Previous Article | Next Article ![]()
Mol Cell Biol, July 1998, p. 3727-3734, Vol. 18, No. 7
Department of Cell Biology and Anatomy, Mount
Sinai Medical Center, New York, New York 10029
Received 26 November 1997/Returned for modification 20 January
1998/Accepted 31 March 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
SBA1 Encodes a Yeast Hsp90 Cochaperone
That Is Homologous to Vertebrate p23 Proteins
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
|
|
|---|
The Saccharomyces cerevisiae SBA1 gene was cloned by PCR amplification from yeast genomic DNA following its identification as encoding an ortholog of human p23, an Hsp90 cochaperone. The SBA1 gene product is constitutively expressed and nonessential, although a disruption mutant grew more slowly than the wild type at both 18 and 37°C. A double deletion of SBA1 and STI1, encoding an Hsp90 cochaperone, displayed synthetic growth defects. Affinity isolation of histidine-tagged Sba1p (Sba1His6) after expression in yeast led to coisolation of Hsp90 and the cyclophilin homolog Cpr6. Using an in vitro assembly assay, purified Sba1His6 bound to Hsp90 only in the presence of adenosine 5'-O-(3-thiotriphosphate) or adenyl-imidodiphosphate. Furthermore, interaction between purified Sba1His6 and Hsp90 in yeast extracts was inhibited by the benzoquinoid ansamycins geldanamycin and macbecin. The in vitro assay was also used to identify residues in Hsp90 that are important for complex formation with Sba1His6, and residues in both the N-terminal nucleotide binding domain and C-terminal half were characterized. In vivo analysis of known Hsp90 substrate proteins revealed that Sba1 loss of function had only a mild effect on the activity of the tyrosine kinase v-Src and steroid hormone receptors.
INTRODUCTION
|
|
|---|
Polypeptide folding occurs in vivo with the aid of molecular chaperones. Members of this diverse protein family have been proposed to function by protecting nascent chains from off-pathway interactions that might otherwise lead to aggregation and to stabilize conformations from which productive folding can proceed (25, 29). The two major classes of molecular chaperone that exist in the eukaryotic cytosol under normal growth conditions are Hsp70 and Hsp90. Both of these chaperones function in protein folding reactions with the aid of several factors that act as cochaperones or modulators. In the case of eukaryotic Hsp70, the cochaperones include members of the DnaJ family, p48/Hip, p60/Sti1p, and Bag1 (10, 21, 26, 50). Each of these cochaperones has been reported to modulate the ATPase activity of Hsp70 by either stimulating ATP hydrolysis or regulating nucleotide exchange (10, 21, 24, 26). The Hsp70 chaperone machine also appears to function in association with Hsp90 via the action of the p60 gene, an ortholog of the yeast STI1, which binds to both chaperone proteins (9, 11, 36, 46). Hsp90 is an abundant and highly conserved molecular chaperone. It exists in several discrete subcomplexes that together comprise the Hsp90 chaperone machine. One of these subcomplexes contains Hsp90/Hsp70/Hip and p60/Sti1 (46), while another contains one of several immunophilins and the acidic protein p23 (31).
The p23 protein was first identified in association with the progesterone receptor (PR) (45) and was later shown to be an Hsp90 binding protein (30, 32, 49). In addition to being found in protein complexes with several unliganded steroid hormone receptors, p23 has been found to associate via Hsp90 with several proteins including transcription factors, protein kinases, and a viral reverse transcriptase (27, 37, 56). In all of these interactions, p23 is thought to be indirectly associated via Hsp90. There is also evidence, however, that p23 can bind independently to polypeptides and prevent them from aggregating (5, 20, 27).
Purified p23 binds to Hsp90 in a manner that is stabilized by nonhydrolyzable ATP and by molybdate ions (49). In addition, complex formation between p23 and Hsp90 is inhibited by geldanamycin, a benzoquinoid ansamycin that was originally defined as a tyrosine kinase inhibitor but was recently shown to specifically interact with Hsp90 (54). Geldanamycin negatively affects the activity of steroid hormone receptors and protein kinases and stimulates their degradation (43, 44, 47, 53). By contrast, p23 appears to be important for stabilizing a high-affinity hormone binding conformation of the glucocorticoid receptor (GR) and PR (14, 47).
Recent studies have demonstrated the conserved nature of yeast and animal cell Hsp90 protein complexes (8, 9; see reference 6 for a review), but to date there has been no report of a yeast p23 homolog. In this report, we present a genetic and biochemical characterization of a p23 homolog from the yeast Saccharomyces cerevisiae.
MATERIALS AND METHODS
|
|
|---|
Materials.
