Previous Article | Next Article ![]()
Mol Cell Biol, July 1998, p. 3796-3802, Vol. 18, No. 7
Department of Biology, University of
California at San Diego, La Jolla, California
92093,1 and
Department of Pathology,
State University of New York at Stony Brook, Stony Brook, New York
117942
Received 25 November 1997/Returned for modification 29 December
1997/Accepted 12 March 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cytomegalovirus Activates Interferon Immediate-Early Response
Gene Expression and an Interferon Regulatory Factor 3-Containing
Interferon-Stimulated Response Element-Binding Complex
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
|
|
|---|
Interferon establishes an antiviral state in numerous cell types through the induction of a set of immediate-early response genes. Activation of these genes is mediated by phosphorylation of latent transcription factors of the STAT family. We found that infection of primary foreskin fibroblasts with human cytomegalovirus (HCMV) causes selective transcriptional activation of the alpha/beta-interferon-responsive ISG54 gene. However, no activation or nuclear translocation of STAT proteins was detected. Activation of ISG54 occurs independent of protein synthesis but is prevented by protein tyrosine kinase inhibitors. Further analysis revealed that HCMV infection induced the DNA binding of a novel complex, tentatively called cytomegalovirus-induced interferon-stimulated response element binding factor (CIF). CIF is composed, at least in part, of the recently identified interferon regulatory factor 3 (IRF3), but it does not contain the STAT1 and STAT2 proteins that participate in the formation of interferon-stimulated gene factor 3. IRF3, which has previously been shown to possess no intrinsic transcriptional activation potential, interacts with the transcriptional coactivator CREB binding protein, but not with p300, to form CIF. Activating interferon-stimulated genes without the need for prior synthesis of interferons might provide the host cell with a potential shortcut in the activation of its antiviral defense.
INTRODUCTION
|
|
|---|
Alpha interferon (IFN-
) and
IFN-
are unique among the continuously growing superfamily of
cytokines in their ability to confer resistance to viral infection
(20, 36). The synthesis of IFN-
and IFN-
is induced at
the transcriptional level after a cell encounters virus or
double-stranded RNA (dsRNA) (16, 46). The subsequent
secretion of the newly produced interferons and their binding to a
common cell surface receptor results in the induction of a set of
immediate-early response genes (12, 21, 24-26, 32, 44, 47).
The activation of these interferon-stimulated genes (ISGs) represents
the first step towards the development of an antiviral state. Control
over ISGs is exerted by an IFN-
/
-activated transcription factor
complex termed interferon-stimulated gene factor 3 (ISGF3), which binds
to a common enhancer element referred to as the interferon-stimulated
response element (ISRE) (10, 14, 23, 27, 43). ISGF3 is
formed through the interaction of the DNA binding subunit ISGF3
(p48) and the regulatory component ISGF3
(14, 28, 48),
which itself is composed of two members of the STAT (signal transducers
and activators of transcription) family of transcription factors, STAT1
and STAT2 (14, 15, 43). Both STAT proteins become tyrosine
phosphorylated in response to IFN-
/
stimulation, which enables
their nuclear translocation and DNA binding (8, 10, 13, 41).
Transcriptionally active STAT1 has been shown to be a requirement for
the antiviral and antiproliferative effects of IFN-
/
(5, 11,
31). The phosphorylation of STAT1 and STAT2 is mediated through
the action of two related tyrosine kinases, Jak1 and Tyk2, which are
enzymatically activated in response to IFN-
/
stimulation
(35, 49).
Human cytomegalovirus (HCMV), a member of the betaherpesvirus family,
is a prevalent pathogen which not only poses a major health threat to
immunocompromised individuals but also accounts for the majority of
virus-mediated birth defects (34). Previously, it was shown
that several human viruses can inhibit the interferon-mediated activation of cellular genes that participate in the antiviral defense
(1, 7, 17, 18, 42). During adenovirus infection, it appears
that the protein encoded by the E1A gene interferes with the
DNA-binding ability of ISGF3, resulting in the transcriptional suppression of the cellular ISGs (17, 18, 42). Since HCMV is
able to complement the growth of an adenovirus E1A mutant
(45), we were interested in determining whether HCMV
infection could also alter the expression of the IFN-
/
-regulated
immediate-early response genes. Surprisingly, we found that HCMV
infection per se resulted in a robust transcriptional activation of the
ISRE-controlled ISG54 gene and that this activation occurred in the
absence of de novo protein synthesis. Furthermore, we identified a
novel HCMV-induced putative transcription factor complex. Biochemical characterization suggests that it is composed of a recently described new member of the interferon regulatory factor (IRF) family and the
transcriptional coactivator CREB binding protein (CBP).
MATERIALS AND METHODS
|
|
|---|
Cells and viruses.
