Previous Article | Next Article 
Mol Cell Biol, July 1998, p. 3880-3888, Vol. 18, No. 7
Département de Biochimie,
Université de Montréal, Montréal, Québec,
Canada H3C 3J7,1 and
Institute of
Parasitology, Macdonald Campus of McGill University,
Ste-Anne-de-Bellevue, Quebec, Canada H9X 3V92
Received 11 February 1998/Returned for modification 2 April
1998/Accepted 20 April 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Schistosome Satellite DNA Encodes Active
Hammerhead Ribozymes
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
 Top NextReferences
|
|---|
Using a computer program designed to search for RNA structural
motifs in sequence databases, we have found a hammerhead ribozyme domain encoded in the Sm
repetitive DNA of Schistosoma
mansoni. Transcripts of these repeats are expressed as long
multimeric precursor RNAs that cleave in vitro and in vivo into
unit-length fragments. This RNA domain is able to engage in both
cis and trans cleavage typical of the
hammerhead ribozyme. Further computer analysis of S. mansoni DNA identified a potential trans cleavage site in the gene coding for a synaptobrevin-like protein, and RNA
transcribed from this gene was efficiently cleaved by the Sm
ribozyme in vitro. Similar families of repeats containing the
hammerhead domain were found in the closely related Schistosoma haematobium and Schistosomatium douthitti species but
were not present in Schistosoma japonicum or
Heterobilharzia americana, suggesting that the hammerhead
domain was not acquired from a common schistosome ancestor.
INTRODUCTION
|
TopPreviousNextReferences
|
|---|
Schistosomes are a family of digenetic trematodes that parasitize many animal species; three members of this group, Schistosoma mansoni, Schistosoma haematobium, and Schistosoma japonicum, infect over 200 million people worldwide. These blood flukes possess a complex life cycle initiated by the release of eggs from a human host. Fluke eggs produce larvae, called miracidia, which infect snails, a secondary host. Snails in turn shed cercariae, another larval form, which are able to penetrate human skin, transform into schistosomula, and, after a complex migration and differentiation process, develop into sexual adults. Adults produce eggs to complete the cycle. Hopefully, the study of the genomic structure of these species could provide key information for the more effective control of these devastating parasites.
Most eukaryotic genomes contain families of interspersed repetitive DNA
called SINEs (37), the sequences of which are generally related to tRNAs or 7SL RNA (1, 3, 10, 41). Their repetitive nature is thought to be due to an amplification process involving reverse transcription of RNA transcripts which are subsequently integrated into host DNA (21, 40). The species S. mansoni contains a family of SINEs, the 335-bp Sm repeats,
which occur over 10,000 times in the haploid genome. Many copies of
this repeat are clustered on the W female chromosome, while others are
dispersed throughout the genome (38). In spite of this
ability to amplify themselves, no function has been ascribed to SINEs.
Transcripts of the highly conserved family of satellite DNAs (Sat2)
found in the newt do, however, possess a self-processing activity
typical of the hammerhead domain found in plant viroids and their
satellite RNAs (5, 7, 13, 39). Tandem arrays of the Sat2
repeats are dispersed throughout the genome of Notophthalmus viridescens and other newt species. Their transcripts have
tissue-specific 5' ends, suggesting that transcription and/or
self-cleavage are regulated in vivo (14). Although
suggestive, no cellular role has yet been assigned to these
self-cleaving transcripts (17). We show here that the Sm
repeats from S. mansoni and their counterparts in S. haematobium and Schistosomatium douthitti contain a
hammerhead catalytic domain having both cis and
trans cleavage properties. These observations raise the
possibility that the presence of self-cleaving domains in repetitive
DNA is more than coincidental.
MATERIALS AND METHODS
|
TopPreviousNextReferences
|
|---|
Searching the database for hammerhead ribozymes. The program RNAMOT was used to search for hammerhead ribozyme domains in GenBank, release April 1996 (23). The format of the descriptor used by the program to accomplish this task is illustrated in Fig. 1.
Organisms.
The Puerto Rican strain of S. mansoni
was obtained from the Institute of Parasitology of McGill University
and was maintained by being cycled through Biomphalaria
glabrata (Puerto Rican strain) and female, CD-1 outbred mice
(Charles River, St. Constant, Québec, Canada). S. mansoni adult worms were obtained by perfusion of mice infected 7 weeks previously with 150 cercariae (29). They were washed
in phosphate-buffered saline at pH 7.2, snap frozen in liquid nitrogen,
and stored at 
80°C. Schistosomula of S. mansoni were prepared by artificial transformation of cercariae
(29), washed in phosphate-buffered saline, pelleted by
centrifugation, snap frozen in liquid nitrogen, and stored at 80°C.
Identification and amplification of Sm repeats in different
organisms.
DNA was purified from S. mansoni, S. haematobium, S. japonicum, Schistosomatium
douthitti, and H. americana as follows. Frozen worms
were suspended in 5 mM Tris-HCl (pH 8)-100 mM EDTA-0.5% sodium
dodecyl sulfate (SDS). Proteinase K was added to a final concentration
of 50 µg/ml, and the mixture was incubated for 3 h at 60°C.
Worm lysates were then extracted once with phenol and then with
phenol-chloroform (1:1). DNA in the aqueous phase was obtained by
ethanol precipitation. To obtain DNA from B. glabrata, the
same procedure was used, but in this case, the frozen snails were first
ground in liquid nitrogen to destroy the shell. Sm repeats were
amplified from the above DNA preparations with two sets of primers.
