Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3310-3320, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
TFII-I Enhances Activation of the c-fos
Promoter through Interactions with Upstream Elements
Dae-Won
Kim,1
Venugopalan
Cheriyath,2
Ananda L.
Roy,2 and
Brent H.
Cochran1,*
Department of Cellular and Molecular
Physiology1 and
Department of
Pathology,2 Tufts University School of
Medicine, Boston, Massachusetts 02111
Received 5 December 1997/Returned for modification 19 January
1998/Accepted 20 March 1998
 |
ABSTRACT |
The transcription factor TFII-I was initially isolated as a factor
that can bind to initiator elements in core promoters. Recent evidence
suggests that TFII-I may also have a role in signal transduction. We
have found that overexpression of TFII-I can enhance the response of
the wild-type c-fos promoter to a variety of stimuli. This
effect depends on the c-fos
c-sis-platelet-derived growth factor-inducible factor
binding element (SIE) and serum response element (SRE). There is no
effect of cotransfected TFII-I on the TATA box containing the
c-fos basal promoter. Three TFII-I binding sites can be
found in c-fos promoter. Two of these overlap the
c-fos SIE and SRE, and another is located just upstream of the TATA box. Mutations that distinguish between serum response factor
(SRF), STAT, and TFII-I binding to the c-fos SIE and SRE suggest that the binding of TFII-I to these elements is important for
c-fos induction in conjunction with the SRF and STAT
transcription factors. Moreover, TFII-I can form in vivo
protein-protein complexes with the c-fos upstream
activators SRF, STAT1, and STAT3. These results suggest that TFII-I may
mediate the functional interdependence of the c-fos SIE and
SRE elements. In addition, the ras pathway is required for
TFII-I to exert its effects on the c-fos promoter, and
growth factor stimulation enhances tyrosine phosphorylation of TFII-I.
These results indicate that TFII-I is involved in signal transduction
as well as transcriptional activation of the c-fos promoter.
 |
INTRODUCTION |
TFII-I is a transcription factor
that was initially characterized as a factor that binds to initiator
sites (Inr) of various promoters (48). It has been
implicated in the initiation of transcription of TATA-less promoters
and in cell-type-specific transcription as well (31, 48).
Deletions of TFII-I are closely associated with neurodevelopmental
Williams-Beuren syndrome in humans (41). TFII-I can also
bind to E-box elements and can interact with upstream regulatory
factors, including USF1 and c-myc (46, 47). In addition,
TFII-I can associate with Bruton's tyrosine kinase (Btk), and its
phosphorylation on tyrosine is stimulated by it (69). The
activity of TFII-I is regulated by phosphorylation, and one of the
potential phosphorylation sites is a mitogen-activated protein (MAP)
kinase phosphorylation site (40). These observations suggest
that TFII-I may play a role in signal transduction as well as in
transcriptional initiation. In addition, Grueneberg et al.
(13) have shown that TFII-I associates with the serum
response factor (SRF) and the Phox1 protein, which are both involved in
the regulation of the c-fos promoter.
The c-fos promoter is the best-studied immediate-early gene
promoter and is well known for being responsive to a variety of extracellular ligands (2, 12, 30, 36). The c-fos
promoter is a TATA box-containing promoter with several upstream
elements, including a calcium cyclic AMP response element (CRE), a
serum response element (SRE), and a c-sis-platelet-derived
growth factor (PDGF)-inducible factor element (SIE) (1, 52,
68). The CREB transcription factor has been associated with
calcium and cyclic AMP induction of the c-fos promoter
through the CRE, and the SIE element binds to STAT proteins and can
regulate the responses to PDGF and tyrosine kinases (9, 34, 50,
56-59). The SRE binds to SRF and can form complexes with a
number of other transcription factors, most notably ternary complex
factors (TCFs), including Elk-1 and SAP-1, which are responsive to MAP
kinase and related pathways (11, 20, 24, 32, 38, 65).
Although the c-fos promoter has been extensively studied,
there are still a number of outstanding issues remaining in the understanding of its regulation. SRF can form a ternary complex with
the various TCFs and can respond to signals from MAP kinase and MAP
kinase-related kinases (3, 24, 55). However, there is
substantial evidence of another pathway that leads to the activation of
the SRE that is activated by small GTP-binding proteins (G proteins),
such as RhoA (23, 27, 44). This pathway appears not to
require the TCFs. The mechanism by which this pathway stimulates the
c-fos promoter through the SRE is unclear. In addition,
results from the introduction of the c-fos promoter into
transgenic animals indicate a high degree of interdependence between
c-fos promoter elements (45). The mechanism that
accounts for this interdependence is also not well understood.
Here, we report that TFII-I can enhance the transcriptional activity of
the c-fos promoter in a manner that is dependent on upstream
elements, including both the SIE and SRE. TFII-I can bind three
different sites in the c-fos promoter, including the SIE and
SRE, in a sequence-specific manner, and these TFII-I binding sites are
required to be intact for the optimal activity of the c-fos
promoter. Moreover, we find that critical promoter binding proteins
SRF, STAT1, and STAT3 form complexes with TFII-I in vivo. TFII-I
requires a functioning ras pathway for its activity, and its
tyrosine phosphorylation is enhanced after epidermal growth factor
(EGF) stimulation. These results suggest that TFII-I plays an important
role in the activation and regulation of the c-fos promoter.
 |
MATERIALS AND METHODS |
Plasmids.
For reporter assays, pSVOA
5' containing a
379-bp murine c-fos promoter was used for the wild-type
c-fos luciferase construct (4, 17), and other
mutant promoters were generated by PCR and cloned into the same vector.
All insertions were made into the HinDIII sites of the
vector. The structures of the newly generated constructs were verified
by sequencing. Thymidine kinase (TK) luciferase constructs were
described previously (17, 63). For transient overexpression
of human TFII-I, the pEBG-His6-TFII-I construct was used
(1a). Mouse STAT1 and human STAT3 expression plasmids were
previously described (9, 71). Human SRF full-length cDNA was
excised from the pG3.5 plasmid (38) and cloned into pCDNA3
vector (Invitrogen) for mammalian expression. pCMV.Elk-1 was obtained
from Peter Shaw (29). The pRL-TK luciferase construct was
obtained from Promega for standardization of transfection. pMT3.N17Ras
was obtained from Larry Feig and was previously described (8).
The following top strand primers were used in the PCR mutagenesis
(lowercase letters indicate nucleotides that differ from the wild-type
sequence):
SIE,
GGGGAAGCT TCTGCAGTCCT T TACACAGGATGTCCATAT TAGGACA;
m34SIE,
GGGGAAGCTTCTGCAGCCGGCGAGCTGTTCaCGTCAATCCCTCCCTCCTTTACACAGGATGTCCATATTAGGACATCT; m67SIE,
GGGGAAGCT TCTGCAGCCGGCGAGCatT TCCCGTaAATCCCTCCCTCCT T TACACAGGATGTCCATATTAGGACATCT;
mTCF,
GGGGAAGCTTCTGCAGCTGTTCCCGTCAATCCCTCCCTCCTTTACAactGATGTCCATATTAGGACATCTGCGTCAGCAGGTTTCCACGG; mSRE-S,
GGGGAAGCTTCTGCAGCTGT TCCCGTCAATCCCTCCCTCCT T TACACAGGATGTCCATATTAccACATCTGCGTCAGCAGGTTTCCACGG; mSRE-T,
GGGGAAGCTTCTGCAGCTGTTCCCGTCAATCCCTCCCTCCT T TACACAGGATGTCCtTATaAGGACATCTGCGTCAGCAGGTTTCCACGG; mSRE-ST,
GGGGAAGCTTCTGCAGCTGTTCCCGTCAATCCCTCCCTCCT T TACACAGGATGTggATATTAccACATCTGCGTCAGCAGGTTTCCACGG; Basal,
GGGGAAGCTTCTGCAG TAGGAAGTCCATCCATTCACAGCGC T TC TATAAAGGCGCCAGCTGAGGCGCCTACTA; mBasal,
GGGGAAGCTTCTGCAGCCGGCGAGCTG T TCCCG TCAATCCCTCCCTCCT T TACACAGGATGTCCATATTAGG;
and m67SIE/mSRE-T,
GGGGAAGCTTCTGCAGCCGGCGAGCatT TCCCG TaAATCCCTCCCTCC T T TACACAGGATG TCCAaAT TtGGACATCTGCGTCAGCAGGTTTCCACGG.
The following bottom strand primer (except mBasal) was also used in the
PCR mutagenesis: GGGGAAGCTTCCCGGGAGTAGTAGGCGCCTCAGCTGGCGCCTTTATA.
The bottom strand primer for mBasal was
GGGGAAGCTTCCCGGGAGTAGTAGGCGCCTCAGCTGGCCGTTTATAGAAGCGCTGTGcccGGATGGACTTCCTACGTCACTGGGCGGAAC.
Antibodies.
Anti-STAT1 polyclonal rabbit antiserum was made
against the synthetic peptide containing the unique C-terminal 37 amino
acids of murine STAT1 protein. Anti-STAT3 antibody was a polyclonal rabbit antiserum made against another unique sequence in the C-terminal region of human STAT3 (amino acids 688 to 700). Anti-TFII-I polyclonal antibody was made against the synthetic peptide (amino acids 301 to
321) and affinity purified as previously described (39). The
anti-CDK4, -Elk-1, and -SRF antibodies were obtained from Santa Cruz
Biotechnology. The anti-phosphotyrosine antibody (4G10) was obtained
from UBI. The anti-GST antibody was obtained from Sigma.
Cell culture and transfections.
Murine NIH 3T3 fibroblasts
were grown in Dulbecco's modified Eagle's medium (DMEM) with 10%
calf serum (CS). COS-1 cells were cultured in DMEM with 10% fetal CS
(FCS). For transient transfection assays, the calcium phosphate method
was used with a calcium phosphate transfection kit from 5 Prime
3
Prime Co. (Boulder, Colorado). For reporter assays, NIH 3T3 cells were
maintained for 30 to 40 h in medium containing 0.5% CS following
transfection and stimulated with various reagents (CS, 10%;
lipophosphatidic acid (LPA), 10 µM; tetradecanoyl phorbol acetate
(TPA), 50 ng/ml; PDGF, 25 ng/ml) for 2.5 to 4 h before harvest.
Four micrograms of reporter construct, 3 µg of pEBG-TFII-I (or pEBG)
expression plasmid, and 1 µg of pRL-TK normalization plasmid were
used per 60-mm-diameter dish. pMT3.N17Ras (0.5 µg) was included where
indicated. A dual-luciferase assay was carried out according to the
manufacturer's recommendation (Promega). All transfection experiments
were performed in duplicate, and results were normalized to the
expression of the Renilla luciferase transfection control.
For mammalian overexpression of TFII-I, SRF, Elk-1, STAT1, and STAT3,
COS-1 cells were maintained before harvest for 36 h in medium
containing 10% FCS following transfection. Seven micrograms of
pEBG-TFII-I or pEBG or 10 µg of the SRF, Elk-1, STAT1, or STAT3
constructs was used per 100-mm-diameter plate. The total amount of DNA
was kept at 17 µg per 100-mm-diameter dish, with pEBG added to adjust
total amounts of DNA where necessary. For EGF stimulation, COS-1 cells
were maintained for 40 h in medium containing either 0.5 or 10%
FCS following transfection and stimulated with 20 ng of EGF per ml for
20 min before harvest for Western blotting analysis.
Isolation of overexpressed TFII-I.
Transfected COS-1 cells
were lysed in buffer A (20 mM Tris [pH 7.8], 500 mM KCl, 10%
glycerol, 1% Triton X-100, 0.5 mM phenylmethylsulfonyl fluoride
(PMSF), and 1 µg each of leupeptin, antipain, pepstatin, and
chymostatin per ml), and the lysate was then centrifuged for 10 min at
10,000 × g at 4°C. Supernatants were incubated with Ni-nitrilotriacetic acid (NTA) agarose beads (Qiagen) for 1 h at
4°C to pull down His6-TFII-I. The beads were collected
by quick spin with a table top microcentrifuge and washed with buffer A supplemented with 20 mM imidazole four times, and the bound fraction was eluted from the column with 250 mM imidazole. The excess imidazole was removed from the sample by gel filtration with a PD10 prepacked desalting column (Pharmacia). The TFII-I-SRF complex for Fig. 2B was
purified similarly from TFII-I-SRF cotransfected COS-1 cells by using
buffer B (20 mM Tris [pH 7.8], 100 mM KCl, 10% glycerol, 0.2%
Triton X-100, 0.5 mM PMSF, and 1 µg each of leupeptin, antipain,
pepstatin, and chymostatin per ml).
Preparation of nuclear extracts.
NIH 3T3 cells were starved
for 48 h with 0.5% CS in DMEM and stimulated with 25 ng of PDGF
per ml for 20 min. The cells were rinsed three times with ice-cold
phosphate-buffered saline (PBS). PBS containing 1 mM
Na3VO4 and 5 mM NaF was added to each plate, and the cells were scraped from the dish and pelleted at 1,500 × g for 10 min at 4°C. Cells were resuspended in the same
buffer and pelleted as before. The pellet was then resuspended in 0.8 ml of ice-cold hypotonic buffer, transferred to microcentrifuge tubes,
and allowed to swell on ice for 15 to 30 min. The lysate was vortexed
vigorously for 1 min, and the nuclei were pelleted (10,000 × g for 30 s). The nuclear pellets were resuspended in 100 to 150 µl of high-salt buffer and rotated at 4°C for 30 min. The extracted proteins were separated from residual nuclei (10,000 × g for 10 min), and the supernatant was quick-frozen in a
dry ice-methanol bath. The buffer compositions were as follows. (i) Hypotonic buffer contained 10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM
MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM
Na3VO4, 1 mM
Na4P2O7, 20 mM NaF, 1 mM
dithiothreitol (DTT), 0.5 mM PMSF, and 1 µg each of leupeptin,
antipain, pepstatin, and chymostatin per ml. (ii) High-salt buffer
contained 20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2,
25% glycerol, 1 mM EDTA, 1 mM EGTA, 1 mM
Na3VO4, 1 mM
Na4P2O7, 20 mM NaF, 1 mM DTT, 0.5 mM PMSF, and 1 µg each of leupeptin, antipain, pepstatin, and
chymostatin per ml.
EMSA.
Binding reactions for electrophoretic mobility shift
assays (EMSAs) with affinity-purified recombinant TFII-I (see Fig. 2A and 3) or TFII-I-SRF complex (Fig. 2B) were done in a mixture of 20 mM
Tris (pH 7.5), 100 mM KCl, 3 mM MgCl2, 5 mM DTT, 5%
glycerol, 250 µg of bovine serum albumin (BSA) per ml, and 5 µg of
poly(dG-dC) per ml. EMSA with nuclear extract (see Fig. 9) was done in
a mixture of 20 mM Tris (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 5 mM DTT,
10% glycerol, 250 µg of BSA per ml, and 50 µg of poly(dG-dC) per
ml. Four micrograms of nuclear extract was used with or without
purified TFII-I. Reaction mixtures were incubated at room temperature
for 15 min prior to addition of labeled probes and for another 15 min
after the addition of various 32P-labeled probes (50,000 cpm). All of the EMSA probes were labeled by Klenow reaction with
-32P-dCTP after annealing of two complementary
oligonucleotides. If necessary, antibodies or cold competitors (50- or
200-fold excess) were preincubated before the addition of various
32P-labeled probes. Binding reaction mixtures, except for
those used for Fig. 2B (TFII-I-SRF complex EMSA), were electrophoresed through 5% polyacrylamide gels (39:1 acrylamide-bisacrylamide) containing 2.5% glycerol in 0.5× Tris-borate-EDTA buffer at room temperature. The binding reaction mixtures with the TFII-I-SRF complex
(Fig. 2B) were electrophoresed through a 3.5% polyacrylamide gel (39:1
acrylamide-bisacrylamide containing 1.25% glycerol in 89 mM
Tris-borate buffer without EDTA and supplemented with 3 mM
MgCl2 at room temperature. The gel was then fixed, dried,
and exposed to X-ray film.
The following oligonucleotides were used in EMSAs: SIE,
AATTCCTGTTCCCGTCAATCCCTCCCC; m34SIE,
AATTCCTGTTCaCGTCAATCCCTCCCC;
m67SIE,
AATTCCatTTCCCGTaAATCCCTCCCC; mTCF,
AATTCTCCTTTACAactGATGTCCATATTAGGACATCTC;
SRE,
AATTCTCCTTTACACAGGATGTCCATATTAGGACATCTC; mSRE-S,
AATTCTCCTTTACACAGGATGTCCATATTAccACATCTC;
mSRE-T,
AATTCTCCTTTACACAGGATGTCCtTATaAGGACATCTC; SIE/SRE,
AATTCCTGTTCCCGTCAATCCCTCCCTCCTTTACACAGGATGTCCATATTAGGACATCTC;
c-
fos basal,
AAT TCG TAGGAAG TCCATCCATTCACAGCGC T TC TATAAACGGCCAGCTGAGGCGCCTACTACTCCAACCGCGACTGCAC;

