites
within the minimal E
can be loaded in vivo. We conclude that no
single factor can occupy its site within the minimal E
and that
enhancer occupancy is highly cooperative in vivo.
Enhancer occupancy induces a local change in chromatin
structure.
We examined whether transcription factor occupancy of
the minimal E
influences local chromatin structure by measuring
DNase I hypersensitivity in an area of 8 kb surrounding the enhancer. Genomic DNA of transgenic thymocytes from T
1,2 line T2,
T
1,2mTCF/LEF line JJ, and T
1,2mEts line JR was analyzed following
DNase I treatment either as naked DNA in vitro or as chromatin in
permeabilized cells. DNase I-treated DNA was subjected to
SacI digestion and was analyzed by Southern blotting with a
radiolabeled J
3 fragment as a probe. Comparison of DNase
I-digested naked DNA and chromatin revealed a DNase I-hypersensitive
region of 200 to 300 bp over the wild-type enhancer in line T2
chromatin (Fig. 8). No such
hypersensitivity was detected over the mutant enhancers in line JJ and
JR chromatin (Fig. 8 and data not shown), arguing that the disruption
of chromatin structure over the enhancer is dependent on full enhancer
occupancy.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 8.
Local chromatin disruption by the wild-type minimal
E . Transgenic thymocyte DNAs from wild-type T 1,2 line T2 and
T 1,2mTCF/LEF line JJ were digested with DNase I either as naked DNA
in vitro or as chromatin in permeabilized cells. DNA samples (10 µg)
were digested with SacI, electrophoresed through a 0.9%
agarose gel, and analyzed on a Southern blot probed with a
32P-labeled 1.1-kb J 3 genomic fragment
(22). A DNase I-hypersensitive region over the enhancer in
line T2 is denoted by a bracket. Size makers (in kilobases) are
indicated at the left.
|
|
We then used LM-PCR to allow fine mapping of the altered chromatin
structure detected by DNase I digestion. In vivo DNase I treatment of
DNA from wild-type T
1,2 transgenic line T2 revealed extended regions
of hypersensitivity within the enhancer, compared with those in in
vitro-treated DNA (Fig. 9A). Of note is a
particularly strong hypersensitive nucleotide at the downstream border
of the TCF/LEF site. This hypersensitivity is directly attributable to occupancy of the TCF/LEF site, as it was previously detected by in
vitro footprinting with purified LEF-1 (6, 59). In addition, a stretch of strongly hypersensitive bases was detected between the
TCF/LEF and CRE sites. DNase I hypersensitivity was previously detected
in this region by footprinting of in vitro-reconstituted chromatin
templates with purified LEF-1 (42). Hence, hypersensitive regions both 5' and 3' of the TCF/LEF site seem to be a direct consequence of TCF/LEF binding. Hypersensitive regions were also detected upstream and downstream of the GC-I box and downstream of the
Ets site. The extensive DNase I hypersensitivity presumably reflects
binding and distortion of the DNA as a consequence of both TCF/LEF
binding and interactions among the various DNA-bound factors. Likely
due to the extensive DNase I hypersensitivity, clear DNase I
footprints, which would be indicative of an occupied wild-type E
,
were not detected. Extended DNase I hypersensitivity between
transcription factor binding sites, rather than footprints over the
binding sites, were similarly detected in studies of the interleukin-2
enhancer (54).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 9.
Chromatin structure probed by LM-PCR analysis of DNase I
digestion products. (A) Transgenic thymocyte DNA from T 1,2 line T2
was digested with DNase I as naked (N) DNA in vitro or as chromatin (C)
in permeabilized cells and was then subjected to LM-PCR. Lane G
displays guanine residues detected by LM-PCR of DMS-treated samples.
