Previous Article | Next Article 
Mol Cell Biol, June 1998, p. 3527-3539, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Conserved p38 Mitogen-Activated Protein Kinase
Pathway Regulates Drosophila Immunity Gene
Expression
Zhiqiang Stanley
Han,1
Hervé
Enslen,1,2
Xiaodi
Hu,1
Xiangjun
Meng,1
I-Huan
Wu,1,2
Tamera
Barrett,1,2
Roger J.
Davis,1,2 and
Y. Tony
Ip1,3,*
Program in Molecular Medicine, Department of
Biochemistry and Molecular Biology,1 and
Department of Cell Biology,3
University of Massachusetts Medical Center, Howard Hughes
Medical Institute,2 Worcester, Massachusetts
01605
Received 1 December 1997/Returned for modification 6 February
1998/Accepted 17 March 1998
 |
ABSTRACT |
Accumulating evidence suggests that the insect and mammalian innate
immune response is mediated by homologous regulatory components. Proinflammatory cytokines and bacterial lipopolysaccharide stimulate mammalian immunity by activating transcription factors such as NF-
B
and AP-1. One of the responses evoked by these stimuli is the
initiation of a kinase cascade that leads to the phosphorylation of p38
mitogen-activated protein (MAP) kinase on Thr and Tyr within the motif
Thr-Gly-Tyr, which is located within subdomain VIII. We have
investigated the possible involvement of the p38 MAP kinase pathway in
the Drosophila immune response. Two genes that are highly
homologous to the mammalian p38 MAP kinase were molecularly cloned and
characterized. Furthermore, genes that encode two novel Drosophila MAP kinase kinases, D-MKK3 and D-MKK4, were
identified. D-MKK3 is an efficient activator of both
Drosophila p38 MAP kinases, while D-MKK4 is an activator of
D-JNK but not D-p38. These data establish that Drosophila
indeed possesses a conserved p38 MAP kinase signaling pathway. We have
examined the role of the D-p38 MAP kinases in the regulation of insect
immunity. The results revealed that one of the functions of D-p38 is to
attenuate antimicrobial peptide gene expression following exposure to
lipopolysaccharide.
 |
INTRODUCTION |
Upon bacterial or fungal infection,
insects synthesize and secrete into the hemolymph a spectrum of
antimicrobial peptides which function synergistically to lyse the
invading microorganisms (6, 29, 30, 32). Antimicrobial
peptides such as attacin, cecropin, diptericin, defensin, lysozyme, and
drosomycin have been isolated from different insects (6, 29, 30,
32). The insect immune response has been proposed to be similar
to vertebrate innate immunity, which includes the activation of
macrophages and the induction of the acute-phase response during
infection and injury (3, 40, 53, 70). This contention is
supported by the isolation of cecropin from pig intestine
(44) and defensin from neutrophils and macrophages
(46).
To facilitate the molecular genetic analysis of insect immunity, the
genes coding for a number of antimicrobial peptides were cloned from
Drosophila melanogaster (2, 14, 18, 42, 75). By
using these molecular clones as probes, several laboratories have
demonstrated that at least some of these genes are regulated by
transcription factors related to NF-
B, NF-IL6, and GATA
(17-19, 34, 36, 37). Furthermore, the bacterial cell wall
component lipopolysaccharide (LPS), a potent mitogen of mammalian
lymphoid cells and inducer of NF-
B and AP-1 activities (13, 25,
52, 58, 72), can efficiently induce insect immunity gene
expression (17, 34, 60, 63). Therefore, it is likely that
insects and mammals employ homologous signaling molecules in
self-defense processes. This notion is further supported by the
molecular cloning of Dif, the Dorsal-related immunity factor, and
Relish, which belong to the Rel/NF-
B family of transcription factors
(16, 35, 73). Experimental analyses suggest that the
Rel-related factors are activated upon infection and regulate at least
a subset of antimicrobial peptide genes (16, 21, 35, 48, 49, 57). The modulation of Dif and Dorsal activities depends on the
transmembrane protein Toll and its intracellular signaling components,
which are strikingly similar to those of the interleukin 1 (IL-1)
receptor that regulates NF-
B activity (4, 34). In
addition, a human homolog of Toll has recently been cloned and shown to
be involved in human innate immunity (53, 54). Together,
these data provide strong support for a conserved regulatory mechanism
in the immune response of different species.
The regulation of AP-1 and related proteins in mammalian immunity
requires a series of mitogen-activated protein kinase (MAPK) pathways
(33, 38, 74). The MAPK signal transduction pathways are
conserved from yeast to mammals (10, 65). Exposure of cells
to growth factors, cytokines, or environmental stress leads to the
activation of MAPK kinases, which activate the MAPKs by dual
phosphorylation on the Thr-X-Tyr motif located within subdomain VIII
(1, 11, 58). The activated MAPKs may then regulate the
activity of transcription factors, such as ATF2, Elk-1, and c-Jun, to
control gene expression.
Several MAPK pathways have been defined in mammalian systems. Following
stimulation, the c-Jun N-terminal kinase (JNK) phosphorylates c-Jun and
ATF2, leading to elevated transcriptional activities (74).
The p38 MAPK, when activated, phosphorylates different but overlapping
groups of protein substrates (58). The p38 MAPK was cloned
based on its tyrosine phosphorylation after LPS treatment and on its
binding to an anti-inflammatory drug (26, 45, 62). Further
experiments suggested that p38 participates not only in the
inflammatory response but also in stress-induced signaling (43), cell proliferation (55, 68), and apoptosis
(39, 41, 77).
Since insect and mammalian immune responses may have similar signaling
molecules, we have investigated the involvement of conserved MAPK
pathways in insect immunity. Previous experiments identified a
Drosophila JNK MAPK signaling pathway (61, 66) and demonstrated that D-JNK is activated during the immune response (66). The p38 MAPK pathway may also be employed in insect
self-defense processes. Indeed, we found two genes, D-p38a and D-p38b,
that encode proteins highly related to the mammalian p38 MAPK. Two upstream MAPK kinases, related to MKK3 (12) and MKK4
(12, 50, 64), have also been identified in the
Drosophila genome. The Drosophila p38 MAPKs can
phosphorylate ATF2 and, to a lesser extent, D-Jun. These kinase
activities can be activated by MAPK kinase D-MKK3. The
anti-inflammatory compound SB203580, which has been shown to inhibit
the activity of the mammalian p38 MAPK and the production of cytokines
(45), inhibits the activities of both D-p38 kinases.
Treatment of cultured Drosophila cells with SB203580
enhanced LPS-induced expression of antimicrobial peptide genes. In
addition, overexpression of D-p38a in transgenic animals suppresses the
LPS induction of immunity genes. These data, together with biochemical
evidence that LPS activates D-p38 MAPK, indicate that the D-p38 MAPKs
may be involved in insect immunity, perhaps by mediating down
regulation of immunity gene expression after prolonged induction. These
results demonstrate that insects possess a conserved p38 MAPK pathway
and that the utilization of this signaling pathway in inflammatory
responses is of ancient evolutionary origin.
 |
MATERIALS AND METHODS |
Molecular cloning.
To clone D-p38a, the degenerate
oligonucleotide primers 5'-GCNGTNGTNCGNGGNACNAA(C/T)ATGCA-3' and
5'-TANCCNGTCAT(C/T)TC(A/G)TT(C/T)TCNGTNGG-3' were employed
for PCR amplification of a 0- to 4-h embryonic cDNA library
(7). The reaction was performed for 30 cycles with an
annealing temperature of 42°C. A single 400-bp DNA product was
obtained and blunt end cloned into pBluescript KS(+) at the EcoRV site. DNA sequencing identified a fragment that
corresponds to a p38-related protein kinase. This PCR fragment was used
as a probe to screen the embryonic cDNA library, and six independent clones were isolated. Most of these clones corresponded to probably full-length cDNA by comparison with the size of the mRNA transcript on
Northern blots. Two clones were sequenced completely, and the deduced
amino acid sequence is shown in Fig. 1.
The genomic region of D-p38a was also obtained from a
library and analyzed. Sequence comparison showed
that the gene contains only one intron of 80 bp,
located in the 5' untranslated region (UTR). The D-p38b genomic sequence, deposited by the Berkeley Drosophila Genome
Project, was identified in GenBank (accession no. AC000616) by using the D-p38a sequence and the BLAST algorithm (National Center for Biotechnology Information). The similarity between the two D-p38 genes
is restricted to the protein-coding region.