Geldanamycin and macbecin were obtained from the
Drug Synthesis & Chemistry Branch, Developmental Theraputics Program,
Division of Cancer Treatment, National Cancer Institute. Both compounds were stored at 2 mg/ml in dimethyl sulfoxide at
20°C. Monoclonal antibodies to phosphotyrosine (4G10) and v-Src (GD11) were purchased from Upstate Biotechnology (Lake Placid, N.Y.). Antiserum to Hsp90 was
described previously (12), and antiserum to Hsp70 was
purchased from Affinity Bioreagents. Antisera to Cpr6 and Sti1 were the kind gifts of D. Picard and D. Toft, respectively. Isogenic yeast strains encoding wild-type and G170D mutant forms of HSP82
were the kind gifts of S. Lindquist. Plasmids encoding the A97I
(pts38RV), T101I (pcs2-3RV), and S485Y (pts33BE) hsp82
mutants were the kind gift of Y. Kimura (33), and those
encoding the E431K (pTCA/hsp82 E431K) and T525I (pTCA/hsp82 T525I)
mutants of hsp82 were the gift of K. Yamamoto
(3). Plasmid pGVSRC (CEN/ARS URA3
v-src) was the kind gift of Frank Boschelli.
Yeast methods and strains. The genotypes of S. cerevisiae strains used in this study are shown in Table 1. Standard genetic methods were used for growth and manipulation. Yeast strains were grown in either rich medium (YPD) or selective minimal medium (0.67% yeast nitrogen base) with 2% glucose (or raffinose or galactose) and supplemented with adenine, uracil, and amino acids, depending on auxotrophy. Transformation of yeast strains was performed as described previously (22). Strain ACY77 was constructed from W3031b by one-step gene replacement (42) using a DNA fragment containing the sti1-1::HIS3 allele that was amplified by PCR from the genomic DNA of strain CN11 (38), using the primers 5' GCGCGCAAGCTTAATATTCTATGTCTGGCAACT 3' and 5' GCGCGCTCTAGACTTATTATCTTCAAGTTCCGA 3' in a 30-cycle reaction at an annealing temperature of 50°C. sti1-1/sba1-1 double mutants were prepared from ACY77 by one-step gene replacement using the 2.4-kb sba1-1::URA3 fragment as described below.
|
SBA1 cloning and gene disruption.
SBA1 was
cloned by a 30-cycle PCR amplification (using Taq
polymerase; annealing temperature of 37°C) from S. cerevisiae W3031b genomic DNA, using the primers 5'
GCGCGCCTCGAGGATAATCATCCAGCA 3' and 5'
GCGCGCTCTAGAACTGCCTTTTATGAA 3'. The 1,269-bp product was gel
purified and cloned into the pCR-Script vector (Stratagene) to generate
the clone designated p2323. The SBA1 disruption allele was
generated by insertion of a 1.1-kb blunt-ended DNA fragment containing
the URA3 gene into HpaI-digested p2323, which
linearized the plasmid in the SBA1 open reading frame (ORF).
A 2.4-kb DNA fragment containing the
sba1-1::URA3 disruption allele (called sba1-1 hereafter) was released from this plasmid
(p
23URA3) by digestion with restriction endonucleases
XhoI and XbaI. This linear 2.4-kb fragment was
transformed into haploid wild-type yeast (W3031b) for one-step gene
replacement of SBA1.
Purification of Sba1His6 and preparation of Sba1
antiserum.
A gene encoding recombinant Sba1His6 for
expression in Escherichia coli was generated by PCR
amplification from p2323 (as above), using the primers 5'
GCGCGCCATATGTCCGATAAAGTTATTAAC 3' and 5' GCGCGCGGATCCAAGTTACTCATTCTAGCA 3'. The 1-kb product was cloned into pCR-Script (Stratagene), excised by using NdeI and
BamHI, and subcloned into similarly digested pET15b
(Novagen). Construction of SBA1 in this vector resulted in
an N-terminal sequence extension juxtaposed to wild-type
SBA1 sequence as follows:
MGSSHHHHHHSSGLVPRGSH (single-letter
amino acid code). The resulting plasmid, p23ET, was transformed into
E. coli BL21(DE3). Expression of Sba1His6 was
induced as follows. BL21(DE3) containing p23ET was grown overnight at
37°C in 100 ml of LB medium plus 50 µg of ampicillin per ml. The
culture was diluted 1:10 into fresh LB medium and incubated for 1 h at 37°C before addition of
isopropyl-
-D-thiogalactopyranoside to a final
concentration of 1 mM. The culture was incubated for a further 2 h
before harvesting the cells. The cells were resuspended in 5 ml of BL
buffer (10 mM Tris-HCl [pH 7.5], 50 mM Sba1, 50 mM KCl, 10 mM
MgCl2, 1 mM EDTA, 5 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride [PMSF], protease inhibitor cocktail
containing equimolar amounts of aprotinin, chymostatin, leupeptin, and
pepstatin [each at 2 µg/ml]) and broken by sonication (10 times,
10-s bursts with cooling on ice for 30 s between bursts). The
lysate was cleared by centrifugation at 14,000 × g for
30 min at 4°C. The protein concentration was adjusted to 10 mg/ml
with lysis buffer.
