Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3431-3444, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Functional Mapping of the U3 Small Nucleolar
RNA from the Yeast Saccharomyces cerevisiae
Dmitry A.
Samarsky and
Maurille J.
Fournier*
Department of Biochemistry and Molecular
Biology, Program in Molecular and Cellular Biology, University of
Massachusetts, Amherst, Massachusetts 01003
Received 22 December 1997/Returned for modification 22 January
1998/Accepted 5 March 1998
 |
ABSTRACT |
The U3 small nucleolar RNA participates in early events of
eukaryotic pre-rRNA cleavage and is essential for formation of 18S
rRNA. Using an in vivo system, we have developed a functional map of
the U3 small nucleolar RNA from Saccharomyces cerevisiae. The test strain features a galactose-dependent U3 gene in
the chromosome and a plasmid-encoded allele with a unique hybridization tag. Effects of mutations on U3 production were analyzed by evaluating RNA levels in cells grown on galactose medium, and effects on U3
function were assessed by growing cells on glucose medium. The major
findings are as follows: (i) boxes C' and D and flanking helices are
critical for U3 accumulation; (ii) boxes B and C are not essential for
U3 production but are important for function, most likely due to
binding of a trans-acting factor(s); (iii) the 5' portion
of U3 is required for function but not stability; and, (iv) strikingly,
the nonconserved hairpins 2, 3, and 4, which account for 50% of the
molecule, are not required for accumulation or function.
 |
INTRODUCTION |
The small nucleolar RNAs (snoRNAs)
play essential roles in posttranscriptional maturation of rRNAs
(reviewed in references 2, 17, 38, 40, 51, 65, and
69). A few snoRNAs are required for cleavage of rRNA
precursors which encode the 18S, 5.8S, and 25S/28S rRNAs. Most and
possibly all of the other snoRNAs serve as guide RNAs in nucleotide
modification reactions, in particular ribose methylation and
pseudouridine formation. Scores of snoRNAs have already been identified
in protist, fungal, plant, and animal cells, and all are believed to
exist as snoRNP particles. The various rRNA maturation reactions are
thought to occur in a large, poorly defined complex called the
processome (16; see also references 17 and 40).
U3, the subject of the present report, is one of a few phylogenetically
conserved snoRNAs and appears to join the processome at an early, vital
stage. In mammalian and yeast cells U3 is approximately 1 order of
magnitude more abundant than other snoRNAs (58, 73). U3 is
required for several early pre-rRNA cleavage reactions, including (i)
an initial cleavage in the 5' external transcribed spacer (5' ETS)
region (in yeast cells, mouse extracts, and Xenopus oocyte
extracts [25, 29, 45]); (ii) two sites that flank the
18S rRNA coding region (in yeast cells [25]); and
(iii) a site near the boundary of internal transcribed spacer-1 (ITS1) and 5.8S rRNA (Xenopus oocytes [60]). U3
appears to interact with pre-rRNA at a variety of sites. In yeast
cells, U3 has been proposed to contact pre-rRNA at three sites: one in
the 5' ETS portion and two early in the 18S rRNA coding region. The
site in the 5' ETS was identified by in vivo cross-linking, and
subsequent mutation analysis showed it to be essential for 18S rRNA
production (7, 9). Additional support for this interaction
came from a suppressor mutation in U3 (8; see also
below). The two interactions within the 18S rRNA coding region are
proposed to occur through base-pairing of a pseudoknot in U3 (24,
44). This suggestion is supported by strong conservation of the
putative interacting sequences in both U3 and 18S RNA and by
preliminary mutations in the corresponding U3 nucleotides which affect
cell viability.
Progress in defining proteins associated with U3 is still at an early
stage. For many years U3 RNAs have been known to be associated with the
nucleolar protein fibrillarin, or its yeast homolog, Nop1p. This
association, which is probably indirect, is now known to be
characteristic of snoRNAs in one of two major snoRNA groups, i.e., the
box C/D family; the second major family consists of box H/ACA snoRNAs
(reviewed in references 65 and 69). Depletion of Nop1p from yeast cells causes
severe defects in ribosome biogenesis, including cleavage and
methylation of pre-rRNA and ribosome assembly (70, 71). More
recently, other proteins associated with U3 have been identified. A U3
RNA-protein complex from CHO cells was shown to contain three
previously uncharacterized proteins and seems likely to be a core
particle of the native U3 snoRNP (37). Two proteins
associated with yeast U3 have been identified, Sof1p and Mpp10p
(15, 27). The gene for Sof1p was found in a search for
suppressors of a temperature-sensitive growth phenotype caused by
substituting the yeast NOP1 gene with its human homolog. The
gene for Mpp10p was identified during a search for a structural homolog
of a human protein (MPP10), which, in turn, had been detected with
antibodies specific for proteins phosphorylated during mitosis. Neither
yeast protein is known to be associated with other snoRNAs, as
determined by limited hybridization screening of immunoprecipitated
RNAs (Sof1p and Mpp10p) and analysis of immunoprecipitated and
postlabeled RNAs (Mpp10p). It is not known if Sof1p and Mpp10p interact
directly with U3. However, depletion of these proteins causes defects
in rRNA processing similar to those resulting from loss or inactivation of U3 itself.
All known U3 RNAs contain a 5' cap, and the nature of the cap
correlates with the type of RNA polymerase used in transcription. Protist, fungal, and animal U3 RNAs are transcribed by RNA polymerase II and have a trimethyl guanosine (TMG) cap. In plants U3 is produced by RNA polymerase III and has a gamma-monomethyl phosphate cap (reviewed in reference 17). In all cases, known U3
is transcribed from independent genes. This is in contrast to most
other snoRNAs in animals, which are encoded within introns of protein
genes, and some plant snoRNAs, which are transcribed from polycistronic snoRNA operons (reviewed in reference 69). The U3
genes in several species of fungi have the remarkable distinction of
being the only snoRNA coding sequences known which themselves contain
introns (11, 47).
Phylogenetic comparison of the first U3 snoRNAs revealed conserved
sequence elements, called boxes A to D (26, 28, 30, 52, 73,
77). Additional elements, called boxes A' and C' (or A°), have
been defined more recently (39, 47, 74). Other snoRNAs
were subsequently determined to contain boxes C and D, and these
elements now define the box C/D family of snoRNAs. Most box C/D
snoRNAs possess long (>12 nucleotides) sequences complementary to rRNA
that are located immediately upstream of box D and/or an analog box D'
(reviewed in references 2, 65, and
69). RNAs with these features guide the formation of
2'-O-methylated nucleotides in rRNAs (14, 32, 48,
75). The U3 snoRNAs do not contain the methylation motif and thus
are not believed to function in 2'-O-methylation.
Secondary structure models have been proposed for a variety of U3
molecules, based on computer folding, phylogenetic sequence comparisons, and direct structure probing data (10, 18, 21, 22,
26, 28, 30, 31, 34, 39, 41-44, 46, 47, 49, 50, 52, 53, 61, 62).
A consensus structure has not yet been determined, but several features
occur consistently (Fig. 1). The
conserved box A' and A elements and adjoining nonconserved nucleotides,
known as a hinge region, define the 5' portion of the molecule. No
unambiguous secondary structure has been proposed for this region: one
or two hairpins were proposed to be formed in yeasts, one or no
hairpins were proposed for higher eukaryotes, and no hairpins were
proposed for protists. The rest of the molecule is believed to be
highly folded and relatively consistent structures have been proposed
for this portion. Boxes C' and D occur between phylogenetically
conserved terminal and central stems, juxtaposed next to each other.
The regions surrounding boxes B and C are not conserved; however, in
all cases boxes B and C are predicted to be in close proximity. Folding
of the surrounding segments results in different numbers of hairpins:
from none in protists to three in some fungal species.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
The U3 snoRNA from the yeast S. cerevisiae.
The model shown is derived from a compilation of structures proposed
for U3 RNAs from different organisms. Several configurations have been
suggested for the 5' segment including (i) nonfolded (28,
49), (ii) possessing a single helix (hairpin 1 [50]), or (iii) containing two helices (hairpin 1a and
1b, not shown [44, 52]). The well-structured 3'
portion of S. cerevisiae U3 contains two highly conserved
(central and terminal stems) and nonconserved helices (hairpins 2, 3, and 4 [26]). The number of hairpins in this region
varies from none to three in different organisms. The relative
positions of the phylogenetically conserved sequence elements, boxes A,
A', B, C, C', and D are well preserved in all U3 snoRNAs known. The box
A' and A segments are believed to interact with pre-rRNA (see text).
Box C influences association with the protein fibrillarin
(6). Box D is required for formation of the 5' TMG cap
structure and nuclear retention of mature RNA (68). The
primary sequence of the hinge region separating the conserved elements
of the 5' and 3' portions is not well preserved phylogenetically. Ten
nucleotides of the hinge segment in yeast U3 have been postulated to
interact with the 5' ETS of pre-rRNA through complementary base-pairing
(8).
|
|
Functional mapping of U3 is still at an early stage. A few elements
have been tied to different aspects of snoRNA synthesis, localization,
or function. Box A of yeast U3 was shown to be essential for yeast cell
viability, based on substitution and deletion mutations (24,
44). This is one of the two regions proposed to base-pair with
pre-rRNA, based on cross-linking data obtained with yeast and animal U3
RNAs (66, 72). Box A' has also been implicated in
base-pairing with pre-rRNA, and mutation of this element has been found
to affect yeast cell viability (44). The hinge region of
yeast U3 has been proposed to interact directly with pre-rRNA through a
segment of 10 complementary nucleotides (9). Consistent with
binding, a mutation in this segment rescued a lethal rRNA mutation by
providing complementarity to the mutant rRNA region (8). No
functional information is yet available for box B and the central stem.
