Previous Article | Next Article ![]()
Mol Cell Biol, July 1998, p. 3991-4003, Vol. 18, No. 7
Department of Biochemistry, University of
Illinois, Urbana, Illinois 61801
Received 10 February 1998/Accepted 7 April 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
In Vitro Genetic Analysis of the RNA Binding Site
of Vigilin, a Multi-KH-Domain Protein
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
|
|
|---|
The function(s) and RNA binding properties of vigilin, a ubiquitous protein with 14 KH domains, remain largely obscure. We recently showed that vigilin is the estrogen-inducible protein in polysome extracts which binds specifically to a segment of the 3' untranslated region (UTR) of estrogen-stabilized vitellogenin mRNA. In order to identify consensus mRNA sequences and structures important in binding of vigilin to RNA, before vigilin was purified, we developed a modified in vitro genetic selection protocol. We subsequently validated our selection procedure, which employed crude polysome extracts, by testing natural and in vitro-selected RNAs with purified recombinant vigilin. Most of the selected up-binding mutants exhibited hypermutation of G residues leading to a largely unstructured, single-stranded region containing multiple conserved (A)nCU and UC(A)n motifs. All eight of the selected down-binding mutants contained a mutation in the sequence (A)nCU. Deletion analysis indicated that approximately 75 nucleotides are required for maximal binding. Using this information, we predicted and subsequently identified a strong vigilin binding site near the 3' end of human dystrophin mRNA. RNA sequences from the 3' UTRs of transferrin receptor and estrogen receptor, which lack strong homology to the selected sequences, did not bind vigilin. These studies describe an aproach to identifying long RNA binding sites and describe sequence and structural requirements for interaction of vigilin with RNAs.
INTRODUCTION
|
|
|---|
The steps between gene transcription
and mRNA translation, which include nuclear RNA processing, mRNA
trafficking, and cytoplasmic mRNA degradation, are increasingly seen as
important regulatory sites in diverse cellular processes (5, 6,
52). Many of these steps in mRNA metabolism appear to be
regulated by RNA binding proteins containing K-homology (KH) domains
(14). While a detailed picture of KH-domain-RNA interaction
is not yet available, in several cases proteins containing KH domains
have been shown to bind RNA (13, 14, 21, 57). Some KH-domain
proteins are clinically significant, including FMR1 protein
(57), which is involved in fragile X syndrome, the major
cause of heritable human mental retardation, and Nova-1, which is
important in the motor control disorder paraneoplastic
opsoclonus-ataxia (12, 13). KH-domain proteins which affect
nuclear RNA splicing include Mer1, SF1, and PSI (1, 46, 55),
while the
-poly(C) binding protein plays a role in the cytoplasmic
stability of globin mRNA (68). Prokaryotic KH-domain
proteins are highly diverse and include NusA,
polyribonucleotide:orthophosphate nucleotidyltransferase, CsrA, and
ribosomal protein S3 (27, 40, 58). Since the RNA binding
sites and mechanisms of action of many KH-domain proteins remain
obscure, the question of whether KH-domain proteins can preferentially
recognize and bind to specific RNA binding sites remained unresolved.
In an important recent paper, Buckanovich and Darnell used in vitro
genetic selection with purified recombinant Nova-1 to identify RNAs
which bind Nova-1 with high affinity. Nova-1 and inhibitory glycine
receptor
2 RNAs were then shown to contain consensus binding sites
which bind to Nova-1 through a KH domain (12).
One important but little-understood KH-domain protein is vigilin. Vigilin initially was cloned from chicken chondrocytes and then was shown to be up-regulated in rapidly dividing cells and to be present in all vertebrate cell lines tested, in nematodes, and perhaps in yeast (35, 47, 49, 50, 54, 69). With its 14 KH domains, vigilin has been used as a model protein for the KH domains in FMR1 and other proteins in a seminal study solving the structure of a vigilin KH domain uncomplexed to RNA (45). However, the intracellular RNA targets of this ubiquitous, model protein and its functions remained elusive.
We had shown that estrogen specifically stabilizes the hepatic mRNA coding for the egg yolk precursor protein vitellogenin, increasing its half life from 16 to 500 h (10). The estrogen-mediated stabilization of vitellogenin mRNA requires estrogen receptor (48) and association of the mRNA with polysomes (9) and involves the 3' untranslated region (UTR) of the mRNA (48). We identified an estrogen-inducible protein which binds specifically to a segment of the vitellogenin mRNA 3' UTR (25). We recently unambiguously identified this protein as Xenopus vigilin (26). Our observations that the protein we now refer to as vigilin is found in several human cell lines and in several Xenopus cell lines and tissues and that testosterone induces vigilin in Xenopus muscle suggested a wider role for vigilin in eukaryotic mRNA metabolism (24). Despite the wide distribution of vigilin, binding sites in mRNAs other than vitellogenin mRNA had not been identified.