View larger version (89K):
[in this window]
[in a new window]

View larger version (91K):
[in this window]
[in a new window]

View larger version (45K):
[in this window]
[in a new window]

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Molecular cloning of two Drosophila p38
MAPKs. (A and B) The nucleotide sequences of the D-p38a (A) and D-p38b
(B) genomic clones are presented. The exon structure of the D-p38a gene
and the primary sequence of the D-p38a protein kinase were deduced from
the sequences of cDNA clones. The sequences are numbered starting with
nucleotide 1 of exon 1. Two exons were identified in the D-p38a gene;
one exon included the 5' UTR, and the second exon included the complete
coding region. The intron is udnerlined. A single exon containing the
coding region of D-p38b was identified from the genomic sequence. The
sequence of the D-p38b gene is numbered arbitrarily upstream of the
initiation codon. The primary sequence encoded by each exon is
illustrated in the single-letter code (italics). Termination codons are
indicated by asterisks. (C) The D-p38 primary sequences were compared
with those of human MAPKs (JNK1, JNK2, JNK3, p38 , p38 , p38 ,
p38 , ERK1, ERK2, and ERK5) and Drosophila MAPKs (D-JNK
and D-ERKA) by using the PILE-UP program (version 9.0; Wisconsin
Genetics Computer Group). The protein sequences are presented in the
single-letter code. Gaps introduced into the sequences to optimize the
alignments are represented by dashes. Identical residues are indicated
by dots. The sites of activating phosphorylation on Thr and Tyr are
indicated by asterisks. Conserved kinase subdomains I to XI are
illustrated. (D) The relationship between members of the human and
Drosophila MAPK groups is presented as a dendrogram created
by the unweighted pair-group method using arithmetic averages (PILE-UP
program).
|
|
The PCR amplification of D-MKK3 and D-MKK4 was similar to that of
D-p38a, except that the annealing temperature was 47°C. The
degenerate oligonucleotides 5'-TGGATITG(C/T)ATGGA(A/G)(C/T)TIATG-3' and
5'-(G/A)TCIATIC(G/T)(T/C)IGGIGCCAT(G/A)TA-3' (where I is inosine) were used as primers. These amplimers were designed based on conserved regions of the mammalian MAPK kinase group. The PCR product
(approximately 400 bp) was cloned into the pBluescript vector. The
sequence of two clones was similar to that of mammalian MKK3, and that
of three clones was similar to that of mammalian MKK4. These cloned PCR
fragments were used to screen an embryonic cDNA library to isolate
full-length cDNA. Genomic clones corresponding to the two MAPK kinases
were also isolated and sequenced.
Embryo in situ hybridization.
Collections of wild-type
embryos ranging from 0 to 16 h were rinsed in a Triton X-100 NaCl
solution (0.03% Triton X-100, 50 mM NaCl), dechorionated in bleach for
3 min, and fixed with vigorous shaking in 4 ml of heptane-4 ml of
4.6% formaldehyde-0.5× phosphate-buffered saline-25 mM EGTA for 25 min. The embryos in the heptane layer were mixed with 2 volumes of
methanol, devitellinized by shaking for 1 min, washed with three
changes each of methanol, and washed with ethanol. The ethanol-washed
embryos were soaked in xylene for 30 min, rinsed with ethanol,
postfixed in 5% formaldehyde in 1× phosphate-buffered saline-0.1%
Tween 80 (PBT), washed in PBT, and digested with proteinase K (4 µg/ml) for 5 min. The embryos were washed, postfixed again, and
prehybridized (in 5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate]-50% deionized formamide-100-µg/ml salmon sperm
DNA-50-µg/ml heparin-0.1% Tween) at 55°C for 1 h.
Hybridization was carried out in the same buffer, at the same
temperature, with digoxigenin-labeled antisense RNA probes for 18 h. The hybridized embryos were washed extensively with hybridization
buffer at 55°C and then with PBT at room temperature and the
incubated with an alkaline phosphatase-conjugated antidigoxigenin antibody (Boehringer Mannheim) at 4°C overnight. The embryos were washed with PBT, and the expression patterns were visualized by incubation with staining solution (100 mM NaCl, 50 mM
MgCl2, 100 mM Tris [pH 9.5], 0.1% Tween 80) containing
nitroblue tetrazolium and X-phosphate (Boehringer Mannheim) as
substrates. The stained embryos were mounted in Permount (Fisher) and
photographed under differential interference contrast optics using a
Zeiss Axiophot microscope.
Protein purification and kinase assays.
To create
glutathione S-transferase (GST) fusion constructs, D-p38a
was PCR amplified with
5'-TGTGGGATCCTCAAGCAACACCATGGACTATAAGGACGATGACGACAAATCAGTGT CCATTACAAAA-3'
and 5'-TGTGGAGCTCTCACTTTACATCCTTTAG-3' as the primers and the cDNA clone as the template. The DNA product was digested with
BamHI and SacI and ligated into the same sites of
Escherichia coli expression vector pGSTag (15).
D-p38b was amplified by using
5'-GGCGGATCCGCCACCATGGCCAAATTCTACAAGCTG-3' and
5'-GCGTCTAGATTACTGCTCTTTGGGCAGGA-3' as the primers and
wild-type genomic DNA as the template. The PCR product was digested
with BamHI and XbaI and inserted into the pGSTag
vector. The expression constructs were introduced into E. coli BL21(DE3), and the cultures were induced with 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG). The GST
fusion proteins were purified with glutathione-agarose columns
(67). The purified proteins were employed for kinase assays.
Approximately 0.5 µg of D-p38a, 0.1 µg of D-p38b, 0.5 µg of D-JNK
(66), and 0.1 µg of protein kinase A (PKA; Sigma) were
used for each reaction. The phosphorylation reactions were initiated by
addition of 1 µg of substrate protein (ATF2 [58], D-JUN [66], myelin basic protein [Sigma], or casein
[Sigma]) and 1 pmol of [
-32P]ATP (10 mCi/mmol) in a
final volume of 20 µl of buffer (25 mM HEPES, [pH 7.4], 25 mM
-glycerophosphate, 25 mM MgCl2, 25 µM ATP, 0.1 mM
Na3VO4, 0.5 mM dithiothreitol [DTT]). When
the SB203580 compound (Calbiochem) was used, it was dissolved in
dimethyl sulfoxide (DMSO) and added to the reaction mixture containing
the protein kinases prior to addition of the substrates. The reactions
were terminated after 30 min of incubation at 30°C by addition of
sodium dodecyl sulfate (SDS) sample buffer. The phosphorylation of
substrate proteins was examined by SDS-polyacrylamide gel
electrophoresis (PAGE) and autoradiography.
Cell culture.
While some Schneider S2 subcultures show no
response to LPS stimulation (57, 63), the S2* cells
(57) in our laboratory show significant induction of the
Cecropin and Attacin genes. On the other hand,
Diptericin, Drosomycin, and Defensin
are not as inducible in this cultured S2* cell line (data not shown). S2* cells were grown in Schneider's medium supplemented with 10% heat-inactivated fetal calf serum, 1× Glutamax I, and 1× Pen-strep (GIBCO). Cells were treated with 1/1,000 of the cell culture volume of
either DMSO or SB203580 (dissolved in DMSO). Following 1 h of
treatment, LPS was added to 5 µg/ml. Samples were taken at different
times for RNA isolation.
Tissue culture expression vectors were constructed by PCR amplification
of the D-p38 cDNA with oligonucleotide primers. A
FLAG epitope was
inserted between codons 1 and 2 of the D-p38
cDNA. D-p38a was cloned
into the pPA-Actin5C vector (
27) between
the
BamHI and
SacI sites, while D-p38b was cloned
into the
BamHI
and
EcoRV sites. D-MKK3 was PCR
amplified, without the FLAG sequence,
and cloned into the
BamHI and
SacI sites of the pPA-Actin5C vector;
D-MKK4 was similarly cloned into the
EcoRV site. S2* cells
were
transfected by using the Lipofectin method (Life Technologies
Inc.) with 1 µg each of the D-p38 MAPK and D-MKK expression vectors.
After 48 h, the cells were serum deprived for 4 h, treated
with
LPS, and harvested.
Immunoprecipitation and protein kinase assays.
Cells were
solubilized with buffer A (20 mM Tris [pH 7.5], 10% glycerol, 1%
Triton X-100, 0.137 M NaCl, 25 mM
-glycerophosphate, 2 mM EDTA, 0.5 mM DTT, 1 mM Na3VO4, 2 mM Na pyrophosphate, 10 µg of leupeptin per ml, 1 mM phenylmethylsulfonyl fluoride). The extracts were centrifuged at 15,000 × g (15 min at
4°C). Epitope-tagged protein kinases were immunoprecipitated by
incubation for 2 h at 4°C with the M2 Flag monoclonal antibody
(IBI-Kodak) bound to protein G-Sepharose (Pharmacia-LKB Biotechnology,
Inc.). The immunoprecipitates were washed twice with buffer A and twice
with kinase buffer (25 mM HEPES [pH 7.4], 25 mM
-glycerophosphate, 25 mM MgCl2, 0.5 mM DTT, 0.1 mM
Na3VO4).
Protein kinase assays were performed with protein kinase
immunoprecipitates. The reactions were initiated by addition of 1
µg
of a recombinant GST-ATF2 fusion protein and 50 µM
[

-
32P]ATP (10 Ci/mmol) in a final volume of 40 µl of
kinase buffer.
The reactions were terminated after 30 min at 30°C by
addition
of Laemmli sample buffer. Phosphorylation of ATF2 was examined
after SDS-PAGE by autoradiography and PhosphorImager analysis.