Mutations in box C influence U3 association with fibrillarin in human
cell extracts, and alterations in box D and the 3' terminal stem block
cap formation in Xenopus U3 transcripts injected into
oocytes (6, 68). Mutations in the latter elements also
impair retention of U3 in the nucleus (68). In yeast cells a
large deletion covering most of the hinge region, the proximal part of
the 3' terminal stem, and box C' has been shown to abolish U3
accumulation (44).
The present investigation was undertaken to develop a map of essential
regions in this vital RNA. The major aims of our study were to evaluate
the importance of the conserved and nonconserved elements for U3
production and function in S. cerevisiae. The elements
featured in our analysis included (i) the 5' segment encompassing
conserved boxes A' and A and the nonconserved hinge region; (ii)
conserved boxes B, C, C', and D; (iii) the conserved central and
terminal stems, and (iv) the nonconserved hairpins in the highly
structured 3' domain.
 |
MATERIALS AND METHODS |
Strains and media.
S. cerevisiae JH84
(
leu2-3,12 ura3-52 his3-
ade2-1 can1100 u3a
UASGAL:U3A::URA3
U3B::LEU2) was kindly provided by John Hughes
and was used as the test strain (a similar strain, JH44, is described
in reference 25). Yeast cells were grown at 30°C unless otherwise specified. Transformants were grown initially on
selective solid 0.67% yeast nitrogen base (YNB) medium containing 2%
galactose. This allowed maintenance of the introduced plasmid and
expression of U3 from the galactose-dependent genomic cassette; hence,
even cells containing nonfunctional U3 genes on the plasmid were able
to grow.
To test the ability of mutant U3 genes to support growth, transformants
were restreaked from galactose plates onto plates
containing 5%
glucose (in this condition the genomic U3 cassette
is silent) and grown
for 5 days. To distinguish unambiguously
between residual growth and
slow growth, cells were restreaked
onto fresh glucose plates and
incubated for another 5-day period.
In all, except some control experiments, production of RNA was analyzed
with cells grown overnight in selective liquid medium
(YNB) containing
2% galactose. In control experiments where the
efficiency of
repressing the galactose-dependent
U3 allele was
evaluated,
RNA was isolated from cells grown overnight in selective
liquid medium
containing 5% glucose.
All cloning procedures were carried out with
Escherichia
coli DH5

(
supE44 lacU169 [
80
lacZ-
M15]
hsdR17 recA1 endA1 gyrA96 thi-1 relA1)
grown on either liquid or solid Luria-Bertani medium
(0.5% yeast
extract, 1% tryptone, 1% NaCl), supplemented with
ampicillin (50 µg/ml) when necessary.
Bacterial and yeast strains were transformed with plasmids by slightly
modified calcium chloride and lithium acetate methods,
respectively
(
20,
54).
DNA and RNA manipulations.
Plasmid DNA was prepared from
E. coli with a boiling miniprep procedure, and total yeast
RNA was isolated with a hot-phenol-glass bead procedure (33,
59).
Northern hybridization assays were performed essentially as described
previously (
4,
55). Equity of RNA transfer to the
nitrocellulose membrane was verified by hybridization of the blots
with control oligonucleotides and/or ethidium bromide staining.
Oligonucleotides for probing U3 RNA included C163
(CATAGGATGGGTCAAGATCATCGCGCC),
which recognizes U3, U3*, and
all derivatives except U3(del);
SD14 (GCCGAACCGCTAAGGATTGCGGAC),
which hybridizes to hairpin 4
of wild-type U3 but not to U3* and
U3(del) variants; SD13 (CGGCTTAGGCTAAGCTAAGGCCAG),
which
binds to U3* and all its mutant derivatives except U3(del)
but not to
wild-type U3; and SD74 (see below), which recognizes
all U3 forms
including U3(del). Oligonucleotides used for controls
were C164
(CGCCTTCCGCGCCGTATGTGTGTGTGACC), which is specific for
U1
spliceosomal RNA, and C106 (CGATGGGTTCGTAAGCGTACTCCTACCGTGG),
which is specific for U14 snoRNA.
Preparation of modified U3 coding sequences.
The original
U3A gene was isolated from plasmid pRex4A (kindly provided
by John Hughes) as a blunt-ended HindIII fragment and
subcloned into the blunt-ended SalI site of the pBluescript IISK(
) vector with a previously removed BstXI site to
generate plasmid pBU3. PCR strategies to alter the U3 gene
were performed with this plasmid (Fig.
2). Plasmids used for yeast
transformation were prepared by cloning
EcoRI-XhoI fragments carrying the wild-type and
mutated U3 RNA genes from the pBluescript IISK(
) vector
into the yeast shuttle vector pRS313 (64). The final
plasmids were as follows: pRU3, wild-type U3; pRU3*, tagged U3;
pRU3*(C':G
C), substitution of the first G in box C' with C;
pRU3*(C':A
T), substitution of the first A in box C' with T;
pRU3*(C:G
C), substitution of the first G in box C with C;
pRU3*(C:A
T), substitution of the first A in box C with T;
pRU3*(D:A
T), substitution of the last A in box D with T;
pRU3*(C:subst), substitution of the entire box C sequence CGATGA
with GCTACT; pRU3*(B:subst), substitution of the
entire box B sequence GAGTGAG with CTCACTC;
pRU3*(t.st:P), substitution of the terminal stem proximal
sequence ACTTG with TGGGC; pRU3*(t.st:D), substitution of the terminal
stem distal sequence CAAGT with GCCCA; pRU3*(t.st:PD), substitution of
both proximal and distal sequences of the terminal stem; pRU3*(c.st:P), substitution of the central stem proximal sequence CCTTTGTAGGG with GGAAACATGGG; pRU3*(c.st:D), substitution of the
central stem distal sequence GGGTACAAATCC with
CCCATGTTTTCC; pRU3*(c.st:PD), substitution of both proximal
and distal sequences of the terminal stem; pRU3*(trunc), deletion from
the 5' end to the base of the terminal stem; and pRU3*(del), deletion
of hairpins 2, 3, and 4.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
U3 mutagenesis strategies. Different PCR strategies were
used for creating U3 mutations, depending on the position and length of
the mutant sequence and the number of sequences to be substituted. In
each case two PCR amplification steps were involved. To introduce point
mutations or make a short sequence substitutions, the strategies
presented in panels A or B were used. Multiple mutations were created
with the strategy presented in panel C. Substitution or deletion of
large regions were done as depicted in panel D. Arrows with numbers
correspond to the oligonucleotide primers. Short vertical lines with
letters correspond to restriction sites. Open and closed boxes
designate mutant and wild-type sequences, respectively.
|
|
The oligonucleotides used for PCR mutagenesis were as follows:
universal M13 forward (GTAAAACGACGGCCAGT) and reverse
(GGAAACAGCTATGACCATG)
primers for all mutations; SD10 and
SD11 for U3* (CGGCTTAGGCTAAGCTAAGGCCAGCAAGCTAATTTAGATTCAA
and CTGGCCTTAGCTTAGCCTAAGCCGCATCTATAATTTTGAATAA,
respectively);
SD19 (CCAACTTGGTTCATGAGTCCC) for
U3*(C':G

C); SD20 (CCAACTTGGTTGTTGAGTCCC)
for
U3*(C':A

T); SD29 (GGATGGGTCAAGATCATGGCGCC) for
U3*(C:G

C);
SD30 (GGATGGGTCAAGATCAACGCGCC) for
U3*(C:A

U); SD32 (GTGGTTAACTTGACAGACTGCC)
for
U3*(D:A

T); NS1 (CAATATTTTATGGCGGCTACTTCTTGACCCATCC) and
NS2
(GGATGGGTCAAGAAGTAGCCGCCATAAAATATTG) for U3*(C:subst);
NS3
(CTTAGGCTAAGCCAAGGCCAGCAAGCTAATTTAGATTTCAATTTCGGTTTGAGTCTCTGGGGTAC)
for U3*(B:subst); SD34 (CACTGAATCCATGGGCGTTGATGAGT)
and SD35 (GACTCATCAACGCCCATGGATTCAGTG)
for U3*(t.st:P)
and U3*(t.st:PD); SD33 (TGGCAGTCTGAGCCCATAACCACTTT)
and D149
(AAAGTGGTTATGGGCTCAGACTGCCA) for U3*(t.st:D) and
U3*(t.st:PD);
SD71 (GGAAACATGGGCAGAGTGAGAAACCGAAATTG) and
SD72 (CGGTTTCTCACTCTGCCCATGTTTCCTTATGGGACTCATCAACCAA)
for U3*(c.st:P) and U3*(c.st:PD); SD69
(GGTCCCATGTTTTCCCAGTCTGACAAGTTAACCAC)
and SD70
(CTTGTCAGACTGGGAAAACATGGGACCCATAGAGCCCTATCCCTTC) for
U3*(c.st:D) and U3*(c.st:PD); SD65
(TGACTCTGTCGACAACTTGGTTGATGAGTCCC)
for U3*(trunc); and SD73
(GTGAGAAACCGGCGCGATGATCTTGATGGGTACAAATGGCAGTCTGAC)
and SD74
(ATCAAGATCATCGCGCCGGTTTCTCACTCTGGGGTAC) for U3(del).
Restriction endonucleases used for treating the final PCR fragments
before cloning (see Fig.
2) were
SalI and
BstXI.
All new
constructs were verified by sequencing the mutated regions
using
the dsDNA Cycle Sequencing System Kit from BRL Life Technologies,
Inc., and appropriate primers.
 |
RESULTS |
Genetic system for functional mapping of yeast U3 RNA.