To allow prediction of vigilin binding sites in human mRNAs, we first defined the vigilin binding site by using iterative in vitro genetic selection. In vitro genetic selection or systematic evolution of ligands by exponential enrichment has been used to identify RNA (and DNA) ligands which interact with proteins or small molecules (28). Although an early study (8) and several subsequent studies used DNA gel mobility shifts to separate free and protein-bound DNA, in vitro genetic selection with an RNA gel mobility shift has not been described. RNA binding sites have been identified for several proteins by using in vitro genetic analysis (11, 12, 15, 31, 39, 56, 62, 63, 66). Those studies used purified RNA binding proteins. For example, in early studies, in vitro selection of RNA binding sites was used to identify the structure of the human immunodeficiency virus (HIV) Rev binding site (3) and the binding preferences of splicing factors (31, 56, 62), hnRNPs (15, 29), and the autoimmune RNA binding protein Hel-N1 (39). Using in vitro genetic selection of gel-shifted RNA-protein complexes, we have extended this technique to proteins present in relatively crude extracts. Since this work was carried out in parallel with studies aimed at the identification of the vitellogenin mRNA 3' UTR binding protein, we had to employ a relatively crude polysome extract. We first selected RNA binding sites with an increased affinity for vigilin. We then used an RNA selected for increased binding to vigilin to carry out a novel in vitro selection for random point mutations that markedly reduced binding of vigilin.
Together with deletion analysis and RNA footprinting, the in vitro genetic analysis enabled us to identify structural and sequence elements important for the interaction of vigilin with RNA. Using this information, we scanned the human sequence database and predicted and subsequently identified a strong vigilin binding site near the 3' end of human dystrophin mRNA. We then analyzed binding of purified recombinant human vigilin to the selected up- and down-binding RNAs and demonstrated that vigilin exhibits strong preferences for binding to specific RNAs.
MATERIALS AND METHODS
|
|
|---|
Construction of DNA template pools. A 116-base oligonucleotide that contained 106 bases of the 3' UTR of the Xenopus vitellogenin B1 mRNA was synthesized. Phosphoramidite mixtures were used to introduce point mutations at a frequency of 36% per position in the 70-nucleotide region shown in Fig. 3 (wild-type sequence). The synthetic oligonucleotides were purified on a 12% polyacrylamide gel and amplified by five cycles of PCR with 5'-PR1 (5'-CCGAATTCTAATACGACTCACTATAGGGAGTCTCTATATCTCTATCAA-3') and 3'-PR2 (5'-CGCGGGATCCAAATTGAATTGTTTACAA-3') primers to obtain an initial pool, pool 0. The templates for in vitro transcription for pool 0 consisted of >1013 unique, double-stranded DNA fragments which contained a T7 RNA polymerase initiation sequence (boldface in the 5'-PR1 primer sequence) and restriction enzyme sites on both the 5' and 3' ends (EcoRI and BamHI sites in the 5'-PR1 and 3'-PR2 primers, respectively) (shown in italics), as well as 18 flanking nucleotides on the 5' and 3' sides of the 70-nucleotide central region (underlined nucleotides in the 5'-PR1 and 3'-PR2 primer sequences, respectively).
For selection of RNAs exhibiting reduced binding to vigilin (down-binders), the highest binder from the selection for up-binders, HBT7, was used as the starting material, and the primers described above were used to create the starting pool by employing two rounds of mutagenic PCR (30 cycles each) as described previously (16). The expected mutation frequency was 1.2% (an average of 0.8 nucleotide in 70 bases) without a strong bias with respect to the type of base substitution.In vitro selections by RNA gel mobility shifts. Extracts containing vigilin were a salt wash of polysomes from estrogen-treated Xenopus liver prepared as previously described (25).
RNAs were transcribed in vitro by using T7 RNA polymerase and templates either from PCR products or from plasmids linearized with BamHI and were labeled to a specific activity of 109 cpm/µg with [
-32P]UTP (ICN; 3,000 Ci/mmol). Incubations for the RNA gel mobility shift assays were
carried out for 1 h on ice in a 10-µl total volume and the
mixtures typically contained 8 U of RNasin, 10 µg of yeast tRNA, 10 µg of heparin, 0.1 ng of [32P]RNA, 1 to 2 µg of
polysome extract, 10 mM Tris-HCl (pH 7.6), 1 mM Mg acetate (MgOAc), 1 mM EDTA, and 70 mM KCl (25). To select strong up-binding
mutants in selection cycles 4 to 10, the following RNAs were used as
nonspecific competitors: cycles 4 and 5, 50 µg of tRNA; cycles 6 to
9, 1 µg of Escherichia coli rRNA plus 10 µg of tRNA; and
cycle 10, 5 µg of rRNA plus 10 µg of tRNA. The samples were then
loaded on a 4% polyacrylamide gel (80:1 acrylamide-bisacrylamide in a
low-ionic-strength buffer [6.7 mM Tris-HCl {pH 7.9}, 3.3 mM NaOAc,
1 mM EDTA]) and run at 300 V at 4°C. Either gels were visualized by
autoradiography with X-ray film or gels were analyzed and the bands
were quantitated with a Molecular Dynamics PhosphorImager. Relative
binding was determined as the ratio of the intensity of the gel-shifted
band to that of the gel-shifted wild-type band except where noted.