Primers 1A and 1B (see Fig. 2A) are 5'CCCATCGCACAAGCAAGTGG3' and 5'CACTTAGTATTGTTTGTTTGAATC3', respectively. Primer
1C, used to amplify Schistosomatium douthitti satellite DNA,
is 5'TATAGGTTTTAGTGTCATTG3'. Primers 2A and 2B are
5'GACGCGCGTTTCGTCCTATT3' and 5'CTGGATTCCACTGCTATCCA3', respectively. PCRs were carried out with either Vent DNA
polymerase (New England Biolabs [NEB]) or Taq DNA
polymerase (Pharmacia) with the buffers supplied by the manufacturers.
PCR conditions were as follows: 50 pmol of the primers, 200 µM (each)
deoxynucleoside triphosphates (dNTPs), and 1 U of polymerase in 1×
Vent DNA polymerase or Taq DNA polymerase buffer. PCR cycles
were for 30 or 60 s at 94°C; 30 or 60 s at 45, 50, 55, or
60°C; and 30 or 60 s at 72°C. Amplified bands were cloned into
pBLUESCRIPT (Stratagene) and sequenced by existing procedures
(35).
In vitro transcription and cleavage kinetics.
Individual
clones were PCR amplified as described above with oligonucleotide 1B
and an oligonucleotide containing the sequence of the T7 RNA polymerase
promoter 5' to the sequence of oligonucleotide 1A,
5'TAATACGACTCACTATAGGCCCATCGCACAAGCAAGTGG3'. Transcription reactions with T7 RNA polymerase (NEB) were as described previously (28). The reaction mixtures contained 40 mM Tris-HCl (pH
8.0) at 37°C; 12 mM MgCl2; 5 mM dithiothreitol; 2 mM
spermidine- (HCl)3; 25 mM NaCl; 1 mM (each) ATP, CTP, and
GTP and 0.5 mM UTP; 10 µCi of [-32P]UTP (3,000 Ci/mmol); 1 µM DNA template; 40 U of RNasin (Pharmacia); and 100 U of
T7 RNA polymerase (NEB). Reaction mixtures were incubated for 2 to
4 h at 30 or 37°C. To determine the cleavage rate in cis, full-length transcripts from Sm or Sd templates
were gel purified, eluted, phenol extracted, and recovered by ethanol
precipitation. Cleavage reactions were carried out in 40 mM Tris-HCl
(pH 8.0)-10 mM MgCl2-1 µM RNA at the times and
temperatures indicated in the figures. Reactions were terminated by
adding an equal volume of 95% (vol/vol) formamide-0.1% xylene
cyanol-0.1% bromophenol blue-10 mM EDTA. Products were heated at
95°C for 1 min, analyzed by electrophoresis in 6% polyacrylamide-8
M urea gels, and quantified by densitometry of the corresponding
autoradiogram.
transcript was obtained after in vitro transcription and gel
purification as described previously. The synaptobrevin-like protein
RNA fragment was also obtained by in vitro transcription from the
cloned PCR fragment described above, after insertion into pBLUESCRIPT
and digestion with XbaI. The full-length products of both
the ribozyme and the substrate were gel purified and quantified by UV
spectroscopy. The rate of the trans reaction between the 5'
cleavage product of the cis reaction and the
synaptobrevin-like protein RNA was determined under single-turnover
conditions. Constant amounts of substrate (2 nM) were incubated with
increasing amounts of ribozyme (from 2- to 64-fold molar excess) for
4 h. Ribozyme and substrate were mixed in 40 mM Tris-HCl (pH
8.0)-10 mM MgCl2-1 mM EDTA, heated for 1 min at 95°C,
and cooled on ice. Reactions were started by adding 10 mM
MgCl2 and terminated by adding an equal volume of 95%
(vol/vol) formamide-0.1% xylene cyanol-0.1% bromophenol blue-10 mM
EDTA. The kcat/Km values
are derived from the equation ln F/t = kcat/Km, where
F is the fraction of uncleaved substrate at the end of the
reaction at time t.
RNA ligation-dependent PCR. A sample of 1 µg of in vitro-transcribed RNA was incubated in 1× polynucleotide kinase buffer (NEB)-1 mM ATP-10 U of polynucleotide kinase for 30 min at 37°C. The phosphorylated RNA was then ligated to the 14-mer oligoribonucleotide 5'ACGGUCUCACGAGC3', in 50 mM HEPES (pH 7.5)-10 mM MgCl2-1 mM ATP-20 mM dithiothreitol-1 µg of RNase-free bovine serum albumin-10% dimethyl sulfoxide-6 U of T4 RNA ligase (NEB) in a final volume of 20 µl. The reaction mixture was incubated overnight at 15°C, the reaction was stopped by heating at 65°C and the products were recovered by ethanol precipitation. Ligated RNA was reverse transcribed in 1× Vent DNA polymerase buffer (NEB) supplemented with 1 mM (each) dNTPs in a volume of 20 µl with 50 pmol of the primer 1B and 50 U of Moloney murine leukemia virus reverse transcriptase (NEB). The reaction was carried out for 2 h at 37°C. The resulting cDNA was then amplified by using primer 1B and the deoxyribonucleotide version of the oligoribonucleotide 14-mer used in the ligation reaction. PCRs were carried out in a final volume of 100 µl with 1 U of Vent DNA polymerase for 30 cycles at 94, 50, and 72°C. The PCR products were cloned and sequenced.