47/II-I, AATTCGTAGGAAGTCCATCCATTCACAGCGCTTCC; TATA,
AATTCCACAGCGCTTCTATAAACGGCCAGCTGAG;

5/II-I,
AATTCAGGCGCCTACTACTCCAACCGCGACTGCAC; m

47/II-I,
AATTCGTAGGAAGTCCgggCATTCACAGCGCTTCC;
and E-box,
GGGCCCCCACCACGTGGTGCCTGA.
GST pulldown and Western analysis.
Transfected COS-1 cells
were lysed in buffer B (20 mM Tris [pH 7.8], 100 mM KCl, 10%
glycerol, 0.2% Triton X-100, 0.5 mM PMSF, and 1 µg each of
leupeptin, antipain, pepstatin, and chymostatin per ml), and the lysate
was then centrifuged for 10 min at 10,000 × g at
4°C. Supernatants were incubated with glutathione-Sepharose beads
(Pharmacia) for 1 h at 4°C to pull down either glutathione S-transferase (GST) or GST-TFII-I. The beads were collected
by quick spin with a table top microcentrifuge, washed with buffer B
four times, and finally resuspended in 2× Laemmli sample buffer. Western blot analyses with anti-SRF, -Elk-1, -STAT1, -STAT3, -GST, or
-phosphotyrosine (4G10) antibodies were carried out under standard conditions.
 |
RESULTS |
TFII-I binds to the c-fos SRE and forms a complex with
SRF in vivo.
TFII-I binds to a subset of consensus Inr sequences
(49). Comparison of the Inr consensus-binding sequence
(YYAN[A/T]YY) (26) to that of the c-fos
promoter indicates four possible TFII-I binding sites, three of which
are shown in Fig. 1. Two of these potential binding sites overlap the c-fos SIE and SRE, and
the other two (
47 and
5) are located in the basal region of the c-fos promoter. To determine whether TFII-I can bind to the
c-fos SRE, recombinant TFII-I protein affinity purified from
His6-TFII-I-transfected COS-1 cells was incubated with
32P-labeled SRE probe and analyzed by EMSA. The results are
shown in Fig. 2A. Several bands are
shifted with this probe. To determine which of these bands contain
TFII-I, anti-TFII-I antibody was added to the binding reaction mixture
prior to electrophoresis. From lane 4, the anti-TFII-I antibody
appeared to disrupt most efficiently the lower, heavier band and a
series of slightly higher bands (indicated as TFII-I and
TFII-Io, respectively, in Fig. 2A). The multiple
TFII-I-containing bands (TFII-Io) are presumably due to
processing, differential phosphorylation, or formation of complexes
with other factors. Interestingly, one of the weak upper bands that did
not react with the TFII-I antibody ran at a position that was
consistent with the position of SRF. To determine whether this band in
fact contained SRF, an anti-SRF antibody was added to the binding
reaction mixture prior to electrophoresis. From lane 6, it can be seen
that the anti-SRF antibody specifically disrupted one of the upper
bands (indicated as SRF in Fig. 2A), indicating that this weak band
does contain SRF. These data demonstrate that endogenous SRF or
SRF-related protein from COS-1 cells forms an in vivo complex with
TFII-I and copurifies with it. SRF and TFII-I also form a complex that
can be coprecipitated from transfected cells (see Fig. 7). The
interaction between TFII-I and SRF is relatively strong in solution,
since His6-TFII-I was purified over the Ni-NTA agarose
column in the presence of 1% Triton X-100 and 500 mM KCl, which are
relatively stringent conditions. Control extracts from cells without
transfected His6-TFII-I run over the Ni-NTA agarose column
under the same conditions showed neither TFII-I nor SRF binding
activity (data not shown). Anti-Cdk4 and anti-Elk-1 antibodies failed
to react with any of the shifted bands (lanes 3 and 5). Likewise,
anti-STAT1 and anti-STAT3 antibodies also failed to shift any of the
bands (data not shown). Neither TFII-I nor Elk-1 appears to be in the
SRF complex observed on the band shift gel in Fig. 2A run in the
presence of EDTA. Thus, despite the fact that the TFII-I complex
copurifies with SRF in solution over the Ni-NTA agarose beads, the
complex dissociates under the conditions of this EMSA. This behavior
has been noted for other transcription factors that interact with
TFII-I (35).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of c-fos promoter sequences and
binding sites. (A) Major elements and TFII-I binding sites in the
c-fos promoter. (B) Mutant c-fos promoters. (The
wild-type sequence is given for comparison.)
|
|