RNAs in shifted (up-binders) or unshifted (down-binders) bands were
recovered from polyacrylamide gel slices and incubated in the elution
buffer (0.5 N NH4OAc, 10 mM MgCl2, 0.5% sodium dodecyl sulfate [SDS], 1 mM EDTA) for 2 h at room temperature. The supernatants were phenol-chloroform extracted and ethanol precipitated.
The RNAs recovered after the selections were reverse transcribed by
using the PR2 primer and PCR amplified by adding PR1 primer. The PCR
products were gel purified for subsequent selection or digested with
EcoRI and BamHI to be subcloned into the pUC19
plasmid.
Determination of the minimum length of RNA required for efficient
binding by vigilin.
HBT7 RNA was end labeled at the 5' end with
[
-32P]ATP by using T4 polynucleotide kinase, gel
purified, and partially digested under mild alkaline conditions. To
obtain an RNA ladder, the end-labeled RNA was incubated in 25 mM sodium
bicarbonate for 20 min at 90°C. The digestion products were incubated
for 1 h on ice with or without vigilin as described above for the
RNA gel mobility shift. The reaction mixtures contained 50 µg of
yeast tRNA and 50 µg of heparin in 50-µl volumes. The reaction
mixture was filtered onto nitrocellulose, and RNAs retained with the
protein on the filter were recovered as described previously
(65). Briefly, the RNAs were incubated at 65°C in 0.2 ml
of 7 M urea-3 mM EDTA-100 mM sodium citrate (pH 5.0) for 5 min, and
RNAs were recovered by phenol-chloroform extraction and ethanol
precipitation. The RNAs were then dissolved in gel loading buffer (8 M
urea, 20 mM Tris [pH 7.9], 1 mM EDTA), boiled for 90 s, chilled
on ice, and loaded on an 8% polyacrylamide gel containing 7 M urea
next to RNA sequencing ladders made by chemical modification (diethyl
pyrocarbonate and hydrazine-chloride).
RNA footprinting.
End-labeled RNAs were incubated for 1 h on ice either with extract containing vigilin (3 µg) or with buffer
as described above, except a reaction volume of 30 µl and 30 µg of
tRNA plus 30 µg of heparin were used. The incubation mixtures were
then digested with
-sarcin.
-Sarcin was expressed and purified
from E. coli and was a kind gift from A. Martínez
del Pozo, Universidad Complutense de Madrid, Madrid, Spain
(37).
-Sarcin was added to a final concentration of 5 µM, and the mixture was incubated for 15 min at 30°C,
phenol-chloroform extracted, and ethanol precipitated. The
-sarcin
digestion products were dissolved in the gel loading buffer described
above and resolved by electrophoresis on 8% polyacrylamide gels
containing 7 M urea.
In vitro transcription and translation and purification of human vigilin. PCRs were performed to amplify a region of the human vigilin cDNA spanning nucleotides 73 to 3947 (GenBank accession no. M64098). The 5' primer (5'-AAGCTTTAATACGACTCACTATAGGGAGGCGGCCTCAGGACGG-3') was designed to incorporate a T7 promoter (boldface) upstream of the start codon. The 3' primer (5'-GGGAAGCTTATTTATCGTCATCGTCTTTGTAGTCCCAAG GGAGGGTCTTGG-3') was designed to incorporate an in-frame FLAG peptide sequence and a stop codon (underlined) on the 3' end of the coding sequence of human vigilin at amino acid residue 1264. The vigilin-FLAG cDNA was amplified by using the LA PCR kit (Takara) from the plasmid pM306N containing a full-length human vigilin clone (43).
In vitro transcription-translation was performed according to the supplier's instructions for a 1.4-ml reaction mixture by using a T7 coupled reticulocyte lysate system (TnT; Promega). The PCR-amplified vigilin-FLAG cDNA was used as the template. The in vitro-translated FLAG-tagged product was dialyzed against BC100 (20 mM Tris-HCl [pH 7.9], 20% glycerol, 0.2 mM EDTA, 100 mM KCl, 1 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride), purified by binding to anti-FLAG M2 agarose (Eastman Kodak Co.), and eluted by using the FLAG peptide (final volume, 200 µl) as described previously (20). RNA gel mobility shift assays were carried out under the same conditions described above for assays with crude vigilin-containing extracts. One to two microliters of the elutant from the FLAG affinity purification was added to each reaction mixture. In the antibody supershift experiments, 1 µg of anti-FLAG M2 monoclonal antibody (Eastman Kodak Co.) or 1 µg of anti-human estrogen receptor H222 antibody (41) was added to the mixture in the absence of RNA probe, and the reaction mixture was incubated for 30 min on ice. The RNA probe was then added, and the reaction mixture was incubated for an additional 45 min before gel analysis.Analysis of human mRNA 3' UTR binding to vigilin. The human dystrophin cDNA clone p9-13, which contains the dystrophin 3' UTR, was a kind gift from L. M. Kunkel. A portion of the 3' UTR was amplified by PCR with 5'-DYS1 (5'-GAATTCATTTAGGTGACACTATAGAACATTTACGAATTATTT-3') and 3'-DYS2 (5'-AGTAAAGCAGTACTATAA-3') primers to obtain a dystrophin 3' UTR template (DYS). A 106-mer oligonucleotide (5'-AACATTTACA AATTATTTTTGTAAACTTCAGTTTTACTGCATTTTCGCAACATATCAT ACTTCACCAAGTATATGCCTTACTATTATATTATAGTACTGCTTTAC T-3') was synthesized and amplified by PCR with 5'-mDYS (5'-GAATTAATTTAGGTGACACTATAGAACATTTACAAATTATTT-3') and 3'-DYS2 primers to obtain a template for mutated dystrophin 3' UTR (mDYS) (mutated nucleotides from dystrophin cDNA are shown in boldface). DYS and mDYS templates were in vitro transcribed with SP6 RNA polymerase (the SP6 promoter is underlined) and used in RNA gel shift assays. The 107-nucleotide transcripts contain 106 nucleotides of human dystrophin mRNA 3' UTR (GenBank accession no. M18533; nucleotides 13820 to 13925) plus one extra G residue at the 5' end.