Fly stocks.
Canton S or yw flies were used as the
wild-type stock. The heat shock D-p38a construct was generated by
inserting the D-p38a cDNA into the pCaSpeR-hs vector between the
BglII and NotI sites (69). Transgenic
flies were generated by P-element-mediated transformation using the
yw stock. The lines that contain transgenes on the second or
the third chromosomes were crossed to double balancer stocks and
interbred to generate a line that contains four copies of the heat
shock transgene. All fly stocks were maintained at 25°C on standard
yeast-cornmeal-agar media. Heat shock at 37°C for 1 h was used
to induce gene expression. After the heat shock, the larvae were
allowed a 30-min recovery period before a bacterial challenge. This
challenge was performed by pricking third-instar larvae with a thin
glass needle previously dipped into a saturated E. coli
bacterial culture. RNA was isolated at various time points after
exposure to bacteria.
RNA preparation and Northern analysis.
Total RNA was
prepared with Tri-Reagent (containing phenol and guanidinium
thiocyanate) in accordance with the protocol furnished by Molecular
Research Center Inc. (Cincinnati, Ohio). Essentially, the cells or the
larvae were homogenized in Tri-Reagent and the total RNA was
precipitated with isopropanol. For Northern blotting experiments,
approximately 10 µg of total RNA was separated on a
formaldehyde-agarose gel and blotted onto a GeneScreen Plus membrane
(NEN Life Science). Hybridization was performed at 45°C in 50%
formamide-2× SSC-1% SDS-200-µg/ml salmon sperm DNA-1% nonfat dry milk. After 20 h of hybridization, the filter was washed in 0.2× SSC-0.1% SDS. The hybridized probe was detected by
autoradiography.
Nucleotide sequence accession numbers.
The nucleotide
sequences described in this report have been deposited in GenBank and
assigned accession no. AF035546, AF035547, AF035548, AF035549,
AF035550, AF035551, and AF035552.
 |
RESULTS |
Molecular cloning of Drosophila p38 MAPKs.
The
mammalian ERK, JNK, and p38 MAPKs are characterized by distinct
tripeptide phosphorylation motifs that mediate activation of the MAPKs.
The dual phosphorylation motifs of ERK, JNK, and p38 are TEY, TPY, and
TGY, respectively. Drosophila homologs of ERK (5,
8) and JNK (61, 66) have been previously identified. However, a Drosophila homolog of the mammalian p38 MAPK has
not been reported. To identify possible homologs of the p38 MAPK in Drosophila, we designed degenerate oligonucleotides to
amplify MAPK-related sequences from a Drosophila embryonic
cDNA library (7). Sequence analysis led to the
identification of one group of cDNAs (D-p38a) related to the mammalian
p38 MAPK. The full-length D-p38a cDNA was subsequently isolated, and
sequence analysis demonstrated the presence of an open reading frame of
366 amino acids (Fig. 1). D-p38a shares 66% amino acid identity with
human p38
(Fig. 1C). The protein includes the 11 conserved kinase
subdomains and the characteristic TGY dual phosphorylation motif in the
activation loop. We also cloned and analyzed the genomic locus of
D-p38a. The gene contains only one 80-bp intron, which is located in
the 5' UTR (Fig. 1A).
Another highly homologous p38 DNA sequence deposited by the
Drosophila Genome Project was identified by searching
GenBank
with the D-p38a sequence. This genomic DNA sequence contains an
open reading frame (D-p38b) which also does not contain an intron
and
encodes a putative protein of 365 amino acids (Fig.
1B). The
deduced
amino acid sequence is 75% identical to that of D-p38a
(Fig.
1C).
Therefore, the
Drosophila genome contains at least
two genes
homologous to human p38 MAPK.
The activity of human p38 MAPKs is regulated by upstream kinases, which
include MKK3 and MKK6 (
12,
59). Another upstream
human
kinase, MKK4, has been shown to phosphorylate and activate
both JNK and
p38 (
12). We therefore investigated whether similar
upstream
kinases are present in
Drosophila. The MKKs contain highly
conserved motifs and constitute a family of proteins (
12,
59).
We used degenerate oligonucleotides to amplify MKK-related
sequences
from a
Drosophila embryonic cDNA library by PCR.
Two novel protein
kinases were identified. Sequence analysis of
full-length cDNAs
led to the identification of homologs of human MKK3
and MKK4 (H-MKK3
and H-MKK4) (Fig.
2).
The sequence of D-MKK3 is 53% identical
to that of
H-MKK3. The identity between D-MKK4 and H-MKK4 is 50%.
Analysis of the genomic sequences demonstrated that both D-MKK
genes
contain a small number of introns in the coding region (Fig.
2A and B).

View larger version (81K):
[in this window]
[in a new window]

View larger version (87K):
[in this window]
[in a new window]

View larger version (53K):
[in this window]
[in a new window]

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Molecular cloning of two Drosophila MAPK
kinases. (A and B) The nucleotide sequences of D-MKK4 (A) and D-MKK3
(B) genomic clones are presented. The exon structures of the D-MKK4 and
D-MKK3 genes and the primary sequences of the D-MKK4 and D-MKK3 protein
kinases were deduced from the sequences of cDNA clones. The sequences
are numbered starting with nucleotide 1 of exon 1. Both genes consist
of five exons. The primary sequence encoded by each exon is illustrated
in the single-letter code (italics). Termination codons are indicated
by asterisks. For D-MKK4, DNA polymorphisms were detected at codon 111 (GCC/GGC; Ala/Gly), codon 112 (GCT/GCC; Ala/Ala), and codon 140 (ATC/ACC; Ile/Thr). (C) The D-MKK4 and D-MKK3 primary sequences were
compared with human MAPK kinases (MKK1, MKK2, MKK3, MKK4, MKK5, MKK6,
and MKK7) and Drosophila MAPK kinases (HEP and DSOR) by
using the PILE-UP program (version 9.0; Wisconsin Genetics Computer
Group). The protein sequences are presented in the single-letter code.
Gaps introduced into the sequences to optimize the alignment are
represented by dashes. Identical residues are indicated by periods.
Conserved kinase subdomains I to XI are illustrated. (D) The
relationship between members of the human and Drosophila
MAPK kinase groups is presented as a dendrogram created by the
unweighted pair-group method using arithmetic averages (PILE-UP
program).
|
|
To facilitate future genetic analysis of these kinases, we performed
chromosome in situ hybridization to map the cytological
locations of
these genes. The results demonstrated that these
genes are located in
distinct regions of the
Drosophila genome.
The D-p38a gene
was mapped to a single site at 95E4-F1 on the
third chromosome. D-p38b
was located at 34C4-D1 on the second
chromosome. The D-MKK3 and D-MKK4
genes were found at 11C4-D3
(X chromosome) and 85A2-A7 (third
chromosome), respectively. Figure
3
summarizes the cytological locations of the stress-activated
MAPKs and
MKKs.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 3.
Cytological localization of the p38 MAPK and MKK
genes. Chromosome in situ hybridization was performed with
digoxigenin-labeled cDNA probes on samples prepared from wild-type
larval salivary glands. After hybridization with the probes, the
samples were incubated with antidigoxigenin antibodies, which
were conjugated with horseradish peroxidase. The hybridized
probe, visualized with a peroxidase reaction, is indicated by the
arrowheads. The locations of the genes for the MAPKs and the upstream
kinases are summarized in the table.
|
|
Comparison of the expression of the p38 MAPKs and MKKs in
Drosophila.
The expression patterns of the protein kinases
were examined in the developing embryo to gain information about the
possible functional relationship among the MAPK and MKK isoforms. The
two D-p38 genes exhibited different embryonic expression patterns. The
D-p38a mRNA expression was predominantly at the preblastoderm stage,
indicating a high level of maternal deposition (Fig.
4A). Zygotic expression was less than the
detectable level during most of the embryonic development (Fig. 4B and
C). Northern analysis, however, demonstrated the presence of low mRNA
levels throughout development (data not shown). At stage 16, there was
a low level of staining in the posterior region, which may correspond
to the developing hindgut (Fig. 4D). The preblastoderm staining
indicates that D-p38a may participate in early embryonic development.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
Embryonic mRNA expression patterns of the p38 MAPKs and
MKKs. Digoxigenin-labeled cDNA probes were incubated with wild-type
embryos, and the hybridized probe was visualized with an alkaline
phosphatase reaction. Panels A, E, I, and M show stage 2, before pole
cell formation and zygotic gene expression. Panels B, F, J, and N show
stage 10, when the germ band has been fully extended. Panels C, G, K,
and O show stage 13, when the germ band has been retracted and the
midguts have been fused. Panels D, H, L, and P show stage 15, when the
ventral nerve cord starts to retract.
|
|
The D-p38b gene is expressed throughout embryonic development (Fig.
4E
to H). There is a high level of maternal deposition,
and at later
stages, zygotic expression is present in most of
the tissues. At
midembryogenesis, higher levels of mRNA were detected
in the developing
anterior and posterior midguts (Fig.