DNase I-hypersensitive (HS) regions within the wild-type enhancer are
indicated by brackets. A prominent hypersensitive base previously shown
to be dependent upon LEF-1 binding (6, 59) is also indicated
(open arrowhead). Protein binding sites are indicated by brackets. (B)
Transgenic thymocyte DNAs from T 1,2 line T2, T 1,2mTCF/LEF line
JJ, and T 1,2mEts line JR were digested with DNase I as chromatin (C)
in permeabilized cells and were then subjected to LM-PCR. Note that the
DNase I digestion patterns upstream of the GC-I box are offset between
line T2 and lines JJ and JR due to the use of slightly different
cloning strategies for the different constructs (53). These
differences lie outside the minimal E .
|
|
Strikingly, a comparison of in vivo DNase I-treated DNA samples from
T
1,2 line T2, T
1,2mTCF/LEF line JJ, and T
1,2mEts line JR
revealed no evidence of hypersensitive regions in the mutant enhancers
(Fig. 9B), supporting the notion that the mutant enhancers are
unoccupied. The result for T
1,2mEts line JR is particularly important because it argues persuasively that the TCF/LEF binding site
remains unoccupied in the absence of Ets binding, as initially suggested by DMS footprinting (Fig. 7A).
 |
DISCUSSION |
Coordinate factor binding to the minimal E
in vivo.
Because
of the positions of their binding sites in an accessible location at
the edge or on the surface of a nucleosome, some transcription factors
can bind to chromatin, initiate the disruption of the nucleosome
structure, and in this way facilitate the binding of other factors to
adjacent but otherwise inaccessible sites (2, 38). Our data
indicate that no single factor can access its binding site to carry out
this function for the minimal E
. As such, it is possible that none
of the binding sites within the minimal E
is positioned
appropriately with respect to the nucleosome to allow appropriate
access. Simultaneous loading of multiple transcription factors may be
essential for stable binding to nucleosomal DNA when no one site is
readily accessible.
Our experiments have implications for the mechanism by which TCF/LEF
and other HMG proteins regulate gene expression. LEF-1 binds to its
specific sequence with only 20- to 40-fold-greater affinity than to
random DNA (14), raising the question of how it can display
appropriate binding site selectivity when challenged with a complete
genome. This problem also applies to other sequence-specific members of
the HMG family of proteins (20). Our data clearly indicate
that TCF/LEF must bind to the minimal E
in vivo in conjunction with
other sequence-specific proteins. This requirement for cooperative binding is both consistent with and provides a mechanism to overcome the low binding specificity of TCF/LEF factors. Importantly, our data
argue against the possibility that these factors play an initiating or
nucleating role for the assembly of a multiprotein complex on E
, as
suggested elsewhere (34, 66). We predict that cooperative
binding with other factors will be found to be an important general
mechanism for increasing the sequence selectivity of members of the HMG
family.
We have identified the GC-I box as a novel, functionally important
regulatory site within E
that binds Sp1. The GC-I box was not
detected in initial studies of the enhancer by DNase I footprinting in
vitro (30). Further, more recent analyses of factor assembly
and functioning on the enhancer (17, 42, 59, 64, 65) were
performed with 95- and 98-bp enhancer fragments (corresponding to bases
19 to 112 and 12 to 109, respectively, of the 116-bp fragment
originally identified by Ho et al. [30]) that lack the
GC-I box. Interestingly, although the in vitro transcription experiments of Mayall et al. (42) made use of an enhancer
fragment lacking the GC-I box, a similarly situated Sp1 site was
contributed by the thymidine kinase promoter in their construct.
Purified Sp1 was found to act in synergy with enhancer binding proteins (42), perhaps because the fortuitously positioned promoter
site mimicked the natural enhancer site.
The adjacent GC-II box identified in this study was previously found to
be occupied by DNase I footprinting experiments performed in vitro with
Jurkat cell extracts (30). As it is not protected by HeLa
cell nuclear extract or purified CREB protein (17, 42), it
may serve as the binding site for an unidentified T-cell-specific nuclear protein. Our transient transfection experiments did not attribute functional activity to the GC-II box, but it should be noted
that our experiments did not address the roles of the GC-I and GC-II
boxes in a chromosomal context.