Similarly, the human estrogen receptor cDNA 3' UTR (30) and human transferrin receptor cDNA 3' UTR (36) were PCR amplified to obtain templates for in vitro transcription with 5'-ER primer (5'-GAATTCATTTAGGTGACACTATAGCAGCTTTGCTTTGTTTA-3') and 3'-ER primer (5'-AATAGGTTGAGAAAATTG-3') for human estrogen receptor and 5'-TfR primer (5'-GAATTCATTTAGGTGACACTATAGTCACAATGGTAACACATTA-3') and 3'-TfR primer (5'-CATATGGAGATCACTGTCTC-3') for human transferrin receptor. PCR templates were in vitro transcribed with SP6 polymerase (the SP6 promoter is underlined) to generate the 106-nucleotide human estrogen receptor 3' UTR RNA (GenBank accession no. X03635, nucleotides 6320 to 6425) and the 108-nucleotide human transferrin receptor 3' UTR RNA (GenBank accession no. X01060, nucleotides 3869 to 3976), respectively. The labeled human estrogen receptor and human transferrin receptor RNAs were used as probes in RNA gel mobility shift assays carried out with purified recombinant vigilin as described above.Computer analysis. Computer programs used for the nucleotide sequence database search and RNA secondary structure analysis were from the University of Wisconsin Genetics Computer Group package. The GenBank (release 91.0) and EMBL (release 42.0) nucleotide sequence databases were scanned with the program FASTA for nucleotide sequences homologous to HBT7 RNA. RNA secondary structures at 37°C were calculated by using the MFOLD program (70) and drawn by means of the loopDloop program of D. G. Gilbert (a Macintosh program for visualizing RNA secondary structure, published electronically on the Internet and available via anonymous ftp to ftp.bio.indiana.edu). The free energy of each RNA mutant at 4°C was calculated by using the MFOLD program.
RESULTS
|
|
|---|
Selection and identification of mutant RNAs exhibiting enhanced binding to vigilin. Mutagenesis and in vitro genetic selections were carried out on a 116-nucleotide mRNA segment which contains the vigilin binding site (25). This RNA sequence ends 2 nucleotides upstream of the vitellogenin mRNA polyadenylation signal (Fig. 1, top). A pool of variants was generated by using doped oligonucleotides to mutate the central section at a frequency of approximately 36%. This level of mutation allows for the generation of a large mutant pool, in which the mutants retain some resemblance to the wild-type sequence (3). Sequencing of 10 of the resulting pool 0 mutants showed that they exhibited an overall mutation rate of 35%, which is very close to the predicted rate of 36%. The overall base composition of the 10 pool 0 mutants was very similar to that predicted for this mutation frequency (Table 1).
|
|
|
|
Sequence and structural features of the RNA binding site. Analysis of the nucleotide compositions of the up-binding mutants indicated hypermutation of Gs and mutation of other nucleotides to C, with no change in the proportion of A and U (Table 1). There was a general correlation between the loss of G residues, increased free energy of the RNA secondary structures, and increased vigilin binding (Fig. 4). This suggests that efficient binding of vigilin to RNA might require a relatively flexible stretch of single-stranded RNA.
|
Identification of nucleotides critical for vigilin binding by using down-binding mutants. To more directly identify nucleotides important in creating a strong binding site, we carried out a selection for mutants with reduced ability to bind vigilin (Fig. 1, right). In this selection, we recovered unshifted bands from the RNA gel mobility shift assay. Since mutants exhibiting reduced binding and other RNAs which had simply failed to bind vigilin are both represented in this band, it was important to use conditions in which essentially all of the labeled RNA probe interacted with the binding protein. To achieve maximal interaction of the RNA with the binding protein, we used HBT7 RNA, the mutant RNA with the highest affinity for the binding protein (Fig. 2B). We used mutagenic PCR to generate an RNA pool with mutations in the central 70 nucleotides of the HBT7 template. With increasing cycles of selection, there was a progressive increase in the intensity of the unshifted band (Fig. 2B). After four selection cycles, RNA in the unshifted band was recovered, reverse transcribed, PCR amplified, subcloned, sequenced, transcribed into RNA, and analyzed for vigilin binding.