Affinity isolation of Sba1 from yeast. One-step affinity chromatography of Sba1His6 expressed in yeast was performed by a modification of the procedure of Fang et al. (18). Briefly, 100-ml yeast cultures were harvested, the pellet was washed once with water and once with YL buffer (10 mM Tris-HCl [pH 7.5], 50 mM NaCl, 50 mM KCl, 10 mM MgCl2, 1 mM EDTA, 1 mM PMSF, and protease inhibitor cocktail [2 µg/ml] as described above). The pellet was resuspended in 0.8 ml of lysis buffer plus 20 mM sodium molybdate, and the cells were broken in the presence of 1.5 g of 0.4-mm-diameter glass beads by 5 30-s bursts in a mini-BeadBeater (Biospec Products) at 4°C, with cooling on ice for 30 s between bursts. The crude lysate was cleared at 14,000 × g for 30 min at 4°C. The protein concentration was adjusted to 3 mg/ml, and 0.5 ml of protein extract was incubated with 50 µl of Ni-NTA resin (equilibrated in lysis buffer) for 15 min at 4°C on a nutator. The resin was collected at 500 × g and washed three times in 1 ml of lysis buffer plus 20 mM sodium molybdate and 10 mM imidazole. The resin was incubated with 50 µl of elution buffer (lysis buffer plus 150 mM imidazole) at 4°C for 10 min. The eluted protein was resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Coomassie blue staining or by Western blotting.
In vitro assembly assay. Sba1His6 purified from E. coli was bound to Ni-NTA resin (30 µl of packed beads, equilibrated in YL buffer as described above) by direct addition and incubation for 15 min at 4°C. Beads containing 1 µg of Sba1His6 were added to 100 µl of desalted yeast whole-cell extract (at a concentration of 1 mg/ml; prepared by using a 5-ml HiTrap desalting column [Pharmacia]). The volume was adjusted to 250 µl with YL buffer, and the mixture was incubated for 30 min at 30°C. The beads were collected by centrifugation at 1,000 × g and washed three times with 1 ml of YL buffer plus 10 mM imidazole. Protein was eluted from the beads YL buffer plus 150 mM imidazole in a 30-µl volume for 10 min at 4°C and analyzed by SDS-PAGE and Western blotting.
v-Src expression, immunoblot analysis, and steroid hormone receptor assays. Lysates of yeast expressing v-Src were prepared as follows. Yeast cultures were grown at 30°C in minimal medium containing 2% (wt/vol) raffinose to late log phase. v-Src expression was induced by the addition of 2% (wt/vol) galactose to the medium. Induction was continued for 6 h, at which time cells were harvested, resuspended in YLS buffer (20 mM Tris-HCl [pH 7.4], 0.14 M NaCl, 5 mM EDTA, 1% Nonidet P-40, 1 mM sodium vanadate, 5 mM dithiothreitol, 1 mM PMSF, a mixture of aprotinin, chymostatin, leupeptin, and pepstatin [each at 2 µg/ml]), and lysed with glass beads as described above. Lysates were cleared of broken cell debris at 14,000 × g.
The levels of tyrosine phosphorylation and v-Src protein were assayed by immunoblot analysis using either antiphosphotyrosine or anti-v-Src monoclonal antibodies (see Materials and Methods). Lysates (100 µg of total protein) were resolved by SDS-PAGE and transferred to nitrocellulose membranes (0.45 µm; MSI). Filters were washed briefly with TTBS (20 mM Tris-HCl [pH 7.5], 0.5 M NaCl, 0.05% Tween 20) and blocked overnight with TTBS containing 5% nonfat dry milk. Filters were incubated with antibodies to v-Src or phosphotyrosine (diluted 1:1,000 in antibody dilution buffer [1× phosphate-buffered saline, 3% bovine serum albumin, 0.05% Tween 20, 0.1% thimerosal) for 2 h. Filters were washed three times for 10 min each in TTBS. Filters were incubated with secondary antibody (horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G, diluted 1:10,000 in antibody dilution buffer) for 1 h, and subsequently washed as for the primary antibody. Filters were then treated with the chemiluminescence reagent (Pierce) and exposed to X-ray film for detection. Immunoblots for detecting Sba1, Cpr6, Sti1, and Hsp90 were processed by standard procedures after transfer of the proteins in denaturing gels to nitrocellulose membranes. The filters were typically blocked overnight in TTBS plus 5% nonfat dried milk and incubated with primary and secondary antibodies for 1 to 2 h. Filters were washed between antibody incubations with TTBS (three times, 5 min each), and proteins were detected as described above. Assays for steroid hormone receptor activation were performed as previously described (7, 18).RESULTS
|
|
|---|
YKL117W is orthologous to vertebrate p23 genes. A BLAST search of the GenBank database with the sequence of human p23 protein revealed a single orthologous ORF in S. cerevisiae displaying 24% identical amino acids (28). This gene (YKL117W) encodes a putative protein of 24.1 kDa, which is 5.4 kDa larger than the human p23 protein (18.7 kDa) (Fig. 1 shows protein sequence alignments). YKL117W resides on the left arm of chromosome XI between coordinates 219970 and 220620, just downstream of a tRNAAla gene and upstream of a hypothetical ORF, YKL116C.