In a formal sense, the GC-I and GC-II boxes should not be considered
true components of the functionally defined minimal E
, as transient
transfection experiments indicated that substantial enhancer activity
remained with both sites deleted. Given this finding our data are
consistent with two distinct models for coordinate factor binding to
the minimal E
(defined as extending from the CRE site through the
Ets site). The first model proposes fully cooperative occupancy, in
which simultaneous availability of all enhancer binding proteins is
required to disrupt the nucleosome structure and assemble a stable
complex on the enhancer. The second model has aspects of both
cooperative occupancy and hierarchical occupancy. It suggests that the
combination of TCF/LEF and Ets factors (and presumably also CBF/PEBP2,
which binds in a highly cooperative fashion with Ets-1 in vitro
[17, 68]) is required to initiate disruption of the
nucleosome structure and facilitate the binding of CREB/ATF proteins to
the 5' end of the enhancer. In vivo analysis of a CRE site mutant
should distinguish the models; elimination of TCF/LEF, Ets, and
CBF/PEBP2 site occupancy by this mutation would argue strongly in favor
of simultaneous, single-step occupancy. Because occupancy of the
CBF/PEBP2 and Ets binding sites depends on LEF-1-induced bending and
helical phasing with the CRE site even on naked DNA templates
(17), we favor the notion that CRE site occupancy is
critical for the occupancy of other minimal E
binding sites in vivo.
Whether GC-I and GC-II site occupancy is required for the occupancy of
minimal E
binding sites is an open question. Since transient
transfection experiments revealed substantial enhancer activity to be
retained without the GC-I and GC-II sites, their occupancy might not be
critical for occupancy elsewhere. This idea leads to speculation that
the assembly of CREB/ATF, TCF/LEF, CBF/PEBP2, and Ets factors occurs in
an all-or-none fashion and that the assembly of this complex may be
required for the occupancy of GC-I, GC-II, and other sites within E
.
Additional work is required to test the details of this model.
Factor binding and functional studies performed in vivo versus in
vitro.
Both of the models outlined above differ from those
suggested by studies of factor binding in vitro to naked and
chromatin-reconstituted minimal E
DNA (17, 42). Compared
to the analysis of naked DNA templates (17), the more
stringent cooperativity detected in our study probably reflects the
fact that in vivo occupancy depends on both the specific
protein-protein contacts that lead to the cooperative assembly steps
previously identified with naked DNA in vitro and an additional level
of cooperativity imposed by the need to effectively compete with core
histones.
Differences between our results and those obtained with in
vitro-reconstituted nucleosomal templates (42) are more
surprising. The diminished cooperativity with respect to enhancer
occupancy observed in that study was paralleled by diminished
functional synergy among enhancer binding proteins. Although
transcriptional synergy could be reproduced with limiting
concentrations of transcription factors, the enhancer typically
retained significant activity in the absence of one or more enhancer
binding proteins. One explanation for this difference may be that in
vitro-reconstituted nucleosomal templates are in a derepressed or
weakly repressed state compared to native chromatin, such that the DNA
is relatively more accessible to transcription factors (48).
A second explanation may be that the translational positioning of
nucleosomes assembled in vitro is distinct from that found in vivo
(2). A third possibility is that the heightened
cooperativity observed in vivo depends on the coassembly of enhancer
binding proteins with coactivators, such as CBP (36) and ALY
(6), that were not included in the in vitro experiments.
Finally, it is possible that superphysiological levels of the various
transcription factors tested in vitro compete for binding sites in
nucleosomal DNA in a fashion that is much more efficient than would
normally be expected to occur in vivo. Regardless, our work suggests
that studies of transcription factor access to chromatin that rely
solely on in vitro-reconstituted nucleosomal DNA should be interpreted
cautiously.
Comparison with in vivo occupancy of other regulatory
elements.
It is interesting to compare our data with in vivo
occupancy data obtained for other regulatory elements. Our results
suggest a model that is different from that proposed for the
A/
globin gene enhancer (4). Analysis of
wild-type and mutant enhancer constructs in transfected cells indicated
that the binding of erythroid cell-specific factors additively, rather
than cooperatively, increased the probability of the formation of DNase
I-hypersensitive sites. Thus, accessible regions were generated even in
the absence of one or more tissue-specific factors, although the
fraction of cells in which such regions were generated was reduced.