Mutants obtained after four cycles of selection showed reduced binding compared to the starting HBT7 up-binding RNA (Fig. 5). The mutagenesis was carried out under conditions in which the predicted mutation frequency was only 0.8 mutation per 70-nucleotide RNA, and only a small fraction of the RNAs contained multiple mutations. Nevertheless, all of the mutants selected contained at least two mutations. This suggests that no single point mutation was sufficient to abolish binding by vigilin, a relatively large polypeptide with a mass of approximately 155 kDa. Most, and perhaps all, of the mutations identified in the mutants shown in Fig. 5 contribute to the down-binding phenotype. All of the down-binders which had three or fewer mutations are shown in Fig. 5. Although the conditions for the mutagenesis do not show a strong bias with respect to the type of base substitution (16), approximately half (13 of 23) of the mutations in the down-binders were to G. This is consistent with our finding that mutation of Gs to other nucleotides is characteristic of up-binding mutants.
|
Both RNA sequence and structure are important in establishing a binding site. Three clustered point mutations (G55, G57, and U60) in the DB7 mutant are sufficient to virtually abolish vigilin binding (Fig. 5). A model of the secondary structure of DB7 RNA suggests that the mutations create a small stem-loop structure in the long 33-nucleotide single-stranded region near the center of the HBT7 up-binding mutant (Fig. 6A). Although the mutations in the other down-binding mutants were more dispersed than those in DB7, the importance of the central region of the RNA mutated in DB7 was shown by the fact that every other down-binding mutant contains a mutation in the A tract of the (A)nCU sequence (nucleotides 52 to 59) (Fig. 5).
|
Determination of the 3' and 5' boundaries of the RNA binding site. The in vitro genetic analysis suggested that the RNA segment containing the (A)nCU and UC(A)n motifs in a single-stranded region of the RNA played an important role in vigilin binding. However, vigilin is a large, approximately 155-kDa protein (26) with 14 KH domains. We therefore determined the minimal length of the sequence required for efficient vigilin binding.
An RNA ladder was prepared by mild alkaline hydrolysis of a 116-nucleotide 5'-end-labeled HBT7 RNA (Fig. 7A, lane 4). The RNAs were incubated with vigilin, and protein-RNA complexes were isolated on a nitrocellulose filter and fractionated on a denaturing polyacrylamide gel (Fig. 7A, lane 5). Bands for RNAs smaller than 55 nucleotides (Fig. 7A, lane 5) or for RNAs incubated in the absence of the binding protein (Fig. 7A, lane 6) were undetectable. Quantitation of band intensities of both the ladder and recovered RNA revealed that binding was unimpaired with RNAs as short as 80 nucleotides (Fig. 7C). Binding then declined to undetectable levels for RNAs shorter than 55 nucleotides (Fig. 7C). Since binding was unimpaired for an 80-nucleotide RNA, in which the 3'-terminal 36 nucleotides were deleted, nucleotides 81 to 116 are not essential for binding (Fig. 6A, boxed area at the 3' end). Our conclusion that this RNA segment is not important for vigilin binding is supported by our observations that it has the potential to form a secondary structure and is not well conserved among up-binding variants (Fig. 3). The highly conserved region lies immediately upstream of the nonessential RNA segment (Fig. 3). Deletions in this region (nucleotides 79 to 55) exhibited a progressive decline in binding to vigilin (Fig. 7C).
|
Analysis of RNA-protein contacts by RNA footprinting.
Our
observation that maximal binding of vigilin required RNAs at least 73 to 80 nucleotides long suggested either that the large, approximately
155-kDa vigilin protein exhibits multiple contacts with the RNA over a
stretch of 70 to 80 nucleotides or that a long unstructured RNA is
required to make a short RNA binding sequence available for binding. To
distinguish between these possibilities, we performed an RNA
footprinting analysis with the up-binding RNA HBT7 and the down-binding
mutant RNA DB7. The end-labeled RNA was incubated with (Fig.
8A, lanes 2 and 4, and B, lane 2) or
without (Fig. 8A, lanes 1 and 3, and B, lane 1) the vigilin-containing polysome extract and digested with
-sarcin.