To
assess the importance of U3 structural elements, we developed a genetic
system that features a S. cerevisiae JH84 test strain
containing a galactose-dependent U3 gene in the genome (UASGAL:U3A). All mutations were
introduced into a constitutively expressed U3 gene on the
plasmid, called U3* (Fig. 3A;
see also Materials and Methods). The RNA expressed from the
U3* gene contains a unique hybridization "tag," which
makes it possible to distinguish the products of this allele from RNA
produced from the genomic locus. When designing this gene, we took into
consideration the fact that hairpin 4 of the S. cerevisiae
U3 RNA is the least phylogenetically conserved portion of the molecule
and in most organisms (including the yeast Schizosaccharomyces
pombe) is absent altogether and thus probably plays an unimportant
role. Modifications were made in this stem-loop domain that changed the
primary sequence slightly but left the hypothetical secondary structure
intact (Fig. 3B).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Genetic system for functional mapping of yeast U3 RNA.
(A) Mutational analyses were carried out with test strain JH84
(25). In this strain one of two genes encoding U3 RNA
(U3B) is disrupted with a LEU2 marker gene, and
the second (U3A) is under control of the
UASGAL-regulated promoter. Cells grow well on
medium containing galactose as the sole carbon source, since U3A RNA is
transcribed from the promoter induced by galactose. In the presence of
glucose the UASGAL-regulated promoter is
repressed, and this leads to severe underaccumulation of U3 and
subsequent cell death. Lethality can be avoided, however, if the cells
also contain a plasmid with a functional U3 RNA gene under control of
the normal U3 promoter. (B) In order to distinguish RNAs expressed from
the chromosome and the plasmid, a modified U3 gene with a
unique hybridization tag (U3*) was constructed. The U3* RNA
has a different sequence in the nonconserved hairpin 4 region; however,
the secondary structure of the hairpin is preserved. The importance of
specific U3 elements for RNA function and production was evaluated by
transforming test cells with the plasmid-encoded mutant genes and
examining cell growth on glucose and the accumulation of mutant U3 RNA
on galactose. (C) Depletion of wild-type U3 produced from the
galactose-dependent chromosomal allele during cell growth on glucose
was evaluated by Northern blotting analysis. The test strain was
transformed with plasmids encoding wild-type (pRU3) or tagged (pRU3*)
U3. Total RNA was prepared from transformants grown overnight in liquid
selective medium containing 5% glucose. A blot containing these RNAs
was first probed with a radiolabeled oligonucleotide (C163) that
recognizes both wild-type (U3) and tagged U3 (U3*; left panel) RNAs.
The blot was washed and then probed with an oligonucleotide (SD14) that
recognizes exclusively wild-type U3 (right panel). Depletion of
wild-type U3 is nearly complete in cells transformed with pRU3* and
grown on glucose.
|
|
Our system allows the importance of specific U3 elements to be tested
in two ways. The inability of mutant
U3* alleles to
support
growth on glucose medium indicates that an essential nucleotide(s)
has
been mutated. By examining U3* RNA levels in cells grown on
galactose,
it is possible to distinguish mutations that influence
RNA accumulation
from those that impair U3* function without affecting
production.
Before initiating the mapping analysis, we analyzed the behavior of the
test strain itself. Growth and U3 RNA production from
both genomic and
plasmid alleles were evaluated on galactose and
glucose medium. Cells
were transformed with either a commonly
used vector lacking an insert
(pRS313 [
64]) or a vector containing
either the
natural
U3A gene (pRU3) or the tagged
U3 gene
(pRU3*).
Transformants were first analyzed for the ability to grow on
galactose
and glucose. Cells containing plasmids with the natural or
tagged
U3 genes grew with the same efficiency on solid
medium containing
glucose; no growth was observed for cells containing
the control
plasmid. All three types of cells grew equally well on
solid medium
containing galactose. These results demonstrate that the
galactose-dependent
U3 allele (chromosome) is repressed on
glucose and does not support
cell growth; this allele does allow normal
growth on galactose.
The results also show that the tagged
U3* gene supports wild-type
growth on glucose, when the
galactose-dependent allele is silent.
We next analyzed the patterns of U3 RNA produced by these same
transformants grown in liquid galactose or glucose medium by
using
probes specific to natural or tagged U3 or one that recognizes
both
RNAs simultaneously. The results demonstrated that the tagged
U3* RNA
accumulates at a normal level, both in glucose- and in
galactose-grown
cells. The tagged (U3*) and natural (U3) RNAs
were easily distinguished
with the specific probes. Repression
of the chromosomal
galactose-dependent
U3 gene on glucose was
nearly complete.
The RNA from this allele was barely detectable
in cells with the
plasmid-encoded
U3* gene grown in liquid medium
overnight;
we estimate the amount of natural U3 at less than 5%
of the normal
level. Thus, it seems likely that little or no residual
wild-type U3 is
present in the test cells when the ability of
the mutant
U3*
gene to support growth is examined. Much of the
characterization data
for the test system are not shown here since
most control genes are
included in the experiments that follow.
Northern blotting demonstrated
that wild-type U3 is essentially
depleted from test cells grown in
liquid glucose medium (Fig.
3C).
U3 contains a structural homolog of the U14 box C/D terminal stem
motif.
In box C/D snoRNAs, boxes C (UGAUGA) and D
(GUCUGA) are usually located near the 5' and 3' ends of the
mature molecule, respectively. Structure and phylogenetic studies of
S. cerevisiae U14 RNA revealed that box C, box D, and an
adjoining terminal stem form a box C/D stem structural motif (Fig.
4A; see also references
3 and 23). Identical structures
occur in folding models of U14 molecules from other organisms (several
examples are presented). In yeast and Xenopus sp., each
component of the motif has been shown to be essential for U14
accumulation (23, 78). Certain of the box C and D
nucleotides are particularly important (Fig. 4, circled).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Structural homologs of the box C/D stem motif in U3 and
U14 snoRNAs. (A) Boxes C and D of U14 snoRNA together with adjoining
inverted repeats form a conserved structure known as the box C/D stem
motif. Each of the components of this motif is essential for U14
accumulation in S. cerevisiae (23). Box C and box
D nucleotides important for RNA production are circled. (B) Boxes C'
and D of U3 can also be arranged in a secondary structure similar to
that of the U14 box C/D stem motif. As in U14 this hypothetical
structure is phylogenetically conserved in all U3 homologs. The
nucleotides essential for U14 accumulation are also preserved in U3
(circled).
|
|
U3 differs from U14 and other box C/D snoRNAs in that it possesses two
box C-like elements (boxes C and C'), both of which
are in the interior
of the molecule. Interestingly, box C' (but
not box C) and box D of U3
snoRNA and flanking 5-nucleotide inverted
repeats can be arranged in a
secondary structure similar to that
of the U14 box C/D stem motif (Fig.
4B; see also references
18,
21,
28,
31,
34,
39,
41,
44,
49,
50,
52, and
62). As in U14 this
hypothetical structure is phylogenetically
conserved in U3 homologs
(examples are shown). Furthermore, the
nucleotides essential for U14
accumulation are also preserved
(circled). The phylogenetic
similarities suggest that the U3 box
C'/D stem motif is both a
structural and functional homolog of
the box C/D stem motif in U14.
This hypothesis was examined in
the experiments described below.
Boxes C' and D, but not box C, are essential for U3
accumulation.
If the box C or C' element (or both) of U3 is a
functional homolog of U14 box C, the corresponding nucleotides vital
for U14 accumulation should also be necessary for U3 RNA production.
This prediction was examined by introducing two point mutations in boxes C and C' of U3* which are known to cause severe
underaccumulation of U14 (Fig. 5A; see
also Fig. 4).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
A box C/D stem motif containing box C' rather than box C
is important for U3 accumulation. (A) Single base substitutions were
made in U3 boxes C and C' at positions known to be essential for the
box C stabilizing function in U14. A point mutation was created in box
D, which in U14 is known to lead to underaccumulation of snoRNA
(23). A substitution mutation which replaces the entire box
C was also prepared. (B) Effects of mutations on U3 RNA accumulation
were assessed by Northern blotting analysis of total RNA isolated from
galactose-grown cells. Levels of mutant U3* RNA were estimated with a
probe specific to a hybridization tag (upper portion of panel). RNA
loading was assessed with hybridization probes for U14 and U1 RNAs.
Mutation effects on cell viability were determined by growing
transformants on glucose-containing plates (lower portion of panel).
Growth rates are indicated as follows: + corresponds to wild-type
growth, and represents no growth.
|
|
Substitutions in box C had no effect on either cell growth on glucose
or accumulation of the U3* RNA on galactose [Fig.
5B,
lanes
pRU3*(C:G

C) and pRU3*(C:A

T)]. In contrast, point mutations
in
box C' impaired cell growth on glucose and accumulation of
U3* in
galactose-grown cells [lanes pRU3*(C':G

C) and
pRU3*(C':A

T)].
To determine if box C plays a role in RNA
production, a
U3* allele
was prepared in which all of box C
was replaced with an unrelated
sequence. No significant difference in
mutant RNA levels was observed
for transformants grown on galactose
[lane pRU3*(C:subst)]. However,
the mutant allele did not support
growth on glucose, indicating
that box C is required for U3* function.
A point mutation in U3*
box D was also created analogous to one in U14
box D that leads
to severe underaccumulation of that RNA. This mutation
led to
impaired growth on glucose and a dramatic reduction in the
amount
of stable RNA [lane pRU3*(D:A

T)]. Taken together, these
results
argue that boxes C' and D in U3 provide the critical
accumulation
function(s) first established for boxes C and D in yeast
U14.
The canonical box C in U3 is not required for RNA accumulation
but
it is needed for U3 function since substitution of this element
leads
to lethality.
Both stems flanking boxes C' and D are required for U3
production.
We propose the box C' and D elements in U3 comprise a
structure similar to the U14 box C/D stem motif. If true, the inverted repeats flanking boxes C' and D must form a helix in vivo that is
important for snoRNA accumulation. To test this, we separately substituted both the 5' proximal [pRU3*(t.st:P)] and 3' distal [pRU3*(t.st:D)] inverted repeats with noncomplementary sequences. An
additional construct, pRU3*(t.st:PD), contained proximal and distal
stem segments with reconstituted base-pairing possibilities but with
different sequences (Fig. 6A).