Human foreskin fibroblasts (HFFs) were
maintained in Dulbecco modified Eagle medium (Irvine Scientific)
supplemented with 10% fetal bovine serum (FBS), penicillin, and
streptomycin (Irvine Scientific). HCMV Towne was obtained from the
American Type Culture Collection, propagated as previously described,
and stored at
80°C in Eagle minimal essential medium with 1%
dimethyl sulfoxide and 10% FBS. HCMV infections were performed at a
multiplicity of infection (MOI) of 5 PFU per cell. Mock infections were
performed with media conditioned on actively growing cells for 2 days.
Conditioned media were adjusted to 1% dimethyl sulfoxide and stored at
80°C until use.
Reagents. Cycloheximide (CHX), genistein, and staurosporine were obtained from Sigma Chemical Co. and were used at 30 µg/ml, 100 µg/ml, and 50 ng/ml, respectively. The immunogen used to generate the anti-IRF3 antibody was human IRF3 amino acids 107 to 208 fused to glutathione S-transferase (pGEX2T; Pharmacia).
Whole-cell extracts.
HFFs were infected, mock infected, or
stimulated as described above. At different times postinfection or
poststimulation, the cells were scraped, pelleted, washed once with
phosphate-buffered saline (PBS), and subsequently lysed on ice for 10 min in lysis buffer containing 20 mM HEPES (pH 7.4), 100 mM NaCl, 50 mM
NaF, 10 mM
-glycerophosphate, 1 mM vanadate, 1% Triton
X-100, and 1 mM phenylmethylsulfonyl fluoride. Lysates were vortexed
and centrifuged at 15,000 × g for 10 min at 4°C.
Protein concentration was measured by the Bio-Rad protein assay.
Selected extracts were treated with 3 mM N-ethylmaleimide
(NEM) for 20 min at room temperature and then quenched with 20 mM
dithiothreitol on ice for 10 min.
Immunoprecipitation and immunoblotting. Cellular extracts were subjected to immunoprecipitation with an antibody against the C terminus of Stat1 for 2 h prior to the addition of protein G-Sepharose beads (Pharmacia Biotech, Inc.) and incubation for an additional hour. The beads were pelleted at 15,000 × g for 2 min and washed three times with ice-cold lysis buffer (1 ml). Immunoprecipitates were boiled in sodium dodecyl sulfate sample buffer and resolved by sodium dodecyl sulfate-7.5% polyacrylamide gel electrophoresis. After transfer to Immobilon (Millipore), the blots were probed with a monoclonal antibody against Stat1 (Transduction Laboratories) and anti-phosphoStat1 antibodies (New England Biolabs). Reactive proteins were detected with horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence (Amersham).
RNase protection assay analysis. HFFs were cultured and infected as described above. Total RNA was isolated with TRIzol Reagent (Gibco BRL). 32P-labeled antisense riboprobes were generated by transcription of the linearized plasmid in vitro by using T7 or SP6 RNA polymerase (Promega). Labeled riboprobe and 10 µg of RNA were incubated in hybridization buffer {4:1 formamide and 5× stock; 5× stock was 200 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid); pH 6.4], 2 M NaCl, 5 mM EDTA} overnight at 56°C before digestion with T1 RNase (Gibco BRL) for 1 h at 37°C. After phenol extraction and ethanol precipitation, protected fragments were solubilized in RNA loading buffer (98% formamide, 10 mM EDTA [pH 8], bromophenol blue [1 mg/ml], xylene cyanol [1 mg/ml]), boiled for 2 min, and subjected to electrophoresis on a 4.5% polyacrylamide-urea gel.
In vitro transcription-translation reactions.
ISGF3
,
IRF1, and IRF2 were in vitro translated with rabbit reticulocyte lysate
(Promega) according to the manufacturer's instructions.
Immunofluorescence.
HFFs were seeded onto glass coverslips
in 6-well plates and incubated overnight at 37°C under 5%
CO2 in Dulbecco modified Eagle medium supplemented with
10% FBS. The cells were then treated with medium alone or 1,000 U of
IFN-
per ml for 30 min or else infected with HCMV for 6 h.
After treatment, cells were rinsed once with PBS and once with 1× PB
(100 mM PIPES [pH 6.8], 2 mM MgCl2, 2 mM EGTA). Cells
were fixed in methanol for 6 min at room temperature. Nuclei were
permeabilized by incubating with 0.5% Nonidet P-40-PB for 10 min at
room temperature. After one rinsing with PBS, the fixed cells were
blocked in 10% goat serum in PBS for 35 min at room temperature. After
blocking, the cells were incubated for 50 min at room temperature with
an anti-Stat1 antibody (Transduction Laboratories). Cells were rinsed
four times for 5 min in PBS, incubated with a goat anti-mouse
Cy3-conjugated secondary antiserum for 40 min at room temperature, and
mounted after rinsing on glass slides with 50% glycerol-PBS.
EMSAs.