-Sarcin digests RNAs
at the 3' side of purines, independent of RNA secondary structure. Since the experiments were carried out in the presence of a large excess of tRNA, protection is due to specific interaction of vigilin with the RNA. We digested HBT7 RNA labeled either at the 5' or 3' end,
and 5'-end-labeled nonbinding DB7 RNA in parallel, using
-sarcin
(Fig. 8). Since the digestion patterns of DB7 in the presence and
absence of vigilin are identical (Fig. 8A, lanes 1 and 2), the
vigilin-containing extract neither protects DB7 RNA against degradation
nor inhibits the activity of
-sarcin. In contrast, HBT7 RNA was
partially protected from digestion from positions 18 to 87 (Fig. 8A,
lanes 3 and 4, and B). The A tract of the (A)nCU
sequence (nucleotides 52 to 57) shown to be important for binding by in
vitro selection of down-binding mutants was also in a highly protected
region of the RNA (Fig. 8A, lane 4).
|
A strong vigilin binding site is located near the 3' end of human dystrophin mRNA. If the in vitro genetic selections truly created an artificial phylogeny of vigilin binding sites, it should be possible to use the RNA sequence and structure information obtained by in vitro genetic analysis to predict the occurrence of mRNA binding sites. The HBT7 sequence was used to screen the EMBL and GenBank databases of human DNA sequences by using the program FASTA from the University of Wisconsin Genetics Computer Group package (23). Since the natural vitellogenin binding site was in the 3' UTR and this region has often been implicated in control of mRNA degradation, we selected sequences only from mRNA 3' UTRs to examine. The 3' UTR with the highest homology to HBT7 was located at the 3' end of the human dystrophin gene. Homology between HBT7 and this region of the dystrophin 3' UTR extended over a 69-nucleotide region (HBT7 nucleotides 30 to 98), with a 71% sequence identity over nucleotides 56 to 76, which the in vitro selections identified as the conserved region, important for vigilin binding. Subsequent sequence analysis and secondary structure modeling of the dystrophin mRNA 3' UTR region revealed a long, largely single-stranded, G-free region (Fig. 6B) containing some of the ACU and UCA motifs (Fig. 6B, boldface) found in HBT7 and other strong up-binding mutants. Dystrophin mRNA was therefore tested for binding to vigilin, and it represents the only mRNA from the database search that we analyzed for vigilin binding.
We synthesized a 107-nucleotide RNA from a cDNA template derived from the 2.7-kb 3' UTR of dystrophin mRNA. This RNA terminates 10 nucleotides upstream of the AAUAAA polyadenylation signal. In RNA gel shift assays, vigilin in Xenopus polysome extracts bound effectively to the human dystrophin RNA sequence (Fig. 9A, lanes 3 and 4). In addition to a gel-shifted band with the same mobility as the vitellogenin RNA-vigilin complex (Fig. 9A, lane 2), two faster-migrating bands were observed. Since only the band with the same electrophoretic mobility as the vitellogenin RNA-vigilin complex is competed by unlabeled HBT7 RNA (data not shown) and the additional bands are not seen in binding studies carried out with purified recombinant vigilin (see below), the more rapidly migrating bands represent interactions with other proteins in the extract.
|
Recombinant human vigilin binds to the HBT7 and dystrophin RNAs. We had previously demonstrated that Xenopus vigilin was the protein binding to the vitellogenin mRNA 3' UTR sequence (26). While the HBT7, dystrophin, and vitellogenin RNA-protein complexes exhibit the same mobility in gel shift assays and the HBT7 and dystrophin RNAs effectively competed out binding to the vitellogenin RNA (Fig. 9B), it was still important to confirm that vigilin, and not other proteins in the polysome extracts, was binding to the RNAs. We also wished to determine whether human vigilin bound the human dystrophin RNA sequence. We therefore tested the ability of purified, recombinant human vigilin to bind to in vitro-selected RNAs and the vitellogenin and dystrophin RNAs. We introduced the FLAG epitope at the C terminus of a full-length human vigilin cDNA (43), expressed the vigilin by in vitro transcription-translation in the rabbit reticulocyte lysate cell-free protein synthesis system, and isolated the epitope-tagged vigilin by anti-FLAG immunoaffinity chromatography. SDS-polyacrylamide gel analysis demonstrated that a protein of the expected 155-kDa size was purified from the lysate containing the in vitro-translated vigilin but not from the mock-purified control reticulocyte lysate (Fig. 10A). In gel mobility shift assays, the mock-purified product from the rabbit reticulocyte lysate did not bind HBT7 RNA, while the purified protein did bind the HBT7 RNA (Fig. 10B, lanes 3 and 4), confirming that vigilin is the protein purified from the lysate which is responsible for formation of the RNA-protein complex. Confirmation that the RNA-protein complexes represent binding of recombinant vigilin to the RNAs comes from an antibody supershift experiment. Antibody to the FLAG epitope, present in the recombinant vigilin, supershifted the RNA-protein complex (Fig. 10C, lanes 2 and 3). The same amount (1 µg) of anti-estrogen receptor monoclonal antibody had no effect on migration of the RNA-protein complex (Fig. 10C, lane 4). Addition of either the FLAG antibody or the estrogen receptor antibody did not alter migration of the probe (Fig. 10C, lanes 5 and 6).