Transformants containing these alleles were analyzed for growth on
glucose, and RNA was prepared from cells grown on galactose. RNA
expressed from plasmid pRU3*(t.st:P) accumulated at a very low level on
galactose and did not support normal growth on glucose medium [Fig.
6B, lane pRU3*(t.st:P)]. Although U3 expressed from the pRU3*(t.st:D)
construct supported normal growth, the mutant RNA accumulated at a
level lower than did the U3* control [lane pRU3*(t.st:D)]. Cells
dependent on the mutant allele in which substitution mutations restored base-pairing grew on glucose as well as cells expressing wild-type U3*;
however, the level of the mutant RNA expressed on galactose actually
exceeded that of wild-type U3* [lanes pRU3*(t.st:PD) and pRU3*].

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
The terminal and central stems are required for stable
RNA production. (A) The importance of the terminal and central stems
flanking boxes C' and D was evaluated with mutations that disrupt the
complementary interactions. Mutations which change the primary but
preserve the secondary structures of these stems were also prepared.
(B) Substitutions in either proximal (P) or distal (D) parts of the
terminal stem (t.st) or central stem (c.st) lead to underaccumulation
of U3 on galactose medium and impair cell growth on glucose.
Substitutions in both proximal and distal parts (PD) which preserve
complementarity rescue these effects. Hybridization probes for the
Northern blotting analyses and symbols indicating cell growth on
glucose are the same as in Fig. 5.
|
|
To evaluate the importance of the central stem, we examined
three
U3* alleles containing substituted proximal
[pRU3*(c.st:P)]
or distal [pRU3*(c.st:D)] stem segments and a
stem defined by
novel complementarities [pRU3*(c.st:PD); Fig.
6A].
Characterization
of transformants cultured on both glucose and
galactose media
clearly demonstrated the importance of the central stem
structure
for RNA accumulation (Fig.
6B). RNA produced from the
galactose-inducible
alleles containing disrupted base-pairings
accumulated at much
lower levels than RNA synthesized from the control
U3* allele
and did not support normal growth on glucose
[compare lanes pRU3*(c.st:P)
and pRU3*(c.st:D) and lane (pRU3*)]. RNA
with restored complementary
interactions accumulated during galactose
growth at a level only
slightly lower than that of U3* RNA [lanes
pRU3*(c.st:PD) and
pRU3*] and provided normal growth on glucose.
These results demonstrate that base-pairing in the terminal and central
stems is necessary for U3 accumulation and cell growth
and imply that
these stems exist in vivo. Why RNA with a substituted
distal part of
the terminal stem [pRU3*(t.st:D)] still accumulates,
though at a
lower level, is not clear. It is possible that the
new sequence creates
an additional stabilizing signal or allows
an alternative stable
structure to be formed. Taken together,
the results argue that U3 boxes
C' and D and flanking inverted
repeats form a structure in vivo which
is functionally homologous
to the box C/D stem motif of U14. The
internal inverted repeats,
which in U3 comprise the central stem, are
most likely also involved
in the formation of this structure.
Box B is required for U3 function but not accumulation.
To
assess the importance of the conserved box B, we prepared a construct
in which the seven most phylogenetically stable nucleotides were
substituted with an unrelated sequence [pRU3*(B:subst); Fig. 7A]. Expression of this construct in
test cells cultured on galactose revealed no change in accumulation
level, indicating that box B is not important for U3 production (Fig.
7B). While the RNA accumulated, it could not support normal growth of
cells on solid glucose medium. To assess the effect of the mutation in
more detail, we analyzed cell growth at different temperatures and in
liquid medium. At 15°C and on solid glucose medium, cells expressing U3*(B:subst) grew more slowly than those expressing wild-type U3*.
However, at 37°C both types of cells grew equally well. A growth
curve analysis at 30°C in liquid glucose medium revealed that the
onset of logarithmic growth was delayed 10 h (data not shown). The
basis of this effect is unknown. In any case, the cold-sensitive growth
indicates that box B is important for U3 RNA function but does not
affect its accumulation.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
Box B is required for U3 function but not RNA
accumulation. (A) The importance of the highly conserved box B element
was examined by substituting the entire box with an unrelated sequence.
(B) Substitution of box B (B:subst) does not affect U3 accumulation on
galactose but does cause a cs slow-growth phenotype for
cells grown on glucose medium. Probes and growth symbols are the same
as in Fig. 5, except that ± refers to partially impaired growth (see
text).
|
|
U3 lacking a 5' segment is toxic, but mutation of box C rescues
this effect.
The box A' and A elements of the U3 5' segment are
known to be required for RNA function but not RNA stability (24,
44). We evaluated a construct in which nearly all of the 5'-end
segment was removed, leaving only six native nucleotides at the very 5' end of the molecule and one nucleotide preceding the proximal part of
the terminal stem [pRU3*(trunc); Fig.
8A]. The truncated RNA accumulated
normally on galactose but was unable to support growth on glucose
medium [Fig. 8B, lane pRU3*(trunc)]. Interestingly, cells containing
the abnormal RNA grew more slowly on galactose-containing plates than
cells containing U3* or just the plasmid vector pRS313. The growth
curve of cells cultured in liquid galactose medium revealed a
pre-logarithmic-phase delay of 8 h (not shown). We wondered if the
toxic effect of the truncated RNA might reflect competition of this
molecule for an essential trans-acting factor(s). Results
from this and earlier studies suggest that a factor(s), presumably a
protein(s), binds to the central part of U3 where the conserved boxes B
and C occur (5, 6, 37, 44, 50, 68). The possibility that the
truncated U3 variant competes for such a factor(s) was examined with a
mutant U3 containing the same deletion, as well as with a fully
substituted box C mutation (Fig. 8A). Strikingly, the box C mutation
rescued both the slow-growth phenotype on solid galactose medium and
the delayed-growth phenotype in liquid medium (not shown). The mutant
RNA was produced at a normal level [Fig. 8B, lane
pRU3*(trunc/C:subst)].

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 8.
U3 lacking the 5' segment is toxic, but substitution of
box C rescues this effect. (A) The importance of the entire 5' segment
for U3 RNA accumulation was examined by creating a deletion spanning
the region between position +6 and a nucleotide preceding the terminal
stem. (B) This variant, U3*(trunc), accumulates normally in cells grown
in galactose but, as expected, does not support growth on glucose.
Interestingly, cells expressing both the wild-type and truncated forms
of U3 on galactose grow slower than cells which only express normal U3.
Substitution of box C with an unrelated sequence, U3*(trunc/C:subst),
rescues the toxic effect of the truncated molecule in cells grown on
galactose. This fact suggests binding of the hypothetical
trans-acting factor(s) with the portion of U3 where boxes B
and C are located. Probes and growth symbols are as in Fig. 5 and 7.
|
|
The results from this series of functional mapping are summarized as
follows: (i) the 5' portion of U3 containing the hinge
region and
conserved box A' and A elements is essential for RNA
function but is
not important for RNA production; (ii) U3 with
a truncated 5' end
competes with wild-type U3 for a hypothetical
trans-acting
factor(s); and (iii) the hypothetical factor(s) most
likely binds box C
(and perhaps box B), which is located in the
central part of the 3'
region.
The essential 5' region contains a previously unidentified GAC box
element.
To gain additional insight into the role of the 5'
region, we conducted a phylogenetic comparison of the 5' segments from more than 20 U3 RNA species (Fig. 9).
This analysis revealed a novel, absolutely conserved GAC box element
which precedes box A'. The conserved nature of this box suggests that
it is important for U3 function (see also Discussion).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 9.
Phylogenetic comparison of U3 5' regions. Alignment of
the 5' segment sequences from diverse organisms reveals a novel
conserved GAC box element. The length but not the primary structure of
the hinge region appears well preserved. The U3 sequences analyzed
(GenBank accession numbers are given in parentheses) are from protists
Leptomonas collosoma (L32919), Trypanosoma brucei
(M25776), Leishmania tarentolae (L20948), Tetrahymena
thermophila (X71349), Euglena gracilis (U27297), and
Dictyostelium discoideum (V00190); fungi Saccharomyces
cerevisiae (M26648 and X05498), Hansenula wingei
(X91005), and Schizosaccharomyces pombe (X56982 and X56189);
plants Zea mays (Z29641), Oryza sativa (X79685),
Triticum aestivum (X63065), Solanum lycopersicum
(X14411), Solanum tuberosum (Z11883), and Arabidopsis
thaliana (X52629, X52630, and X58068); and animals Xenopus
laevis (X07318), Xenopus borealis (X07319), Mus
musculus (X63743), Rattus norvegicus (J01884 and
K00780), and Homo sapiens (M14061). The first nucleotide (R)
follows the cap (either TMG or gamma-monomethyl phosphate). T.st(P)
corresponds to the proximal region of the terminal stem. The G*
nucleotide in the GAC box of mouse U3 has been shown to cross-link to
the 5' ETS of pre-rRNA (72).
|
|
Hairpins 2, 3, and 4 are not required for accumulation or
function.
The functional importance of the nonconserved hairpins
2, 3, and 4 was evaluated with a deletion construct that removed all three stem-loop structures [pRU3*(del); Fig.
10A]. In this construct the hairpins
were almost completely deleted, leaving only the nucleotides which
comprise the first base pair of each hairpin. Surprisingly, the RNA
expressed from the new allele was stable and also provided normal
growth in the absence of wild-type U3 (Fig. 10B). Minor larger species
present in the Northern blot correspond to U3 derivatives with a 3' end
extended by approximately 20 to 30 nucleotides, as demonstrated with
hybridization probes specific for the 5' or 3' flanking regions in the
U3 gene (not shown). These striking results indicate that in
yeast cells a small U3 variant lacking most of the nonconserved
sequence is able to accumulate normally and provide all of the
essential functions. This mini-variant resembles the U3 RNAs from
protists (18, 21, 49).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 10.