Electrophoretic mobility shift assays (EMSAs) were
performed with a 32P-end-labeled probe corresponding
to the ISRE of the ISG15
promoter (5' GATCCATGCCTCGGGAAAGGGAAACCGAAACTGAAGCC 3'). Equal
amounts of protein were incubated with poly(dI-dC) and labeled
oligonucleotides in ISRE binding buffer (40 mM KCl, 20 mM HEPES [pH
7.0], 1 mM MgCl2, 0.1 mM EGTA, 0.5 mM dithiothreitol, 4%
Ficoll, 0.02% Nonidet P-40). Extracts incubated with the ISRE probe
were in some instances supplemented with in vitro-translated ISGF3
(Promega). Electrophoresis was performed by 6% nondenaturing TBE
polyacrylamide gel electrophoresis, and the gels were dried and
subjected to autoradiography. For competition experiments, unlabeled
oligonucleotides were added to the reaction mixture prior to the
addition of the labeled oligonucleotides. The oligonucleotide used as a
competitor corresponded to either the ISG15-ISRE or the IFN-
response region (GRR) sequence in the promoter of the high-affinity
Fc
RI receptor (5' AATTAGCATGTTTCAAGGATTTGAGATGTATTTCCCAGAAAAG 3'). For supershift experiments, whole-cell extracts were
incubated on ice with the specified antiserum for 1 h at 4°C
prior to the addition of the labeled oligonucleotide.
RESULTS
|
|
|---|
HCMV infection activates transcription of the IFN-
/
-regulated
ISG54 gene in the absence of protein synthesis.
Activation of
IFN-
/
-induced immediate-early response genes carrying the ISRE
enhancer sequence requires the assembly of the ISGF3 transcription
factor complex. Interference with the DNA binding capability of ISGF3
by the adenoviral E1A gene product prevents the transcriptional
induction of cellular ISGs. Since HCMV is able to complement an
adenovirus E1A mutant in this respect, we proceeded to determine
whether infection with HCMV would result in a similar pattern of
transcriptional suppression. HFFs were either treated with 1,000 U of
IFN-
per ml or infected with HCMV Towne at an MOI of 5 PFU per cell,
and total cellular RNA was then isolated at 2, 4, and 8 h after
infection. We then performed RNase protection assays with a probe
corresponding to the human ISG54 gene. Surprisingly, infection of the
cells with HCMV was sufficient to induce a significant activation of
the ISG54 gene (Fig. 1A, lanes 7 to 9).
In order to investigate whether the induction of ISG54 by HCMV occurred
in the absence of protein synthesis as suggested by the rapid kinetics
of the transcriptional activation, we repeated the experiments in the
presence of the translation inhibitor CHX.
|
in the presence of CHX (data not shown).
To determine if the observed transcriptional activation after HCMV
infection is restricted to the ISG54 gene or if other ISRE-containing
genes are affected, we proceeded with the analysis of additional
IFN-
/
-regulated immediate-early response genes such as the 9-27 (Fig. 1C, lanes 4 to 6), ISG15 (lanes 7 to 9), and GBP (lanes 10 to 12)
genes. Unexpectedly, other than ISG54, HCMV infection failed to
significantly activate the ISGs analyzed (Fig. 1C, lanes 5, 8, and 11).
Effects of protein kinase inhibitors on HCMV-mediated gene
expression.
Since IFN-
/
-mediated gene expression requires
the activity of tyrosine and serine-threonine kinases (13,
50), we wanted to determine whether the same was true for
HCMV-induced activation of ISG54. Cells were preincubated with the
kinase inhibitor staurosporine (Fig. 2A,
lane 3) and the tyrosine-specific kinase inhibitor genistein (lane 2)
for 30 min prior to infection with HCMV. Whereas genistein pretreatment
resulted in an 82% inhibition of ISG54 expression, the effects of
staurosporine were less significant (13% inhibition), indicating that
protein tyrosine phosphorylation is an essential step in HCMV-induced
gene transcription. In addition, we tested the PKR-specific inhibitor
2-aminopurine since this kinase is known to catalyze virus
infection-dependent protein phosphorylation. Induction of ISG54 was
unaffected by 2-aminopurine (Fig. 2A, lane 4).
|
HCMV infection initiates the assembly of a novel ISRE binding
complex.