|
SBA1 is nonessential and constitutively expressed. The SBA1 gene was cloned by PCR amplification from wild-type yeast genomic DNA. Northern blot analysis revealed that SBA1 is constitutively expressed as previously found (17) but not heat shock inducible under the same conditions when STI1 mRNA is induced (reference 38 and data not shown). Sba1 protein was detected in wild-type yeast whole-cell extracts by Western blot analysis using antisera prepared from recombinant Sba1His6 expressed in E. coli. Wild-type Sba1 migrates anomalously at 32 kDa, approximately 8 kDa larger than the predicted size (Fig. 2A, lane 1). Sba1His6 also migrated anomalously at 32 kDa after inducible expression in yeast or after purification (to approximately 90%) from E. coli (Fig. 2).
|
|
Sba1 interacts with Hsp90. Vertebrate p23 proteins bind to Hsp90 in a nucleotide-dependent manner (49). To determine whether Sba1 also interacts with Hsp90, Sba1His6 was inducibly expressed from the yeast GAL1 promoter at 30°C in the sba1-1 disruption strain (Fig. 2A). Sba1His6 was isolated from whole-cell extracts by affinity chromatography using Ni-NTA resin. Examination of the protein profiles after affinity chromatography revealed that many yeast proteins bound nonspecifically to the Ni-NTA resin. However, comparison of the eluates from induced and noninduced cells revealed the presence of two major bands at 32 and 86 kDa that were observed only after Sba1His6 induction (Fig. 4A; compare lanes 4 and 5). The band at 32 kDa corresponds to Sba1His6 itself and reacted with Sba1 antiserum (data not shown), while the 86-kDa protein (which appears as a very tight doublet in Fig. 4A) reacted with antiserum to Hsp90 (Fig. 4B). The isolation of Hsp90 with Ni-NTA resin was dependent on the presence of Sba1His6, since it was not isolated from extracts of wild-type cells not containing plasmid pGAL-SBA1 (Fig. 4B). Complex formation between Hsp90 and Sba1His6 was stabilized by the presence of sodium molybdate in the binding and wash buffers; omission of sodium molybdate from the wash buffer destabilized the complex and Hsp90 dissociated from Sba1His6 (Fig. 4C).
|
|
S), suggesting that this
interaction is strongest when ATP is unable to be hydrolyzed. The
binding of Sba1His6 to Hsp90 is apparently specific since
there was no interaction with Hsp70 under any of the conditions used,
as revealed by reprobing the Western blot with antiserum to Hsp70 as
shown in Fig. 5A. The interaction between Sba1His6 and
Hsp90 can also occur with either the Hsc82 or the Hsp82 isoform, as
judged by the formation of complexes in strains having deletions in
either the HSC82 or HSP82 gene (data not shown).
This interaction with both isoforms may account for the presence of a
doublet at 86 kDa (4) after affinity isolation of
Sba1His6 from wild-type yeast cell extracts after in
vivo expression (Fig. 5A).
We also tested whether binding of Sba1His6 to Hsp90 was
sensitive to benzoquinoid ansamycins, which have been shown to inhibit complex formation between p23 and Hsp90 (23, 32, 47).
Similar inhibition occurs between yeast Hsp90 and Sba1. As shown in
Fig. 5B, both geldanamycin and the related compound macbecin inhibit the association of purified Sba1 with Hsp90 in yeast extracts supplemented with AMP-PNP. The inhibition by macbecin is 5- to 10-fold
less sensitive than was found for geldanamycin.
The in vitro binding assay was used to identify residues in Hsp90 that
are critical to Sba1 binding. This experiment was performed by
incubating purified Sba1His6 with extracts from yeast cells
expressing different mutant forms of Hsp90 (specifically the Hsp82
isoform expressed from a constitutive promoter). Six different point
mutants were used in this experiment (Fig. 5C), and in the presence of
AMP-PNP, only two of these mutant forms of Hsp90 (T101I and E431K) were
able to bind to Sba1His6. Of those that failed to bind
Sba1His6, two have their mutations in the N-terminal
nucleotide binding domain and two (S485Y and T525I) reside in
the C-terminal half of Hsp90, suggesting that this region is also
important for Sba1His6 binding.
These combined results demonstrate the similarity in structure and
function between Sba1 and vertebrate p23 proteins. We next performed a
functional analysis in yeast to determine whether Sba1 loss of function
affected processes known to require the Hsp90 chaperone machine: the
activity of the tyrosine kinase v-Src and steroid hormone receptors.
Role of Sba1 in v-Src maturation and steroid hormone receptor activation. After heterologous expression in yeast, the tyrosine kinase v-Src is active in a manner that is dependent on Hsp90 and its cochaperones. In wild-type cells, expression of v-Src from a galactose-inducible promoter leads to greatly increased levels of phosphotyrosine (Fig. 6A) which result in a lethal phenotype (reference 19 and data not shown). Previous studies have shown that mutation or deletion of yeast genes encoding Hsp90 or other components of the Hsp90 chaperone machine resulted in decreased levels of v-Src activity, often suppressing the lethal phenotype accompanying it (9, 12, 13, 16, 34, 35, 55). Disruption of the SBA1 gene, however, did not suppress this lethal phenotype upon inducible expression of v-Src. Furthermore, v-Src gene induction from a GAL1 promoter led to similar accumulation of v-Src protein (Fig. 6A, lower panel), and the level of protein tyrosine phosphorylation, as assessed by Western blotting with antiphosphotyrosine, revealed significant v-Src activity in sba1-1 cells (Fig. 6A), although the levels were approximately twofold lower in this strain than in the wild type (Fig. 6B).