RNA purification, Northern blotting, RT-PCR, and primer extension. Total RNA was obtained by treatment of frozen worms previously powdered on dry ice with 4 M guanidinium isothiocyanate, followed by phenol chloroform extraction and ethanol precipitation. Then it was treated for 1 h with DNase I (Pharmacia), 1 U/µg of total RNA, in 40 mM Tris-HCl (pH 7.9)-6 mM MgCl2, at 37°C. For Northern blots, the RNA was fractionated on 1.4% formaldehyde-agarose gels and transferred to Hybond-N nylon membranes (Amersham) in 20× SSC (1× SSC is 0.15 M NaCl, 0.015 M sodium citrate [pH 7.0], and 0.1% SDS). Hybridization was performed by incubation of the membranes with 32P-labeled probes (T7 Quickprime; Pharmacia Biotech Inc.) at 65°C in 7% SDS-0.25 M Na2HPO4 (pH 7.4)-1% bovine serum albumin (Gibco). The membranes were washed twice at 65°C in 2× SSC for 10 min and once in 0.2× SSC for 30 min. For reverse transcriptase PCR (RT-PCR), 1 µg of total RNA was incubated at 30°C for 30 min with 50 pmol of primer 1B in 20 µl of 1× Vent DNA polymerase buffer (NEB) supplemented with 2 mM dNTPs. Then, 40 U of RNase-Guard (Pharmacia) and 54 U of Moloney murine leukemia virus reverse transcriptase was added and the reaction was continued for 1 h at 37°C. The cDNA was amplified by adding primers 1A and 1B (50 pmol of each), 2 U of Vent DNA polymerase, and 1× Vent DNA polymerase buffer to make 100 µl. The PCR was carried out for 30 cycles of 1 min each at 94, 55, and 72°C. The products were resolved by agarose gel electrophoresis. Primer extension with 10 µg of total RNA was under the conditions described elsewhere (35).
Nucleotide sequence accession number.
The nucleotide
sequences reported here have been assigned the following GenBank
accession numbers: for S. mansoni Sm, GenBank AF036739 to
AF036756; for S. haematobium Sh, GenBank AF036389 to
AF036398; and for Schistosomatium douthitti Sd, GenBank AF036399 to AF036404.
RESULTS
|
TopPreviousNextReferences
|
|---|
Identification and cloning of hammerhead-containing repeats from S. mansoni. We have searched the DNA sequence bank (GenBank, version April 1996) for putative hammerhead ribozyme domains with a search engine known as RNAMOT (23). This program screens sequences for potential secondary and tertiary structural elements to uncover cryptic RNA motifs undetected by primary sequence analysis. The descriptor used to search for the hammerhead ribozyme is shown in Fig. 1. The descriptor does not include the base-pairing requirements of helices I and III of the consensus hammerhead domain because we wanted to leave open the possibility of finding a domain that might act in trans; that is, the representation of the two helices as single stranded is equivalent to defining them as substrate recognition arms. This search not surprisingly found the known hammerhead domains in plant viroids and their satellite RNAs and in several newt species but unexpectedly found them among the satellite DNA sequences from the human blood fluke S. mansoni as well (accession no. SCMRSLA). The chance occurrence of this domain is one in 1013 nucleotides based on the descriptor used in the search. Moreover, immediately downstream of this domain is a region complementary to the substrate recognition arms, fitting the substrate requirements for this ribozyme.
|
|
.
Transcripts from the Sm family of satellite DNA self-cleave in
vitro.
Two of the cloned repeat sequences were chosen to
characterize the cleavage properties of the hammerhead domain: one
corresponded to a canonical hammerhead (Sm1 [Fig. 2B]) and the other
contained a G
C change at position 5 (Sm3). In vitro transcripts of
the two clones were prepared from the PCR-generated templates
containing a T7 promoter with T7 RNA polymerase. As demonstrated in
Fig. 3A, the repeat containing the
canonical hammerhead domain cleaved during transcription, while the
repeat containing the mutated hammerhead did not cleave.
|
C base substitution. In vitro transcription
was less efficient on the templates treated with restriction
endonucleases. Numbers at right indicate sizes in base pairs. (B)
Kinetics of self-cleavage at 30°C in 10 mM magnesium and at pH 8. Gel-purified full-length transcripts were incubated under the cleavage
conditions described in Materials and Methods, and the reaction was
stopped at the indicated time. The products were resolved on a 6%
acrylamide-8 M urea gel. Numbers at right indicate size in base pairs.
(C) The intensities of the bands in panel B were measured by
densitometry, normalized to the background of degradation, and graphed
on a semilog plot to calculate the rate of the reaction. S,
concentration of substrate at time t; So, initial substrate
concentration.
CUG at the 5' end of the
3' cleavage product. In addition, the 3' cleavage product could be
labeled with radioactive phosphate by T4 polynucleotide kinase in the
presence of [
-32P]ATP, indicating the presence of a 5'
hydroxyl group. Under the conditions used during in vitro
transcription, 58% of the transcripts were cleaved at 37°C and 37%
were cleaved at 30°C. Cleavage required Mg2+, the optimal
concentration of which was 10 mM at pH 8. The kinetics of cleavage,
shown in Fig. 3B and C, were determined at 30°C. The
kcat of self-cleavage was 0.30 ± 0.05 min
1. Transcripts of repeats 5, 7, 10, 12, and 20, which
also contain consensus hammerhead domains, have cleavage rates between
0.22 and 0.36 min1.
|
Sm repeats are expressed in vivo.