The ISRE enhancer element has been shown to be necessary
and sufficient for the transcriptional activation of the ISGs (38, 39). To determine if HCMV causes the protein
synthesis-independent formation of ISGF3 or another DNA binding
complex, we performed EMSAs with the ISG15 and the ISG54 ISREs as
probes. In contrast to IFN-
(Fig. 3A, lanes 6 to 9), HCMV infection
did not initiate the assembly of STAT1, STAT2, and p48 into the ISGF3
complex. However, it did lead to the protein synthesis-independent
appearance of an HCMV-inducible ISRE binding factor of distinct
mobility, which we termed cytomegalovirus-induced ISRE-binding factor
(CIF; Fig. 3A, lanes 2 to 5). These
results suggest that CIF preexists in a latent, inactive form in the
cell and is activated by a virus-induced, posttranslational
modification. To verify that the ISRE binding of CIF occurred in a
sequence-specific manner, we performed competition analysis with
unlabeled oligonucleotides corresponding either to the ISRE or to the
GRR, a distinct STAT1-binding sequence located in the promoter of the
high-affinity Fc
RI receptor. As shown in Fig. 3B, unlabeled ISRE at
a 10-fold molar excess competed appropriately for CIF binding (lanes 7 and 8), whereas the addition of an up to 200-fold molar excess of GRR
as a competitor DNA had no effect (lanes 9 to 11). Although ISG54 was
induced to a much greater extent than the ISG15 gene, we were unable to
detect by EMSA any significant differences in the binding
characteristics of CIF to the two ISRE probes (data not shown). This
suggests that additional factors or subtle differences in the specific ISRE sequence contribute to the differences in transcriptional induction.
|
Role of STAT proteins in HCMV infection.
Activation of STAT
proteins by tyrosine phosphorylation causes their nuclear translocation
and facilitates DNA binding (23, 27). In order to
investigate whether HCMV could cause tyrosine phosphorylation of STAT1,
we performed immunoprecipitations followed by Western blot analysis
with an anti-phosphoSTAT1 antibody that specifically recognizes
STAT1 after its phosphorylation on Tyr701. STAT1 was
immunoprecipitated from whole-cell lysates derived from cells
that were either left untreated, stimulated with 1,000 U of IFN-
per
ml, or infected with HCMV at an MOI of 5 PFU per cell for the indicated
times. Although STAT1 was clearly tyrosine phosphorylated in response
to IFN-
(Fig. 4A, lanes 5 to 8), no such modification was observed after viral infection (lanes 9 to 12).
Loading of identical amounts of STAT1 protein was confirmed by
Western blotting with a monoclonal anti-STAT1 antibody. To explore the possibility that HCMV infection might initiate STAT1 translocation in the absence of tyrosine phosphorylation, we subjected HFF cells to immunohistochemical staining utilizing a monoclonal antibody against STAT1. Whereas IFN-
treatment resulted in a robust nuclear presence of STAT1 (Fig. 4B, center panel), no
translocation was observed during 6 h of HCMV infection (Fig. 4B,
right panel). Since it appeared feasible that STAT1 or STAT2 might
participate in the formation of CIF, even in an unphosphorylated form,
we also executed supershift experiments on CIF- and ISGF3-containing extracts with anti-STAT1 (Fig. 4C, left panel) and anti-STAT2 (right
panel) antibodies. As expected, both sera were able to supershift the
ISGF3 complex (Fig. 4C, lanes 6 and 12); however, CIF migration was not
affected (lanes 4 and 10). Taken together, these results
clearly demonstrate that the STAT proteins known to bind the ISRE do
not participate in the formation of CIF.
|
Comparison of CIF with the IRF family.
Several proteins in
addition to STAT1, STAT2, and p48 have been shown to bind to the ISRE
enhancer, where they function either as transcriptional activators or
suppressors. Among them are several members of the IRF family (2,
6, 19, 30, 33, 51, 52) and the interferon consensus sequence
binding protein ICSBP (22, 37). For some of the ISRE binding
proteins it has been reported that their DNA binding activity is
decreased by protein synthesis inhibition (e.g., VIBP)
(4). In contrast, CIF activation was found to be
enhanced in the presence of CHX (data not shown). This also suggests
that IRF1 and IRF2 are not involved in the formation of CIF since their
binding to the ISRE appears to be regulated through the abundance
of those proteins rather than through a posttranslational
modification. Another useful approach for distinguishing DNA binding
proteins is their sensitivity towards alkylation by NEM, which in many
cases eliminates protein-DNA interactions (9, 27).
Therefore, we subjected a CIF-containing extract as well as in
vitro-translated IRF1 or IRF2 to treatment with 3 mM NEM and analyzed
for ISRE binding by EMSA. As shown in Fig.
5A, NEM exposure resulted in a complete
loss of IRF1 and IRF2 binding to the ISRE (lanes 2 and 4, respectively), whereas CIF binding was not affected (lane 6). Since the
target of NEM in the ISGF3 complex is the DNA binding component
ISGF3
(p48), the addition of exogenous, in vitro-translated
ISGF3
to the NEM-treated ISGF3-containing extract
restored the binding of ISGF3 but did not alter the appearance of
CIF (data not shown).
|
DISCUSSION
|
|
|---|
IFN-
/
-mediated transcription of immediate-early
response genes is an integral part of the cellular defense
mechanism against viral infection. The concept of the interferon system
is based on the transcriptional induction of the interferon genes upon viral infection. This results in the production and the release of
newly synthesized IFN-
/
, which acts upon the neighboring cells or
in an autocrine manner to induce the expression of ISGs. Activation of
the Jak-STAT pathway is then required to establish an antiviral state
in response to IFN-
/
. Unfortunately, this process causes a
delayed response to the virus threat, since it requires the synthesis
of IFN-
/
in order to produce cellular defensive actions. However,
evidence exists for alternative pathways that regulate the
transcription of ISGs under the control of the ISRE enhancer in a more
timely fashion and independent of protein synthesis.