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Binding of TFII-I to the c-fos SRE. (A)
TFII-I protein purified from TFII-I-transfected COS-1 cells was
incubated with the indicated 32P-labeled oligonucleotide
probes and processed for EMSA as described in Materials and Methods.
The specified antibodies were preincubated with affinity-purified
TFII-I for 15 min at room temperature where indicated. (B) TFII-I
purified from TFII-I-SRF-cotransfected COS-1 cells was incubated with
the c-fos SRE 32P-labeled oligonucleotide probes
and processed for EMSA as described in Materials and Methods. EDTA was
removed from the gel and the running buffer, and 3 mM MgCl2
was added as a supplement. The specified antibodies were preincubated
with the extracts for 15 min at room temperature where indicated.
|
|
mSRE-S and mSRE-T mutants dissociate SRF and TFII-I binding to the
SRE.
To determine whether the binding of SRF and TFII-I to the SRE
could be discriminated, two mutant SRE probes were designed and
synthesized. The mSRE-S probe has mutations at the 3' end of the CArG
box, which is outside of the TFII-I binding site (Fig. 1B), and the
mSRE-T probe has mutations in the internal core region of the CArG box
that leave the exterior C's and G's intact (Fig. 1B). It has been
shown that SRF binding can tolerate these internal core base changes
(42), but the mSRE-T mutation should eliminate the binding
of TFII-I (26). Therefore, the mSRE-S mutant was predicted
to be specifically defective for SRF binding, leaving TFII-I binding
intact and vice versa for the mSRE-T mutant. When each of these
oligonucleotides was used as a probe in the binding assay, the results
were as predicted. The mSRE-S oligonucleotide fails to form the upper
band which contains SRF (Fig. 2A, lane 10), and the mSRE-T probe has
diminished binding of the lower band which contains TFII-I (Fig. 2A,
lane 12). The band patterns in the EMSA are not significantly affected
by introduction of the mutations in the TCF site of the SRE probe (Fig.
2A, lane 8).
The TFII-I-SRF complex can bind to c-fos SRE.
In
order to demonstrate that TFII-I and SRF can bind to the
c-fos SRE as a complex, modified EMSA conditions were used.
TFII-I was purified through the Ni-NTA agarose column from TFII-I- and SRF-co-overexpressing COS-1 cells to maximize the formation of TFII-I-SRF complex. EDTA was removed from both the EMSA polyacrylamide gel and running buffer, and 3 mM MgCl2 was used as a
supplement to stabilize the DNA-protein complexes. The results are
shown in Fig. 2B. Two bands are shifted under these conditions (lane 2), and both of these bands are diminished by the addition of anti-TFII-I antibody, indicating that both bands contain TFII-I (lane
3). The upper band (indicated as TFII-I/SRF on the figure) in addition
can be shifted with anti-SRF antibody (lane 4), but not with an
anti-Cdk4 antibody (lane 5). Thus, the upper band contains both TFII-I
and SRF. It also can be concluded that TFII-I DNA binding contributes
to the binding of the TFII-I-SRF complex to the SRE, because the
mSRE-S competitor oligonucleotide, which is specifically defective for
SRF binding while leaving TFII-I binding intact, efficiently competes
out the binding (lane 7). If the binding of the TFII-SRF complex were
primarily determined by SRF binding to c-fos SRE, then the
mSRE-S oligonucleotide should not have competed out the binding.
m34SIE and m67SIE mutants dissociate STAT and TFII-I binding to the
SIE.
To determine whether TFII-I can bind to the c-fos
SIE, the same affinity-purified, recombinant TFII-I as that shown in
Fig. 2A was incubated with 32P-labeled SIE probe and
analyzed by EMSA. The results are shown in Fig.
3A. A major band (indicated as TFII-I in
Fig. 3) can be seen in lane 2 and is abolished by the addition of
anti-TFII-I antibody (lane 3), suggesting that TFII-I does bind to
c-fos SIE. Competition experiments with the
32P-labeled SIE probe and 50- or 200-fold excess cold SIE,
m34SIE, m67SIE, and SRE oligonucleotides as competitors were also
carried out, and the results are shown in lanes 4 to 11. Both the
wild-type SIE and the m34SIE (Fig. 1B), which is defective for STAT
binding (68), can compete for TFII-I binding (lanes 4 to 7).
Interestingly, the high-affinity mutant SIE (m67SIE), which binds STAT
proteins with greater affinity (68), has a mutation that
disrupts the consensus binding motif for TFII-I (Fig. 1B) and does not
compete efficiently for TFII-I binding, even in the presence of
200-fold excess unlabeled probe (lanes 8 and 9). Thus, consistent with the results of Grueneberg et al. (13), the m34SIE mutant is specifically defective for STAT binding, leaving TFII-I binding intact
and vice versa for the m67SIE mutant. Moreover, the finding that the
SRE oligonucleotide also competes very effectively for TFII-I binding
against the SIE (lanes 10 and 11) suggests that the same DNA binding
domain of TFII-I is utilized for binding of both SRE and SIE.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of TFII-I to the c-fos SIE. (A)
TFII-I, prepared as described for Fig. 2A, was incubated with
32P-labeled c-fos SIE probe and processed for
EMSA as described in Materials and Methods. Anti-TFII-I antibody
( -TFII-I) or the indicated unlabelled oligonucleotide competitor
DNAs were preincubated with affinity-purified TFII-I for 15 min at room
temperature where indicated. (B) Affinity-purified recombinant TFII-I
was incubated with 32P-labeled c-fos basal probe
( 60 to +18) and processed for EMSA as described in Materials and
Methods. Anti-TFII-I antibody or the indicated unlabelled
oligonucleotide competitor DNAs were preincubated with the extracts for
15 min at room temperature where indicated.
|
|
TFII-I can bind to c-fos basal promoter through the
47 TFII-I site.
Two possible TFII-I binding sites can be found
in the basal region of murine c-fos promoter at
47 (
50
catccattcaca
39) and
5 (
8
ctactactccaac +3) (underlined sequences match the
TFII-I consensus sequence). (Note that the putative +1 site is
taken from the GenBank murine c-fos entry, accession no.
V00727.) To determine whether TFII-I can bind these sites, purified
recombinant TFII-I was incubated with 32P-labeled
c-fos basal probe (
60 to +18) and analyzed by EMSA. The
results are shown in Fig. 3B. TFII-I can bind to the c-fos basal probe (lane 2), and this band is abolished either by anti-TFII-I antibody (lane 3) or by self competitor (lane 4), showing the specificity of this binding. SRE unlabeled competitor can also compete
this binding (lane 6), suggesting that TFII-I utilizes the same DNA
binding domain for c-fos basal probe binding as well as SRE
binding. This domain is distinct from that used in E-box binding (lane
5) to which TFII-I also binds (41, 42). This observation is
consistent with the notion that TFII-I has two different DNA binding
domains.
In order to locate the functional TFII-I binding site in the basal
probe, three different regions of c-
fos basal probe,
including
the

47 TFII-I site (indicated as

47/II-I;

60 to

32),
TATA
box (indicated as TATA;

42 to

14), and

5 TFII-I site
(indicated
as

5/II-I;

11 to +18) were used as unlabeled competitor
DNAs
(lanes 7 to 9). The results demonstrate that only the sequence
at

47 is capable of competing for TFII-I binding (lane 7). Moreover,
an
oligonucleotide (indicated as m

47/II-I in lane 10) which has
mutations in the consensus sequence for TFII-I binding (see mBasal
in
Fig.
1) was not able to compete for TFII-I binding, demonstrating
that
the binding between TFII-I and c-
fos basal probe is mediated
by the TFII-I binding motif present at the

47 location. Thus,
TFII-I
can bind the basal region of c-
fos promoter as well as
upstream enhancers, including the SIE and SRE. However, mutation
of
this site had no significant effect on c-
fos promoter
activation
by serum in a transient assay (data not shown). In addition,
TFII-I
appears to be unable to bind to the putative

5 site, which is
the location nearest the initiation site. Moreover, this putative
Inr
sequence is not conserved between the mouse (
CTACTC)
and human
(
GTACTC) c-
fos
promoters (change underlined), though the other
3 TFII-I binding sites
are (
43). Thus, it is unlikely that c-
fos has a
functional Inr element, and since TFII-I does not bind near
the
initiation site as well, it is highly unlikely that TFII-I
functions as
a classical initiator factor in the c-
fos promoter.
TFII-I enhances c-fos promoter activation in vivo in a
manner that is dependent on upstream elements.
The fact that
TFII-I can bind to the c-fos SRE and SIE and can form a
complex with SRF suggests that TFII-I may be involved in
c-fos promoter regulation. To determine whether TFII-I can functionally affect c-fos induction, TFII-I was
cotransfected with a wild-type c-fos promoter driving a
luciferase reporter gene into NIH 3T3 fibroblasts, and luciferase
activity was measured before and after simulation with various agents.
The results are shown in Fig. 4A. TFII-I
cotransfection enhanced the activity of the wild-type c-fos
promoter two- to fourfold. This enhancement occurred in response to a
variety of c-fos stimulators, including serum, TPA, LPA, and
PDGF. Since these agents activate a variety of c-fos signal
transduction pathways, this result suggests that TFII-I has an impact
on more than one signal transducer in the c-fos promoter and
may be involved in enhancing the cooperativity between them.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
TFII-I enhances c-fos promoter activation.
(A) NIH 3T3 cells were transfected with the wild-type (WT)
c-fos/Luc reporter constructs and TFII-I. For control
cultures, the empty vector of TFII-I expression plasmid was
cotransfected with reporter constructs. Cells were serum starved for
36 h in 0.5% CS and then stimulated for 4 h with 10% CS, 50 ng of TPA per ml, 10 µM LPA, or 25 ng of PDGF-BB per ml in DMEM. Cell
extracts were then processed for luciferase activity. Relative
luciferase activities shown here are from a representative experiment,
and similar results were obtained from four further independent
experiments. All transfections were performed in duplicate for each
experiment, and the values between the duplicates were within 10% of
the mean. (B) TFII-I fails to transactivate the TK and c-fos
basal promoters. The TK/Luc, c-fos basal ( 57)/Luc, and
wild-type c-fos/Luc reporter constructs were transfected
into NIH 3T3 cells with or without TFII-I. Unstimulated or 10%
CS-stimulated cells were then analyzed for luciferase activity. The
data shown are the average of three independent experiments, and the
standard deviations between experiments were on average 30% of the
values shown here. All transfections were performed in duplicate for
each experiment, and the values between the duplicates were within 10%
of the mean.
|
|
Since TFII-I was originally isolated as a basal transcription initiator
factor, the effects of TFII-I on the activation of
truncated (

57)
c-
fos basal (Fig.
1B) or TK promoter by serum
were also
examined. The results are shown in Fig.
4B. c-
fos promoter
activity in the absence of upstream elements is not affected by
TFII-I
cotransfection. In addition, ectopic TFII-I fails to enhance
the
activity of the Inr-less TK promoter under either serum-stimulated
or
unstimulated conditions. Thus, the enhancement effect of TFII-I
on the
c-
fos promoter requires the presence of upstream elements
which are not present in either the truncated c-
fos basal
promoter
or the TK promoter.
To determine which c-
fos upstream elements are required for
enhancement by TFII-I, a variety of reporter constructs containing
point mutations or small deletions in the wild-type c-
fos
promoter
were generated and tested for their response to ectopically
expressed
TFII-I during serum induction of c-
fos promoter.
The mutations
introduced into the reporters include