Hairpins 2, 3, and 4 together are not essential for U3
accumulation and function. (A) The importance of hairpins 2, 3, and 4 was evaluated by deleting all three stem-loop domains. (B) The ability
of mutant U3(del) RNA to accumulate was assessed with cells grown in
liquid galactose medium, in which natural U3 is also produced from the
chromosomal gene. Since the mutant RNA lacks hairpin 4, which contains
the unique hybridization tag, a different probe was used in this
analysis. This probe (SD74) hybridizes to the U3(del) region
corresponding to the central stem and boxes B and C, which are also
present in the wild-type U3 produced from the genomic locus. Since
U3(del) is much smaller than wild-type U3 it is easily identified. The
mutant U3(del) accumulates at a good level on galactose and,
remarkably, supports wild-type growth of cells on glucose medium, where
the wild-type U3 gene is repressed. Probes for control RNAs and growth
symbols are the same as in Fig. 5.
|
|
 |
DISCUSSION |
Our results provide several new insights into the structure and
function elements of the essential U3 snoRNA from S. cerevisiae and should be relevant to other U3 homologs as well.
The genetic system used allowed us not only to identify defective
U3 genes but also to distinguish mutations that influence U3
production from others that affect only U3 function.
The unfolded 5' segment of U3 is essential for activity but not RNA
production.
Deleting most of the 5' portion of U3 did not affect
RNA accumulation; rather, a stable, but nonfunctional by-product was produced. Biochemical and genetic studies conducted previously with U3
RNAs from various organisms strongly suggest that the 5' segment
interacts directly with pre-rRNA (see the introduction). However,
attempts to identify specific nucleotides involved in such
interaction(s) have yielded ambiguous results. The primary candidates
in U3 are the highly conserved nucleotides in the box A'/A region, and
the proposed target sites in pre-rRNA include nucleotides in the
noncoding region of the 5' ETS and in an early portion of the 18S rRNA
coding region (9, 24, 44, 66, 72). In reality U3 may
interact with pre-rRNA at multiple sites, perhaps in an evolving
dynamic fashion.
Our phylogenetic comparison of the 5' segments from more than 20 U3
snoRNA species revealed a novel GAC box element. The absolutely
conserved nature of this element suggests it is important for
U3
function. This view is supported by experimental results showing
that
the C nucleotide of the GAC box was a site of cross-linking
to the
pre-rRNA 5' ETS in mouse cell extracts (
72). Recently,
the
GAC nucleotides have been proposed to base pair with pre-rRNA
in the
18S rRNA portion (
44).
Another interesting observation is that despite obvious differences in
the primary structure of the hinge region in various
U3 molecules, its
length is well conserved (Fig.
10; see also electronic
databases
described in references
19 and
79). This property
suggests that the hinge region
serves as a spacer to separate
the 5' segment containing the GAC, A',
and A box elements and
the highly folded, protein-bound 3' portion of
U3 (see also below).
Interestingly, a mutation in the hinge region of
yeast U3 has
been identified that suppresses a lethal mutation in the
5' ETS
segment of pre-rRNA (
8). This mutation provided
base-pairing
between U3 and the mutant pre-rRNA. However, the mutated
region
in U3 is not essential and is not conserved, suggesting that
this
segment may not normally interact with pre-rRNA. Nonetheless,
this
finding argues that yeast U3 and pre-rRNA do interact through
base-pairing.
Computer folding and chemical probing analyses have not produced a
consistent secondary structure for the 5' segment. This
situation
indicates that the 5' region might not be folded at
all or only
transiently so. Indeed, association with pre-rRNA
might be complicated
by stable secondary folding of the 5' segment.
This view is supported
by different chemical modification patterns
observed for yeast U3
analyzed as free RNA or a RNP complex (
44).
Boxes C' and D comprise a recognition motif characteristic of other
box C/D snoRNAs.
Previous studies with other box C/D snoRNAs
revealed that box C, box D, and an adjoining terminal stem are required
for snoRNA accumulation and form a structural motif in mature RNA
(3, 12, 13, 23, 76, 78). This box C/D stem motif is believed to be recognized by a hypothetical protein(s) which protects the mature
RNA from exonucleolytic degradation. Our mutational results demonstrate
that boxes C' and D and flanking complementary elements are required
for U3 production, as shown earlier for boxes C and D and flanking
inverted repeats of yeast U14 (see also reference 23). These results argue that the box C'/D stem
motif of U3 corresponds functionally to the box C/D motif of U14.
Consistent with this view and a role in protein binding, the box C'/D
stem segments were found to be protected in structure probing studies of U3 RNP complexes in human and yeast cell extracts and in intact yeast cells (44, 50). The canonical box C is located far
from box D in the U3 secondary structure. This fact and our
demonstration that box C is not required for RNA production indicate
that box C in U3 is not homologous to box C from other box C/D snoRNAs.
Of particular interest is our demonstration that the central stem of U3
is also required for RNA accumulation, suggesting
that this helix is
important for the formation of the box C'/D
stem recognition motif.
This result is consistent with the finding
that formation of the
stabilizing box C/D stem signal in yeast
U14 involves an additional
complementary interaction as well.
In U14 the enhanced structural
stability is provided by a single
complementary element that extends
into the flanking precursor
regions (
56; see also
reference
3). A role for internal folding
to create
the RNA stabilizing motif which contains boxes C and
D is also favored
by the knowledge that some box C/D snoRNAs lack
an obvious terminal
stem (see reference
76). A protein(s) specific
for
boxes C (C' in U3) and D has not yet been identified, though
results
from competition analysis of RNAs injected into
Xenopus oocytes indicate that the same
trans-acting factor(s)
stabilizes
different box C/D snoRNAs (
68).
In addition to contributing to RNA stabilization, box D is required for
nuclear targeting of U3 injected into the cytoplasm
of
Xenopus oocytes and for nuclear retention when injected into
the nucleus (
5,
67,
68). In work to be described elsewhere,
we have demonstrated that the box C/D motif is sufficient for
nucleolar
targeting of model box C/D snoRNAs expressed in yeast
and mammalian
cells (
56). It is likely that stabilization-processing
and
targeting-retention functions are provided by the same protein(s).
In
many other box C/D snoRNAs known, the box D element is also
a
determinant in guiding the formation of 2'-
O-methylated
nucleotides
in rRNAs (see Introduction). Because U3 does not have a
discernible
methylation motif, it is not believed to participate in
that process.
Interestingly, box D has also been implicated in the methylation of U3
itself, specifically, in the hypermethylation of a
monomethyl guanosine
cap to yield TMG (
68). In contrast to TMG
cap formation for
the spliceosomal RNAs, hypermethylation of U3
does not occur in the
cytoplasm but in the nucleus (
67). The
TMG cap is believed
to protect the 5' segment of U3 from degradation
by exonucleases.
Indeed, when TMG is not formed, a shorter molecule,
stabilized by the
box C'/D stem motif accumulates. This shorter
by-product was observed
when U3 was encoded in an intron context
or removed
posttranscriptionally with a ribozyme (
57,
76).
Consistent
with a role in protecting 5' ends, in vivo addition
of a TMG cap to the
normally uncapped yeast U14 snoRNA yields
a final product with a capped
5' extension; the 5' end is defined
by the TMG cap
(
35; see also references
3 and
36). Whether
protection of the 5' end is the true
and only function of the
TMG cap in U3 and other capped snoRNAs remains
to be determined.
Boxes B and C are predicted to form a recognition motif for a
U3-specific protein(s).
The canonical box C element is required
for normal function of U3; this is due, most likely, to interaction
with some trans-acting factor(s). In the secondary
structure, box B is always found in close proximity to box C,
suggesting that boxes B and C may form a recognition motif and interact
with the same factor(s). The importance of box B was demonstrated by a
substitution mutation which impaired U3 function, although to a lesser
degree than substitution of box C.
Box C is known to influence the association of mammalian U3 with
fibrillarin (
6). This effect was demonstrated by adding
in
vitro-transcribed U3 to cell extracts and assaying complex
formation
with antibodies to fibrillarin. It is not known if this
association is
direct or depends on other
trans-acting factors.
A region
containing boxes B and C has been implicated in the binding
of a 55-kDa
protein from mammalian cells (
37). This protein
was isolated
as part of a U3 RNP complex from CHO cells and subsequently
shown to
bind U3 in vitro. In another study, chemical and nuclease
probing
analyses with free
Trypanosoma sp. and human U3 RNAs and
the
corresponding RNPs revealed that regions containing boxes
B and C are
most likely covered with protein (
21,
50). Similar
results
have been also obtained with U3 RNP complexes in yeast
cells and
extracts (
44). We speculate that boxes B and C form
a
conserved U3-specific box B/C motif and that this structure
serves as a
recognition signal for one or more protein factors.
This putative
interaction is essential for the formation of a
functional U3 snoRNP.
Nearly 50% of wild-type U3 is dispensable.
Our results
demonstrate that the nonconserved stem-loop domains in the highly
structured 3' portion are not required for U3 accumulation or function.
Molecules lacking all three hairpins, corresponding to about 50% of
the nucleotides, accumulate and provide normal function. This fact,
though quite remarkable, is not completely surprising. For example, the
yeast U2 spliceosomal RNA is almost six times larger than mammalian U2
and more than 80% of the molecule, corresponding to the nonconserved
parts, can be removed without significantly affecting function (1, 63). The U3 from S. cerevisiae with 333 nucleotides is
among the largest known U3 molecules. The smallest ones, from protists, are about 50% smaller and do not possess hairpins 2 to 4 (18, 21,
49). However, the latter RNAs contain all of the phylogenetically conserved U3 elements. Our functional mini-U3 molecule looks very similar to the protist homologs.