The presence and high
conservation of the RNA polymerase III promoter elements among
different repeats of the Sm family suggested that the repeat region
is transcribed in vivo; however, the absence of termination signals
raised the issue of the length of such transcription products. We
addressed these questions by the analysis of total cellular RNA by
Northern blotting, RT-PCR, and primer extension experiments. The
autoradiogram obtained from probing the Northern blot of total RNA from
both female and male adult schistosomes and schistosomulas with an Sm1
PCR fragment produced the band pattern shown in Fig. 4A. Since RNA
quantities are approximately equivalent in each lane, it would appear
that these developmental stages express the Sm repeats at virtually
the same level. Also, the size of the major band in all cases
corresponds to that of the unit repeat. Bands of greater length,
corresponding to multiples of unit-length Sm, are also present and
are more evident after overexposure of the autoradiogram. These data
suggest that the major band arises after hammerhead processing of long
multimeric transcripts. However, the preponderance of single-unit
lengths in light of the large number (approximately two-thirds) of
putatively inactive forms requires that cleavage take place at sites
which are in trans or at least distal to the catalytic
domain unless only the active repeats are transcribed.
repeats are expressed in both female and male
adult schistosomes. Sequences of these products were the expected
permutated versions of the sequences obtained from genomic DNA with
primers 1A and 1B.
The 5' end of Sm transcripts was also studied to determine whether
unit-length transcripts were generated by transcription alone or by
transcription followed by cleavage. Normally, the 5' terminus of the
RNA would contain the polymerase III promoter sequence; however, if the
terminus of the unit-length transcript is produced by cleavage of long
transcripts, then the 5'-terminal sequence should be the same as that
produced by in vitro cleavage. By using primer extension with primer
1B, the two possibilities can be distinguished by the lengths of the
extension products. The data presented in Fig. 4C confirm that the in
vivo product is identical to the in vitro product and, therefore,
results from hammerhead cleavage.
trans cleavage of transcripts from the Sm
family.
The high proportion of unit-length Sm transcripts
despite the preponderance of repeats containing inactive hammerhead
domains indicates that simple self-cleavage is not the only processing mechanism to which the Sm transcripts are subjected. Active ribozymes from distant sites would have to recognize and cleave a target sequence
from a repeat containing a disabled hammerhead in order to explain the
data shown in Fig. 4A. Active transcripts could first self-cleave and
then go on to cleave a repeat with an inactive ribozyme either in
cis or in trans (Fig.
5A). Note that, because of the polarity
of cleavage, a catalytic domain which had been involved in
self-cleavage could cleave only upstream in cis, whereas trans cleavage could be accomplished at any site. Consider
as well that trans cleavage implies the use of either the
I/II format of the hammerhead (8) or the more familiar I/III
format. In the I/II format, the catalytic domain would provide the
essential CUGACGA sequence and the target would provide the conserved
GAAA sequence and the cleavage site GUC (Fig. 5A).
|
family and is found in the only
known intron for this gene whose entire sequence is not yet available. Since there is no catalytic domain in this target region, it would be
provided presumably from a self-cleaved Sm transcript (Fig. 5A).
In order to demonstrate the feasibility of the trans
reaction, we cloned a 650-bp fragment of the synaptobrevin-like protein gene from S. mansoni by PCR and prepared substrate RNA from
it by in vitro transcription with T7 RNA polymerase. Figure 5B shows that the 650-ribonucleotide fragment was readily cleaved into fragments
of 419 and 231 nucleotides in the presence of cleavage products of the
Sm repeat. The 5' product of cleavage alone also produces these
bands (data not shown). The cleavage site was finely mapped by RNA
ligation-dependent PCR, which permitted sequencing of the entire 3'
cleavage product. This sequence corresponds to that expected from the
cleavage suggested in Fig. 5A. The cleavage rate of the
synaptobrevin-like protein RNA fragment was measured under
single-turnover conditions, where the ribozyme is in large excess over
the substrate so that the observed rate of cleavage is independent of
product release. The amount of cleaved substrate increased linearly
with ribozyme concentration (Fig. 5B and C), reaching 70 to 85% after
4 h of incubation with a 64-fold molar excess of the ribozyme. The
catalytic efficiency of this hammerhead reaction is
kcat/Km = 500 M1 s1, which is comparable to the
efficiency (10 to 500 M1 s1) of
artificially engineered hammerhead ribozymes against substrates of
similar length (18).
The distribution of hammerhead-containing satellite DNA in the Schistosomatidae family. Schistosomes have adult forms in different vertebrates and larval stages in various molluscan hosts. The species that parasitize humans have been classically grouped with respect to egg morphology and snail host type into African (S. mansoni and S. haematobium) and Asian (S. japonicum) schistosomes, while the American species, Schistosomatium douthitti and H. americana, parasitize small mammals. The phylogeny of rRNA sequences confirms this morphogeographic classification separating African, American, and Asian species (2).
The presence of satellite DNA coding for the self-cleaving repeats in the human parasite S. mansoni suggested that the distribution of the Sm family among the Schistosomatidae as a
function of host type could be of interest. This idea led to the PCR
amplification of DNA from the schistosomes listed in Table
1 with two sets of primers: 1A and 1B and
2A and 2B (Fig. 2A). The latter set was useful because of its
specificity for the hammerhead ribozyme domain. Results of these PCR
amplifications are presented in Table 1. In agreement with the previous
phylogenies, Sm repeats were readily amplified with both sets of
primers in S. haematobium but not in S. japonicum
or H. americana. In addition, the hammerhead-specific primers allowed the amplification of a family of repeats from Schistosomatium douthitti. Amplification of DNA from
B. glabrata, the intermediate molluscan host of S. mansoni, as a control was negative.
|
repeats (named in the same manner as the Sm
repeats in S. mansoni) were 92% identical to the Sm
family and had a similar three-domain organization including the
polymerase III promoter region and the hammerhead domain; however,
unusual variations were found in the hammerhead domain (Fig.