|
DISCUSSION
|
|
|---|
Molecular chaperones are thought to play a major role in the folding and assembly of newly synthesized polypeptide chains in both prokaryotes and eukaryotes. Hsp70 and Hsp90 are the most abundant molecular chaperones in the eukaryotic cytosol and are probably responsible for the majority of chaperoning events taking place in this compartment. These activities occur in association with various cochaperones that modulate Hsp70 or Hsp90 action and may also function as molecular chaperones themselves.
The Sba1 protein has properties similar to those of the vertebrate Hsp90 cochaperone, p23. These proteins display several regions of conserved sequence similarity, although the overall amino acid sequence identity between Sba1 and p23 is only 24% (Fig. 1). In addition, both p23 and Sba1 migrate more slowly in denaturing gels than would be predicted from their size, suggesting some shared structural feature (30).
Sba1 and p23 also have functional similarities. Both bind to Hsp90 in a manner that is stabilized by nonhydrolyzable ATP or by molybdate ions (32, 49). This nucleotide requirement is likely to represent the binding of ATP to Hsp90 itself, which has recently been shown to have a nucleotide binding pocket in its N-terminal domain (41). Indeed, two mutations in the HSP82 gene (A97I and G170D) that alter amino acids adjacent to those directly interacting with the nucleotide prevent binding of Sba1p to Hsp90 in vitro (Fig. 5C). Similar inhibition has also been observed between human Hsp90 and p23 when the G170 equivalent (G182 in human Hsp90) is mutated to aspartate (23). Residues at the C-terminal domain of Hsp90 also appear to be important for its interaction with Sba1, since no complex formation was observed with the S485Y or T525I mutant (Fig. 5C). A further similarity between vertebrate and yeast p23 proteins derives from the finding that Sba1 association with Hsp90 is inhibited by geldanamycin and by the related compound macbecin, which has been shown to affect the activity of p53 expressed in yeast (1). Geldanamycin binds in the nucleotide binding pocket of human Hsp90 (48) and also inhibits complex formation with p23 (23, 47, 49). The effect of N-terminal mutations in Hsp90 and the effect of geldanamycin or macbecin may therefore be related to nucleotide-dependent conformations that may allosterically affect the binding of Sba1 elsewhere in Hsp90. The most likely candidate region for Sba1 binding is therefore the C-terminal half of Hsp90, since two of three mutations in this region (S485Y and T525I) blocked complex formation.
The complex between p23 and Hsp90 in animal cells also contains one of several immunophilins, such as cyclophilin 40 (31). Similar interactions also occur in yeast, since the cyclophilin Cpr6 is highly enriched in eluates after affinity chromatography of Sba1His6. By contrast, the Sti1 cochaperone was present in these complexes in much smaller amounts. Previous biochemical studies have concluded that p60 and p23 reside independently of each other on different Hsp90 subcomplexes (30, 46) and that immunophilins and p60 compete with each other for the same binding site on Hsp90 (40). The relationship between p23 and p60/Sti1 may not be so discrete, however, since purified p23 can interact with the Hsp90-Hsp70-p60 complex, suggesting that these proteins may indeed function together, if only in a temporary manner (14, 32). Our results are consistent with there being a functional interaction between Sti1 and Sba1, based on the biochemical evidence that they coexist in the same complexes (albeit to a very small degree) in addition to the synthetic growth defects of the sba1/sti1 double mutant.
Together, these combined data indicate that Sba1 is a yeast homolog of vertebrate p23 proteins. SBA1 disruption did not result in any major growth phenotype, however, although the sba1-1 cells grew more slowly at both low and high temperatures compared to the wild type. These data contrast with the relative importance of Hsp90 for cell growth (4) and suggest that Sba1 is dispensable for general chaperone-mediated protein folding under normal conditions, although it may have a more specific role under nonoptimal growth conditions.
The vertebrate p23 protein has been characterized as a component of Hsp90 containing heterocomplexes with steroid hormone receptors and with v-Src. However, loss of Sba1 function resulted in only mild defects in steroid receptor signaling or v-Src activity. These data contrast with the relative importance of other yeast Hsp90 or Hsp70 cochaperones to both steroid receptor signaling and v-Src activity, such as Ydj1, Cdc37, Cpr7, and Sti1 (9, 12, 13, 16, 34, 35, 55). The results from the sba1-1 strain are especially surprising given the relative importance attributed to p23 for stable complex formation between Hsp90 and steroid hormone receptors (14, 31). However, the near-wild-type activity of AR and GR in the sba1-1 strain is consistent with the recent finding that while p23 is important to stabilize Hsp90-GR complexes in a high-affinity hormone binding state (14), it is not responsible for generating this conformation (15), through which receptor activation is likely to occur in yeast. In the absence of p23, the GR can attain the high-affinity hormone binding state via the action of Hsp90/Hsp70 and p60, although its ability to maintain it is severely compromised. But as observed by Dittmar and Pratt (15), heterocomplex instability does not preclude hormone binding if the ligand is incubated during heterocomplex assembly. Thus, Sba1 may be dispensable for AR and GR signaling because it stabilizes the activatable state rather than generates it. In this manner, Sba1 may contribute to the efficiency with which chaperone-mediated folding of steroid receptors and v-Src take place and hence the relatively mild reductions in activity resulting from its loss of function.