Previous reports have demonstrated that infection of cells with a mutant, E1A-deficient adenovirus can cause the activation of ISRE-containing genes. Wild-type adenovirus fails to induce ISG transcription because the E1A gene product interferes with the DNA binding of the ISGF3 transcription complex. Vesicular stomatitis virus infection of L929 cells also results in the formation of an ISRE binding complex referred to as VIBP. However, the formation of VIBP was prevented by inhibition of protein synthesis. Similar to virus infection, transfection of dsRNA is able to induce the binding of two distinct factors, DRAF1 and DRAF2, to the ISRE and to activate transcription of ISGs.
We describe the formation of a new ISRE binding factor, CIF, that
occurs after infection of primary human fibroblasts with wild-type
HCMV. CIF differs in a number of aspects from known ISRE binding
proteins in that activation of CIF is paralleled by the transcriptional
induction of ISG54, and both events are independent of protein
synthesis. In contrast, VIBP assembly requires protein synthesis. The
DRAF complexes display mobilities different from that of CIF in EMSAs.
Furthermore, dsRNA transfection results in activation of ISG15 and
ISG54 to comparable levels. On the other hand, CMV infection
causes predominantly the expression of ISG54, without the
upregulation of ISG15, 9-27, or GBP mRNA. Although we do not expect
that ISG54 is the only HCMV-induced ISRE-containing gene, the observed
specificity in gene expression is additional evidence that the
activation of ISG54 by HCMV is not due to an autocrine stimulation by
newly synthesized interferon, since IFN-
/
is able to activate all
of the genes tested. Since we found that CIF bound the ISG15-ISRE to
the same extent or better than the ISG54-ISRE, we believe that either
additional proteins or subtle differences in the ISRE sequence account
for the differences in transcriptional activation. It is notable in
this context that the IP10 gene, whose promoter contains an ISRE that
differs from the ISG54-ISRE in only two bases, is not significantly
induced in response to IFN-
/
(29).
In our efforts to classify the proteins that compose CIF, we identified
a recently described new member of the interferon regulatory factor
family, IRF3, of unknown cellular function, as a component of CIF.
Recombinant IRF1 and IRF2, which are of similar size and share a
significant degree of homology with IRF3, display a higher mobility in
EMSAs compared to CIF, suggesting that additional proteins contribute
to the assembly of CIF. IRF3, which in contrast to IRF1 lacks
transactivating potential, binds the ISRE sequence constitutively as a
recombinant protein (2). IRF3 was found to support
ISRE-dependent transcription in cotransfection and overexpression
experiments, but it fails to induce transcription by itself
(2). These facts suggested the possibility that IRF3 participates in the formation of a multicomponent transcription complex, perhaps functioning as a DNA binding component similar to the
role of ISGF3
in the assembly of the ISGF3 complex. Indeed, there
are striking similarities between CIF and ISGF3 in that both complexes
preexist in a latent form in the cell and are activated in the absence
of protein synthesis, and their formation is sensitive to the presence
of tyrosine kinase inhibitors but not of 2-aminopurine. Further
analysis of the ISRE binding complex revealed that the transcriptional
coactivator CBP participates in the formation of CIF, thereby
contributing to the generation of a complex that is capable of
initiating transcription.
In summary, our results show that HCMV infection results in the protein synthesis-independent activation of a novel cellular ISRE binding complex termed CIF. This putative transcription factor complex appears to selectively mediate the transcription of ISG54. Although we were able to establish IRF3 and CBP as components of CIF, the possibility that additional unidentified proteins might participate in CIF assembly remains. This hypothesis is supported by the fact that despite the abrogation of CIF formation by inhibition of tyrosine kinase activity, we were thus far unable to detect any tyrosine phosphorylation of either IRF3 or CBP. Since CIF is induced in the absence of protein synthesis, it is possible that the complex contains proteins which are part of the virion particle and are introduced into the cell upon viral entry. Alternatively, they may be cellular proteins that are activated upon viral contact or entry. Experiments are currently in progress to address this question.
Activating ISGs without the need for prior de novo synthesis of interferons might provide the host cell with a potential shortcut in the activation of its antiviral defense. Subsequent production and release of interferons by the host cell might be more beneficial to neighboring uninfected cells by protecting them from viral invasion. Alternatively, the restricted induction of ISG54 might be advantageous for the virus and its replication cycle. The ongoing further characterization of CIF will allow us to identify the underlying mechanism of CIF activation and its cellular function.