6A). Most of the clones contained a
three-A insertion immediately after the putative self-cleavage site,
like the Sm repeats Sm4, Sm14, and Sm18 presented in Fig. 2B. In
contrast to the Sm repeats, for which most sequence variations were
found in the conserved hammerhead core, all Sh sequences had an
intact hammerhead ribozyme core; variations were often found in the
adjacent helices.
|
repeats. Comparison
of these sequences with those of S. mansoni showed a number
of differences which were localized in the region where primer 1B
should bind, thereby explaining why this primer in conjunction with
primer 1A did not produce the corresponding band. This new sequence,
however, was then used to design a new primer, 1C, which allowed
amplification of the satellite DNA from Schistosomatium douthitti without predetermination of the hammerhead sequence by
the primers. Sequencing of the 340-bp amplification product revealed a
novel hammerhead motif shown in Fig. 6B. Instead of the ubiquitous
GUC triplet 5' to the cleavage site, Sd repeats possess an AUC
triplet. Also, nucleotide substitutions that potentially disrupt the
core of the hammerhead ribozyme were found in two of six sequenced
clones. The rate of self-cleavage for the active Sd transcripts was
0.02 min1, around 10 times lower than the rate calculated
for the self-cleaving transcripts from S. mansoni.
DISCUSSION
|
TopPreviousNextReferences
|
|---|
Comparison of hammerhead domains from repetitive DNAs.
The
occurrence of the hammerhead domain in the Sm family of repeated
sequences of S. mansoni superficially resembles the case of
a hammerhead domain in the Sat2 repeats from the newt (17).
Both contain adjacent GC base pairs and a loop in helix 1, which are
required for activity in the newt (14, 31). In addition,
other characteristics of the newt hammerhead are found in that of the
schistosome, such as the spacing between the internal loop in helix I
and the cleavage site as well as the identity of several nucleotides in
the external loop and the distal portion of helix II (43).
Nevertheless, the two occurrences of the hammerhead domain are likely
unrelated based on the facts that (i) there is little overall sequence
similarity between the satellite DNAs from the two species, (ii)
repeats in the newt are transcribed by RNA polymerase II with small
nuclear RNA promoter elements (9) while in schistosomes
polymerase III promoter elements seems to be implicated, and (iii)
kinetic analysis of the hammerhead domain from schistosomes
demonstrates its greater catalytic activity compared to that from the
newt. Comparison of the secondary structure models for both domains
shows that stem III in schistosomes could be more stable, because it
contains 3 bp compared with 2 in the newt. Also, the two organisms,
newts and schistosomes, are unrelated in terms of their phylogenetic
position. We conclude that the hammerhead-containing satellite DNAs in
these two species are not evolutionarily related. However, if ribozyme
domains are present in many more repetitive sequences than is currently
known, then the occurrence of the hammerhead domain in repetitive DNA
may not be completely coincidental.
site, with two exemptions: GUA in the lucerne transient
streak virus (15) and AUA in the satellite RNA from barley yellow dwarf virus (27). Thus, the AUC site found
in Schistosomatium douthitti is unique and its presence
contrasts with data from previous reports indicating that this site was not suitable for cleavage in the I/III trans format
(32). Surprisingly, AUC does seem to be a good cleavage
site in the I/II trans format (34), which could
be the format for the S. mansoni hammerhead (see below).
Functional implications of trans-acting self-cleaving
transcripts.
The apparent lack of function for repeated sequences
has given rise to the selfish DNA hypothesis to rationalize their
existence and propagation. According to this model, repeated sequences
are not useful to the host but are maintained because they have
discovered sequence-specific replication and amplification strategies.
Elimination of these sequences would thus require improbable multiple
deletion events (11, 30). On the other hand, some repeated
sequences contain motifs for transcriptional regulation (20,
33) and some regions of human Alu repeats are
immutable, suggesting a role for these repeats in the evolution of
primates (6). Copies of repetitive DNA, like the
Alu family, are thought to arise via an
endonuclease-dependent integration of reverse transcripts into genomic
DNA (4). In some repeats of S. mansoni and most
repeats of S. haematobium, the presence of three adenines
after the cleavage site also suggests a retrotranscription origin,
since these adenines could be derived from the polyadenylation of the
cleaved transcript. We have formulated a model for Sm dispersion in
schistosomes (Fig. 7). Transcription of
tandem repeats would yield long multimeric transcripts which
self-process. Reverse transcription of the processed transcripts
permits dispersion of the unit to other sites in the genome. However,
incorporation of the processed transcripts at isolated sites is a dead
end for expansion, because polymerase III promoter elements are located
at the 3' end of the processed transcripts. There would be no such
barrier to propagation of multimeric transcripts. This scenario
provides schistosomes with a method of limiting the copy number of
repetitive DNA. In the newt, a similar function is suggested by the
fact that monomeric transcripts are found predominantly in the ovaries
while transcripts in somatic tissues are mostly dimers and larger
multimers (14). In this case, cycles of self-amplification
would be limited in the germ line. Interestingly, when the Sm
repeats were first cloned, Spotila et al. noticed that some members of
the family lost the tRNA homology region as predicted in our model
(38). They suggested that transcripts from the repeats
underwent a processing reaction before reinsertion into the genome.
|
repeats,
might have originated from retrotransposition of a Sm fragment. It
is of note that several human genes (5% of cDNAs in the GenBank) also
contain a segment of an Alu sequence, in their 5' or 3'
noncoding regions or their coding region (26, 42). A role in
RNA processing in newts has also been advanced because the
hammerhead-containing transcripts were found in 12S riboprotein
particles (25).