4G). The
expression pattern of
D-p38b is very similar to that of the two
D-MKKs, which also have high
maternal deposition in early embryos
and zygotic expression in the
midguts. One noteworthy difference
between the two D-MKKs is that
D-MKK4 expression is sustained
in the ventral nerve cord (Fig.
4P),
while D-MKK3 expression is
less detectable in this tissue but is more
prominent in the midgut
(Fig.
3L). Previous studies have demonstrated
that D-JNK expression
is present in the ventral nerve cord
(
66), suggesting a functional
relationship with D-MKK4 in
this tissue. Since each of these kinases
is deposited maternally, they
may all be involved in early development.
At later stages, D-p38b may
be the primary mediator of the p38
MAPK pathway, particularly in the
developing midgut.
D-MKK3 and LPS increase D-p38 MAPK activity.
We examined the
protein kinase activities of D-p38a and D-p38b by using an in vitro
assay (Fig. 5). The two D-p38 MAPKs were expressed as GST fusion proteins in bacteria and purified. In vitro
kinase assays demonstrated that both D-p38a and D-p38b phosphorylate D-Jun and mammalian ATF2. The D-p38 isoforms can also phosphorylate myelin basic protein, which is phosphorylated more effectively by PKA
(Fig. 5). Previous studies demonstrated that the mammalian p38 MAPK
efficiently phosphorylates ATF2 but not c-Jun (58). In
contrast, mammalian JNK recognizes both substrates with similar specificities (22, 23). Our results revealed that while
D-p38 can phosphorylate ATF2, D-Jun also serves as a substrate but to a
lesser extent. On the other hand, D-JNK recognized both substrates with
the same efficiency (Fig. 5).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro phosphorylation of substrates by the D-p38
kinases. The substrate proteins indicated at the top were incubated
with the kinases indicated to the left of the panels. The proteins in
the reaction were resolved by SDS-PAGE, and the autoradiogram of a
representative experiment is presented. MBP, myelin basic protein.
|
|
We tested the regulation of D-p38 MAPK activity by MAPK kinases D-MKK3
and D-MKK4. The cDNA were placed under the control
of the Actin5C
promoter, and different combinations of the plasmids
were cotransfected
into Schneider S2* cells (
57). The FLAG epitope-tagged
D-p38
MAPKs were immunoprecipitated, and their kinase activity
was measured
in vitro with ATF2 as the substrate. The results
demonstrated that
D-MKK3 is an efficient activator of both D-p38a
and D-p38b (Fig.
6A). Cotransfection of D-MKK4 under
similar conditions
did not activate the D-p38 MAPKs (Fig.
6A) but did
cause activation
of D-JNK (data not shown). The possible role of D-MKK4
in the
activation of D-p38 requires further investigation.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Regulation of D-p38 activity. (A) The ability of D-MKK3
and D-MKK4 to activate D-p38a and D-p38b MAPKs was tested in
cotransfection assays. S2* cells were transfected with the FLAG
epitope-tagged D-p38a or D-p38b MAPK together with an Actin5C empty
vector or an expression vector encoding D-MKK3 or D-MKK4. D-p38 MAPK
activity was measured in an immune complex kinase assay using ATF2 as
the substrate (top). D-p38 MAPK activity was quantitated by
PhosphorImager analysis and is presented as relative protein kinase
activity (bottom). (B) The D-p38 MAPKs are activated by LPS. S2* cells
transfected with epitope-tagged D-p38a or D-p38b were treated with LPS
(5 µg/ml) for 3 or 6 h or with UV-C (80 J/m2). D-p38
MAPK activity was measured in an immune complex kinase assay using ATF2
as the substrate (top). D-p38 MAPK activity was quantitated by
PhosphorImager analysis, and the results are presented as relative
protein kinase activity (bottom).
|
|
We also examined the regulation of D-p38 by extracellular stimuli.
Epitope-tagged D-p38 MAPKs were expressed in S2* cells,
which were then
treated with bacterial LPS. The D-p38 MAPK activity
was measured in an
immune complex assay with ATF2 as the substrate.
It was found that LPS
increased the kinase activity of both D-p38
isoforms. Control
experiments demonstrated that the exposure of
S2* cells to UV light
also activated the MAPKs (Fig.
6B).
An anti-inflammatory drug that inhibits D-p38 MAPK also modulates
insect immunity gene expression.
SB203580 is a pyridinyl-imidazole
compound that binds to the human p38 MAPK and inhibits the production
of IL-1 and tumor necrosis factor by monocytes during inflammation
(45). The bacterially expressed kinases were first incubated
either with the solvent DMSO or with various concentrations of the drug
prior to the measurement of protein kinase activity. The results
demonstrate that this anti-inflammatory drug is an efficient inhibitor
of both D-p38 MAPK isoforms (Fig. 7). The
inhibitory effect is similar to that on mammalian p38
, since
micromolar concentrations are sufficient to almost abolish protein
kinase activity (45).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition of D-p38 by the pyridinyl-imidazole compound
SB203580. The ATF2 protein was used as the substrate for all of the
assays, with PKA, D-p38a, or D-p38b as the kinase, as indicated to the
left. The compound was added to the reaction mixture containing the
kinase prior to addition of the substrate. Various concentrations of
the drug or the DMSO solvent (0 µM) were added to the reaction
mixture. The proteins in the reaction mixture were resolved by
SDS-PAGE, and the autoradiogram of a representative experiment is
presented. The graph at the bottom is the result of quantitation, by
PhosphorImager analysis (Molecular Dynamics), of the experiment
shown at the top.
|
|
Induction of the insect immune response leads to the production of
antimicrobial peptides. This inductive event can be mimicked
in tissue
culture (
57,
63). To test the hypothesis that the
D-p38
MAPKs regulate insect immunity, we incubated S2* cells (
57)
in medium that contained either solvent (DMSO) or drug (SB203580)
prior
to LPS induction. With LPS treatment alone, the mRNA levels
of two
antibacterial peptide genes,
Attacin and
Cecropin, were
induced by more than 10-fold within 3 h
(Fig.
8). The expression
of
Attacin and
Cecropin returned to lower levels
after 6 h. In
the presence of SB203580, the early phase of
induction of these
two genes was similar to that of the DMSO control.
During the
later phase, 3 to 6 h after LPS treatment, when the
gene expression
should be reduced,
Attacin was induced to a
much higher level
and
Cecropin induction was modestly
elevated. These results suggest
that the targets of the drug,
presumably the D-p38 protein kinases,
are involved in the down
regulation of immunity gene expression.
We surmise that D-p38 is
involved in the attenuation of immunity
gene expression during the late
phase of infection. Such negative
regulation may be employed to
attenuate immunity gene expression
to avoid overactivation, which may
be harmful to the host.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 8.
The drug SB203580 potentiates immunity gene expression.
S2* cells were treated with LPS and SB203580 as indicated. Total RNA
was isolated and assayed by Northern blotting (top). Control
experiments designed to examined RNA loading were performed by using a
ribosomal protein rp49 probe. The level of immunity gene
mRNA expression relative to that of rp49, determined by
quantitation of the hybridization signals, is presented at the
bottom.
|
|
Overexpression of D-p38a blocks antimicrobial peptide gene
expression.
To test whether the D-p38 protein kinases function in
vivo as attenuators of immunity gene expression, we generated
transgenic flies that express the D-p38a cDNA under the control of the
heat shock promoter. A fly strain with four copies of the transgene was
established through genetic manipulation. The transgenic larvae, or the
control parental yw animals, were heat shocked at 37°C to
induce the expression of D-p38a. After heat shock, the animals were
challenged by bacterial injection. Total RNA was isolated, and immunity
gene expression was examined. The parental strain showed normal
induction of Attacin and Cecropin. Within 3 h, the mRNA levels were more than 10-fold higher than those in the
unchallenged animals. On the other hand, overexpression of D-p38a
caused significantly reduced mRNA levels of both Cecropin
and Attacin (Fig. 9). The expression of the antifungal peptide gene Drosomycin was
also examined, and it appeared to be affected to a lesser extent, while the expression of another antibacterial peptide gene,
Diptericin, was only modestly decreased. These results
suggest that the p38 MAPK pathway is used to attenuate the induced
expression of a selective group of immunity genes in vivo.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 9.
Overexpression of D-p38 inhibits immunity gene
expression in vivo. Transgenic hs-D-p38a or yw
larvae were heat shocked and induced with bacteria for the amounts of
time indicated. RNA was isolated and analyzed by Northern blotting
(top). The ratio of immunity gene to rp49 mRNA levels is
presented graphically at the bottom.
|
|
 |
DISCUSSION |
The p38 MAPK pathway has been implicated in the mediation of
stress signals. Proinflammatory cytokines, osmotic shock, and bacterial
LPS can induce p38 MAPK activity, which leads to increased cytokine
production (43, 74). The p38 MAPKs are also involved in the
control of other cellular processes, such as apoptosis and
proliferation (39, 41, 55, 68, 77).