ACKNOWLEDGMENTS
|
|
|---|
We thank Jie Jin for help with protein purification, Alex Shorstein for help with SBA1 gene cloning, and Robert J. Donnelly (Molecular Resource Facility, New Jersey Medical School, UMDNJ) for DNA sequencing. We also thank F. Boschelli and E. Craig, Y. Kimura, S. Lindquist, D. Picard, D. Toft, and K. Yamamoto for the gifts of reagents, Sean Bohen for discussions and communication of results prior to publication, and Jeanne Hirsch for comments on the manuscript.
This work was supported by grants from the NIH (R01-DK49065) and the Sinsheimer Foundation to A.J.C.
FOOTNOTES
* Corresponding author. Mailing address: Department of Cell Biology and Anatomy, Mount Sinai Medical Center, One Gustave L. Levy Place, New York, NY 10029. Phone: (212) 241-6563. Fax: (212) 860-1174. E-mail: caplan{at}msvax.mssm.edu.
REFERENCES
|
|
|---|
| 1. |
Blagosklonny, M. V.,
J. Toretsky,
S. Bohen, and L. Neckers.
1996.
Mutant conformation of p53 translated in vitro or in vivo requires functional HSP90.
Proc. Natl. Acad. Sci. USA
93:8379-8383 |
| 2. | Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline]. |
| 3. |
Bohen, S. P., and K. R. Yamamoto.
1993.
Isolation of Hsp90 mutants by screening for decreased steroid receptor function.
Proc. Natl. Acad. Sci. USA
90:11424-11428 |
| 4. |
Borkovich, K. A.,
F. W. Farrelly,
D. B. Finkelstein,
J. Taulien, and S. Lindquist.
1989.
Hsp82 is an essential protein that is required in higher concentrations for growth of cells at higher temperatures.
Mol. Cell. Biol.
9:3919-3930 |
| 5. |
Bose, S.,
T. Weikl,
H. Bügl, and J. Buchner.
1996.
Chaperone function of Hsp90-associated proteins.
Science
274:1715-1717 |
| 6. | Caplan, A. J. 1997. Yeast molecular chaperones and the mechanism of steroid hormone action. Trends Endocrine Metab. 8:271-276. |
| 7. |
Caplan, A. J.,
E. Langley,
E. M. Wilson, and J. Vidal.
1995.
Hormone dependent transactivation by the human androgen receptor is regulated by a dnaJ protein.
J. Biol. Chem.
270:5251-5257 |
| 8. |
Chang, H.-C. J., and S. Lindquist.
1994.
Conservation of Hsp90 macromolecular complexes in Saccharomyces cerevisiae.
J. Biol. Chem.
269:24983-24988 |
| 9. | Chang, H.-C. J., D. F. Nathan, and S. Lindquist. 1997. In vivo analysis of the Hsp90 cochaperone Sti1 (p60). Mol. Cell. Biol. 17:318-325[Abstract]. |
| 10. | Cheetham, M. E., and A. J. Caplan. 1998. Structure, function and evolution of dnaJ: conservation and adaptation of chaperone function. Cell Stress Chap. 3:28-36. [Medline] |
| 11. |
Chen, S.,
V. Prapapanich,
R. A. Rimerman,
B. Honoré, and D. F. Smith.
1996.
Interactions of p60, a mediator of progesterone receptor assembly, with heat shock proteins Hsp90 and Hsp70.
Mol. Endocrinol.
10:682-693 |
| 12. | Dey, B., A. J. Caplan, and F. Boschelli. 1996. The YDJ1 molecular chaperone facilitates formation of active p60v-src in yeast. Mol. Biol. Cell 7:91-100[Abstract]. |
| 13. | Dey, B., J. J. Lightbody, and F. Boschelli. 1996. CDC37 is required for p60v-src activity in yeast. Mol. Biol. Cell 7:1405-1417[Abstract]. |
| 14. |
Dittmar, K. D.,
D. R. Demady,
L. F. Stancato,
P. Krishna, and W. B. Pratt.
1997.
Folding of the glucocorticoid receptor by the heat shock protein (hsp) 90-based chaperone machinery.
J. Biol. Chem.
272:21213-21220 |
| 15. |
Dittmar, K. D., and W. B. Pratt.
1997.
Folding of the glucocorticoid receptor by the reconstituted hsp90-based chaperone machinery.
J. Biol. Chem.
272:13047-13054 |
| 16. |
Duina, A. A.,
H.-C. J. Chang,
J. A. Marsh,
S. Lindquist, and R. F. Gaber.
1996.