Sex chromosome-specific, Sm-related sequences have been isolated in
schistosomes by representational difference analysis (12).
One of the isolated clones (OZ.A) codes for a female-specific retroposon (accession no. SMU12442). This retroposon is 76% identical to members of the Sm family and therefore could be considered another target of the trans reaction. We have found that the
OZ.A retroposon also has sequence similarity with the
microcopia element dhMiF2 of Drosophila hydei. An
interesting parallel between the Drosophila microcopia
retrotransposon and the Sm family is that both are enriched in the
heterogametic sexual chromosome (the male chromosome in the fruit fly).
microcopia encodes a testis-specific antisense RNA
complementary to the sequence of its own reverse transcriptase gene
(24). This antisense RNA could be involved in controlling
the germ line expression of transposon-encoded proteins much as the
trans-acting ribozymes in schistosomes could control
propagation of repetitive sequences and transposable elements.
The phylogenesis of self-cleaving repeats in schistosomes. The distribution of hammerhead-containing repeats in members of the Schistosomatidae is limited and does not resemble the distribution produced via a common ancestor. Horizontal transmission between organisms in the same host, however, may be possible. In the laboratory, cross-mating can readily be accomplished between S. haematobium and S. mansoni when they share a hamster host (22). These two species also coparasitize their human hosts in Africa. In a locality of Bahia, Brazil, 47% of wild rodents are infected with S. mansoni (36), a favorable situation for interspecies crosses between S. mansoni and rodent schistosomes like Schistosomatium douthitti.
Concluding remarks. The function of genes is usually predicted by first translating open reading frames in the DNA and then using the predicted protein sequence to find homologs in the protein database. This paradigm dominates the field of functional genomics emerging from genome sequencing efforts. One of the shortcomings of this strategy is that the functionality of RNA sequences is completely ignored. The fact that RNAs likely anteceded proteins in biological evolution (16) suggests that searching databases for RNA domains could provide novel insights into the biology of organisms. The unexpected finding of an active hammerhead domain in schistosome repetitive DNA reported here testifies to the potential of the genomic study of RNA, that is, ribonomics. Perhaps when a more detailed knowledge of functional RNA motifs and domains has been achieved, a wide variety of functions may be found encoded in what previously had been considered junk DNA.
ACKNOWLEDGMENTS
|
TopPreviousNextReferences
|
|---|
We thank Véronique Bourdeau, who made the RNAMOT searches, and the members of the sequencing unit of the Organelle Megasequencing Program (OGMP), especially Y. Zhu; Gary O'Neal of Merck Sharpe for providing DNA from S. mansoni; and Scott Snyder for providing specimens of Schistosomatium douthitti and H. americana.
R. Cedergren is Richard Ivey Fellow of the Canadian Institute of Advanced Research. This work was supported by a grant from the Medical Research Council of Canada.
FOOTNOTES
* Corresponding author. Mailing address: Département de Biochimie, Université de Montréal, C. P. 6128, succursale Centre-Ville, Montréal, Québec, Canada H3C 3J7. Phone: (514) 343-6320. Fax: (514) 343-2210. E-mail: ceder{at}poste.umontreal.ca.
Present address: Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY 11724.
REFERENCES
|
TopPrevious |
|---|
| 1. |
Balmain, A.,
R. Krumlauf,
J. K. Vass, and G. D. Birnie.
1982.
Cloning and characterization of the abundant cytoplasmic 7S RNA from mouse cells.
Nucleic Acids Res.
10:4259-4277 |
| 2. | Barker, S. C., and D. Blair. 1996. Molecular phylogeny of Schistosoma species supports traditional groupings within the genus. J. Parasitol. 82:292-298[Medline]. |
| 3. |
Benslimane, A. A.,
M. Dron,
C. Hartmann, and A. A. Rode.
1986.
Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.
Nucleic Acids Res.
14:8111-8119 |
| 4. |
Boeke, J. D.
1997.
LINEs and Alus the poly A connection.
Nat. Genet.
16:6-7[Medline].
|
| 5. | Bratty, J., P. Chartrand, G. Ferbeyre, and R. Cedergren. 1993. The hammerhead RNA domain, a model ribozyme. Biochim. Biophys. Acta 1216:345-359[Medline]. |
| 6. |
Britten, R. J.
1994.
Evolutionary selection against change in many Alu repeat sequences interspersed through primate genomes.
Proc. Natl. Acad. Sci. USA
91:5992-5996 |
| 7. | Bruening, G. 1989. Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods Enzymol. 180:546-558[Medline]. |
| 8. | Clouet-d'Orval, B., and O. C. Uhlenbeck. 1996. Kinetic characterization of two I/II format hammerhead ribozymes. RNA 2:483-491[Abstract]. |
| 9. |
Coats, S. R.,
Y. Zhang, and L. M. Epstein.
1994.
Transcription of satellite 2 DNA from the newt is driven by a snRNA type of promoter.
Nucleic Acids Res.
22:4697-4704 |
| 10. | Daniels, G. R., and P. L. Deininger. 1985. Repeat sequence families derived from mammalian tRNA genes. Nature 317:819-822[Medline]. |
| 11. | Doolittle, W. F., and C. Sapienza. 1980. Selfish genes, the phenotype paradigm and genome evolution. Nature 284:601-603[Medline]. |
| 12. | Drew, A. C., and P. J. Brindley. 1995. Female-specific sequences isolated from Schistosoma mansoni by representational difference analysis. Mol. Biochem. Parasitol. 71:173-181[Medline]. |
| 13. | Epstein, L., and J. G. Gall. 1987. Self-cleaving transcripts of satellite DNA from the newt. Cell 48:535-543[Medline]. |
| 14. |
Epstein, L. M.,
K. A. Mahon, and J. G. Gall.
1986.