The nonconserved hairpins in
S. cerevisiae U3 do not appear
to be without function. In addition to the major expected species,
cells expressing the mini-U3 accumulate two minor, larger variants
with
extra nucleotides at the 3' end. We speculate that some or
all of the
nonconserved hairpins might be important for proper
RNA folding and
subsequent processing. Interestingly, internal
deletions in the
spliceosomal U2 snRNA can also result in extension
of the 3' end
(
63).
Structure-function map of U3.
The structural and functional
information available for the U3 small nucleolar RNA from S. cerevisiae is summarized in Fig. 11. The 5' segment containing the
conserved GAC, A', and A boxes is believed to be involved in direct
interaction with pre-rRNA, which is critical for rRNA processing. The
hinge region is proposed to serve a spacer function to divide the
protein-covered 3' portion of U3 and the 5' segment, which interacts
with pre-rRNA. The 5' TMG cap is postulated to protect the 5' region
upstream of the box C'/D stem motif from exonucleolytic degradation.
The box C'/D stem and box B/C motifs are proposed to be recognition
signals for RNA binding proteins. A protein(s) associated with the box C'/D stem motif provides U3 stability and processing and allows nucleolar targeting functions. Protein(s) recognizing the box B/C motif
is predicted to be important for U3 function. Finally, the nonconserved
hairpins 2, 3, and 4 are dispensable but appear to facilitate RNA
folding and processing, thus affecting the homogeneity of the final U3
products. The present map will be useful for studies aimed at
identifying the precise role that U3 RNA plays in ribosome biogenesis
and characterizing its mechanism of action.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 11.
Functional map of U3 snoRNA. Results from the present
and earlier studies have been combined to yield a functional map of the
U3 molecule from S. cerevisiae. The 5' segment encompassing
conserved boxes A and A' and a novel conserved element, designated the
GAC box, is involved in direct interaction with pre-rRNA and is
essential for snoRNA function but not production. A hinge region is
predicted to provide proper spacing between the 5' portion which
interacts with pre-rRNA and the 3' segment complexed with RNA binding
proteins. The 5' and hinge segments are protected from degradation by a
TMG (gamma-monomethyl phosphate in plants) cap. The box C'/D stem motif
is homologous to the box C/D stem motifs in other box C/D snoRNAs and
most likely serves as a recognition element for protein(s) which in U3
(i) protects the RNA from degradation, (ii) facilitates formation of
the 5' TMG-cap, and (iii) specifies nucleolar localization. Formation
of the box C'/D stem structure requires pairing of the central stem.
Boxes B and C are proposed to form a box B/C structure motif which
serves as a recognition element for a trans-acting
factor(s), presumably a protein(s). Interaction with this factor(s) is
required for U3 function. Hairpins 2, 3, and 4 are dispensable for U3
accumulation and function. These latter domains may be considered a
species-specific "signature." The nucleotide regions corresponding
to the minimal functional U3 are indicated by boldface letters. The
shaded areas correspond to putative protein recognition sites.
|
|
 |
ACKNOWLEDGMENTS |
We thank Nandita Sharma for help in preparing box B and box C
substitution mutations, Matthew Huang and Xiwei Wang for sharing unpublished data, Andrey Balakin for valuable discussions, and Elizabeth Furter-Graves for expert editorial work. We also thank Susan
Baserga, Michael Terns, and anonymous reviewers for critical reading of
the manuscript prior to publication and for helpful suggestions.
This research was supported by National Institutes of Health grant
GM19351.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, Lederle GRC Tower B, University of Massachusetts, Box 34505, Amherst, MA 01003-4505. Phone: (413) 545-2732. Fax: (413) 545-3291. E-mail:
4nier{at}biochem.umass.edu.
 |
REFERENCES |
| 1.
|
Ares, M., Jr.
1986.
U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs.
Cell
47:49-59[Medline].
|
| 2.
|
Bachellerie, J. P., and J. Cavaille.
1997.
Guiding ribose methylation of rRNA.
Trends Biochem. Sci.
22:257-261[Medline].
|
| 3.
|
Balakin, A. G.,
R. A. Lempicki,
G. M. Huang, and M. J. Fournier.
1994.
Saccharomyces cerevisiae U14 small nuclear RNA has little secondary structure and appears to be produced by post-transcriptional processing.
J. Biol. Chem.
269:739-746[Abstract/Free Full Text].
|
| 4.
|
Balakin, A. G.,
G. S. Schneider,
M. S. Corbett,
J. Ni, and M. J. Fournier.
1993.
SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae.
Nucleic Acids Res.
21:5391-5397[Abstract/Free Full Text].
|
| 5.
|
Baserga, S. J.,
M. Gilmore-Hebert, and X. W. Yang.
1992.
Distinct molecular signals for nuclear import of the nucleolar snRNA, U3.
Genes Dev.
6:1120-1130[Abstract/Free Full Text].
|
| 6.
|
Baserga, S. J.,
X. W. Yang, and J. A. Steitz.
1991.
An intact box C sequence in the U3 snRNA is required for binding of fibrillarin, the protein common to the major family of nucleolar snRNPs.
EMBO J.
10:2645-2651[Medline].
|
| 7.
|
Beltrame, M.,
Y. Henry, and D. Tollervey.
1994.
Mutational analysis of an essential binding site for the U3 snoRNA in the 5' external transcribed spacer of yeast pre-rRNA.
Nucleic Acids Res.
22:5139-5147[Abstract/Free Full Text].
|
| 8.
|
Beltrame, M., and D. Tollervey.
1995.
Base pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis.
EMBO J.
14:4350-4356[Medline].
|
| 9.
|
Beltrame, M., and D. Tollervey.
1992.
Identification and functional analysis of two U3 binding sites on yeast pre-ribosomal RNA.
EMBO J.
11:1531-1542[Medline].
|
| 10.
|
Bernstein, L. B.,
S. M. Mount, and A. M. Weiner.
1983.
Pseudogenes for human small nuclear RNA U3 appear to arise by integration of self-primed reverse transcripts of the RNA into new chromosomal sites.
Cell
32:461-472[Medline].
|
| 11.
|
Brule, F.,
J. Venema,
V. Segault,
D. Tollervey, and C. Branlant.
1996.
The yeast Hansenula wingei U3 snoRNA gene contains an intron and its coding sequence co-evolved with the 5' ETS of the pre-ribosomal RNA.
RNA
2:183-197[Abstract].
|
| 12.
|
Caffarelli, E.,
A. Fatica,
S. Prislei,
E. De Gregorio,
P. Fragapane, and I. Bozzoni.
1996.
Processing of the intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA.
EMBO J.
15:1121-1131[Medline].
|
| 13.
|
Cavaille, J., and J. P. Bachellerie.
1996.
Processing of fibrillarin-associated snoRNAs from pre-mRNA introns: an exonucleolytic process exclusively directed by the common stem-box terminal structure.
Biochimie
78:443-456[Medline].
|
| 14.
|
Cavaille, J.,
M. Nicoloso, and J.-P. Bachellerie.
1996.
Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides.
Nature
383:732-735[Medline].
|
| 15.
|
Dunbar, D. A.,
S. Wormsley,
T. M. Agentis, and S. J. Baserga.
1997.
Mpp10p, a U3 small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast.
Mol. Cell. Biol.
17:5803-5812[Abstract].
|
| 16.
|
Fournier, M. J., and E. S. Maxwell.
1993.
The nucleolar snRNAs: catching up with the spliceosomal snRNAs.
Trends Biochem. Sci.
18:131-135[Medline].
|
| 17.
|
Gerbi, S. A.
1995.
Small nucleolar RNA.
Biochem. Cell Biol.
73:845-858[Medline].
|
| 18.
|
Greenwood, S. J.,
M. N. Schnare, and M. W. Gray.
1996.
Molecular characterization of U3 small nucleolar RNA from the early diverging protist, Euglena gracilis.
Curr. Genet.
30:338-346[Medline].
|
| 19.
|
Gu, J., and R. Reddy.
1997.
Small RNA database.
Nucleic Acids Res.
25:98-102[Abstract/Free Full Text].
|
| 20.
|
Hanahan, D.,
J. Jessee, and F. R. Bloom.
1991.
Plasmid transformation of Escherichia coli and other bacteria.
Methods Enzymol.
204:63-113[Medline].
|
| 21.
|
Hartshorne, T., and N. Agabian.
1994.
A common core structure for U3 small nucleolar RNAs.
Nucleic Acids Res.
22:3354-3364[Abstract/Free Full Text].
|
| 22.
|
Hartshorne, T., and N. Agabian.
1993.
RNA B is the major nucleolar trimethylguanosine-capped small nuclear RNA associated with fibrillarin and pre-rRNAs in Trypanosoma brucei.
Mol. Cell. Biol.
13:144-154[Abstract/Free Full Text].
|
| 23.
|
Huang, G. M.,
A. Jarmolowski,
J. C. R. Struck, and M. J. Fournier.
1992.
Accumulation of U14 small nuclear RNA in Saccharomyces cerevisiae requires box C, box D, and a 5', 3' terminal stem.
Mol. Cell. Biol.
12:4456-4463[Abstract/Free Full Text].
|
| 24.
|
Hughes, J. M. X.
1996.
Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.
J. Mol. Biol.
259:645-654[Medline].
|
| 25.
|
Hughes, J. M. X., and M. Ares, Jr.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 26.
|
Hughes, J. M. X.,
D. A. M. Konings, and G. Cesareni.
1987.
The yeast homologue of U3 snRNA.
EMBO J.
6:2145-2155[Medline].
|
| 27.
|
Jansen, R.,
D. Tollervey, and E. C. Hurt.
1993.
A U3 snoRNP protein with homology to splicing factor PRP4 and G domains is required for ribosomal RNA processing.
EMBO J.
12:2549-2558[Medline].
|
| 28.
|
Jeppesen, C.,
B. Stebbins-Boaz, and S. A. Gerbi.
1988.
Nucleotide sequence determination and secondary structure of Xenopus U3 snRNA.