SIE, m34SIE,
m67SIE, mTCF,
mSRE-S, mSRE-T, mSRE-ST, and each mutation is denoted in
Fig.
1B. The results are summarized in Fig.
5 and
6.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of mutations of the c-fos SRE on
TFII-I transactivation. NIH 3T3 cells were transfected with the
indicated c-fos/Luc reporter constructs with or without
TFII-I. Cells were serum starved for 36 h in 0.5% calf serum and
then stimulated for 2.5 h with 10% CS in DMEM. Cell extracts were
then processed for luciferase activity. Data shown in panel A are from
a representative experiment, and similar results were obtained from
three qualitatively similar and independent experiments. All
transfections were performed in duplicate for each experiment, and the
values between the duplicates were within 10% of the mean. WT, wild
type. Data shown in panel B are the comparison of the relative
enhancement of each mutant reporter gene by TFII-I cotransfection to
the fold enhancement of the wild-type c-fos reporter
activation by TFII-I.
|
|
Grueneberg et al. (
13) found that TFII-I can cooperate with
Phox1 to enhance the activity of a minimal SRE reporter construct.
To
study the effects of TFII-I by itself on the SRE in the context
of the
wild-type c-
fos promoter, different SRE mutations, including
mSRE-S and mSRE-T, which preferentially diminish binding of either
TFII-I or SRF to the SRE, were examined. Figure
5 shows the results.
Interestingly, the mSRE-T mutant reporter, which is specifically
defective for TFII-I binding while leaving SRF binding intact,
caused
significant loss of promoter activity (40% level of the
wild type)
upon serum stimulation. This result suggests that the
binding of
endogenous TFII-I to the SRE may be necessary for maximal
induction of
the c-
fos promoter. The mSRE-T mutant could not be
further
stimulated by cotransfection of TFII-I, suggesting that
SRF-TFII-I
protein interactions cannot overcome the loss of the
TFII-I DNA binding
site. The mSRE-S mutant reporter, which is
specifically defective for
SRF binding, leaving TFII-I binding
intact, substantially lowered the
activity of the promoter (15%
of that of the wild type) as expected.
However, in contrast to
mSRE-T, a small but significant enhancement of
promoter activity
by TFII-I cotransfection was still observed with the
mSRE-S mutation.
One interpretation of this result could be that TFII-I
can facilitate
the recruitment of SRF to a weak SRE through SRF-TFII-I
protein-protein
interaction. A similar effect has been found for
the Phox1 protein
(
15). The TFII-I enhancement effect
on mSRE-S was completely
eliminated in the mSRE-ST mutant reporter,
which is defective
in both SRF and TFII-I binding (Fig.
1B), confirming
again that
the functional effect of TFII-I requires its own intact
binding
site.
Next we sought to determine whether the TCF site might influence the
effect of TFII-I on c-
fos induction. Under the conditions
we
used, TCF was not copurified with TFII-I (see Fig.
2 and Fig.
7). As
shown in Fig.
5, mTCF reporter, which is defective for
TCF binding,
exhibited a decreased response (50%) to the serum
stimulation.
Luciferase expression from the mTCF construct could
still be enhanced
by TFII-I overexpression, albeit with less efficiency
(50%) than with
the wild-type c-
fos reporter. These results indicate
that
the activity of TFII-I is not strictly dependent on the TCF
site, but
this site contributes to the maximum effect of TFII-I.
Since we have found that TFII-I can bind to the SIE, we examined the
effects of mutations in the SIE on TFII-I-mediated transactivation
of
the c-
fos promoter. As described previously, deletion of the
SIE from the promoter (

SIE) caused a significant reduction in
the
promoter response to serum stimulation (30% of the that of
the wild
type) (
21). In addition, the