In this report, we demonstrate the conservation of some components of
the mammalian p38 MAPK pathway in Drosophila. Two D-p38 genes and two genes related to mammalian upstream kinases, MKK3 and
MKK4, have been identified. Previous studies demonstrated that
Hemipterous is an activator of D-JNK (66) and is homologous to MKK4 (20). Detailed comparison of all of the MKKs (Fig.
2D), however, indicates that Hemipterous is more closely related to the
newly identified mammalian isoform MKK7 (31, 51, 56, 71),
which exclusively activates JNK. Therefore, it is likely that
Hemipterous is a functional homolog of MKK7, while D-MKK4 and D-MKK3
are functional homologs of the respective mammalian kinases. Our
experimental results demonstrated that D-MKK3 can, indeed, activate
both D-p38 isoforms, suggesting a conservation of the functions of
these signaling components. Using cell culture and transgenic assays,
we found that one of the possible functions of the D-p38 pathway is to
down regulate insect immunity gene expression after prolonged
infection. These results further support the notion that insect
antimicrobial response and human innate immunity share an evolutionary
origin.
One of the well-characterized Drosophila signaling pathways
involved in the self-defense response is the Toll-Dif/Dorsal pathway (4, 34). Toll is the transmembrane protein that transmits the extracellular signal to regulate Dorsal nuclear transport in the
early embryo (28). The intracellular components that mediate
the signal include Tube, Pelle, and Cactus. Recent evidence demonstrates that this signaling cassette is also involved in the
induction of some immunity genes, particularly the antifungal peptide
gene Drosomycin (49). The Drosophila
Toll signaling molecules are strikingly similar to those in the
mammalian IL-1R-NF-
B pathway, which participate in the inflammatory
response (34, 52, 73). Furthermore, a human Toll homolog has
recently been identified and shown to be able to induce cytokine
production in monocytic cells, probably through the activation of
NF-
B (53, 54). Therefore, the Toll pathway is employed
for self-defense in many organisms that have diverged evolutionarily.
However, although much evidence points to the notion that Toll
signaling mediates innate immunity in both vertebrates and
invertebrates, genetic analysis suggests that only a subset of
Drosophila immunity genes requires this pathway
(49). A recent study showed that a Toll-like transmembrane
protein, 18-Wheeler, is required for the induction of
Attacin and, to some extent, Cecropin gene
expression (76). Moreover, the mutation immune
deficiency (imd), localized to the 55C-F region,
exhibits a specific defect in the induction of antibacterial, but not
antifungal, genes (9, 47). It was therefore proposed that
multiple signaling pathways are involved in regulating the repertoire
of immunity genes in insects (47, 49, 76).
To search for other parallel pathways that regulate
Drosophila immunity, we cloned a number of kinases that are
homologs of mammalian protein kinases that have been shown to
participate in stress-induced responses (66, this
study). Previous results indicated that the MAPK D-JNK is activated by
immune challenge in cultured cells (66). However, due to the
embryonic lethality caused by mutations in the D-JNK gene (61,
66), no genetic data have been obtained on the in vivo function
of D-JNK in insect immunity. In this paper, we report the analysis of
the D-p38 MAPK pathway. MAPK p38 has been implicated in the process of
inflammation, as human p38 was found to be the target of the
anti-inflammatory drug SB203580, which inhibits the production of IL-1
and tumor necrosis factor (45).
By using transgenic flies and pharmacological assays, we demonstrated
that D-p38 MAPKs are involved in mediating antimicrobial responses in
Drosophila. However, while we expected that the kinases might positively mediate immunity signaling, experimental results demonstrated that D-p38 may function as a negative regulator. Inhibition of D-p38 by the drug SB203580 leads to increased expression of antimicrobial peptide genes in the later phase of induction by LPS.
The drug treatment caused no enhancement of immunity gene expression in
the early phase (Fig. 7), suggesting that the D-p38 protein kinases do
not function as constitutive repressors. Meanwhile, overexpression of
D-p38a in transgenic animals caused inhibition of immunity gene
induction. Therefore, it is conceivable that one of the functions of
the D-p38 MAPK is to mediate attenuation of immunity gene expression at
late phases of infection. This mechanism is analogous to the
attenuation of cytokine production during inflammation, which may
otherwise lead to septic shock.
Repressive cross-regulation of MAPKs has been identified in the yeast
osmosensing pathway, which involves the yeast p38 homolog HOG1, and in
the mating type pathway (24). It may be that the LPS-activated D-p38 signaling pathway serves as a repressor for yet
another Drosophila MAPK which positively mediates the LPS effect. This MAPK should not be sensitive to treatment with
pyridinyl-imidazole drugs. Genetic analysis will help to resolve the in
vivo functions of these protein kinases.
 |
ACKNOWLEDGMENTS |
We thank Dan Hultmark for providing the Attacin cDNA probe, Ylva
Engstrom for the Cecropin cDNA probe, Kirugaval Hemavathy for help with
S2 cell culture, and Catherine Tournier for the MKK amplimers.
This publication was made possible by NIH grants GM53269 (to Y.T.I.)
and CA65861 (to R.J.D.). Y.T.I. is a recipient of the Scholar Award of
the Leukemia Society of America. R.J.D. is an investigator of the
Howard Hughes Medical Institute.
 |
ADDENDUM IN PROOF |
The sequence of D-p38a was recently reported by S.-J. Han et al.
(J. Biol. Chem. 273:369-374).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Program in
Molecular Medicine, University of Massachusetts Medical Center, 373 Plantation St., Worcester, MA 01605. Phone: (508) 856-5136. Fax: (508)
856-3210. E-mail: Tony.Ip{at}ummed.edu.
 |
REFERENCES |
| 1.
|
Anderson, N. G.,
J. L. Maller,
N. K. Tonks, and T. W. Sturgill.
1990.
Requirement for integration of signals from two distinct phosphorylation pathways for activation of MAP kinase.
Nature
343:651-652[Medline].
|
| 2.
|
Asling, B.,
M. Dushay, and D. Hultmark.
1995.
Identification of early genes in the Drosophila immune response by PCR-based differential display: the Attacin A gene and the evolution of attacin-like proteins.
Insect Biochem. Mol. Biol.
25:511-518[Medline].
|
| 3.
|
Baumann, H.,
K. R. Prowse,
S. Marinkovic,
K. A. Won, and G. P. Jahreis.
1989.
Stimulation of hepatic acute-phase response by cytokines and glucocorticoids.
Ann. N. Y. Acad. Sci.
557:280-295[Medline].
|
| 4.
|
Belvin, M. P., and K. V. Anderson.
1996.
A conserved signaling pathway: the Drosophila Toll-dorsal pathway.
Annu. Rev. Cell Dev. Biol.
12:393-416.
[Medline] |
| 5.
|
Biggs, W. H.,
K. H. Zavitz,
B. Dickson,
A. van der Straten,
D. Brunner,
E. Hafen, and S. L. Zipursky.
1994.
The Drosophila rolled locus encodes a MAP kinase required in the sevenless signal transduction pathway.
EMBO J.
13:1628-1635[Medline].
|
| 6.
|
Boman, H. G.
1995.
Peptide antibiotics and their role in innate immunity.
Annu. Rev. Immunol.
13:61-92[Medline].
|
| 7.
|
Brown, N. H., and F. C. Kafatos.
1988.
Functional cDNA libraries from Drosophila embryos.
J. Mol. Biol.
203:425-437[Medline].
|
| 8.
|
Brunner, D.,
N. Oellers,
J. Szabad,
W. H. Biggs,
S. L. Zipursky, and E. Hafen.
1994.
A gain-of-function mutation in Drosophila MAP kinase activates multiple receptor tyrosine kinase signaling pathways.
Cell
76:875-888[Medline].
|
| 9.
|
Corbo, J. C., and M. Levine.
1996.
Characterization of an immunodeficiency mutant in Drosophila.
Mech. Dev.
55:211-220[Medline].
|
| 10.
|
Davis, R. J.
1994.
MAPKs: new JNK expands the group.
Trends Biochem. Sci.
19:470-473[Medline].
|
| 11.
|
Dérijard, B.,
M. Hibi,
I.-H. Wu,
T. Barrett,
B. Su,
T. Deng,
M. Karin, and R. J. Davis.
1994.
JNK1: a protein kinase stimulated by UV light and Ha-ras that binds and phosphorylates the c-jun activation domain.
Cell
76:1025-1037[Medline].
|
| 12.
|
Dérijard, B.,
J. Raingeaud,
T. Barrett,
I.-H. Wu,
J. Han,
R. J. Ulevitch, and R. J. Davis.
1995.
Independent human MAP kinase signal transduction pathways defined by MEK and MKK isoforms.
Science
267:682-685[Abstract/Free Full Text].
|
| 13.
|
Diaz-Guerra, M. J. M.,
M. Velasco,
P. Martin-Sanz, and L. Bosca.
1996.
Evidence for common mechanisms in the transcriptional control of type II nitric oxide synthase in isolated hepatocytes. Requirement of NF-kappaB activation after stimulation with bacterial cell products and phorbol esters.