Nucleic Acids Res.
16:2127-2148[Abstract/Free Full Text].
|
| 29.
|
Kass, S.,
K. Tyc,
J. A. Steitz, and B. Sollner-Webb.
1990.
The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing.
Cell
60:897-908[Medline].
|
| 30.
|
Kiss, T., and F. Solymosy.
1990.
Molecular analysis of a U3 RNA gene locus in tomato: transcription signals, the coding region, expression in transgenic tobacco plants and tandemly repeated pseudogenes.
Nucleic Acids Res.
18:1941-1949[Abstract/Free Full Text].
|
| 31.
|
Kiss, T.,
M. Toth, and F. Solymosy.
1985.
Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization.
Eur. J. Biochem.
152:259-266[Medline].
|
| 32.
|
Kiss-Laszlo, Z.,
Y. Henry,
J. P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 33.
|
Kohrer, K., and H. Domdey.
1991.
Preparation of high molecular weight RNA.
Methods Enzymol.
194:398-405[Medline].
|
| 34.
|
Leader, D. J.,
S. Connelly,
W. Filipowicz, and J. W. S. Brown.
1994.
Characterization and expression of a maize U3 snRNA gene.
Biochim. Biophys. Acta
1219:145-147[Medline].
|
| 35.
| Lempicki, R. A., and M. J. Fournier.
1994. Unpublished data.
|
| 36.
|
Li, H. V., and M. J. Fournier.
1992.
U14 function in Saccharomyces cerevisiae can be provided by large deletion variants of yeast U14 and hybrid mouse-yeast U14 RNAs.
EMBO J.
11:683-689[Medline].
|
| 37.
|
Lubben, B.,
C. Marshallsay,
N. Rottmann, and R. Luhrmann.
1993.
Isolation of U3 snoRNP from CHO cells: a novel 55 kDa protein binds to the central part of U3 snoRNA.
Nucleic Acids Res.
21:5377-5385[Abstract/Free Full Text].
|
| 38.
|
Maden, T.
1996.
Click here for methylation.
Nature
383:675-676[Medline].
|
| 39.
|
Marshallsay, C.,
S. Connelly, and W. Filipowicz.
1992.
Characterization of the U3 and U6 snRNA genes from wheat: U3 snRNA genes in monocot plants are transcribed by RNA polymerase III.
Plant Mol. Biol.
19:973-983[Medline].
|
| 40.
|
Maxwell, E. S., and M. J. Fournier.
1995.
The small nucleolar RNAs.
Annu. Rev. Biochem.
35:897-934.
|
| 41.
|
Mazan, S., and J. P. Bachellerie.
1988.
Structure and organization of mouse U3B RNA functional genes.
J. Biol. Chem.
263:19461-19467[Abstract/Free Full Text].
|
| 42.
|
Mazan, S.,
M. P. Gulli,
N. Joseph, and J. P. Bachellerie.
1992.
Structure of the differentially expressed mouse U3A gene.
Eur. J. Biochem.
205:1033-1041[Medline].
|
| 43.
|
Mazan, S.,
L. H. Qu,
J. Sri-Widada,
M. Nicoloso, and J. P. Bachellerie.
1990.
Presence of a differentially expressed U3A RNA variant in mouse. Structure and evolutive implications.
FEBS Lett.
267:121-125[Medline].
|
| 44.
|
Mereau, A.,
R. Fournier,
A. Gregoire,
A. Mougin,
P. Fabrizio,
R. Luhrmann, and C. Branlant.
1997.
An in vivo and in vitro structure-function analysis of the Saccharomyces cerevisiae U3A snoRNP: protein-RNA contacts and base-pair interaction with the pre-ribosomal RNA.
J. Mol. Biol.
273:552-571[Medline].
|
| 45.
|
Mougey, E. B.,
L. K. Pape, and B. Sollner-Webb.
1993.
A U3 small nuclear ribonucleoprotein-requiring processing event in the 5' external transcribed spacer of Xenopus precursor rRNA.
Mol. Cell. Biol.
13:5990-5998[Abstract/Free Full Text].
|
| 46.
|
Mougin, A.,
A. Gregoire,
J. Banroques,
V. Segault,
R. Fournier,
F. Brule,
M. Chevrier-Miller, and C. Branlant.
1996.
Secondary structure of the yeast Saccharomyces cerevisiae pre-U3A snoRNA and its implication for splicing efficiency.
RNA
2:1079-1093[Abstract].
|
| 47.
|
Myslinski, E.,
V. Segault, and C. Branlant.
1990.
An intron in the genes for U3 small nucleolar RNAs of the yeast Saccharomyces cerevisiae.
Science
247:1213-1216[Abstract/Free Full Text].
|
| 48.
|
Nicoloso, M.,
L. H. Qu,
B. Michot, and J. P. Bachellerie.
1996.
Intron-encoded, antisense small nucleolar RNAs: the characterization of nine novel species points to their direct role as guides for the 2'-O-ribose methylation of rRNAs.
J. Mol. Biol.
260:178-195[Medline].
|
| 49.
|
Orum, H.,
H. Nielsen, and J. Engberg.
1993.
Sequence and proposed secondary structure of the Tetrahymena thermophila U3-snRNA.
Nucleic Acids Res.
21:2511[Free Full Text].
|
| 50.
|
Parker, K. A., and J. A. Steitz.
1987.
Structural analyses of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.
Mol. Cell. Biol.
7:2899-2913[Abstract/Free Full Text].
|
| 51.
|
Peculis, B. A., and S. M. Mount.
1996.
Ribosomal RNA: small nucleolar RNAs make their mark.
Curr. Opin. Cell Biol.
6:1413-1415.
|
| 52.
|
Porter, G. L.,
P. J. Brennwald,
K. A. Holm, and J. A. Wise.
1988.
The sequence of U3 from Schizosaccharomyces pombe suggests structural divergence of this snRNA between metazoans and unicellular eukaryotes.
Nucleic Acids Res.
16:10131-10152[Abstract/Free Full Text].
|
| 53.
|
Reddy, R.,
D. Henning, and H. Busch.
1979.
Nucleotide sequence of nucleolar U3B RNA.
J. Biol. Chem.
254:11097-11105[Abstract/Free Full Text].
|
| 54.
|
Rose, M. D.,
F. Winston, and P. Heiter.
1990.
In
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 55.
|
Samarsky, D. A.,
A. G. Balakin, and M. J. Fournier.
1995.
Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35, and snR36.
Nucleic Acids Res.
23:2548-2554[Abstract/Free Full Text].
|
| 56.
| Samarsky, D. A., E. Bertrand, R. H. Singer,
and M. J. Fournier. Unpublished data.
|
| 57.
| Samarsky, D. A., G. Ferbeyre, E. Bertrand, R. H. Singer, R. Cedergren, and M. J. Fournier. Unpublished
data.
|
| 58.
| Samarsky, D. A., and M. J. Fournier.
1996. Unpublished data.
|
| 59.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 60.
|
Savino, R., and S. A. Gerbi.
1990.
In vivo disruption of Xenopus U3 snRNA affects ribosomal RNA processing.
EMBO J.
9:2299-2308[Medline].
|
| 61.
|
Segault, V.,
A. Mougin,
A. Gregoire,
J. Banroques, and C. Branlant.
1992.
An experimental study of Saccharomyces cerevisiae U3 snRNA conformation in solution.
Nucleic Acids Res.
20:3443-3451[Abstract/Free Full Text].
|
| 62.
|
Selinger, D. A.,
G. L. Porter,
P. J. Brennwald, and J. A. Wise.
1992.
The two similarly expressed genes encoding U3 snRNA in Schizosaccharomyces pombe lack introns.
Mol. Biol. Evol.
9:297-308[Abstract].
|
| 63.
|
Shuster, E. O., and C. Guthrie.
1988.
Two conserved domains of yeast U2 snRNA are separated by 945 nonessential nucleotides.
Cell
55:41-48[Medline].
|
| 64.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 65.
|
Smith, C. M., and J. A. Steitz.
1997.
Sno storm in the nucleolus: new roles for myriad small RNPs.
Cell
89:669-672[Medline].
|
| 66.
|
Stroke, I. L., and A. M. Weiner.
1989.
The 5' end of U3 snRNA can be crosslinked in vivo to the external transcribed spacer of rat ribosomal RNA precursor.
J. Mol. Biol.
210:497-512[Medline].
|
| 67.
|
Terns, M. P., and J. E. Dahlberg.
1994.
Retention and 5' cap trimethylation of U3 snRNA in the nucleus.
Science
264:959-961[Abstract/Free Full Text].
|
| 68.
|
Terns, M. P.,
C. Grimm,
E. Lund, and J. Dahlberg.
1995.
A common maturation pathway for small nucleolar RNAs.
EMBO J.
14:4860-4871[Medline].
|
| 69.
|
Tollervey, D., and T. Kiss.
1997.
Function and synthesis of small nucleolar RNAs.
Curr. Opin. Cell Biol.
9:337-342[Medline].
|
| 70.
|
Tollervey, D.,
H. Lehtonen,
M. Carmo-Fonseca, and E. C. Hurt.
1991.
The small nucleolar RNP protein NOP1 (fibrillarin) is required for pre-rRNA processing in yeast.
EMBO J.
10:573-583[Medline].
|
| 71.
|
Tollervey, D.,
H. Lehtonen,
R. Jansen,
H. Kern, and E. C. Hurt.
1993.
Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly.
Cell
72:443-457[Medline].
|
| 72.
|
Tyc, K., and J. A. Steitz.
1992.
A new interaction between the mouse 5' external transcribed spacer of pre-rRNA and the U3 snRNA detected by psoralen crosslinking.
Nucleic Acids Res.
20:5375-5382[Abstract/Free Full Text].
|
| 73.
|
Tyc, K., and J. A. Steitz.
1989.
U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus.
EMBO J.