Transcription of a satellite DNA in the newt.
J. Cell Biol.
103:1137-1144 |
| 15. | Foster, A. C., and R. H. Symons. 1987. Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell 49:211-220[Medline]. |
| 16. | Gilbert, W. 1986. The RNA world. Nature 319:618. |
| 17. | Green, B., L. M. Pabon-Peña, T. A. Graham, S. E. Peach, S. R. Coats, and L. M. Epstein. 1993. Conserved sequence and functional domains in satellite 2 from three families of salamanders. Mol. Biol. Evol. 10:732-750[Abstract]. |
| 18. |
Heidenreich, O., and F. Eckstein.
1992.
Hammerhead ribozyme-mediated cleavage of the long terminal repeat RNA of human immunodeficiency virus type 1.
J. Biol. Chem.
267:1904-1909 |
| 19. |
Hertel, K. J.,
A. Pardi,
O. C. Uhlenbeck,
M. Koizumi,
E. Ohtsuka,
S. Uesugi,
R. Cedergren,
F. Eckstein,
W. L. Gerlach,
R. Hodgson, and R. H. Symons.
1992.
Numbering system for the hammerhead.
Nucleic Acids Res.
20:3252 |
| 20. |
Hewitt, S. M.,
G. C. Fraizer, and G. F. Saunders.
1995.
Transcriptional silencer of the Wilms' tumor gene WT1 contains an Alu repeat.
J. Biol. Chem.
270:17908-17912 |
| 21. | Jagadeeswaran, P., B. G. Forget, and S. M. Weissman. 1981. Short interspersed repetitive DNA elements in eukaryotes: transposable DNA elements generated by reverse transcription of RNA pol III transcripts? Cell 26:141-142[Medline]. |
| 22. | Khalil, S. B., and N. S. Mansour. 1995. Worm development in hamsters infected with unisex and cross-mated Schistosoma mansoni and Schistosoma haematobium. J. Parasitol. 81:8-11[Medline]. |
| 23. |
Laferrière, A.,
D. Gautheret, and R. Cedergren.
1994.
An RNA pattern matching program with enhanced performance and portability.
Comput. Appl. Biosci.
10:211-212 |
| 24. |
Lankenau, S.,
V. G. Corces, and D. H. Lankenau.
1994.
The Drosophila micropia retrotransposon encodes a testis-specific antisense RNA complementary to reverse transcriptase.
Mol. Cell. Biol.
14:1764-1775 |
| 25. |
Luzi, E.,
F. Eckstein, and G. Barsacchi.
1997.
The newt ribozyme is part of a riboprotein complex.
Proc. Natl. Acad. Sci. USA
94:9711-9716 |
| 26. | Makalowski, W., G. A. Mitchell, and M. Labuda. 1994. Alu sequences in the coding region of mRNA: a source of protein variability. Trends Genet. 10:188-193[Medline]. |
| 27. | Miller, W. A., T. Hercus, P. M. Waterhouse, and W. L. Gerlach. 1991. A satellite RNA of barley yellow dwarf virus contains a novel hammerhead structure in the self-cleavage domain. Virology 183:711-720[Medline]. |
| 28. |
Milligan, J. F.,
D. R. Groebe,
G. W. Witherell, and O. C. Uhlenbeck.
1987.
Oligoribonucleotide synthesis using T7 RNA polymerase and DNA templates.
Nucleic Acids Res.
15:8783-8798 |
| 29. | Mkoji, G. M., J. M. Smith, and R. K. Prichard. 1988. Antioxidant systems in Schistosoma mansoni: correlation between susceptibility to oxidant killing and the levels of scavengers of hydrogen peroxide and oxygen free radicals. Int. J. Parasitol. 18:661-668[Medline]. |
| 30. | Orgel, L. E., and F. H. C. Crick. 1980. Selfish DNA: the ultimate parasite. Nature 284:604-607[Medline]. |
| 31. |
Pabon-Peña, L. M.,
Y. Zhang, and L. M. Epstein.
1991.
Newt satellite 2 transcripts self-cleave by using an extended hammerhead structure.
Mol. Cell. Biol.
11:6109-6115 |
| 32. | Perriman, R., A. Delves, and W. L. Gerlach. 1992. Extended target-site specificity for a hammerhead ribozyme. Gene 113:157-163[Medline]. |
| 33. |
Piedrafita, F. J.,
R. B. Molander,
G. Vansant,
E. A. Orlova,
M. Pfahl, and W. F. Reynolds.
1996.
An Alu element in the myeloperoxidase promoter contains a composite SP1-thyroid hormone-retinoic acid response element.