|
|
DISCUSSION
|
|
|---|
In vitro genetic analysis for up-binding and down-binding mutants. The structural and functional diversity of RNA molecules has been elegantly exploited by the development of in vitro genetic methods for screening large populations of RNAs (15, 28, 29, 62). We have successfully adapted this technology to identify the RNA binding site of the multi-KH-domain protein vigilin before the protein was purified. To carry out this selection, we separated the RNA-vigilin complexes from other RNA-protein complexes by using an RNA gel mobility shift assay carried out under unusually stringent conditions and selecting a very narrow upshifted band. To confirm that this strategy was successful in that vigilin was the protein in the extracts binding to the RNAs, we showed that the RNA-protein complexes formed by purified recombinant vigilin and by the protein in the polysome extract exhibit the same electrophoretic mobility. Additionally, we confirmed that purified recombinant vigilin and the binding protein in the polysome extracts display similar binding preferences with five in vitro-selected and natural RNAs. Most compelling was our finding that the RNA binding protein we identified as vigilin in the polysome extract and purified recombinant vigilin both bind effectively to the selected HBT7 RNA (Fig. 10B) and do not bind to the very similar selected down-binding mutant DB7; both bind to the RNA segment at the 3' end of dystrophin RNA and do not exhibit binding to the very similar mutated dystrophin RNA (Fig. 9A and 11A). This methodology may be useful for characterizing the binding sites of nucleic acid binding proteins which are difficult to purify and express or which require protein cofactors or multiprotein complexes to bind DNA or RNA.
One unusual feature of our approach is that we were able to obtain additional important information about the RNA binding site by first isolating high-affinity binding sites and then mutating a high-affinity site. This enabled us to carry out a novel genetic selection for down-binding RNA mutants. This type of selection had not been previously reported, presumably because of the high background produced by RNAs which failed to bind the protein of interest. By using our most effective up-binding mutant (HBT7), we were able to develop conditions under which all of the HBT7 RNA probe was bound to vigilin and shifted up the gel. After only four selection cycles, we did not observe a background of nonmutated HBT7 RNA sequences which had simply failed to bind the protein. One problem which did emerge was that while the mutation rate in the original pool of RNAs was less than one mutation per RNA molecule, the powerful selective pressure for isolation of nonbinding RNAs led to the selection of rare RNAs with numerous mutations. Nevertheless, the information provided by the down-binding mutants was important to the identification of binding motifs.Vigilin exhibits strong preferences for binding to specific RNAs. The in vitro selections reported here demonstrate that vigilin shows strong sequence preferences for binding to specific RNAs and does not simply bind RNA nonspecifically. This conclusion is supported by several lines of evidence. (i) After 10 selection cycles in the presence of high concentrations of nonspecific RNAs, 2 of the 20 selected up-binding mutants were identical and 2 others differed by only 2 nucleotides. From these data we calculate that there are no more than a few hundred RNAs which exhibit strong binding to vigilin in the original pool of 109 mutants. Since <1 in 106 RNAs exhibits high-affinity binding, the length, sequence, and structural requirements for high-affinity binding to vigilin are quite stringent. (ii) All of our RNA gel mobility shift assays (and the footprinting studies) were carried out in the presence of a 100,000-fold excess of tRNA. This is a significantly higher level of tRNA than was used in several other studies demonstrating sequence-specific binding to RNAs (13, 18, 22, 33). While we have not carried out detailed kinetic measurements, we used purified vigilin and the above-described RNA binding conditions to carry out a preliminary assessment of the binding of several concentrations of vigilin to the HBT7 RNA. The recombinant vigilin exhibited an approximate KD for HBT7 of ~1 nM (data not shown), which is in the same of order of magnitude as the KDs of many sequence-specific RNA and DNA binding proteins. (iii) When we searched the human sequence database for sequences in the 3' UTRs of mRNAs homologous to HBT7, the sequence with the highest homology, which was located at the 3' end of human dystrophin RNA, exhibited strong binding to vigilin (Fig. 9A and 11A). We did not explore the possibility that other 3' UTR RNAs with lower but still significant homology to HBT7 would still bind to vigilin. However, two additional 3' UTR RNAs, the human transferrin receptor and human estrogen receptor RNAs, chosen without reference to a database search, did not bind vigilin (Fig. 11B). (iv) Probably the most direct demonstration that vigilin exhibits sequence-specific binding to RNAs is the demonstration that the selected DB7 RNA, which differs by only 3 nucleotides (of 116) from the strong binder HBT7, exhibits no binding to either crude or recombinant vigilin (Fig. 5 and 10B). Similarly, using the information obtained in the in vitro selections for up- and down-binding RNAs, we found that mutating only three widely spaced nucleotides (with three compensatory changes outside the core binding region to maintain the identical RNA base composition) abolished vigilin binding to the dystrophin RNA (Fig. 9A and 11A, mDYS). Taken together, these data provide clear evidence that vigilin exhibits strong sequence preferences for binding to specific RNAs.