Occupancy of the minimal E
is also different from other instances in
which occupancy clearly occurred in a stepwise or hierarchical fashion dependent on the initial binding of a single factor (2, 38). Our data suggest a situation that is similar to one proposed to explain
in vivo factor occupancy of the interleukin-2 promoter, as the
inhibition of any of several combinations of factors eliminated the
occupancy of almost all binding sites (9, 13, 54). In other
instances in which regulatory regions are completely unoccupied when a
single factor has been inactivated by mutation (33, 40) or
when a single binding site has been inactivated by mutation
(18), it is unclear whether the missing factor per se
disrupts chromatin structure, or rather, provides one of several components required for highly cooperative, all-or-none occupancy.
Long-distance regulation of accessibility by E
.
Occupancy
of the minimal E
induces only a local change in the organization of
the nucleosomal array, as assessed by either micrococcal nuclease
digestion or hypersensitivity to DNase I digestion (this study;
42). However, our analysis of the regulation of
V(D)J recombination indicates that an occupied minimal E
can stimulate the accessibility of recombination signal sequences to the
V(D)J recombinase at distances of at least 2 kb in transgenic mice
(53). Furthermore, the endogenous E
regulates the
accessibility of J
recombination signal sequences over
70 kb within the endogenous TCR
/
locus (56). The
mechanism by which accessibility may be modulated over such distances
has not been established. As the hyperacetylation of histones has been
associated with active chromatin domains in vivo (24, 25,
32) and as CREB interacts with CBP and p300 (36),
which are themselves histone acetyltransferases (1, 47),
regional control of histone acetylation by the enhancer is an appealing
possibility. Further investigation is required to evaluate the role of
this and other chromatin modifications in long-distance regulation by
enhancers.
We thank C. Suñé for help during the course of this
study.
This work was supported by National Institutes of Health grant GM41052.
M.S.K. was the recipient of American Cancer Society Faculty Research
award FRA-414. C.H.-M. was supported in part by a fellowship from the
Leukemia Research Foundation.
| 1.
|
Bannister, A. J., and T. Kouzarides.
1996.
The CBP co-activator is a histone acetyltransferase.
Nature (London)
384:641-643[Medline].
|
| 2.
|
Beato, M., and K. Eisfeld.
1997.
Transcription factor access to chromatin.
Nucleic Acids Res.
25:3559-3563[Abstract/Free Full Text].
|
| 3.
|
Behrens, J.,
J. P. von Kries,
M. Kuhl,
L. Bruhn,
D. Wedlich,
R. Grosschedl, and W. Birchmeier.
1996.
Functional interaction of beta-catenin with the transcription factor LEF-1.
Nature (London)
382:638-642[Medline].
|
| 4.
|
Boyes, J., and G. Felsenfeld.
1996.
Tissue-specific factors additively increase the probability of the all-or-none formation of a hypersensitive site.
EMBO J.
15:2496-2507[Medline].
|
| 5.
|
Brannon, M.,
M. Gomperts,
L. Sumoy,
R. T. Moon, and D. Kimelman.
1997.
A -catenin/XTcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus.
Genes Dev.
11:2359-2370[Abstract/Free Full Text].
|
| 6.
|
Bruhn, L.,
A. Munnerlyn, and R. Grosschedl.
1997.
ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCR enhancer function.
Genes Dev.
11:640-653[Abstract/Free Full Text].
|
| 7.
|
Bustin, M., and R. Reeves.
1996.
High-mobility-group chromosomal proteins: architectural components that facilitate chromatin function.
Prog. Nucleic Acids Res. Mol. Biol.
54:35-100[Medline].
|
| 8.
|
Carlsson, P.,
M. L. Waterman, and K. A. Jones.
1993.
The hLEF/TCF-1 HMG protein contains a context-dependent transcriptional activation domain that induces the TCR enhancer in T cells.
Genes Dev.
7:2418-2430[Abstract/Free Full Text].
|
| 9.
|
Chen, D., and E. V. Rothenberg.
1994.
Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles.
J. Exp. Med.
179:931-942[Abstract/Free Full Text].
|
| 10.
|
Chen, X.,
K. L. Wright,
E. A. Berkowitz,
J. C. Azizkham,
J. P.-Y. Ting, and D. C. Lee.
1994.