J. Biol. Chem.
271:14412-14420 |
| 34. | Ruffner, D. E., G. D. Stormo, and O. C. Uhlenbeck. 1990. Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry 29:10695-10702[Medline]. |
| 35. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. In Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. | Silva, T. M., and Z. A. Andrade. 1989. Natural infection of wild rodents by Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 84:227-235[Medline]. |
| 37. | Singer, M. F. 1982. SINEs and LINEs: highly repeated short and long interspersed sequences in mammalian genomes. Cell 28:433-434[Medline]. |
| 38. | Spotila, L. D., H. Hirai, D. M. Rekosh, and P. LoVerde. 1989. A retroposon-like short repetitive DNA element of the human blood fluke, Schistosoma mansoni. Chromosome 97:421-428. |
| 39. | Uhlenbeck, O. C. 1987. A small catalytic oligoribonucleotide. Nature 328:596-600[Medline]. |
| 40. | Van Arsdell, S. W., R. A. Denison, L. B. Bernstein, A. M. Weiner, T. Manser, and R. F. Gesteland. 1981. Direct repeats flank three small nuclear RNA pseudogenes in the human genome. Cell 26:11-17[Medline]. |
| 41. | Weiner, A. M. 1980. An abundant cytoplasmic 7S RNA is complementary to the dominant interspersed middle repetitive DNA sequence family in the human genome. Cell 22:209-218[Medline]. |
| 42. | Yulug, I. G., A. Yulug, and E. M. Fisher. 1995. The frequency and position of Alu repeats in cDNAs, as determined by database searching. Genomics 27:544-548[Medline]. |
| 43. | Zhang, Y., and L. M. Epstein. 1996. Cloning and characterization of extended hammerheads from a diverse set of caudate amphibians. Gene 172:183-190[Medline]. |
Mol Cell Biol, July 1998, p. 3880-3888, Vol. 18, No. 7
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, X., Denison, L., Levy, M., Ellington, A. D.
(2009). Direct selection for ribozyme cleavage activity in cells. RNA
15: 2035-2045
[Abstract] [Full Text] -
Boots, J. L., Canny, M. D., Azimi, E., Pardi, A.
(2008). Metal ion specificities for folding and cleavage activity in the Schistosoma hammerhead ribozyme. RNA
14: 2212-2222
[Abstract] [Full Text] -
Yen, L., Magnier, M., Weissleder, R., Stockwell, B. R., Mulligan, R. C.
(2006). Identification of inhibitors of ribozyme self-cleavage in mammalian cells via high-throughput screening of chemical libraries. RNA
12: 797-806
[Abstract] [Full Text] -
Przybilski, R., Graf, S., Lescoute, A., Nellen, W., Westhof, E., Steger, G., Hammann, C.
(2005). Functional Hammerhead Ribozymes Naturally Encoded in the Genome of Arabidopsis thaliana. Plant Cell
17: 1877-1885
[Abstract] [Full Text] -
OSBORNE, E. M., SCHAAK, J. E., DEROSE, V. J.
(2005). Characterization of a native hammerhead ribozyme derived from schistosomes. RNA
11: 187-196
[Abstract] [Full Text] -
Aksoy, E., Zouain, C. S., Vanhoutte, F., Fontaine, J., Pavelka, N., Thieblemont, N., Willems, F., Ricciardi-Castagnoli, P., Goldman, M., Capron, M., Ryffel, B., Trottein, F.
(2005). Double-stranded RNAs from the Helminth Parasite Schistosoma Activate TLR3 in Dendritic Cells. J. Biol. Chem.
280: 277-283
[Abstract] [Full Text] -
SAKSMERPROME, V., ROYCHOWDHURY-SAHA, M., JAYASENA, S., KHVOROVA, A., BURKE, D. H.
(2004). Artificial tertiary motifs stabilize trans-cleaving hammerhead ribozymes under conditions of submillimolar divalent ions and high temperatures. RNA
10: 1916-1924
[Abstract] [Full Text] -
PENEDO, J. C., WILSON, T. J., JAYASENA, S. D., KHVOROVA, A., LILLEY, D. M.J.
(2004). Folding of the natural hammerhead ribozyme is enhanced by interaction of auxiliary elements. RNA
10: 880-888
[Abstract] [Full Text] -
Vazquez-Tello, A., Castan, P., Moreno, R., Smith, J. M., Berenguer, J., Cedergren, R.
(2002). Efficient trans-cleavage by the Schistosoma mansoni SM{alpha}1 hammerhead ribozyme in the extreme thermophile Thermus thermophilus. Nucleic Acids Res
30: 1606-1612
[Abstract] [Full Text] -
Palkovics, L., Tóth, E. K., Dallmann, G., Balázs, E.
(2001). The DNA form of a retroviroid-like element characterized in cultivated carnation species. J. Gen. Virol.
82: 687-691
[Abstract] [Full Text] -
Vera, A., Daròs, J.-A., Flores, R., Hernández, C.
(2000). The DNA of a Plant Retroviroid-Like Element Is Fused to Different Sites in the Genome of a Plant Pararetrovirus and Shows Multiple Forms with Sequence Deletions. J. Virol.
74: 10390-10400
[Abstract] [Full Text] -
Rojas, A. A., Vazquez-Tello, A., Ferbeyre, G., Venanzetti, F., Bachmann, L., Paquin, B., Sbordoni, V., Cedergren, R.
(2000). Hammerhead-mediated processing of satellite pDo500 family transcripts from Dolichopoda cave crickets. Nucleic Acids Res
28: 4037-4043
[Abstract] [Full Text] -
Ferbeyre, G., Bourdeau, V., Pageau, M., Miramontes, P., Cedergren, R.
(2000). Distribution of Hammerhead and Hammerhead-like RNA Motifs Through the GenBank. Genome Res
10: 1011-1019
[Abstract] [Full Text] -
Denti, M. A., Alba, A. E. M. d., Sagesser, R., Tsagris, M., Tabler, M.
(2000). A novel RNA-binding protein from Triturus carnifex identified by RNA-ligand screening with the newt hammerhead ribozyme. Nucleic Acids Res
28: 1045-1052
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»