SIE reporter completely
lost
the ability to respond to TFII-I cotransfection, demonstrating
that the
intact SIE region of the promoter is required for the
effect of TFII-I
even in the presence of a wild-type SRE (Fig.
6). In order to dissociate the role of
the STAT factors and TFII-I
at the c-
fos SIE, the activation
of m34SIE and m67SIE reporters
by serum was investigated (Fig.
6). The
m67SIE mutation, which
binds poorly to TFII-I, but retains binding to
the STAT proteins,
reduced the serum response of the promoter to 50%
of the wild-type
levels. This result suggests that the loss of
endogenous TFII-I
binding to the promoter is significant for
c-
fos induction even
in the presence of STAT binding and SRF
binding. The expression
of the m67SIE reporter could not be further
enhanced by overexpression
of TFII-I, indicating that the binding of
TFII-I to the SIE site
is critical for the maximum effect of TFII-I on
the c-
fos promoter
(Fig.
6). Interestingly, elimination of
STAT binding by the m34SIE
mutation also abolished promoter enhancement
by TFII-I overexpression,
even though the TFII-I binding site is left
intact. In the absence
of TFII-I overexpression, the m34SIE mutation,
which is specifically
defective for STAT binding, showed a level of
serum inducibility
similar to that of the wild-type c-
fos
promoter. This was not
unexpected, since the STAT factors are not
strongly induced over
the basal levels by serum stimulation of NIH 3T3
cells (
18,
68). This result suggests that some binding of
STAT proteins
to the SIE is required for the maximal activity of
TFII-I. This
observation prompted us to look more carefully for
STAT-TFII-I
interactions.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of mutations of the c-fos SIE on
TFII-I transactivation. NIH 3T3 cells were transfected with the
indicated c-fos/Luc reporter constructs with or without
TFII-I. Cells were serum starved for 36 h in 0.5% CS and then
were stimulated for 2.5 h with 10% CS in DMEM. Cell extracts were
then processed for luciferase activity. Data shown in panel A are from
a representative experiment, and similar results were obtained from
three qualitatively similar and independent experiments. All
transfections were performed in duplicate for each experiment, and the
values between the duplicates were within 10% of the mean. Data shown
in panel B are the comparison of the relative enhancement of each
mutant reporter gene by TFII-I cotransfection to the fold enhancement
of the wild-type (WT) c-fos reporter activation by TFII-I.
|
|
SRF, STAT1, and STAT3 can form complexes with TFII-I in vivo.
To attempt to detect protein complexes in solution between TFII-I and
the STAT factors, GST-TFII-I (or GST) and STAT1 (or STAT3) expression
plasmids were cotransfected into COS-1 cells. TFII-I complexes were
isolated by glutathione-Sepharose pulldown assay, and the resulting
complexes were separated by SDS-PAGE and Western blotted with
anti-STAT1 (or anti-STAT3) antibodies. STAT1 and STAT3 were selected to
investigate, since they are known to bind to the c-fos SIE
(34, 51, 52, 71). As can be seen in Fig.
7C, significant complex formation was
observed between STAT1 and TFII-I and between STAT3 and TFII-I in Fig.
7D. No interaction between Elk-1 and TFII-I could be detected under the
same experimental conditions (Fig. 7B) or with cotransfected GST,
indicating that this is a specific association.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
TFII-I forms in vivo complexes with SRF, STAT1, and
STAT3. SRF (A), Elk-1 (B), STAT1 (C), and STAT3 (D) expression plasmids
were cotransfected into COS-1 cells with pEBG (lanes 1 and 3) and
pEBG-TFII-I (lanes 2 and 4) expression plasmids. Transfected COS-1
cells were lysed and subjected to GST pulldown assay as described in
Materials and Methods. Ten micrograms of each total lysate (lanes 1 and
2) and glutathione (GSH)-Sepharose bead-bound proteins (lanes 3 and 4)
were fractionated by SDS-PAGE (12% polyacrylamide). Proteins
associating with GST or GST-TFII-I were detected by Western blot
analyses with anti-SRF (A), anti-Elk-1 (B), anti-STAT1 (C), or
anti-STAT3 antibody (Ab).
|
|
To further confirm that our previously observed interaction between
TFII-I and SRF can occur in vivo, GST-TFII-I (or GST)
and SRF
expression plasmids were also cotransfected into COS-1
cells and GST
pulldown followed by Western blotting with an anti-SRF
antibody was
carried out. As can be seen in lane 4 of Fig.
7A,
a specific
interaction between SRF and TFII-I was observed.
TFII-I enhances the formation of binary and ternary complexes in
vitro.
To examine the effects of TFII-I on the formation of
complexes to the c-fos promoter, a probe containing both the
SIE and SRE was labeled and allowed to bind to nuclear extract from NIH 3T3 fibroblasts in the absence and presence of TFII-I. The results are
shown in Fig. 8. Overexpressed TFII-I
purified from COS-1 cells was selectively added to the reaction
mixtures. A limited amount of TFII-I, which was not itself sufficient
to give detectable DNA binding, as shown in lane 3, was added to the
nuclear extract in vitro and incubated with the c-fos probe.
This resulted in a threefold-enhanced formation of an SRF binary
complex (indicated as 2o) and a fivefold increase in
SRF-TCF ternary complex (indicated as 3o) as shown in lane
6 (compared to lane 4). Interestingly, TFII-I binding to DNA was itself
enhanced by the presence of the nuclear extract. Addition of an
untransfected control lysate eluted from an Ni-NTA agarose column
(indicated as UT) did not have either DNA binding activity (lane 2) or
a complex enhancement effect (lane 5). Anti-Elk-1 antibody weakened
primarily the ternary complex (lane 9) by as much as 60%, and anti-SRF
antibody shifted both the binary and ternary complexes (lane 10) as
expected. Anti-TFII-I antibody diminished the intensities of TFII-I
band and, more importantly, reduced the intensity of the binary and
ternary complex bands to control levels (lane 8). This observation
confirms that the enhanced complex formation requires TFII-I. Anti-Cdk4
antibody was used as a negative control and had no effect (lane 7).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 8.
TFII-I enhances the protein-DNA complex formation to the
c-fos SRE. A 32P-labeled c-fos
SIE-SRE probe was incubated with PDGF-stimulated nuclear extracts (NE)
in the presence (+) or absence ( ) of TFII-I. TFII-I was affinity
purified from transiently transfected COS-1 cells. UT (+) lanes
contained the 250 mM imidazole-eluted fraction of vector-transfected
COS-1 cell extracts passed over Ni-NTA agarose columns. Antibodies
( CDK4, TFII-I, Elk-1, and SRF) were preincubated with the
extracts for 15 min at room temperature where indicated. Final reaction
mixtures were analyzed by EMSA as described in Materials and Methods.
Band intensities for binary and ternary complexes in control nuclear
extract (lane 4) were considered as 100%, and the relative band
intensities in other samples are represented as compared to that of
lane 4.
|
|
Regulation of TFII-I by signal transduction pathways.
Since
MAP kinase phosphorylation of bacterial TFII-I can activate its
transcriptional activity in vitro (40a), we examined whether
ras activation is required for the TFII-I activity. To do
this, dominant negative N17-ras was cotransfected along with the
wild-type c-fos reporter in the absence or presence of
TFII-I and assayed for luciferase activity after stimulation by serum, TPA, LPA, or PDGF. As can be seen in Fig.
9, dominant negative ras not
only diminished the induction of the c-fos promoter
significantly but also completely abolished the ability of TFII-I to
enhance the c-fos promoter. This result indicates that the
ras pathway must be functioning for TFII-I to exert its
effect on c-fos promoter. It is noteworthy that N17-ras does
not completely abolish c-fos induction, but does completely
abolish TFII-I enhancement of the promoter. This suggests that TFII-I
does not simply enhance the activity of other transcription factors,
but requires ras signaling for its own function.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 9.
N17-Ras inhibits TFII-I enhancement of the
c-fos promoter. NIH 3T3 cells were transfected with the
wild-type c-fos/Luc reporter constructs and TFII-I (or empty
vector) in the absence or presence of pMT3.N17Ras plasmid. Cells were
serum starved for 36 h in 0.5% calf serum and then stimulated for
4 h with 10% CS, 50 ng of TPA per ml, 10 µM LPA, or 25 ng of
PDGF-BB per ml in DMEM. Cell extracts were then processed for
luciferase activity. Relative luciferase activities shown here are from
a representative experiment, and similar results were obtained from
three further independent experiments. All transfections were performed
in duplicate for each experiment, and the values between the duplicates
were within 10% of the mean.
|
|
TFII-I is phosphorylated on both serine and tyrosine residues
(
40). In B cells, TFII-I can associate with Btk and become
tyrosine phosphorylated by it (
69). To determine whether
TFII-I
can be a direct target of signaling pathways stimulated by
growth
factors, GST-TFII-I (or GST) expression plasmid was transfected
into COS-1 cells, and the phosphorylation of TFII-I on tyrosine
residues was examined with or without EGF stimulation. Cell lysates
were subjected to GST pulldown assay and analyzed by Western blotting
with antiphosphotyrosine antibody (4G10) or anti-GST antibody.
As can
be seen in Fig.
10, EGF stimulation
caused a significant
increase in the phosphorylation of TFII-I on
tyrosine residues.
The anti-GST blot shows that the expression levels
of transfected
protein are comparable between samples. In parallel
experiments
with COS-1 cells, we found that TFII-I enhanced the
activity of
the c-
fos promoter in response to EGF (data not
shown). Thus,
tyrosine phosphorylation may also regulate the
transcriptional
activity of TFII-I.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 10.
EGF stimulates TFII-I tyrosine phosphorylation. GST
(left panels) and GST-TFII-I (right panels) expression plasmids were
transfected into COS-1 cells. Transfected COS-1 cells were maintained
in DMEM supplemented with either 0.5 or 10% FCS for 36 h and
stimulated with 20 ng of EGF per ml for 20 min. Cells were lysed and
subjected to GST pulldown assay as described in Materials and Methods.
GSH-Sepharose bead-bound proteins were fractionated by SDS-PAGE (12%
polyacrylamide). The tyrosine phosphorylation or protein level was
detected by Western blot analyses with antiphosphotyrosine antibody
(Ab) or anti-GST antibody.
|
|
 |
DISCUSSION |
The c-fos promoter is upregulated by a variety of
extracellular ligands, and a number of transcription factors have been
found to play a role in the regulation of this promoter. These
transcription factors respond to pathways initiated by calcium, cyclic
AMP, tyrosine kinases, phorbol esters, and serum (66). Three
of these transcription factors
CREB, STAT, and
p62TCF
have been shown to be phosphorylated in response to
specific stimulation and have their activities regulated by this
phosphorylation (22). SRF has been shown to bind
cooperatively with members of the Ets family (Elk-1, SAP-1, and NET1)
whose transcriptional activity is regulated by MAP kinase-related
pathways (67). However, there is considerable evidence that
this is not the only mechanism by which the c-fos SRE
regulates the c-fos promoter. Several other transcription
factors have been found either to bind to the SRE independently or to
interact with SRF, including Phox1, YY1, ATF6, RAP74, and C/EBP
(16, 28, 33, 37, 60, 72). Moreover, serum appears to induce
c-fos through the SRE in a manner that involves the small G
proteins, such as RhoA, Rac1, and CDC42, and in a way that is
independent of the TCF binding site and of the TCF transcription
factors (23, 27). Although RhoA, Rac1, and CDC42 upregulate
c-fos through the SRE and presumably SRF, the molecular
mechanisms underlying this signal transduction cascade are poorly