J. Biol. Chem.
271:30114-30120[Abstract/Free Full Text].
|
| 14.
|
Dimarcq, J. L.,
D. Hoffmann,
M. Meister,
P. Bulet,
R. Lanot,
J.-M. Reichhart, and J. A. Hoffmann.
1994.
Characterization and transcriptional profiles of a Drosophila gene encoding an insect defensin: a study in insect immunity.
Eur. J. Biochem.
221:201-209[Medline].
|
| 15.
|
Dressler, H., and D. Ron.
1992.
pGSTag a versatile bacterial expression plasmid for enzymatic labelling of recombinant proteins.
BioTechniques
13:866-869.
[Medline] |
| 16.
|
Dushay, M. S.,
B. Asling, and D. Hultmark.
1996.
Origins of immunity: Relish, a compound Rel-like gene in the antibacterial defense of Drosophila.
Proc. Natl. Acad. Sci. USA
93:10343-10347[Abstract/Free Full Text].
|
| 17.
|
Engstrom, Y.,
L. Kadalayil,
S.-C. Sun,
C. Samakovlis,
D. Hultmark, and I. Faye.
1993.
B-like motifs regulate the induction of immune genes in Drosophila.
J. Mol. Biol.
232:327-333[Medline].
|
| 18.
|
Fehlbaum, P.,
P. Bulet,
L. Michaut,
M. Lagueux,
W. F. Broekaert,
C. Hetru, and J. A. Hoffmann.
1994.
Insect immunity. septic injury of Drosophila induces the synthesis of a potent antifungal peptide with sequence homology to plant antifungal peptides.
J. Biol. Chem.
269:33159-33163[Abstract/Free Full Text].
|
| 19.
|
Georgel, P.,
M. Meister,
C. Kappler,
B. Lemaitre,
J.-M. Reichhart, and J. A. Hoffmann.
1993.
Insect immunity: the diptericin promoter contains multiple functional regulatory sequences homologous to mammalian acute-phase response elements.
Biochem. Biophys. Res. Commun.
197:508-517[Medline].
|
| 20.
|
Glise, B.,
H. Bourbon, and S. Noselli.
1995.
hemipterous encodes a novel MAP kinase kinase required for epithelial cell sheet movement.
Cell
83:451-461[Medline].
|
| 21.
|
Gross, I.,
P. Georgel,
C. Kappler,
J. M. Reichhart, and J. A. Hoffmann.
1996.
Drosophila immunity: a comparative analysis of the Rel proteins Dorsal and Dif in the induction of the genes encoding diptericin and cecropin.
Nucleic Acids Res.
24:1238-1245[Abstract/Free Full Text].
|
| 22.
|
Gupta, S.,
T. Barrett,
A. J. Whitmarsh,
H. K. Sluss,
J. Cavanagh, and R. J. Davis.
1996.
Selective interaction of JNK protein kinase isoforms with transcription factors.
EMBO J.
15:2760-2770[Medline].
|
| 23.
|
Gupta, S.,
D. Campbell,
B. Dérijard, and R. J. Davis.
1995.
Transcription factor ATF2 regulation by the JNK signal transduction pathway.
Science
267:389-393[Abstract/Free Full Text].
|
| 24.
|
Hall, J. P.,
V. Cherkasova,
E. Elion,
M. C. Gustin, and E. Winter.
1996.
The osmoregulatory pathway represses mating pathway activity in Saccharomyces cerevisiae: isolation of a Fus3 mutant that is insensitive to the repression mechanism.
Mol. Cell. Biol.
16:6715-6723[Abstract].
|
| 25.
|
Hambleton, J.,
S. L. Weinstein,
L. Lem, and A. L. DeFranco.
1996.
Activation of c-Jun N-terminal kinase in bacterial lipopolysaccharide-stimulated macrophages.
Proc. Natl. Acad. Sci. USA
93:2774-2778[Abstract/Free Full Text].
|
| 26.
|
Han, J.,
J.-D. Lee,
L. Bibbs, and R. J. Ulevitch.
1994.
A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells.
Science
265:808-811[Abstract/Free Full Text].
|
| 27.
|
Han, K., and J. L. Manley.
1993.
Functional domains of the Drosophila engrailed protein.
EMBO J.
12:2723-2733[Medline].
|
| 28.
|
Hashimoto, C.,
K. L. Hudson, and K. V. Anderson.
1989.
The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein.
Cell
52:269-279.
|
| 29.
|
Hoffmann, J. A.
1995.
Innate immunity of insects.
Curr. Opin. Immunol.
7:4-10[Medline].
|
| 30.
|
Hoffmann, J. A.,
J.-M. Reichhart, and C. Hetru.
1996.
Innate immunity in higher insects.
Curr. Opin. Immunol.
8:8-13[Medline].
|
| 31.
|
Holland, P. M.,
M. Suzanne,
J. S. Campbell,
S. Noselli, and J. A. Cooper.
1997.
MKK7 is a stress-activated mitogen-activated protein kinase kinase functionally related to hemipterous.
J. Biol. Chem.
272:24994-24998[Abstract/Free Full Text].
|
| 32.
|
Hultmark, D.
1993.
Immune reactions in Drosophila and other insects: a model for innate immunity.
Trends Genet.
9:178-193[Medline].
|
| 33.
| Ip, Y. T., and R. J. Davis. Signal
transduction by the c-Jun NH2-terminal kinase (JNK) from
inflammation to development. Curr. Opin. Cell Biol., in press.
|
| 34.
|
Ip, Y. T., and M. Levine.
1994.
Molecular genetics of Drosophila immunity.
Curr. Opin. Genet. Dev.
4:672-677[Medline].
|
| 35.
|
Ip, Y. T.,
M. Reach,
Y. Engstrom,
L. Kadalayil,
H. Cai,
S. Gonzalez-Crespo,
K. Tatei, and M. Levine.
1993.
Dif, a dorsal-related gene that mediates an immune response in Drosophila.
Cell
75:753-763[Medline].
|
| 36.
|
Kadalayil, L.,
U.-M. Petersen, and Y. Engstrom.
1997.
Adjacent GATA and B-like motifs regulate the expression of a Drosophila immune gene.
Nucleic Acids Res.
25:1233-1239[Abstract/Free Full Text].
|
| 37.
|
Kappler, C.,
M. Meister,
M. Lagueux,
E. Gateff,
J. A. Hoffmann, and J.-M. Reichhart.
1993.
Insect immunity. Two 17 bp repeats nesting a B-related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteria-challenged Drosophila.
EMBO J.
12:1561-1568[Medline].
|
| 38.
|
Karin, M.,
Z. Liu, and E. Zandi.
1997.
AP-1 function and regulation.
Curr. Opin. Cell Biol.
9:240-246[Medline].
|
| 39.
|
Kawasaki, H.,
T. Morooka,
S. Shimohama,
J. Kimura,
T. Hirano,
Y. Gotoh, and E. Nishida.
1997.
Activation and involvement of p38 mitogen-activated protein kinase in glutamate-induced apoptosis in rat cerebellar granule cells.
J. Biol. Chem.
272:18518-18521[Abstract/Free Full Text].
|
| 40.
|
Koj, A.
1996.
Initiation of acute phase response and synthesis of cytokines.
Biochim. Biophys. Acta
1317:84-94[Medline].
|
| 41.
|
Kummer, J. L.,
P. K. Rao, and K. A. Heidenreich.
1997.
Apoptosis induced by withdrawal of trophic factors is mediated by p38 mitogen-activated protein kinase.
J. Biol. Chem.
272:20490-20494[Abstract/Free Full Text].
|
| 42.
|
Kylsten, P.,
C. Samakovlis, and D. Hultmark.
1990.
The cecropin locus in Drosophila: a compact gene cluster involved in the response to infection.
EMBO J.
9:217-224[Medline].
|
| 43.
|
Kyriakis, J. M., and J. Avruch.
1996.
Sounding the alarm: protein kinase cascades activated by stress and inflammation.
J. Biol. Chem.
271:24313-24316[Free Full Text].
|
| 44.
|
Lee, J.,
A. Boman,
S. Chuanxin,
M. Andersson,
H. Jornvall,
V. Mutt, and H. G. Boman.
1989.
Antibacterial peptides from pig intestine: isolation of a mammalian cecropin.
Proc. Natl. Acad. Sci. USA
86:9159-9162[Abstract/Free Full Text].
|
| 45.
|
Lee, J. C.,
J. T. Laydon,
P. C. McDonnell,
T. F. Gallagher,
S. Kumar,
D. Green,
D. McNulty,
M. J. Blumenthal,
J. R. Heys,
S. W. Landvatter,
J. E. Strickler,
M. M. McLaughlin,
I. R. Siemens,
S. M. Fisher,
G. P. Livi,
J. R. White,
J. L. Adams, and P. R. Young.
1994.
A protein kinase involved in the regulation of inflammatory cytokine biosynthesis.
Nature
327:739-746.
|
| 46.
|
Lehrer, R. I.,
T. Ganz, and M. E. Selsted.
1991.
Defensins: endogenous antibiotic peptides of animal cells.