ACKNOWLEDGMENTS
|
|
|---|
We thank Andrew Larner and Keiko Ozata for their generous gifts of STAT1 and STAT2 and of the IRF1 and IRF2 antisera, respectively. We are also grateful to Robert Rickert for a critical reading of the manuscript. Antisera to CBP and p300 were generously provided by Pier Lorenzo Puri.
K.M. is a recipient of a fellowship from the Markey Foundation. This work was supported by NIH grants CA34729 (D.S.) and CA50773 (N.R.) and NIH training grant AI07384 (S.R.).
FOOTNOTES
* Corresponding author. Mailing address: University of California, San Diego, Department of Biology, Bonner Hall 3138, 9500 Gilman Dr., La Jolla, CA 92093-0322. Phone: (619) 822-1108. Fax: (619) 822-1106. E-mail: midavid{at}ucsd.edu.
REFERENCES
|
|
|---|
| 1. |
Ackrill, A. M.,
G. R. Foster,
C. D. Laxton,
D. M. Flavell,
G. R. Stark, and I. M. Kerr.
1991.
Inhibition of the cellular response to interferons by the products of the adenovirus type 5 E1A oncogene.
Nucleic Acids Res.
19:4387-4393 |
| 2. |
Au, W.-C.,
P. A. Moore,
W. Lowther,
Y.-T. Juang, and P. M. Pitha.
1995.
Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes.
Proc. Natl. Acad. Sci. USA
92:11657-11661 |
| 3. |
Bhattacharya, S.,
R. Eckner,
S. Grossman,
E. Oldread,
Z. Arany,
A. D'Andrea, and D. M. Livingston.
1996.
Cooperation of Stat2 and p300/CBP in signalling induced by interferon- .
Nature
383:344-347[Medline].
|
| 4. |
Bovelenta, C.,
J. Lou,
Y. Kanno,
B.-K. Park,
A. M. Thornton,
J. E. Colligan,
M. Schubert, and K. Ozato.
1995.
Vesicular stomatitis virus infection induces a nuclear DNA-binding factor specific for the interferon-stimulated response element.
J. Virol.
69:4173-4181 |
| 5. |
Bromberg, J.,
C. Horvath,
Z. Wen,
R. Schreiber, and J. Darnell.
1996.
Transcriptionally active Stat1 is required for the antiproliferative effects of both interferon and interferon .
Proc. Natl. Acad. Sci. USA
93:7673-7678 |
| 6. |
Cha, Y., and A. B. Deisseroth.
1994.
Human interferon regulatory factor 2 gene. Intron-exon organization and functional analysis of 5'-flanking region.
J. Biol. Chem.
269:5279-5287 |
| 7. |
Colamonici, O. R.,
P. Domanski,
S. M. Sweitzer,
A. Larner, and R. M. L. Buller.
1995.
Vaccinia virus B18R gene encodes a type 1 interferon-binding protein that blocks interferon transmembrane signaling.
J. Biol. Chem.
270:15974-15978 |
| 8. | David, M. 1995. Transcription factors in interferon signaling. Pharmacol. Ther. 65:149-161[Medline]. |
| 9. |
David, M., and A. C. Larner.
1992.
Activation of transcription factors by interferon alpha in a cell-free system.
Science
257:813-815 |
| 10. |
David, M.,
G. Romero,
Z. Y. Zhang,
J. E. Dixon, and A. C. Larner.
1993.
In vitro activation of the transcription factor ISGF3 by IFN involves a membrane-associated tyrosine phosphatase and kinase.
J. Biol. Chem.
268:6593-6599 |
| 11. | Durbin, J. E., R. Hackenmiller, M. C. Simon, and D. E. Levy. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443-450[Medline]. |
| 12. | Finbloom, D. S., and A. C. Larner. 1995. Induction of early response genes by interferons, interleukins, and growth factors by the tyrosine phosphorylation of latent transcription factors: implications for chronic inflammatory diseases. Arthritis Rheum. 38:877-889[Medline]. |
| 13. |
Fu, X.-Y.
1992.
A transcription factor with SH2 and SH3 domains is directly activated by an interferon- induced cytoplasmic protein tyrosine kinase(s).
Cell
70:323-335[Medline].
|
| 14. |
Fu, X.-Y.,
D. S. Kessler,
S. A. Veals,
D. E. Levy, and J. E. Darnell, Jr.
1990.
ISGF-3, the transcriptional activator induced by IFN- , consists of multiple interacting polypeptide chains.
Proc. Natl. Acad. Sci. USA
87:8555-8559 |
| 15. |
Fu, X.-Y.,
C. Schindler,
T. Improta,
R. Aebersold, and J. E. J. Darnell.
1992.
The proteins of ISGF-3, the interferon -induced transcriptional activator, define a gene family involved in signal transduction.