A cyclophilin function in Hsp90-dependent signal transduction.
Science
274:1713-1715 |
| 17. | Fairhead, C., and B. Dujon. 1994. Transcript map of two regions from chromosome XI of Saccharomyces cerevisiae for interpretation of systematic sequencing results. Yeast 10:1403-1413[Medline]. |
| 18. |
Fang, Y.,
A. E. Fliss,
D. M. Robins, and A. J. Caplan.
1996.
Hsp90 regulates androgen receptor hormone binding affinity in vivo.
J. Biol. Chem.
271:28697-28702 |
| 19. | Florio, M., L. K. Wilson, J. B. Trager, J. Thorner, and G. S. Martin. 1994. Aberrant protein phosphorylation at tyrosine is responsible for the growth-inhibitory action of pp60v-src expressed in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 5:283-296[Abstract]. |
| 20. |
Freeman, B. C.,
D. O. Toft, and R. I. Morimoto.
1996.
Molecular chaperone machines: chaperone activities of the cyclophilin Cyp-40 and the steroid aporeceptor-associated protein p23.
Science
274:1718-1720 |
| 21. | Frydman, J., and J. Höhfeld. 1997. Chaperones get in touch: the Hip-Hop connection. Trends Biochem. Sci. 22:87-92[Medline]. |
| 22. | Geitz, R. D., R. H. Schiestl, A. R. Willems, and R. A. Woods. 1995. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360[Medline]. |
| 23. |
Grenert, J. P.,
W. P. Sullivan,
P. Fadden,
T. A. J. Haystead,
J. Clark,
E. Mimnaugh,
H. Krutzsch,
H.-J. Ochel,
T. W. Schulte,
E. Sausville,
L. M. Neckers, and D. O. Toft.
1997.
The amino-terminal domain of heat shock protein 90 (hsp90) that binds geldanamycin is an ATP/ADP switch domain that regulates hsp90 conformation.
J. Biol. Chem.
272:23843-23850 |
| 24. |
Gross, M., and S. Hessefort.
1996.
Purification and characterization of a 66-kDa protein from rabbit reticulocyte lysate which promotes the recycling of Hsp70.
J. Biol. Chem.
271:16833-16841 |
| 25. | Hartl, F. U. 1996. Molecular chaperones in cellular protein folding. Nature 381:571-580[Medline]. |
| 26. | Höhfeld, J., and S. Jentsch. 1997. GrpE-like regulation of the Hsc70 chaperone by the anti-apoptotic protein BAG-1. EMBO J. 16:6209-6216[Medline]. |
| 27. | Hu, J., D. O. Toft, and C. Seeger. 1997. Hepadnavirus assembly and reverse transcription require a multi-component chaperone complex which is incorporated into nucleocapsids. EMBO J. 16:59-68[Medline]. |
| 28. | Jacquier, A., P. Legrain, and B. Dujon. 1992. Sequence of a 10.7 kb segment of yeast chromosome XI identifies the APN1 and the BAF1 loci and reveals one tRNA gene and several new open reading frames including homologs to RAD2 and kinases. Yeast 8:121-132[Medline]. |
| 29. | Johnson, J. L., and E. A. Craig. 1997. Protein folding in vivo: unraveling complex pathways. Cell 90:201-204[Medline]. |
| 30. |
Johnson, J. L.,
T. G. Beito,
C. J. Krco, and D. O. Toft.
1994.
Characterization of a novel 23-kilodalton protein of unactive progesterone receptor complexes.
Mol. Cell. Biol.
14:1956-1963 |
| 31. |
Johnson, J. L., and D. O. Toft.
1994.
A novel chaperone complex for steroid receptors involving heat shock proteins, immunophilins, and p23.
J. Biol. Chem.
269:24989-24993 |
| 32. |
Johnson, J. L., and D. O. Toft.
1995.
Binding of p23 and hsp90 during assembly with the progesterone receptor.
Mol. Endocrinol.
9:670-678 |
| 33. | Kimura, Y., S. Matsumoto, and I. Yahara. 1994. Temperature-sensitive mutants of hsp82 of the budding yeast Saccharomyces cerevisiae. Mol. Gen. Genet. 242:517-527[Medline]. |
| 34. |
Kimura, Y.,
I. Yahara, and S. Lindquist.
1995.
Role of the protein chaperone YDJ1 in establishing Hsp90 mediated signal transduction pathways.
Science
268:1362-1365 |
| 35. |
Kimura, Y.,
S. L. Rutherford,
Y. Miyata,
I. Yahara,
B. C. Freeman,
L. Yue,
R. I. Morimoto, and S. Lindquist.
1997.
Cdc37 is a molecular chaperone with specific functions in signal transduction.
Genes Dev.
11:1775-1785 |
| 36. |
Lässle, M.,
G. L. Blatch,
V. Kundra,
T. Takatori, and B. R. Zetter.
1997.
Stress inducible, murine protein mSTI1.