understood. In addition, experiments with introduction of
c-fos promoter constructs into transgenic mice have
indicated that there may be more functional interdependence between
c-fos promoter elements than has sometimes been apparent
from tissue culture experiments (45).
Consistent with Grueneberg et al. (13), we find that the
transcription factor TFII-I associates with the SRF in solution. In
addition, we find that the TFII-I-SRF complex can bind to the SRE.
Moreover, we find that TFII-I can enhance transcriptional activation of
the c-fos promoter in a manner that is dependent on the SRE
and SIE upstream elements. Interestingly, cotransfection of TFII-I with
the basal c-fos promoter (
57) or with the TK promoter resulted in no enhancement. Previously, TFII-I had been notable for its
ability to direct initiation at promoters which contained initiator
elements in place of or in addition to the TATA box (48).
However, TFII-I also interacts with various gene-specific activators,
including c-myc, USF1, and NF-
B and can function as an
upstream activator in the absence of a functional Inr element (47). Consistent with the latter observations, here we show that TFII-I appears to function as an upstream activator of the c-fos promoter. Moreover, we have found that the Inr-related
sequence at
5 of the c-fos promoter fails to bind to
TFII-I in vitro. Although it is unclear whether the c-fos
promoter contains a functional Inr, the latter data indicate that
TFII-I is not functioning as an initiator binding protein in the
c-fos promoter.
Recent experiments have found that phosphorylation of TFII-I by MAP
kinase regulates its initiator function in vitro (40a). Moreover, in B cells, TFII-I forms a complex with the Btk tyrosine kinase, and its phosphorylation on tyrosine is stimulated by it (69). Recent data (40a) also indicate that the
kinase activity of Btk can regulate TFII-I transcriptional activity in
vivo. These observations suggest that TFII-I is a mediator of multiple
signal transduction pathways and thus could well be involved in signal transduction to the c-fos promoter. Consistent with these
experiments, we find that EGF enhances phosphorylation of TFII-I on
tyrosine and that the enhancement of the c-fos promoter
activity by TFII-I is inhibited by cotransfection with dominant
negative ras. Since dominant negative ras
completely inhibits the effect of TFII-I, but not all c-fos
induction, this suggests that TFII-I function itself is regulated by a
ras-dependent pathway. This effect could be mediated through
the inhibition of phosphorylation of TFII-I by one of the MAP kinase
family proteins. Dominant negative ras can inhibit MAP
kinase activation by EGF as well as activation of RhoA and Rac. (See
the reference by Hunter [25] for review.) Thus, any of
several signal transduction pathways could be regulating TFII-I,
including the RhoA-mediated pathway. Future experiments will be
directed toward delineating the ras-dependent pathways as
well as the effects of tyrosine phosphorylation on TFII-I function.
It is interesting to note that the role of TFII-I in c-fos
activation resembles that of Ste12p in the mating pheromone response in
yeast (Saccharomyces cerevisiae). We have shown that the
a-mating factor can stimulate gene expression in yeast
through the Mcm1p and MAT
1p transcription factors bound to the PQ
box of
-cell-specificity genes (53, 54). MCM1
has homologies to the serum response factor, and MAT
1 is
in many ways analogous to c-fos TCF (19). We
previously demonstrated that the Mcm1p-MAT
1p complex has activity that is completely dependent on the STE12 gene
(53). Although Ste12p can bind to specific DNA sequences and
can mediate the pheromone response at genes such as FUS1, at
the PQ box, it appears to be participating through protein-protein
interactions. Despite the genetic requirement for STE12,
Ste12p is difficult to find in complexes with Mcm1p and MAT
1p in a
bandshift assay (70). Overexpression of STE12 can
enhance expression from the PQ box just as TFII-I enhances expression
from the SRE (5). Ste12p itself is regulated by the MAP
kinase-dependent pathway in response to pheromone (62).
TFII-I also appears to be dependent on a ras-dependent
pathway. Although sequence homologies between TFII-I and STE12 are
minimal, it is possible that these proteins have conserved functions.
It is also of interest that the consensus DNA binding site for Ste12p
closely resembles the consensus binding site for TFII-I (6).
These analogies are made even more intriguing by the fact that Ste12p
is one of the few proteins in the yeast pheromone response pathway that
does not yet have a mammalian homolog. This pathway includes the yeast
homologs of CDC42 and MAP kinase (7, 10, 61). Further
experiments are necessary to determine whether there may be functional
conservation between STE12 and TFII-I.
Although TFII-I can enhance the activity of the c-fos
promoter in a cotransfection experiment, it remains an open question as
to whether endogenous TFII-I has an essential function in
c-fos regulation in vivo. Several experiments presented here
suggest that, in fact, it does. Although the effects of cotransfected TFII-I on the c-fos promoter are only two- to fourfold,
there is endogenous TFII-I in the transfected cells. Therefore, it is entirely possible that endogenous TFII-I has exerted much of its effect
in the absence of overexpression of the exogenous gene. Moreover,
endogenous SRF copurifies with transfected TFII-I, suggesting an in
vivo functional role for TFII-I in SRF activity. In addition, the
mSRE-T mutation, which shows reduced TFII-I binding but wild-type levels of SRF binding, is significantly impaired in its ability to
activate the c-fos promoter. This result suggests that
binding of endogenous TFII-I to the SRE is required for full
transcriptional activity of the promoter. Although it could be argued
that the mSRE-T mutation may also impair the binding of factors other
than TFII-I at the SRE, a similar effect is observed by mutation of the
TFII-I binding site at the SIE in conjunction with mutation of the STAT
binding site. It is also relevant that the effects of TFII-I on the
c-fos promoter are impaired by mutations of the STAT and SRF
binding sites. This result indicates that the enhancement observed is
not simply due to enhanced binding of TFII-I to the promoter, but
requires cooperation with these other factors.
The mechanism by which TFII-I enhances c-fos promoter
activation is uncertain at present. The enhancement effect is dependent on the TFII-I binding sites in the promoter as well as the SRF and STAT
binding sites. Consistent with this, we have found that binding of the
TFII-I-SRF complex to the SRE is competed away by the mSRE-S
oligonucleotide that binds TFII-I, but not SRF. This indicates that
TFII-I DNA binding activity contributes to the binding of the complex
to DNA. It is possible in addition that TFII-I facilitates SRF binding
to DNA. This would be consistent with our finding that limited amounts
of TFII-I enhance formation of SRF-DNA complexes. A mechanism such as
this has been proposed for the ability of the paired-like homeodomain
protein Phox1 to stimulate SRF binding and function (14).
Interestingly, it has been shown recently that TFII-I can also interact
with the Phox1 protein (13). It is not clear whether the
Phox1 protein is expressed in NIH 3T3 or COS-1 cells or whether it is
present in the affinity-purified TFII-I used in our experiments. Since
the TFII-I used in our experiments was generated by overexpression in
COS-1 cells, it is unlikely that Phox1, even if it is expressed
endogenously, would be present stoichiometrically with TFII-I. However,
it is also possible that other paired-like homeodomain proteins are
present in our extracts and could have similar activities to Phox1
(15).
The fact that mutation of the TFII-I site in the SIE reduces the
response of the promoter to TFII-I even in the presence of the
wild-type SRE and vice versa suggests that TFII-I may play an important
role in the mediating the functional interdependence of these elements.
Further indication of cooperativity between the TFII-I binding sites is
that serum induction of either the m67SIE or mSRE-T was not further
repressed by double mutation of both sites simultaneously (data not
shown). Since TFII-I can form complexes with both STATs and SRF as well
as bind to multiple DNA sites, it would be well positioned to play an
important role in the formation of a higher-order enhanceosome
structure as HMG I(Y) does for the beta interferon gene
(64). A possible model of this is shown in Fig.
11. However, it is uncertain whether
the cooperativity between the SIE and SRE is mediated through the formation of a higher-order complex of SRE and SIE binding proteins or
through independent contacts with the basal transcription machinery. TFII-I might act as an adapter protein connecting the upstream transcriptional activators to basal promoter elements (47). Since it is known that TFII-I has basal transcription activity and can
interact with TATA box binding protein, this would be plausible
(48). Moreover, there is a TFII-I binding site at
47 of
the c-fos basal promoter in addition to the TATA box. Thus, TFII-I could directly couple the SIE and SRE to the c-fos
basal promoter through a combination of protein-protein and/or
protein-DNA interactions. Further experiments are necessary to test
this hypothesis.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 11.
Model of the role of TFII-I on the c-fos
promoter. After c-fos induction, activated TFII-I
facilitates the formation of a putative enhanceosome structure
consisting of SRF, TCF, STATs, and TFII-I. This results in the
formation of a surface in which each activation domain can form optimal
contacts with the basal transcription machinery.
|
|
 |
ACKNOWLEDGMENTS |
We are grateful to Beth Harvat, Kip Wharton, Peter Shaw, Larry
Feig, and Richard Treisman for providing some of the plasmids used in
these experiments. We thank Deepa Bhavsar for preparing the antisera to
the STAT proteins and Daniel Ortiz for helpful advice. We thank Dorre
Grueneberg and Michael Gilman for sharing unpublished results.
This work was supported by awards from the Concern Foundation for
Cancer Research and the American Cancer Society (RPG-98-104-01-TBE) to
A.L.R. and by NIH grant R01-GM51551 to B.H.C.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Physiology, Tufts University School of Medicine, 136 Harrison Ave.,
Boston, MA 02111. Phone: (617) 636-0442. Fax: (617) 636-6745. E-mail: cochran{at}opal.tufts.edu.
 |
REFERENCES |
| 1.
|
Berkowitz, L. A.,
K. T. Riabowol, and M. Z. Gilman.
1989.
Multiple sequence elements of a single functional class are required for cyclic AMP responsiveness of the mouse c-fos promoter.
Mol. Cell. Biol.
9:4272-4281[Abstract/Free Full Text].
|
| 1a.
| Cheriyath, V., C. D. Novina, and A. L. Roy. Submitted for publication.
|
| 2.
|
Cochran, B. H.,
J. Zullo,
I. M. Verma, and C. D. Stiles.
1984.
Expression of the c-fos gene and of a fos-related gene is stimulated by platelet-derived growth factor.
Science
226:1080-1082[Abstract/Free Full Text].
|
| 3.
|
Dalton, S., and R. Treisman.
1992.
Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element.
Cell
68:597-612[Medline].
|
| 4.
|
de Wet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737[Abstract/Free Full Text].
|
| 5.
|
Dolan, J. W., and S. Fields.
1990.
Overproduction of the yeast STE12 protein leads to constitutive transcriptional induction.
Genes Dev.
4:492-502[Abstract/Free Full Text].
|
| 6.
|
Dolan, J. W.,
C. Kirkman, and S. Fields.
1989.
The yeast STE12 protein binds to the DNA sequence mediating pheromone induction.
Proc. Natl. Acad. Sci. USA
86:5703-5707[Abstract/Free Full Text].
|
| 7.
|
Elion, E. A.,
P. L. Grisafi, and G. R. Fink.
1990.
FUS3 encodes a cdc2+/CDC28 related kinase required for the transition from mitosis into conjugation.
Cell
60:649-664[Medline].
|
| 8.
|
Feig, L. A., and G. M. Cooper.
1988.
Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP.
Mol. Cell. Biol.
8:3235-3243[Abstract/Free Full Text].
|
| 9.
|
Fu, X.-Y., and J.-J. Zhang.
1993.
Transcription factor p91 interacts with the epidermal growth factor receptor and mediates activation of the c-fos gene promoter.
Cell
74:1135-1145[Medline].
|
| 10.
|
Gartner, A.,
K. Nasmyth, and G. Ammerer.
1992.
Signal transduction in Saccharomyces cerevisiae requires tyrosine and threonine phosphorylation of FUS3 and KSS1.
Genes Dev.
6:1280-1292[Abstract/Free Full Text].
|
| 11.
|
Gilman, M. Z.
1988.
The c-fos serum response element responds to protein kinase C-dependent and -independent signals but not to cyclic AMP.
Genes Dev.
2:394-402[Abstract/Free Full Text].
|
| 12.
|
Greenberg, M. E., and E. B. Ziff.
1984.
Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene.
Nature
311:433-442[Medline].
|
| 13.
|
Grueneberg, D. A.,
R. W. Henry,
A. Brauer,
C. D. Novina,
V. Cheriyath,
A. L. Roy, and M. Gilman.
1997.
A multifunctional DNA-binding protein that promotes the formation of serum response factor/homeodomain complexes: identity to TFII-I.
Genes Dev.
11:2482-2493[Abstract/Free Full Text].
|
| 14.
|
Grueneberg, D. A.,
S. Natesan,
C. Alexandre, and M. Z. Gilman.
1992.
Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor.
Science
257:1089-1095[Abstract/Free Full Text].
|
| 15.
|
Grueneberg, D. A.,
K. J. Simon,
K. Brennan, and M. Gilman.
1995.
Sequence-specific targeting of nuclear signal transduction pathways by homeodomain proteins.
Mol. Cell. Biol.
15:3318-3326[Abstract].
|
| 16.
|
Gualberto, A.,
D. lePage,
G. Pons,
S. L. Mader,
K. Park,
M. L. Atchison, and K. Walsh.
1992.
Functional antagonism between YY1 and the serum response factor.
Mol. Cell. Biol.
12:4209-4214[Abstract/Free Full Text].
|
| 17.
|
Harvat, B. L., and W. Wharton.
1995.
Serum response element and flanking sequences mediate the synergistic transcriptional activation of c-fos by 12-O-tetradecanoylphorbol-13-acetate and cholera toxin in AKR-2B cells.
Cell Growth Differ.
6:955-964[Abstract].
|
| 18.
|
Hayes, T. E.,
A. M. Kitchen, and B. H. Cochran.
1987.
Inducible binding of a factor of the c-fos regulatory region.
Proc. Natl. Acad. Sci. USA
84:1272-1276[Abstract/Free Full Text].
|
| 19.
|
Hayes, T. E.,
P. Sengupta, and B. H. Cochran.
1988.
The human c-fos serum response factor and the yeast factors GRM/PRTF have related DNA-binding specificities.
Genes Dev.
2:1713-1722[Abstract/Free Full Text].
|
| 20.
|
Hill, C. S.,
R. Marais,
S. John,
J. Wynne,
S. Dalton, and R. Treisman.
1993.
Functional analysis of a growth factor-responsive transcription factor complex.
Cell
73:395-406[Medline].
|
| 21.
|
Hill, C. S., and R. Treisman.
1995.
Differential activation of c-fos promoter elements by serum, lysophosphatidic acid, G proteins and polypeptide growth factors.
EMBO J.
14:5037-5047[Medline].
|
| 22.
|
Hill, C. S., and R. Treisman.
1995.
Transcriptional regulation by extracellular signals: mechanisms and specificity.
Cell
80:199-212[Medline].
|
| 23.
|
Hill, C. S.,
J. Wynne, and R. Treisman.
1995.
The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF.
Cell
81:1159-1170[Medline].
|
| 24.
|
Hipskind, R. A.,
V. N. Rao,
C. G. F. Mueller,
E. S. P. Reddy, and A. Nordheim.
1991.
Ets-related protein Elk-1 is homologous to the c-fos regulatory factor p62TCF.
Nature
354:531-534[Medline].
|
| 25.
|
Hunter, T.
1997.
Oncoprotein networks.
Cell
88:333-346[Medline].
|
| 26.
|
Javahery, R.,
A. Khachi,
K. Lo,
B. Zenzie-Gregory, and S. T. Smale.
1994.
DNA sequence requirements for transcriptional initiator activity in mammalian cells.
Mol. Cell. Biol.
14:116-127[Abstract/Free Full Text].
|
| 27.
|
Johansen, F.-E., and R. Prywes.
1994.
Two pathways for serum regulation of the c-fos serum response element require specific sequence elements and a minimal domain of serum response factor.
Mol. Cell. Biol.
14:5920-5928[Abstract/Free Full Text].
|
| 28.
|
Joliot, V.,
M. Demma, and R. Prywes.
1995.
Interaction with RAP74 subunit of TFIIF is required for transcriptional activation by serum response factor.
Nature
373:632-635[Medline].
|
| 29.
|
Kortenjann, M.,
O. Thomae, and P. E. Shaw.
1994.
Inhibition of v-raf-dependent c-fos expression and transformation by a kinase-defective mutant of the mitogen-activated protein kinase Erk2.
Mol. Cell. Biol.
14:4815-4824[Abstract/Free Full Text].
|
| 30.
|
Kruijer, W.,
J. A. Cooper,
T. Hunter, and I. M. Verma.
1984.
Platelet-derived growth factor induces rapid but transient expression of the c-fos gene and protein.
Nature
312:711-716[Medline].
|
| 31.
|
Manzano-Winkler, B.,
C. D. Novina, and A. L. Roy.
1996.
TFII-I is required for transcription of the naturally TATA-less but initiator-containing Vbeta promoter.
J. Biol. Chem.
271:12076-12081[Abstract/Free Full Text].
|
| 32.
|
Marais, R.,
J. Wynne, and R. Treisman.
1993.
The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain.
Cell
73:381-393[Medline].
|
| 33.
|
Metz, R., and E. Ziff.
1991.
The helix-loop-helix protein rE12 and the C/EBP-related factor rNFIL-6 bind to neighboring sites within the c-fos serum response element.
Oncogene
6:2165-2178[Medline].
|
| 34.
|
Meyer, D. J.,
G. Campbell,
B. H. Cochran,
L. Argetsinger,
A. C. Larner,
D. S. Finbloom,
C. Carter-Su, and J. Schwartz.
1993.
Growth hormone induces a DNA-binding factor related to the interferon-stimulated 91-kDa transcription factor.
J. Biol. Chem.
269:4701-4704[Abstract/Free Full Text].
|
| 35.
|
Montano, M. A.,
K. Kripke,
C. D. Norina,
P. Achacoso,
L. A. Herzenberg,
A. L. Roy, and G. P. Nolan.
1996.
NF-kappa B homodimer binding within the HIV-1 initiator region and interactions with TFII-I.
Proc. Natl. Acad. Sci. USA
93:12376-12381[Abstract/Free Full Text].
|
| 36.
|
Muller, R.,
R. Bravo,
J. Burckhardt, and T. Curran.
1984.
Induction of c-fos gene and protein by growth factors precedes activation of c-myc.
Nature
312:716-720[Medline].
|
| 37.
|
Natesan, S., and M. Gilman.
1995.
YY1 facilitates the association of serum response factor with the c-fos serum response element.
Mol. Cell. Biol.
15:5975-5982[Abstract].
|
| 38.
|
Norman, C.,
M. Runswick,
R. Pollock, and R. Treisman.
1988.
Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element.
Cell
55:989-1003[Medline].
|
| 39.
|
Novina, C. D.,
V. Cheriyath,
M. C. Denis, and A. L. Roy.
1997.
Methods for studying the biochemical properties of an Inr element binding protein: TFII-I.
Methods
12:254-263.
[Medline] |
| 40.
| Novina, C. D., V. Cheriyath, and A. L. Roy. Regulation of TFII-I activity by phosphorylation. Submitted
for publication.
|
| 40a.
| Novina, C. D., and A. L. Roy. Unpublished
observations.
|
| 41.
|
Perez Jurado, L. A.,
Y. K. Wang,
R. Peoples,
A. Coloma,
J. Cruces, and U. Francke.
1998.
A duplicated gene in the breakpoint regions of the 7q11.23 Williams-Beuren syndrome deletion encodes the initiator binding protein TFII-I and BAP-135, a phosphorylation target of BTK.
Hum. Mol. Genet.
7:325-334[Abstract/Free Full Text].
|
| 42.
|
Pollock, R., and R. Treisman.
1990.
A sensitive method for the determination of protein-DNA binding specificities.
Nucleic Acids Res.
18:6197-6204[Abstract/Free Full Text].
|
| 43.
|
Renz, M.,
M. Neuberg,
C. Kurz,
R. Bravo, and R. Muller.
1985.
Regulation of c-fos transcription in mouse fibroblasts: identification of DNase I-hypersensitive sites and regulatory upstream sequences.
EMBO J.
4:3711-3716[Medline].
|
| 44.
|
Rivera, V. M.,
M. Sheng, and M. E. Greenberg.
1990.
The inner core of the serum response element mediates both the rapid induction and subsequent repression of c-fos transcription following serum induction.
Genes Dev.
4:255-268[Abstract/Free Full Text].
|
| 45.
|
Robertson, L.,
T. Kerppola,
M. Vendrell,
D. Luk,
R. Smeyne,
C. Bocchiaro,
J. Morgan, and T. Curran.
1995.
Regulation of c-fos expression in transgenic mice requires multiple interdependent transcription control elements.
Neuron
14:241-252[Medline].
|
| 46.
|
Roy, A. L.,
C. Carruthers,
T. Gutjahr, and R. G. Roeder.
1993.
Direct role for Myc in transcription initiation mediated by interactions with TFII-I.
Nature
365:359-361[Medline].
|
| 47.
|
Roy, A. L.,
H. Du,
P. D. Gregor,
C. D. Novina,
E. Martinez, and R. G. Roeder.
1997.
Cloning of an Inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1
EMBO J.
16:7091-7104[Medline].
|
| 48.
|
Roy, A. L.,
S. Malik,
M. Meisterernst, and R. G. Roeder.
1993.
An alternative pathway for transcription initiation involving TFII-I.
Nature
365:355-359[Medline].
|
| 49.
|
Roy, A. L.,
M. Meisterernst,
P. Pognonec, and R. G. Roeder.
1991.
Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF.
Nature
354:245-248[Medline].
|
| 50.
|
Ruff-Jamison, S.,
K. Chen, and S. Cohen.
1993.
Induction by EGF and interferon- of tyrosine phosphorylated DNA binding proteins in mouse liver nuclei.
Science
261:1733-1736[Abstract/Free Full Text].
|
| 51.
|
Ruff-Jamison, S.,
Z. Zhong,
Z. Wen,
K. Chen,
J. J. Darnell, and S. Cohen.
1994.
Epidermal growth factor and lipopolysaccharide activate Stat3 transcription factor in mouse liver.
J. Biol. Chem.
269:21933-21935[Abstract/Free Full Text].
|
| 52.
|
Sadowski, H. B.,
K. Shuai,
J. E. Darnell, Jr., and M. Z. Gilman.
1993.
A common nuclear signal transduction pathway activated by growth factor and cytokine receptors.
Science
261:1739-1744[Abstract/Free Full Text].
|
| 53.
|
Sengupta, P., and B. H. Cochran.
1991.
MAT 1 can mediate gene activation by a-mating factor.
Genes Dev.
5:1924-1934[Abstract/Free Full Text].
|
| 54.
|
Sengupta, P., and B. H. Cochran.
1990.
The PRE and PQ box are functionally distinct yeast pheromone response elements.
Mol. Cell. Biol.
10:6809-6812[Abstract/Free Full Text].
|
| 55.
|
Shaw, P. E.,
H. Schroter, and A. Nordheim.
1989.
The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter.
Cell
56:563-572[Medline].
|
| 56.
|
Sheng, M.,
S. T. Dougan,
G. McFadden, and M. E. Greenberg.
1988.
Calcium and growth factor pathways of c-fos transcriptional activation require distinct upstream regulatory sequences.
Mol. Cell. Biol.
8:2787-2796[Abstract/Free Full Text].
|
| 57.
|
Sheng, M.,
M. A. Thompson, and M. E. Greenberg.
1991.
CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases.
Science
252:1427-1430[Abstract/Free Full Text].
|
| 58.
|
Shuai, K.,
A. Ziemiecki,
A. F. Wilks,
A. G. Harpur,
H. B. Sadowski,
M. Z. Gilman, and J. E. Darnell.
1993.
Polypeptide signalling to the nucleus through tyrosine phosphorylation of Jak and Stat proteins.
Nature
366:580-583[Medline].
|
| 59.
|
Silvennoinen, O.,
C. Schindler,
J. Schlessinger, and D. E. Levy.
1993.
Ras-independent growth factor signaling by transcription factor tyrosine phosphorylation.
Science
261:1736-1739[Abstract/Free Full Text].
|
| 60.
|
Simon, K. J.,
D. A. Grueneberg, and M. Gilman.
1997.
Protein and DNA contact surfaces that mediate the selective action of the Phox1 homeodomain at the c-fos serum response element.
Mol. Cell. Biol.
17:6653-6662[Abstract].
|
| 61.
|
Simon, M. N.,
C. De Virgilio,
B. Souza,
J. R. Pringle,
A. Abo, and S. I. Reed.
1995.
Role for the Rho-family GTPase Cdc42 in yeast mating-pheromone signal pathway.
Nature
376:702-705[Medline].
|
| 62.
|
Song, O.,
J. W. Dolan,
Y. O. Yuan, and S. Fields.
1991.
Pheromone-dependent phosphorylation of the yeast STE12 protein correlates with transcriptional activation.
Genes Dev.
5:741-750[Abstract/Free Full Text].
|
| 63.
|
Subramaniam, M.,
L. J. Schmidt,
C. E. D. Crutchfield, and M. J. Getz.
1989.
Negative regulation of serum-responsive enhancer elements.
Nature
340:64-66[Medline].
|
| 64.
|
Thanos, D., and T. Maniatis.
1995.
Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome.
Cell
83:1091-1100[Medline].
|
| 65.
|
Treisman, R.
1987.
Identification and purification of a polypeptide that binds to the c-fos serum response element.
EMBO J.
6:2711-2727[Medline].
|
| 66.
|
Treisman, R.
1995.
Journey to the surface of the cell: Fos regulation and the SRE.
EMBO J.
14:4905-4913[Medline].
|
| 67.
|
Treisman, R.
1994.
Ternary complex factors: growth factor regulated transcriptional activators.
Curr. Opin. Genet. Dev.
4:96-101[Medline].
|
| 68.
|
Wagner, B. J.,