Proc. Natl. Acad. Sci. USA
89:7840-7843 |
| 16. |
Fujita, T.,
Y. Kimura,
M. Miyamoto,
E. L. Barsoumian, and T. Taniguchi.
1989.
Induction of endogenous IFN- and IFN- genes by a regulatory transcription factor.
Nature
337:270-272[Medline].
|
| 17. |
Gutch, M., and N. Reich.
1991.
Repression of the interferon signal transduction pathway by the adenovirus E1A oncogene.
Proc. Natl. Acad. Sci. USA
88:7913-7917 |
| 18. | Gutch, M., and N. C. Reich. 1991. Response of the interferon signal transduction pathway by the adenovirus E1A oncogene. Proc. Natl. Acad. Sci. USA 88:7913-7917. |
| 19. | Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, and T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729-739[Medline]. |
| 20. | Isaacs, A., and J. Lindenmann. 1957. Virus interference: the interferon. Proc. R. Soc. Lond. Ser. B 147:258-267[Medline]. |
| 21. |
Kalvakolanu, D. V. R., and G. C. Sen.
1993.
Differentiation-dependent activation of interferon-stimulated gene factors and transcription factor NF- B in mouse embryonal carcinoma cells.
Proc. Natl. Acad. Sci. USA
90:3167-3171 |
| 22. |
Kanno, Y.,
C. A. Kozak,
C. Schindler,
P. H. Driggers,
D. L. Ennist,
S. L. Gleason,
J. E. J. Darnell, and K. Ozato.
1993.
The genomic structure of the murine ICSBP gene reveals the presence of the gamma interferon-responsive element, to which an ISGF3 subunit (or similar) molecule binds.
Mol. Cell. Biol.
13:3951-3963 |
| 23. |
Kessler, D. S.,
S. A. Veals,
X.-Y. Fu, and D. S. Levy.
1990.
Interferon- regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator.
Genes Dev.
4:1753-1765 |
| 24. |
Khan, K. D.,
K. Shuai,
G. Lindwall,
S. E. Maher,
J. E. J. Darnell, and A. L. M. Bothwell.
1993.
Induction of the Ly-6A/E gene by interferon / and requires a DNA element to which a tyrosine-phosphorylated 91-kDa protein binds.
Proc. Natl. Acad. Sci. USA
90:6806-6810 |
| 25. |
Larner, A. C.,
A. Chaudhuri, and J. E. Darnell.
1986.
Transcriptional induction by interferon: new protein(s) determine the extent and length of the induction.
J. Biol. Chem.
261:453-459 |
| 26. |
Larner, A. C.,
G. Jonak,
Y.-S. E. Cheng,
B. Korant,
E. Knight, and J. E. Darnell.
1984.
Transcriptional induction of two genes in human cells by interferon.
Proc. Natl. Acad. Sci. USA
81:6733-6737 |
| 27. |
Levy, D. E.,
D. S. Kessler,
R. Pine, and J. E. Darnell, Jr.
1989.
Cytoplasmic activation of ISGF3, the positive regulator of interferon- -stimulated transcription, reconstituted in vitro.
Genes Dev.
3:1362-1371 |
| 28. |
Levy, D. E.,
D. J. Lew,
D. S. Kessler, and J. E. Darnell, Jr.
1990.
Synergistic interaction between interferon- and interferon- through induced synthesis of one subunit of the transcription factor ISGF3.
EMBO J.
9:1105-1111[Medline].
|
| 29. |
Luster, A. D.,
J. C. Unkeless, and J. V. Ravetch.
1985.
-Interferon transcriptionally regulates an early-response gene containing homology to platelet proteins.
Nature
315:672-676[Medline].
|
| 30. |
Matsuyama, T.,
A. Grossman, and H.-W. Mittruecker.
1995.
Molecular cloning of LSIRF, a lymphoid-specific member of the interferon regulatory factor family that binds the interferon-stimulated response element (ISRE).
Nucleic Acids Res.
23:2127-2136 |
| 31. | Meraz, M. A., J. M. White, K. C. F. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, K. Carver-Moore, R. N. DuBois, R. Clark, M. Aguet, and R. D. Schreiber. 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431-442[Medline]. |
| 32. |
Mirkovitch, J.,
T. Decker, and J. E. Darnell, Jr.
1992.
Interferon induction of gene transcription analyzed by in vivo footprinting.
Mol. Cell. Biol.
12:1-9 |
| 33. |
Miyamoto, M.,
T. Fujita,
Y. Kimura,
M. Maruyama,
H. Harada,
Y. Sudo,
T. Miyata, and T. Taniguchi.
1988.
Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN- gene regulatory elements.
Cell
54:903-913[Medline].
|
| 34. | Mocarski, E. S. 1996. Cytomegaloviruses and their replication, p. 2447-2492. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology. Raven Publishers, Philadelphia, Pa. |
| 35. |
Muller, M.,
J. Briscoe,
C. Laxton,
D. Guschin,
A. Ziemiecki,
O. Silvennoinen,
A. G. Harpur,
G. Barbieri,
B. A. Withuhn,
C. Schindler,
S. Pellegrini,
A. F. Wilks,
J. N. Ihle,
G. R. Stark, and I. M. Kerr.
1993.