Protein interactions at Sp1-like sites in the TGF promoter as visualized by in vivo genomic footprinting.
Oncogene
9:3179-3187[Medline].
|
| 11.
|
Chomezynski, P., and N. Saachi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 12.
|
Felsenfeld, G.
1996.
Chromatin unfolds.
Cell
86:13-19[Medline].
|
| 13.
|
Garrity, P. A.,
D. Chen,
E. V. Rothenberg, and B. Wold.
1994.
Interleukin-2 transcription is regulated in vivo at the level of coordinated binding of both constitutive and regulated factors.
Mol. Cell. Biol.
14:2159-2169[Abstract/Free Full Text].
|
| 14.
|
Giese, K.,
A. Amsterdam, and R. Grosschedl.
1991.
DNA-binding properties of the HMG domain of the lymphoid-specific transcriptional regulator LEF-1.
Genes Dev.
5:2567-2578[Abstract/Free Full Text].
|
| 15.
|
Giese, K.,
J. Cox, and R. Grosschedl.
1992.
The HMG domain of lymphoid enhancer factor 1 bends DNA and facilitates assembly of functional nucleoprotein structures.
Cell
69:185-195[Medline].
|
| 16.
|
Giese, K., and R. Grosschedl.
1993.
LEF-1 contains an activation domain that stimulates transcription only in a specific context of factor-binding sites.
EMBO J.
12:4667-4676[Medline].
|
| 17.
|
Giese, K.,
C. Kingsley,
J. R. Kirshner, and R. Grosschedl.
1995.
Assembly and function of a TCR enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions.
Genes Dev.
9:995-1008[Abstract/Free Full Text].
|
| 18.
|
Gong, Q.,
J. McDowell, and A. Dean.
1996.
Essential role of NF-E2 in remodelling a chromatin structure and transcriptional activation of the -globin gene in vivo by 5' hypersensitive site 2 of the -globin locus control region.
Mol. Cell. Biol.
16:6055-6064[Abstract].
|
| 19.
|
Gross, D. S., and W. T. Garrard.
1988.
Nuclease hypersensitive sites in chromatin.
Annu. Rev. Biochem.
57:159-197[Medline].
|
| 20.
|
Grosschedl, R.,
K. Giese, and J. Pagel.
1994.
HMG domain proteins: architectural elements in the assembly of nucleoprotein structures.
Trends Genet.
10:94-100[Medline].
|
| 21.
|
Hata, S.,
M. B. Brenner, and M. S. Krangel.
1987.
Identification of putative human T-cell receptor complementary DNA clones.
Science (Washington, D.C.)
238:678-682[Abstract/Free Full Text].
|
| 22.
|
Hata, S.,
M. Clabby,
P. Devlin,
H. Spits,
J. E. de Vries, and M. S. Krangel.
1989.
Diversity and organization of human T cell receptor variable gene segments.
J. Exp. Med.
169:41-57[Abstract/Free Full Text].
|
| 23.
|
Haynes, T. L.,
M. B. Thomas,
M. R. Dusing,
M. T. Valerius,
S. S. Potter, and D. A. Wiginton.
1996.
An enhancer LEF-1/TCF-1 site is essential for insertion site-independent transgene expression in thymus.
Nucleic Acids Res.
24:5034-5044[Abstract/Free Full Text].
|
| 24.
|
Hebbes, T. R.,
A. L. Clayton,
A. W. Thorne, and C. Crane-Robinson.
1994.
Core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken -globin chromosomal domain.
EMBO J.
13:1823-1830[Medline].
|
| 25.
|
Hebbes, T. R.,
A. W. Thorne, and C. Crane-Robinson.
1988.
A direct link between core histone acetylation and transcriptionally active chromatin.
EMBO J.
7:1395-1402[Medline].
|
| 26.
|
Hernandez-Munain, C., and M. S. Krangel.
1994.
Regulation of the T-cell receptor enhancer by functional cooperation between c-Myb and core-binding factors.
Mol. Cell. Biol.
14:473-483[Abstract/Free Full Text].
|
| 27.
|
Hernandez-Munain, C., and M. S. Krangel.