Cell
64:229-230[Medline].
|
| 47.
|
Lemaitre, B.,
E. Kromer-Metzger,
L. Michaut,
E. Nicolas,
M. Meister,
P. Georgel,
J.-M. Reichhart, and J. A. Hoffmann.
1995.
A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense.
Proc. Natl. Acad. Sci. USA
92:9465-9469[Abstract/Free Full Text].
|
| 48.
|
Lemaitre, B.,
M. Meister,
S. Govind,
P. Georgel,
R. Steward,
J.-M. Reichhart, and J. A. Hoffmann.
1995.
Functional analysis and regulation of nuclear import of dorsal during the immune response in Drosophila.
EMBO J.
14:536-545[Medline].
|
| 49.
|
Lemaitre, B.,
E. Nicolas,
L. Michaut,
J. M. Reichhart, and J. A. Hoffmann.
1996.
The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults.
Cell
86:973-983[Medline].
|
| 50.
|
Lin, A.,
A. Minden,
H. Martinetto,
F.-X. Claret,
C. Lange-Carter,
F. Mercurio,
G. L. Johnson, and M. Karin.
1995.
Identification of a dual specificity kinase that activates Jun kinases and p38-Mpk2.
Science
268:286-290[Abstract/Free Full Text].
|
| 51.
|
Lu, X.,
S. Nemoto, and A. Lin.
1997.
Identification of c-Jun NH2-terminal protein kinase (JNK)-activating kinase 2 as an activator of JNK but not p38.
J. Biol. Chem.
272:24751-24754[Abstract/Free Full Text].
|
| 52.
|
Mackman, N.,
K. Brand, and T. S. Edgington.
1991.
Lipopolysaccharide-mediated transcriptional activation of the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear factor kappa B binding sites.
J. Exp. Med.
174:1517-1526[Abstract/Free Full Text].
|
| 53.
|
Medzhitov, R., and C. A. Janeway, Jr.
1997.
Innate immunity: the virtues of a nonclonal system of recognition.
Cell
91:295-298[Medline].
|
| 54.
|
Medzhitov, R.,
P. Preston-Hurlburt, and C. A. Janeway, Jr.
1997.
A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature
388:394-397[Medline].
|
| 55.
|
Molnar, A.,
A. M. Theodoras,
L. I. Zon, and J. M. Kyriakis.
1997.
Cdc42Hs, but not Rac1, inhibits serum-stimulated cell cycle progression at G1/S through a mechanism requiring p38/RK.
J. Biol. Chem.
272:13229-13235[Abstract/Free Full Text].
|
| 56.
|
Moriguchi, T.,
F. Toyoshima,
N. Masuyama,
H. Hanafusa,
Y. Gotoh, and E. Nishida.
1997.
A novel SAPK/JNK kinase, MKK7, stimulated by TNF and cellular stresses.
EMBO J.
16:7045-7053[Medline].
|
| 57.
|
Petersen, U.-M.,
G. Bjorklund,
Y. T. Ip, and Y. Engstrom.
1995.
The dorsal-related immunity factor, Dif, is a sequence-specific trans-activator of Drosophila Cecropin gene expression.
EMBO J.
14:3146-3158[Medline].
|
| 58.
|
Raingeaud, J.,
S. Gupta,
J. S. Rogers,
M. Dickens,
J. Han,
R. J. Ulevitch, and R. J. Davis.
1995.
Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine.
J. Biol. Chem.
270:7420-7426[Abstract/Free Full Text].
|
| 59.
|
Raingeaud, J.,
A. J. Whitmarsh,
T. Barrett,
B. Dérijard, and R. J. Davis.
1996.
MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated signal transduction pathway.
Mol. Cell. Biol.
16:1247-1255[Abstract].
|
| 60.
|
Reichhart, J.-M.,
M. Meister,
J.-C. Dimarcq,
D. Zachary,
D. Hoffmann,
C. Ruiz,
G. Richards, and J. A. Hoffmann.
1992.
Insect immunity: developmental and inducible activity of the Drosophila diptericin promoter.
EMBO J.
11:1469-1477[Medline].
|
| 61.
|
Riesgo-Escovar, J. R.,
M. Jenni,
A. Fritz, and E. Hafen.
1996.
The Drosophila Jun-N-terminal kinase is required for cell morphogenesis but not for DJun dependent cell fate specification in the eye.
Genes Dev.
10:2759-2768[Abstract/Free Full Text].
|
| 62.
|
Rouse, J.,
P. Cohen,
S. Trigon,
M. Morange,
A. Alonso-Llamazares,
D. Zamanillo,
T. Hunt, and A. R. Nebreda.
1994.
A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins.
Cell
78:1027-1037[Medline].
|
| 63.
|
Samakovlis, C.,
B. Asling,
H. G. Boman,
E. Gateff, and D. Hultmark.
1992.
In vitro induction of cecropin genes an immune response in a Drosophila blood cell line.
Biochem. Biophys. Res. Commun.
188:1169-1175[Medline].
|
| 64.
|
Sanchez, I.,
R. T. Hughes,
B. J. Mayer,
K. Yee,
J. R. Woodgett,
J. Avruch,
J. M. Kyriakis, and L. I. Zon.
1994.
Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun.
Nature
372:794-798[Medline].
|
| 65.
|
Seger, R., and E. G. Krebs.
1995.
The MAPK signaling cascade.
FASEB J.
9:726-735[Abstract].
|
| 66.
|
Sluss, H. K.,
Z. Han,
T. Barrett,
D. C. I. Goberdhan,
C. Wilson,
R. J. Davis, and Y. T. Ip.
1996.
A JNK signal transduction pathway that mediates morphogenesis and an immune response in Drosophila.
Genes Dev.
10:2745-2758[Abstract/Free Full Text].
|
| 67.
|
Smith, S. B., and K. S. Johnson.
1988.
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione-S-transferase.
Gene
67:31-40[Medline].
|
| 68.
|
Spector, M. S.,
K. L. Auer,
W. D. Jarvis,
E. J. Ishac,
B. Gao,
G. Kunos, and P. Dent.
1997.
Differential regulation of the mitogen-activated protein and stress-activated protein kinase cascades by adrenergic agonists in quiescent and regenerating adult rat hepatocytes.
Mol. Cell. Biol.
17:3556-3565[Abstract].
|
| 69.
|
Thummel, C. S., and V. Pirrotta.
1992.
New pCaSpeR P-element vectors.
Dros. Inf. Serv.
71:150.
|
| 70.
|
Tilg, H.,
C. A. Dinarello, and J. W. Mier.
1997.
IL-6 and APPs: anti-inflammatory and immunosuppressive mediators.
Immunol. Today
18:428-432[Medline].
|
| 71.
|
Tournier, C.,
A. J. Whitmarsh,
J. Cavanagh,
T. Barrett, and R. J. Davis.
1997.
Mitogen-activated protein kinase kinase 7 is an activator of the c-Jun NH2-terminal kinase.
Proc. Natl. Acad. Sci. USA
94:7337-7342[Abstract/Free Full Text].
|
| 72.
|
Ulevitch, R. J., and P. S. Tobias.
1995.
Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin.
Annu. Rev. Immunol.
13:437-457[Medline].
|
| 73.
|
Verma, I. M.,
J. K. Stevenson,
E. M. Schwarz,
D. Van Antwerp, and S. Miyamoto.
1995.
Rel/NF- B/I B family: intimate tales of association and dissociation.
Genes Dev.
9:2723-2735[Free Full Text].
|
| 74.
|
Whitmarsh, A. J., and R. J. Davis.
1996.
Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways.
J. Mol. Med.
74:589-607[Medline].
|
| 75.
|
Wicker, C.,
J.-M. Reichhart,
D. Hoffmann,
D. Hultmark,
C. Samakovlis, and J. A. Hoffmann.
1990.
Insect immunity. Characterization of a Drosophila cDNA encoding a novel member of the diptericin family of immune peptides.
J. Biol. Chem.
265:22493-22498[Abstract/Free Full Text].
|
| 76.
|
Williams, M. J.,
A. Rodriguez,
D. A. Kimbrell, and E. D. Eldon.
1997.
The 18-wheeler mutation reveals complex antibacterial gene regulation in Drosophila host defense.
EMBO J.
16:6120-6130[Medline].
|
| 77.
|
Xia, Z.,
M. Dickens,
J. Raingeaud,
R. J. Davis, and M. E. Greenberg.
1995.
Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.
Science
270:1326-1331[Abstract/Free Full Text].
|
Mol Cell Biol, June 1998, p. 3527-3539, Vol. 18, No. 6
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Davis, M. M., Primrose, D. A., Hodgetts, R. B.
(2008). A Member of the p38 Mitogen-Activated Protein Kinase Family Is Responsible for Transcriptional Induction of Dopa decarboxylase in the Epidermis of Drosophila melanogaster during the Innate Immune Response. Mol. Cell. Biol.
28: 4883-4895
[Abstract]
[Full Text]
-
Lei, J., Mariash, C. N., Bhargava, M., Wattenberg, E. V., Ingbar, D. H.