T. H. Hayes,
C. J. Hoban, and B. H. Cochran.
1990.
The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter.
EMBO J.
9:4477-4484[Medline].
|
| 69.
|
Yang, W., and S. Desiderio.
1997.
BAP-135, a target for Bruton's tyrosine kinase in response to B cell receptor engagement.
Proc. Natl. Acad. Sci. USA
94:604-609[Abstract/Free Full Text].
|
| 70.
|
Yuan, Y. O.,
I. L. Stroke, and S. Fields.
1993.
Coupling of cell identity to signal response in yeast: interaction between the alpha 1 and STE12 proteins.
Genes Dev.
7:1584-1597[Abstract/Free Full Text].
|
| 71.
|
Zhong, Z.,
Z. Wen, and J. J. Darnell.
1994.
Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6.
Science
264:95-98[Abstract/Free Full Text].
|
| 72.
|
Zhu, C.,
F.-E. Johansen, and R. Prywes.
1997.
Interaction of ATF6 and serum response factor.
Mol. Cell. Biol.
17:4957-4966[Abstract].
|
Mol Cell Biol, June 1998, p. 3310-3320, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fan, C., Ouyang, P., Timur, A. A., He, P., You, S.-A., Hu, Y., Ke, T., Driscoll, D. J., Chen, Q., Wang, Q. K.
(2009). Novel Roles of GATA1 in Regulation of Angiogenic Factor AGGF1 and Endothelial Cell Function. J. Biol. Chem.
284: 23331-23343
[Abstract]
[Full Text]
-
Tapia-Paez, I., Tammimies, K., Massinen, S., Roy, A. L., Kere, J.
(2008). The complex of TFII-I, PARP1, and SFPQ proteins regulates the DYX1C1 gene implicated in neuronal migration and dyslexia. FASEB J.
22: 3001-3009
[Abstract]
[Full Text]
-
Ashworth, T., Roy, A. L.
(2007). Cutting Edge: TFII-I Controls B Cell Proliferation via Regulating NF-{kappa}B. J. Immunol.
178: 2631-2635
[Abstract]
[Full Text]
-
Caraveo, G., van Rossum, D. B., Patterson, R. L., Snyder, S. H., Desiderio, S.
(2006). Action of TFII-I outside the nucleus as an inhibitor of agonist-induced calcium entry.. Science
314: 122-125
[Abstract]
[Full Text]
-
Rajaiya, J., Nixon, J. C., Ayers, N., Desgranges, Z. P., Roy, A. L., Webb, C. F.
(2006). Induction of Immunoglobulin Heavy-Chain Transcription through the Transcription Factor Bright Requires TFII-I. Mol. Cell. Biol.
26: 4758-4768
[Abstract]
[Full Text]
-
Ogura, Y., Azuma, M., Tsuboi, Y., Kabe, Y., Yamaguchi, Y., Wada, T., Watanabe, H., Handa, H.
(2006). TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor {alpha}. GENES CELLS
11: 373-381
[Abstract]
[Full Text]
-
Desgranges, Z. P., Ahn, J., Lazebnik, M. B., Ashworth, T., Lee, C., Pestell, R. C., Rosenberg, N., Prives, C., Roy, A. L.
(2005). Inhibition of TFII-I-Dependent Cell Cycle Regulation by p53. Mol. Cell. Biol.
25: 10940-10952
[Abstract]
[Full Text]
-
Stasyk, T., Dubrovska, A., Lomnytska, M., Yakymovych, I., Wernstedt, C., Heldin, C.-H., Hellman, U., Souchelnytskyi, S.
(2005). Phosphoproteome Profiling of Transforming Growth Factor (TGF)-{beta} Signaling: Abrogation of TGF{beta}1-dependent Phosphorylation of Transcription Factor-II-I (TFII-I) Enhances Cooperation of TFII-I and Smad3 in Transcription. Mol. Biol. Cell
16: 4765-4780
[Abstract]
[Full Text]
-
Jackson, T. A., Taylor, H. E., Sharma, D., Desiderio, S., Danoff, S. K.
(2005). Vascular Endothelial Growth Factor Receptor-2: COUNTER-REGULATION BY THE TRANSCRIPTION FACTORS, TFII-I AND TFII-IRD1. J. Biol. Chem.
280: 29856-29863
[Abstract]
[Full Text]
-
Cui, T. X., Piwien-Pilipuk, G., Huo, J. S., Kaplani, J., Kwok, R., Schwartz, J.
(2005). Endogenous CCAAT/Enhancer Binding Protein {beta} and p300 Are Both Regulated by Growth Hormone to Mediate Transcriptional Activation. Mol. Endocrinol.
19: 2175-2186
[Abstract]
[Full Text]
-
Unni, E., Sun, S., Nan, B., McPhaul, M. J., Cheskis, B., Mancini, M. A., Marcelli, M.
(2004). Changes in Androgen Receptor Nongenotropic Signaling Correlate with Transition of LNCaP Cells to Androgen Independence. Cancer Res.
64: 7156-7168
[Abstract]
[Full Text]
-
Sacristan, C., Tussie-Luna, M. I., Logan, S. M., Roy, A. L.
(2004). Mechanism of Bruton's Tyrosine Kinase-mediated Recruitment and Regulation of TFII-I. J. Biol. Chem.
279: 7147-7158
[Abstract]
[Full Text]
-
Kim, D.-W., Lassar, A. B.
(2003). Smad-Dependent Recruitment of a Histone Deacetylase/Sin3A Complex Modulates the Bone Morphogenetic Protein-Dependent Transcriptional Repressor Activity of Nkx3.2. Mol. Cell. Biol.
23: 8704-8717
[Abstract]
[Full Text]
-
Bowen, H., Lapham, A., Phillips, E., Yeung, I., Alter-Koltunoff, M., Levi, B.-Z., Perry, V. H., Mann, D. A., Barton, C. H.
(2003). Characterization of the Murine Nramp1 Promoter: REQUIREMENTS FOR TRANSACTIVATION BY Miz-1. J. Biol. Chem.
278: 36017-36026
[Abstract]
[Full Text]
-
Cen, B., Selvaraj, A., Burgess, R. C., Hitzler, J. K., Ma, Z., Morris, S. W., Prywes, R.
(2003). Megakaryoblastic Leukemia 1, a Potent Transcriptional Coactivator for Serum Response Factor (SRF), Is Required for Serum Induction of SRF Target Genes. Mol. Cell. Biol.
23: 6597-6608
[Abstract]
[Full Text]
-
Xu, W., Comhair, S. A. A., Zheng, S., Chu, S. C., Marks-Konczalik, J., Moss, J., Haque, S. J., Erzurum, S. C.
(2003). STAT-1 and c-Fos interaction in nitric oxide synthase-2 gene activation. Am. J. Physiol. Lung Cell. Mol. Physiol.
285: L137-L148
[Abstract]
[Full Text]
-
Yang, E., Lerner, L., Besser, D., Darnell, J. E. Jr.
(2003). Independent and Cooperative Activation of Chromosomal c-fos Promoter by STAT3. J. Biol. Chem.
278: 15794-15799
[Abstract]
[Full Text]
-
Hakimi, M.-A., Dong, Y., Lane, W. S., Speicher, D. W., Shiekhattar, R.
(2003). A Candidate X-linked Mental Retardation Gene Is a Component of a New Family of Histone Deacetylase-containing Complexes. J. Biol. Chem.
278: 7234-7239
[Abstract]
[Full Text]
-
Wen, Y.-D., Cress, W. D., Roy, A. L., Seto, E.
(2003). Histone Deacetylase 3 Binds to and Regulates the Multifunctional Transcription Factor TFII-I. J. Biol. Chem.
278: 1841-1847
[Abstract]
[Full Text]
-
Casteel, D. E., Zhuang, S., Gudi, T., Tang, J., Vuica, M., Desiderio, S., Pilz, R. B.
(2002). cGMP-dependent Protein Kinase Ibeta Physically and Functionally Interacts with the Transcriptional Regulator TFII-I. J. Biol. Chem.
277: 32003-32014
[Abstract]
[Full Text]
-
Cheriyath, V., Desgranges, Z. P., Roy, A. L.
(2002). c-Src-dependent Transcriptional Activation of TFII-I. J. Biol. Chem.
277: 22798-22805
[Abstract]
[Full Text]
-
Tice, D. A., Soloviev, I., Polakis, P.
(2002). Activation of the Wnt Pathway Interferes with Serum Response Element-driven Transcription of Immediate Early Genes. J. Biol. Chem.
277: 6118-6123
[Abstract]
[Full Text]
-
Young, M. R., Nair, R., Bucheimer, N., Tulsian, P., Brown, N., Chapp, C., Hsu, T.-C., Colburn, N. H.
(2002). Transactivation of Fra-1 and Consequent Activation of AP-1 Occur Extracellular Signal-Regulated Kinase Dependently. Mol. Cell. Biol.
22: 587-598
[Abstract]
[Full Text]
-
Calvo, S., Vullhorst, D., Venepally, P., Cheng, J., Karavanova, I., Buonanno, A.
(2001). Molecular Dissection of DNA Sequences and Factors Involved in Slow Muscle-Specific Transcription. Mol. Cell. Biol.
21: 8490-8503
[Abstract]
[Full Text]
-
Tussie-Luna, M. I., Bayarsaihan, D., Ruddle, F. H., Roy, A. L.
(2001). Repression of TFII-I-dependent transcription by nuclear exclusion. Proc. Natl. Acad. Sci. USA
98: 7789-7794
[Abstract]
[Full Text]
-
Kim, D.-W., Cochran, B. H.
(2001). JAK2 Activates TFII-I and Regulates Its Interaction with Extracellular Signal-Regulated Kinase. Mol. Cell. Biol.
21: 3387-3397
[Abstract]
[Full Text]
-
Parker, R., Phan, T., Baumeister, P., Roy, B., Cheriyath, V., Roy, A. L., Lee, A. S.
(2001). Identification of TFII-I as the Endoplasmic Reticulum Stress Response Element Binding Factor ERSF: Its Autoregulation by Stress and Interaction with ATF6. Mol. Cell. Biol.
21: 3220-3233
[Abstract]
[Full Text]
-
Webb, C. F., Yamashita, Y., Ayers, N., Evetts, S., Paulin, Y., Conley, M. E., Smith, E. A.
(2000). The Transcription Factor Bright Associates with Bruton's Tyrosine Kinase, the Defective Protein in Immunodeficiency Disease. J. Immunol.
165: 6956-6965
[Abstract]
[Full Text]
-
Mobley, C. M., Sealy, L.
(2000). The Rous Sarcoma Virus Long Terminal Repeat Promoter Is Regulated by TFII-I. J. Virol.
74: 6511-6519
[Abstract]
[Full Text]
-
Bayarsaihan, D., Ruddle, F. H.
(2000). Isolation and characterization of BEN, a member of the TFII-I family of DNA-binding proteins containing distinct helix-loop-helix domains. Proc. Natl. Acad. Sci. USA
97: 7342-7347
[Abstract]
[Full Text]
-
Warren, D., Heilpern, A. J., Berg, K., Rosenberg, N.
(2000). The Carboxyl Terminus of v-Abl Protein Can Augment SH2 Domain Function. J. Virol.
74: 4495-4504
[Abstract]
[Full Text]
-
Kim, D.-W., Cochran, B. H.
(2000). Extracellular Signal-Regulated Kinase Binds to TFII-I and Regulates Its Activation of the c-fos Promoter. Mol. Cell. Biol.
20: 1140-1148
[Abstract]
[Full Text]
-
Duan, R., Porter, W., Samudio, I., Vyhlidal, C., Kladde, M., Safe, S.
(1999). Transcriptional Activation of c-fos Protooncogene by 17{beta}-Estradiol: Mechanism of Aryl Hydrocarbon Receptor-Mediated Inhibition. Mol. Endocrinol.
13: 1511-1521
[Abstract]
[Full Text]
-
Novina, C. D., Kumar, S., Bajpai, U., Cheriyath, V., Zhang, K., Pillai, S., Wortis, H. H., Roy, A. L.
(1999). Regulation of Nuclear Localization and Transcriptional Activity of TFII-I by Bruton's Tyrosine Kinase. Mol. Cell. Biol.
19: 5014-5024
[Abstract]
[Full Text]
-
Murphy, D. J., Hardy, S., Engel, D. A.
(1999). Human SWI-SNF Component BRG1 Represses Transcription of the c-fos Gene. Mol. Cell. Biol.
19: 2724-2733
[Abstract]
[Full Text]
-
Soh, J.-W., Lee, E. H., Prywes, R., Weinstein, I. B.
(1999). Novel Roles of Specific Isoforms of Protein Kinase C in Activation of the c-fos Serum Response Element. Mol. Cell. Biol.
19: 1313-1324
[Abstract]
[Full Text]
-
Wu, Y., Patterson, C.
(1999). The Human KDR/flk-1 Gene Contains a Functional Initiator Element That Is Bound and Transactivated by TFII-I. J. Biol. Chem.
274: 3207-3214
[Abstract]
[Full Text]
-
WEBB, C., ZONG, R.-T., LIN, D., WANG, Z., KAPLAN, M., PAULIN, Y., SMITH, E., PROBST, L., BRYANT, J., GOLDSTEIN, A., SCHEUERMANN, R., TUCKER, P.
(1999). Differential Regulation of Immunoglobulin Gene Transcription via Nuclear Matrix-associated Regions. Cold Spring Harb Symp Quant Biol
64: 109-118
[Abstract]
-
Novina, C. D., Cheriyath, V., Roy, A. L.
(1998). Regulation of TFII-I Activity by Phosphorylation. J. Biol. Chem.
273: 33443-33448
[Abstract]
[Full Text]
-
Simon, A. R., Rai, U., Fanburg, B. L., Cochran, B. H.
(1998). Activation of the JAK-STAT pathway by reactive oxygen species. Am. J. Physiol. Cell Physiol.
275: C1640-C1652
[Abstract]
[Full Text]
-
Cheriyath, V., Novina, C. D., Roy, A. L.
(1998). TFII-I Regulates Vbeta Promoter Activity through an Initiator Element. Mol. Cell. Biol.
18: 4444-4454
[Abstract]
[Full Text]
-
TREISMAN, R., ALBERTS, A.S., SAHAI, E.
(1998). Regulation of SRF Activity by Rho Family GTPases. Cold Spring Harb Symp Quant Biol
63: 643-652
[Abstract]
-
Hartley, D. A., Cooper, G. M.
(2000). Direct Binding and Activation of STAT Transcription Factors by the Herpesvirus saimiri Protein Tip. J. Biol. Chem.
275: 16925-16932
[Abstract]
[Full Text]
-
Cheriyath, V., Roy, A. L.
(2000). Alternatively Spliced Isoforms of TFII-I. COMPLEX FORMATION, NUCLEAR TRANSLOCATION, AND DIFFERENTIAL GENE REGULATION. J. Biol. Chem.
275: 26300-26308
[Abstract]
[Full Text]
-
Nissen, L. J., Gelly, J.-C., Hipskind, R. A.
(2001). Induction-independent Recruitment of CREB-binding Protein to the c-fos Serum Response Element through Interactions between the Bromodomain and Elk-1. J. Biol. Chem.
276: 5213-5221
[Abstract]
[Full Text]
-
Cheriyath, V., Roy, A. L.
(2001). Structure-Function Analysis of TFII-I. ROLES OF THE N-TERMINAL END, BASIC REGION, AND I-REPEATS. J. Biol. Chem.
276: 8377-8383
[Abstract]
[Full Text]
-
Egloff, A. M., Desiderio, S.
(2001). Identification of Phosphorylation Sites for Bruton's Tyrosine Kinase within the Transcriptional Regulator BAP/TFII-I. J. Biol. Chem.
276: 27806-27815
[Abstract]
[Full Text]
-
Mahajan, S., Vassilev, A., Sun, N., Ozer, Z., Mao, C., Uckun, F. M.
(2001). Transcription Factor STAT5A Is a Substrate of Bruton's Tyrosine Kinase in B Cells. J. Biol. Chem.
276: 31216-31228
[Abstract]
[Full Text]