1995.
c-Myb and core-binding factor (CBF/PEBP2) display functional synergy but bind independently to adjacent sites in the T-cell receptor enhancer.
Mol. Cell. Biol.
15:3090-3099[Abstract].
|
| 28.
|
Hernandez-Munain, C.,
P. Lauzurica, and M. S. Krangel.
1996.
Regulation of T cell receptor gene rearrangement by c-Myb.
J. Exp. Med.
183:289-293[Abstract/Free Full Text].
|
| 29.
|
Ho, I.-C.,
N. K. Bhat,
L. R. Gottschalk,
T. Lindsten,
C. B. Thompson,
T. S. Papas, and J. M. Leiden.
1990.
Sequence-specific binding of human Ets-1 to the T cell receptor gene enhancer.
Science (Washington, D.C.)
250:814-818[Abstract/Free Full Text].
|
| 30.
|
Ho, I.-C.,
L.-H. Yang,
G. Morle, and J. M. Leiden.
1989.
A T-cell-specific transcriptional enhancer element 3' of C in the human T-cell receptor locus.
Proc. Natl. Acad. Sci. USA
86:6714-6718[Abstract/Free Full Text].
|
| 31.
|
Huber, O.,
R. Korn,
J. McLaughlin,
M. Ohsugi,
B. G. Hermann, and R. Kemler.
1996.
Nuclear localization of -catenin by interaction with transcription factor LEF-1.
Mech. Dev.
59:3-10[Medline].
|
| 32.
|
Jeppesen, P., and B. M. Turner.
1993.
The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression.
Cell
74:281-289[Medline].
|
| 33.
|
Kara, C. J., and L. H. Glimcher.
1991.
In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome.
Science (Washington, D.C.)
252:709-711[Abstract/Free Full Text].
|
| 34.
|
Kingston, R. E.,
C. A. Bunker, and A. N. Imbalzano.
1996.
Repression and activation by multiprotein complexes that alter chromatin structure.
Genes Dev.
10:905-920[Abstract/Free Full Text].
|
| 35.
|
Kornberg, R. D., and Y. Lorch.
1992.
Chromatin structure and transcription.
Annu. Rev. Cell Biol.
8:563-587.
|
| 36.
|
Kwok, R. P. S.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richards,
H. P. Bachinger,
R. D. Brennan,
S. G. E. Roberts,
M. R. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature (London)
370:223-226[Medline].
|
| 37.
|
Lauzurica, P., and M. S. Krangel.
1994.
Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor transgene.
J. Exp. Med.
179:43-55[Abstract/Free Full Text].
|
| 38.
|
Li, Q.,
O. Wrange, and P. Eriksson.
1997.
The role of chromatin in transcriptional regulation.
Int. J. Biochem. Cell. Biol.
29:731-742[Medline].
|
| 39.
|
Love, J. J.,
X. Li,
D. A. Case,
K. Giese,
R. Grosschedl, and P. E. Wright.
1995.
Structural basis for DNA bending by the architectural transcription factor LEF-1.
Nature (London)
376:791-795[Medline].
|
| 40.
|
Mach, B.,
V. Steimle,
E. Martinez-Soria, and W. Reith.
1996.
Regulation of MHC class II genes: lessons from a disease.
Annu. Rev. Immunol.
14:301-331[Medline].
|
| 41.
|
Martinez-Balbas, M. A.,
A. Dey,
S. K. Rabindran,
K. Ozato, and C. Wu.
1995.
Displacement of sequence-specific transcription factors from mitotic chromatin.
Cell
83:29-38[Medline].
|
| 42.
|
Mayall, T. P.,
P. L. Sheridan,
M. R. Montminy, and K. A. Jones.
1997.
Distinct roles for P-CREB and LEF-1 in TCR enhancer assembly and activation on chromatin templates in vitro.
Genes Dev.
11:887-899[Abstract/Free Full Text].
|
| 43.
|
McMurry, M. T.,
C. Hernandez-Munain,
P. Lauzurica, and M. S. Krangel.
1997.
Enhancer control of local accessibility to V(D)J recombinase.
Mol. Cell. Biol.