8:3113-3119[Medline].
|
| 74.
|
Tycowski, K. T.,
M. D. Shu, and J. A. Steitz.
1993.
A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein S3.
Genes Dev.
7:1176-1190[Abstract/Free Full Text].
|
| 75.
|
Tycowski, K. T.,
C. M. Smith,
M. D. Shu, and J. A. Steitz.
1996.
A small nucleolar RNA requirement for site-specific ribose methylation of rRNA in Xenopus.
Proc. Natl. Acad. Sci. USA
93:14480-14485[Abstract/Free Full Text].
|
| 76.
|
Watkins, N. J.,
R. D. Leverette,
L. Xia,
M. T. Andrews, and E. S. Maxwell.
1996.
Elements essential for processing intronic U14 snoRNA are located at the termini of the mature snoRNA sequence and include conserved nucleotide boxes C and D.
RNA
2:118-133[Abstract].
|
| 77.
|
Wise, J. A., and A. M. Weiner.
1980.
Dictyostelium small nuclear RNA D2 is homologous to rat nucleolar RNA U3 and is encoded by a dispersed multigene family.
Cell
22:109-118[Medline].
|
| 78.
|
Xia, L.,
N. J. Watkins, and E. S. Maxwell.
1997.
Identification of specific nucleotide sequences and structural elements required for intronic U14 snoRNA processing.
RNA
3:17-26[Abstract].
|
| 79.
|
Zwieb, C.
1996.
The uRNA database.
Nucleic Acids Res.
24:76-79[Abstract/Free Full Text].
|
Mol Cell Biol, June 1998, p. 3431-3444, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nabavi, S., Nellimarla, S., Nazar, R. N.
(2008). Post-transcriptional Regulation of the U3 Small Nucleolar RNA. J. Biol. Chem.
283: 21404-21410
[Abstract]
[Full Text]
-
Chakrabarti, K., Pearson, M., Grate, L., Sterne-Weiler, T., Deans, J., Donohue, J. P., Ares, M. Jr
(2007). Structural RNAs of known and unknown function identified in malaria parasites by comparative genomics and RNA analysis. RNA
13: 1923-1939
[Abstract]
[Full Text]
-
Reichow, S. L., Hamma, T., Ferre-D'Amare, A. R., Varani, G.
(2007). The structure and function of small nucleolar ribonucleoproteins. Nucleic Acids Res
35: 1452-1464
[Abstract]
[Full Text]
-
Clery, A., Senty-Segault, V., Leclerc, F., Raue, H. A., Branlant, C.
(2007). Analysis of Sequence and Structural Features That Identify the B/C Motif of U3 Small Nucleolar RNA as the Recognition Site for the Snu13p-Rrp9p Protein Pair. Mol. Cell. Biol.
27: 1191-1206
[Abstract]
[Full Text]
-
Bax, R., Vos, H. R., Raue, H. A., Vos, J. C.
(2006). Saccharomyces cerevisiae Sof1p Associates with 35S Pre-rRNA Independent from U3 snoRNA and Rrp5p. Eukaryot Cell
5: 427-434
[Abstract]
[Full Text]
-
Vos, H. R., Bax, R., Faber, A. W., Vos, J. C., Raue, H. A.
(2004). U3 snoRNP and Rrp5p associate independently with Saccharomyces cerevisiae 35S pre-rRNA, but Rrp5p is essential for association of Rok1p. Nucleic Acids Res
32: 5827-5833
[Abstract]
[Full Text]
-
Gallagher, J. E.G., Dunbar, D. A., Granneman, S., Mitchell, B. M., Osheim, Y., Beyer, A. L., Baserga, S. J.
(2004). RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components. Genes Dev.
18: 2506-2517
[Abstract]
[Full Text]
-
Granneman, S., Vogelzangs, J., Luhrmann, R., van Venrooij, W. J., Pruijn, G. J. M., Watkins, N. J.
(2004). Role of Pre-rRNA Base Pairing and 80S Complex Formation in Subnucleolar Localization of the U3 snoRNP. Mol. Cell. Biol.
24: 8600-8610
[Abstract]
[Full Text]
-
YADAVA, R. S., MAHEN, E. M., FEDOR, M. J.
(2004). Kinetic analysis of ribozyme-substrate complex formation in yeast. RNA
10: 863-879
[Abstract]
[Full Text]
-
Gallagher, J. E. G., Baserga, S. J.
(2004). Two-hybrid Mpp10p interaction-defective Imp4 proteins are not interaction defective in vivo but do confer specific pre-rRNA processing defects in Saccharomyces cerevisiae. Nucleic Acids Res
32: 1404-1413
[Abstract]
[Full Text]
-
DOBBYN, H. C., O'KEEFE, R. T.
(2004). Analysis of Snu13p mutations reveals differential interactions with the U4 snRNA and U3 snoRNA. RNA
10: 308-320
[Abstract]
[Full Text]
-
MARMIER-GOURRIER, N., CLERY, A., SENTY-SEGAULT, V., CHARPENTIER, B., SCHLOTTER, F., LECLERC, F., FOURNIER, R., BRANLANT, C.
(2003). A structural, phylogenetic, and functional study of 15.5-kD/Snu13 protein binding on U3 small nucleolar RNA. RNA
9: 821-838
[Abstract]
[Full Text]
-
Yuan, G., Klambt, C., Bachellerie, J.-P., Brosius, J., Huttenhofer, A.
(2003). RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs. Nucleic Acids Res
31: 2495-2507
[Abstract]
[Full Text]
-
Granneman, S., Gallagher, J. E. G., Vogelzangs, J., Horstman, W., Venrooij, W. J. v., Baserga, S. J., Pruijn, G. J. M.
(2003). The human Imp3 and Imp4 proteins form a ternary complex with hMpp10, which only interacts with the U3 snoRNA in 60-80S ribonucleoprotein complexes. Nucleic Acids Res
31: 1877-1887
[Abstract]
[Full Text]
-
Granneman, S., Pruijn, G. J. M., Horstman, W., van Venrooij, W. J., Luhrmann, R., Watkins, N. J.
(2002). The hU3-55K Protein Requires 15.5K Binding to the Box B/C Motif as Well as Flanking RNA Elements for Its Association with the U3 Small Nucleolar RNA in Vitro. J. Biol. Chem.
277: 48490-48500
[Abstract]
[Full Text]
-
Wehner, K. A., Gallagher, J. E. G., Baserga, S. J.
(2002). Components of an Interdependent Unit within the SSU Processome Regulate and Mediate Its Activity. Mol. Cell. Biol.
22: 7258-7267
[Abstract]
[Full Text]
-
Borovjagin, A. V., Gerbi, S. A.
(2001). Xenopus U3 snoRNA GAC-Box A' and Box A Sequences Play Distinct Functional Roles in rRNA Processing. Mol. Cell. Biol.
21: 6210-6221
[Abstract]
[Full Text]
-
GERBI, S.A., BOROVJAGIN, A.V., EZROKHI, M., LANGE, T.S.
(2001). Ribosome Biogenesis: Role of Small Nucleolar RNA in Maturation of Eukaryotic rRNA. Cold Spring Harb Symp Quant Biol
66: 575-590
[Abstract]
-
Speckmann, W. A., Terns, R. M., Terns, M. P.
(2000). The Box C/D motif directs snoRNA 5'-cap hypermethylation. Nucleic Acids Res
28: 4467-4473
[Abstract]
[Full Text]
-
Lukowiak, A. A., Granneman, S., Mattox, S. A., Speckmann, W. A., Jones, K., Pluk, H., Venrooij, W. J. v., Terns, R. M., Terns, M. P.
(2000). Interaction of the U3-55k protein with U3 snoRNA is mediated by the Box B/C motif of U3 and the WD repeats of U3-55k. Nucleic Acids Res
28: 3462-3471
[Abstract]
[Full Text]
-
Antal, M., Mougin, A., Kis, M., Boros, E., Steger, G., Jakab, G., Solymosy, F., Branlant, C.
(2000). Molecular characterization at the RNA and gene levels of U3 snoRNA from a unicellular green alga, Chlamydomonas reinhardtii. Nucleic Acids Res
28: 2959-2968
[Abstract]
[Full Text]
-
Villa, T., Ceradini, F., Bozzoni, I.
(2000). Identification of a Novel Element Required for Processing of Intron-Encoded Box C/D Small Nucleolar RNAs in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 1311-1320
[Abstract]
[Full Text]
-
Speckmann, W., Narayanan, A., Terns, R., Terns, M. P.
(1999). Nuclear Retention Elements of U3 Small Nucleolar RNA. Mol. Cell. Biol.
19: 8412-8421
[Abstract]
[Full Text]
-
Sharma, K., Tollervey, D.
(1999). Base Pairing between U3 Small Nucleolar RNA and the 5' End of 18S rRNA Is Required for Pre-rRNA Processing. Mol. Cell. Biol.
19: 6012-6019
[Abstract]
[Full Text]
-
Narayanan, A., Speckmann, W., Terns, R., Terns, M. P.
(1999). Role of the Box C/D Motif in Localization of Small Nucleolar RNAs to Coiled Bodies and Nucleoli. Mol. Biol. Cell
10: 2131-2147
[Abstract]
[Full Text]
-
Samarsky, D. A., Ferbeyre, G., Bertrand, E., Singer, R. H., Cedergren, R., Fournier, M. J.
(1999). A small nucleolar RNA:ribozyme hybrid cleaves a nucleolar RNA target in vivo with near-perfect efficiency. Proc. Natl. Acad. Sci. USA
96: 6609-6614
[Abstract]
[Full Text]
-
Lange, T. S., Ezrokhi, M., Borovjagin, A. V., Rivera-León, R., North, M. T., Gerbi, S. A.
(1998). Nucleolar Localization Elements of Xenopus laevis U3 Small Nucleolar RNA. Mol. Biol. Cell
9: 2973-2985
[Abstract]
[Full Text]