(2008). T3 increases Na-K-ATPase activity via a MAPK/ERK1/2-dependent pathway in rat adult alveolar epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol.
294: L749-L754
[Abstract]
[Full Text]
-
Balakireva, M., Rosse, C., Langevin, J., Chien, Y.-c., Gho, M., Gonzy-Treboul, G., Voegeling-Lemaire, S., Aresta, S., Lepesant, J.-A., Bellaiche, Y., White, M., Camonis, J.
(2006). The Ral/Exocyst Effector Complex Counters c-Jun N-Terminal Kinase-Dependent Apoptosis in Drosophila melanogaster. Mol. Cell. Biol.
26: 8953-8963
[Abstract]
[Full Text]
-
Brun, S., Vidal, S., Spellman, P., Takahashi, K., Tricoire, H., Lemaitre, B.
(2006). The MAPKKK Mekk1 regulates the expression of Turandot stress genes in response to septic injury in Drosophila. GENES CELLS
11: 397-407
[Abstract]
[Full Text]
-
Sano, Y., Akimaru, H., Okamura, T., Nagao, T., Okada, M., Ishii, S.
(2005). Drosophila Activating Transcription Factor-2 Is Involved in Stress Response via Activation by p38, but Not c-Jun NH2-Terminal Kinase. Mol. Biol. Cell
16: 2934-2946
[Abstract]
[Full Text]
-
Orr, A. W., Sanders, J. M., Bevard, M., Coleman, E., Sarembock, I. J., Schwartz, M. A.
(2005). The subendothelial extracellular matrix modulates NF-{kappa}B activation by flow: a potential role in atherosclerosis. JCB
169: 191-202
[Abstract]
[Full Text]
-
Tirouvanziam, R., Davidson, C. J., Lipsick, J. S., Herzenberg, L. A.
(2004). Fluorescence-activated cell sorting (FACS) of Drosophila hemocytes reveals important functional similarities to mammalian leukocytes. Proc. Natl. Acad. Sci. USA
101: 2912-2917
[Abstract]
[Full Text]
-
Cha, G.-H., Cho, K. S., Lee, J. H., Kim, M., Kim, E., Park, J., Lee, S. B., Chung, J.
(2003). Discrete Functions of TRAF1 and TRAF2 in Drosophila melanogaster Mediated by c-Jun N-Terminal Kinase and NF-{kappa}B-Dependent Signaling Pathways. Mol. Cell. Biol.
23: 7982-7991
[Abstract]
[Full Text]
-
Hacker, U., Nystedt, S., Barmchi, M. P., Horn, C., Wimmer, E. A.
(2003). piggyBac-based insertional mutagenesis in the presence of stably integrated P elements in Drosophila. Proc. Natl. Acad. Sci. USA
100: 7720-7725
[Abstract]
[Full Text]
-
Chen, S. L., Chang, Y. J., Wu, Y. H., Lin, K. H.
(2003). Mitogen-Activated Protein Kinases Potentiate Thyroid Hormone Receptor Transcriptional Activity by Stabilizing Its Protein. Endocrinology
144: 1407-1419
[Abstract]
[Full Text]
-
Zhang, X., Bedard, E. L., Potter, R., Zhong, R., Alam, J., Choi, A. M. K., Lee, P. J.
(2002). Mitogen-activated protein kinases regulate HO-1 gene transcription after ischemia-reperfusion lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol.
283: L815-L829
[Abstract]
[Full Text]
-
Kim, D. H., Feinbaum, R., Alloing, G., Emerson, F. E., Garsin, D. A., Inoue, H., Tanaka-Hino, M., Hisamoto, N., Matsumoto, K., Tan, M.-W., Ausubel, F. M.
(2002). A Conserved p38 MAP Kinase Pathway in Caenorhabditis elegans Innate Immunity. Science
297: 623-626
[Abstract]
[Full Text]
-
Tournier, C., Dong, C., Turner, T. K., Jones, S. N., Flavell, R. A., Davis, R. J.
(2001). MKK7 is an essential component of the JNK signal transduction pathway activated by proinflammatory cytokines. Genes Dev.
15: 1419-1426
[Abstract]
[Full Text]
-
Lorenzen, J., Baker, S., Denhez, F, Melnick, M., Brower, D., Perkins, L.
(2001). Nuclear import of activated D-ERK by DIM-7, an importin family member encoded by the gene moleskin. Development
128: 1403-1414
[Abstract]
-
van den Blink, B., Juffermans, N. P., ten Hove, T., Schultz, M. J., van Deventer, S. J. H., van der Poll, T., Peppelenbosch, M. P.
(2001). p38 Mitogen-Activated Protein Kinase Inhibition Increases Cytokine Release by Macrophages In Vitro and During Infection In Vivo. J. Immunol.
166: 582-587
[Abstract]
[Full Text]
-
Takatsu, Y., Nakamura, M., Stapleton, M., Danos, M. C., Matsumoto, K., O'Connor, M. B., Shibuya, H., Ueno, N.
(2000). TAK1 Participates in c-Jun N-Terminal Kinase Signaling during Drosophila Development. Mol. Cell. Biol.
20: 3015-3026
[Abstract]
[Full Text]
-
Salamov, A. A., Solovyev, V. V.
(2000). Ab initio Gene Finding in Drosophila Genomic DNA. Genome Res
10: 516-522
[Abstract]
[Full Text]
-
Kelkar, N., Gupta, S., Dickens, M., Davis, R. J.
(2000). Interaction of a Mitogen-Activated Protein Kinase Signaling Module with the Neuronal Protein JIP3. Mol. Cell. Biol.
20: 1030-1043
[Abstract]
[Full Text]
-
McEwen, D., Cox, R., Peifer, M
(2000). The canonical Wg and JNK signaling cascades collaborate to promote both dorsal closure and ventral patterning. Development
127: 3607-3617
[Abstract]
-
Ashburner, M., Misra, S., Roote, J., Lewis, S. E., Blazej, R., Davis, T., Doyle, C., Galle, R., George, R., Harris, N., Hartzell, G., Harvey, D., Hong, L., Houston, K., Hoskins, R., Johnson, G., Martin, C., Moshrefi, A., Palazzolo, M., Reese, M. G., Spradling, A., Tsang, G., Wan, K., Whitelaw, K., Kimmel, B., Celniker, S., Rubin, G. M.
(1999). An Exploration of the Sequence of a 2.9-Mb Region of the Genome of Drosophila melanogaster: The Adh Region. Genetics
153: 179-219
[Abstract]
[Full Text]
-
Han, Z. S., Ip, Y. T.
(1999). Interaction and Specificity of Rel-related Proteins in Regulating Drosophila Immunity Gene Expression. J. Biol. Chem.
274: 21355-21361
[Abstract]
[Full Text]
-
Suzanne, M., Irie, K., Glise, B., Agnès, F., Mori, E., Matsumoto, K., Noselli, S.
(1999). The Drosophila p38 MAPK pathway is required during oogenesis for egg asymmetric development. Genes Dev.
13: 1464-1474
[Abstract]
[Full Text]
-
Meng, X., Khanuja, B. S., Ip, Y. T.
(1999). Toll receptor-mediated Drosophila immune response requires Dif, an NF-kappa B factor. Genes Dev.
13: 792-797
[Abstract]
[Full Text]
-
Wysk, M., Yang, D. D., Lu, H.-T., Flavell, R. A., Davis, R. J.
(1999). Requirement of mitogen-activated protein kinase kinase 3 (MKK3) for tumor necrosis factor-induced cytokine expression. Proc. Natl. Acad. Sci. USA
96: 3763-3768
[Abstract]
[Full Text]
-
Johnson, D. I.
(1999). Cdc42: An Essential Rho-Type GTPase Controlling Eukaryotic Cell Polarity. Microbiol. Mol. Biol. Rev.
63: 54-105
[Abstract]
[Full Text]
-
Adachi-Yamada, T., Nakamura, M., Irie, K., Tomoyasu, Y., Sano, Y., Mori, E., Goto, S., Ueno, N., Nishida, Y., Matsumoto, K.
(1999). p38 Mitogen-Activated Protein Kinase Can Be Involved in Transforming Growth Factor beta Superfamily Signal Transduction in Drosophila Wing Morphogenesis. Mol. Cell. Biol.
19: 2322-2329
[Abstract]
[Full Text]
-
Tournier, C., Whitmarsh, A. J., Cavanagh, J., Barrett, T., Davis, R. J.
(1999). The MKK7 Gene Encodes a Group of c-Jun NH2-Terminal Kinase Kinases. Mol. Cell. Biol.
19: 1569-1581
[Abstract]
[Full Text]
-
Agnes, F, Suzanne, M, Noselli, S
(1999). The Drosophila JNK pathway controls the morphogenesis of imaginal discs during metamorphosis. Development
126: 5453-5462
[Abstract]
-
WIDMANN, C., GIBSON, S., JARPE, M. B., JOHNSON, G. L.
(1999). Mitogen-Activated Protein Kinase: Conservation of a Three-Kinase Module From Yeast to Human. Physiol. Rev.
79: 143-180
[Abstract]
[Full Text]