17:4553-4561[Abstract].
|
| 44.
|
Moolenar, M.,
M. Van de Wetering,
M. Oosterwegel,
J. Peterson-Maduro,
S. Godsave,
V. Korinek,
J. Roose,
O. Destree, and H. Clevers.
1996.
Xtcf-3 transcription factor mediates -catenin-induced axis formation in Xenopus embryos.
Cell
86:391-399[Medline].
|
| 45.
|
Mueller, P. R.,
P. A. Garrity, and B. Wold.
1992.
Ligation-mediated PCR for genomic sequencing and footprinting, p. 1-26.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 46.
|
Mueller, P. R., and B. Wold.
1989.
In vivo footprinting of a muscle specific enhancer by ligation mediated PCR.
Science (Washington, D.C.)
246:780-786[Abstract/Free Full Text].
|
| 47.
|
Ogryzko, V. V.,
R. L. Schiltz,
V. Russanova,
B. H. Howard, and Y. Nakatani.
1996.
The transcriptional coactivators p300 and CBP are histone acetyltransferases.
Cell
87:953-959[Medline].
|
| 48.
|
Paranjape, S. M.,
R. T. Kamakaka, and J. T. Kadonaga.
1994.
Role of chromatin structure in the regulation of transcription by RNA polymerase II.
Annu. Rev. Biochem.
63:265-297[Medline].
|
| 49.
|
Pfeifer, G. P., and A. D. Riggs.
1991.
Chromatin differences between active and inactive X chromosomes revealed by genomic footprinting of permeabilized cells using DNase I and ligation-mediated PCR.
Genes Dev.
5:1102-1113[Abstract/Free Full Text].
|
| 50.
|
Redondo, J. M.,
J. L. Pfohl, and M. S. Krangel.
1991.
Identification of an essential site for transcriptional activation within the human T-cell receptor enhancer.
Mol. Cell. Biol.
11:5671-5680[Abstract/Free Full Text].
|
| 51.
|
Riese, J.,
X. Yu,
A. Munnerlyn,
S. Eresh,
S.-C. Hsu,
R. Grosschedl, and M. Bienz.
1997.
LEF-1, a nuclear factor coordinating signaling imputs from wingless and decapentaplegic.
Cell
88:777-787[Medline].
|
| 52.
|
Rigaud, G.,
J. Roux,
R. Pictet, and T. Grange.
1991.
In vivo footprinting of rat TAT gene: dynamic interplay between the glucocorticoid receptor and a liver-specific factor.
Cell
67:977-986[Medline].
|
| 53.
|
Roberts, J. L.,
P. Lauzurica, and M. S. Krangel.
1997.
Developmental regulation of VDJ recombination by the core fragment of the T cell receptor enhancer.
J. Exp. Med.
185:131-140[Abstract/Free Full Text].
|
| 54.
|
Rothenberg, E. V., and S. B. Ward.
1996.
A dynamic assembly of diverse transcription factors integrates activation and cell-type information for the interleukin 2 gene regulation.
Proc. Natl. Acad. Sci. USA
93:9358-9365[Abstract/Free Full Text].
|
| 55.
|
Sheridan, P. L.,
C. T. Sheline,
K. Cannon,
M. L. Voz,
M. J. Pazin,
J. T. Kadonaga, and K. A. Jones.
1995.
Activation of the HIV-1 enhancer by the LEF-1 HMG protein on nucleosome-assembled DNA in vitro.
Genes Dev.
9:2090-2104[Abstract/Free Full Text].
|
| 56.
|
Sleckman, B. P.,
C. G. Bardon,
R. Ferrini,
L. Davidson, and F. W. Alt.
1997.
Function of the TCR enhancer in  and  T cells.
Immunity
7:505-515[Medline].
|
| 57.
|
Sleckman, B. P.,
J. R. Gorman, and F. W. Alt.
1996.
Accessibility control of antigen receptor variable region gene assembly: role of cis-acting elements.
Annu. Rev. Immunol.
14:459-481[Medline].
|
| 58.
|
Stanhope-Baker, P.,
K. M. Hudson,
A. L. Shaffer,
A. Constantinescu, and M. S. Schlissel.
1996.
Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro.
Cell
85< |