The protein tyrosine kinase JAK1 complements defects in the interferon- / and - signal transduction.
Nature
366:129-135[Medline].
|
| 36. |
Muller, U.,
U. Steinhoff,
L. F. Reis,
S. Hemmi,
J. Pavlovic,
R. M. Zinkernagel, and M. Aguet.
1994.
Functional role of type I and type II interferons in antiviral defense.
Science
264:1918-1921 |
| 37. |
Nelson, N.,
M. S. Marks,
P. H. Driggers, and K. Ozato.
1993.
Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription.
Mol. Cell. Biol.
13:588-599 |
| 38. |
Pine, R., and J. E. Darnell, Jr.
1989.
In vivo evidence of interaction between interferon-stimulated gene factors and the interferon-stimulated response element.
Mol. Cell. Biol.
9:3533-3537 |
| 39. | Porter, A. C., Y. Chernajovsky, T. C. Dale, C. S. Gilbert, G. R. Stark, and I. M. Kerr. 1988. Interferon response element of the human 6-16 gene. EMBO J. 7:85-92[Medline]. |
| 40. | Puri, P. L., M. L. Avantaggiati, C. Balsano, N. Sang, A. Graessmann, A. Giordano, and M. Levrero. 1997. p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription. EMBO J. 16:369-383[Medline]. |
| 41. |
Qureshi, S. A.,
M. Salditt-Georgieff, and J. E. Darnell, Jr.
1995.
Tyrosine-phosphorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA in forming interferon-stimulated gene factor 3.
Proc. Natl. Acad. Sci. USA
92:3829-3833 |
| 42. | Reich, N., R. Pine, D. Levy, and J. E. Darnell. 1987. Transcription of interferon-stimulated genes is induced by adenovirus particles but is suppressed by E1A gene products. J. Virol. 62:114-119. |
| 43. |
Schindler, C.,
X.-Y. Fu,
T. Improta,
R. Aebersold, and J. E. Darnell, Jr.
1992.
Proteins of transcription factor ISGF-3: one gene encodes the 91- and 84-kDa ISGF-3 proteins that are activated by interferon .
Proc. Natl. Acad. Sci. USA
89:7836-7839 |
| 44. |
Staeheli, P.,
P. Danielson,
O. Haller, and J. G. Sutcliffe.
1986.
Transcriptional activation of the mouse Mx gene by type I interferon.
Mol. Cell. Biol.
6:4770-4774 |
| 45. | Tevethia, M. J., and D. J. Spector. 1984. Complementation of an adenovirus 5 immediate early mutant by human cytomegalovirus. Virology 137:428-431[Medline]. |
| 46. |
Thanos, D., and T. Maniatis.
1992.
The high mobility group protein HMG 1(Y) is required for NF- B-dependent virus induction of the human IFN- gene.
Cell
71:777-789[Medline].
|
| 47. |
Tomita, Y.,
K. Cantell, and T. Kuwata.
1982.
Effects of human interferon on cell growth, replication of virus and induction of 2'-5' oligoadenylate synthetase in three human lymphoblastoid cell lines and K562 cells.
Int. J. Cancer
30:161-165[Medline].
|
| 48. |
Veals, S. A.,
T. Santa Maria, and D. E. Levy.
1993.
Two domains of ISGF3 that mediate protein-DNA and protein-protein interactions during transcription factor assembly contribute to DNA-binding specificity.
Mol. Cell. Biol.
13:196-206 |
| 49. |
Velazquez, L.,
M. Fellous,
G. R. Stark, and S. Pellegrini.
1992.
A protein tyrosine kinase in the interferon / signaling pathway.
Cell
70:313-322[Medline].
|
| 50. | Wen, Z., Z. Zhong, and J. E. Darnell, Jr. 1995. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241-250[Medline]. |
| 51. |
Yamagata, T.,
J. Nishida,
T. Tanaka,
R. Sakai,
Y. Mitani,
M. Yoshida,
T. Taniguchi,
Y. Yazaki, and H. Hirai.
1996.
A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes.
Mol. Cell. Biol.
16:1283-1294 |
| 52. |
Yu-Lee, L.,
J. A. Hrachovy,
A. M. Stevens, and L. A. Schwarz.
1990.
Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T Cells.
Mol. Cell. Biol.
10:3087-3094 |
| 53. |
Zhang, J. J.,
U. Vinkemeier,
W. Gu,
D. Chakravarti,
K. Horvath, and J. Darnell.
1996.
Two contact regions between Stat1 and CBP/p300 in interferon signaling.
Proc. Natl. Acad. Sci. USA
93:15092-15096 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»