J. Biol. Chem.
272:1876-1884 |
| 37. | Nair, S. C., E. J. Toran, R. A. Rimerman, S. Hjermstad, T. E. Smithgall, and D. F. Smith. 1996. A pathway of multi-chaperone interactions common to diverse regulatory proteins; estrogen receptor, fes tyrosine kinase, heat shock transcription factor HSF1 and the arylhydrocarbon receptor. Cell Stress Chap. 1:237-249. [Medline] |
| 38. | Nathan, D. F., and S. Lindquist. 1995. Mutational analysis of Hsp90 function: interactions with a steroid hormone receptor and protein kinase. Mol. Cell. Biol. 15:3917-3925[Abstract]. |
| 39. |
Nicolet, C. M., and E. A. Craig.
1989.
Isolation and characterization of STI1, a stress inducible gene from Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:3638-3646 |
| 40. |
Owens-Grillo, J. K.,
M. J. Czar,
K. A. Hutchison,
K. Hoffmann,
G. H. Perdew, and W. B. Pratt.
1996.
A model of protein targeting mediated by immunophilins and other proteins that bind to hsp90 via tetratricopeptide repeat domains.
J. Biol. Chem.
271:13468-13475 |
| 41. | Prodromou, C., S. M. Roe, R. O'Brien, J. E. Ladbury, P. W. Piper, and L. H. Pearl. 1997. Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell 90:65-75[Medline]. |
| 42. | Rothstein, R. 1991. Targeting, disruption, replacement and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-301[Medline]. |
| 43. |
Schulte, T. W.,
M. V. Blagosklonny,
C. Ingui, and L. Neckers.
1995.
Disruption of the raf-1-hsp90 molecular complex results in destabilization of raf-1 and loss of raf-1-ras association.
J. Biol. Chem.
270:24585-24588 |
| 44. |
Segnitz, B., and U. Gehring.
1997.
The function of steroid hormone receptors is inhibited by the hsp90-specific compound geldanamycin.
J. Biol. Chem.
272:18694-18701 |
| 45. |
Smith, D. F.,
L. E. Faber, and D. O. Toft.
1990.
Purification of unactivated progesterone receptor and identification of novel receptor-associated proteins.
J. Biol. Chem.
265:3996-4003 |
| 46. |
Smith, D. F.,
W. P. Sullivan,
T. N. Marion,
K. Zaitsu,
B. Madden,
D. J. McCormick, and D. O. Toft.
1993.
Identification of a 60-kilodalton stress-related protein, p60, which interacts with Hsp90 and Hsp70.
Mol. Cell. Biol.
13:869-876 |
| 47. | Smith, D. F., L. Whitesell, S. C. Nair, S. Chen, V. Prapapanich, and R. A. Rimmerman. 1995. Progesterone receptor structure and function altered by geldanamycin, an Hsp90-binding agent. Mol. Cell. Biol. 15:6804-6812[Abstract]. |
| 48. | Stebbins, C. E., A. A. Russo, C. Schneider, N. Rosen, F. U. Hartl, and N. P. Pavletich. 1997. Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell 89:239-250[Medline]. |
| 49. |
Sullivan, W.,
B. Stensgard,
G. Caucutt,
B. Bartha,
N. McMahon,
E. S. Alnemri,
G. Litwack, and D. O. Toft.
1997.
Nucleotides and two functional states of hsp90.
J. Biol. Chem.
272:8007-8012 |
| 50. | Takayama, S., D. N. Bimston, S. Matsuzawa, B. C. Freeman, C. Aime-Sempe, Z. Xie, R. I. Morimoto, and J. C. Reed. 1997. BAG-1 modulates the chaperone activity of Hsp70/Hsc70. EMBO J. 16:4887-4896[Medline]. |
| 51. | Thomas, B. J., and R. Rothstein. 1989. Elevated recombination rates in transcriptionally active DNA. Cell 56:619-630[Medline]. |
| 52. | Warth, R., P.-A. Briand, and D. Picard. 1997. Functional analysis of the yeast 40 kDa cyclophilin Cyp40 homologue and its role for viability and steroid receptor regulation. Biol. Chem. 387:381-391. |
| 53. |
Whitesell, L., and P. Cook.
1996.
Stable and specific binding or heat shock protein 90 by geldanamycin disrupts glucocorticoid receptor function in intact cells.
Mol. Endocrinol.
10:705-712 |
| 54. |
Whitesell, L.,
E. G. Mimnaugh,
B. De Costa,
C. E. Myers, and L. M. Neckers.
1994.
Inhibition of heat shock protein Hsp90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation.
Proc. Natl. Acad. Sci. USA
91:8324-8328 |
| 55. |
Xu, Y., and S. L. Lindquist.
1993.
Heat-shock protein hsp90 governs the activity of pp60v-src.
Proc. Natl. Acad. Sci. USA
90:7074-7078 |
| 56. | Xu, Z., J. K. Pal, V. Thulasiraman, H. P. Hahn, J. J. Chen, and R. L. Matts. 1997. The role of the 90-kDa heat-shock protein and its associated cohorts in stabilizing the heme-regulated eIF-2alpha kinase in reticulocyte lysates during heat stress. Eur. J. Biochem. 246:461-470[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»