The in vitro-selected RNAs and the natural RNAs appear to bind to vigilin in a similar fashion. By using large pools of random RNA sequences, it is possible to select RNA receptors (aptamers) that can bind to proteins which do not contain known RNA binding motifs (7, 28, 32). However, in this work, we created a mutant pool which retained some resemblance to the natural vitellogenin RNA binding site, which may bias the selection toward RNA sequences that bind to vigilin in a fashion similar to that of the vitellogenin 3'-UTR RNA. Perhaps the most direct evidence that the selected RNAs and the naturally occurring RNAs bind vigilin through the same general mechanism comes from the competition gel mobility shift assays. The in vitro-selected HBT7 RNA and the natural dystrophin RNA sequence, but not the mutated dystrophin RNA, effectively compete with the labeled vitellogenin RNA for binding to vigilin (Fig. 9B). These data support the view that the vitellogenin RNA 3' UTR sequence and the selected HBT7 RNA use similar mechanisms and either share the same binding site on vigilin or use substantially overlapping binding sites. Additional support for the view that the selected and natural RNAs interact with vigilin through similar mechanisms comes from our data indicating that the same types of mutations which abolish binding in the selected DB7 RNA also abolish binding in the naturally occurring dystrophin RNA.
While these data support the view that vigilin binding to the selected and natural RNAs occurs by similar mechanisms, the precise role of the 14 vigilin KH domains in RNA binding remains to be established. Using the boundaries for the KH domains described by Musco et al. (45), who solved the crystal structure of a vigilin KH domain, the 14 KH domains of vigilin represent approximately 80% of its 155-kDa mass, with the remainder largely in linker regions between the KH domains. The very large number of KH domains and the potential complexity of their combinatorial interactions with the long RNA binding site we describe will make it difficult to demonstrate an explicit role for vigilin's KH domains in RNA binding. We therefore cannot exclude the formal possibility that vigilin binds RNAs not through its 14 KH domains but by still-unidentified RNA binding sequences or RNA binding domains.The vigilin binding site. The RNA binding properties of KH-domain proteins have often been assessed primarily by binding to simple RNAs (1, 38, 42, 58, 59, 67, 68). While it had been suggested that these proteins bind RNA nonspecifically (27), several KH-domain proteins have been shown to bind to specific RNAs (2, 13, 34, 46, 55, 60), but the precise nature of these RNA binding sites, except in the case of the Nova-1 site (12), has generally not been established.
Our data indicate that the length of the RNA, the absence of secondary structure, and the presence of specific RNA sequence motifs all contribute to high-affinity vigilin binding. While a specific binding motif has emerged for the
-globin stability complex, binding
involves several proteins which do not all contain KH domains
(68). However, the identical electrophoretic mobility of the
RNA-protein complexes formed by crude vigilin and the purified recombinant vigilin indicates that the vigilin-RNA complexes do not
contain other tightly bound proteins.
Perhaps because it contains 14 KH domains, the sequence and structural
requirements for vigilin binding to RNA are different from those of
many other RNA binding proteins which bind short sequence motifs
(15, 19, 29, 61, 64). In contrast, our observations from the
minimum-size determination experiment (Fig. 7) indicate that an
unusually long, 75-nucleotide RNA is required for efficient vigilin
binding.
Our finding that efficient binding requires a long single-stranded
region of RNA suggests that interaction of the RNA with vigilin may
allow the protein to deform the RNA and create specific contacts. A
similar conclusion was reached from interaction of the HIV Rev protein
with its binding site (4). Although both the HIV Rev protein
and vigilin may deform RNA on binding, the HIV Rev protein and the
heavily studied iron response element binding protein, which regulates
transferrin receptor mRNA stability (17, 44), differ
from vigilin in that they both use RNA secondary structure in their
recognition motifs.
The selection of strong up-binding mutants led to the identification of
RNA sequence motifs which were candidate sites for the interaction of
vigilin with RNA. We identified an RNA sequence containing several
undermutated nucleotides, whose deletion we previously showed to
abolish binding (25). It seemed probable that this region
(nucleotides 53 to 76) played an important role in generating a
high-affinity binding site. The undermutated sequences which were
candidate vigilin binding sites included (A)nCU and UC(A)n, which are clustered in this area.
The selection of mutant RNAs which had lost the ability to bind
effectively to vigilin strengthened this conclusion. All of the eight
down-binding mutants which had three or fewer mutations contained
mutations in an A tract in the (A)nCU sequence
(Fig. 5). In the down-binding mutant DB7, the three mutations altered
the sequence of one (A)nCU element to
(A)nGCU and moved a UC(A)n sequence into a double-stranded stem.
Analysis of the other down-binding mutants confirmed that insertion of Gs into the central single-stranded area can both destroy the (A)nCU and UC(A)n
sequence motifs and eliminate the single-stranded structure of this
region, both of which appear to be important for vigilin binding.
Interestingly, the Nova-1 protein, which contains three KH domains,
binds to multiple separated copies of the motif UCAU in a
single-stranded region (12). However, the UCAU motifs
recognized by Nova-1 are part of the loop of a stem-loop structure,
while the vigilin binding sites contain extended, largely unstructured
regions.
We conclude that in HBT7 RNA a 75-nucleotide RNA containing multiple
(A)nCU and UC(A)n motifs
in a largely G-free region of single-stranded RNA provides a strong
binding site. However, other vigilin binding motifs may be possible.
Indeed, the ability of vigilin to exhibit a range of affinities for
different RNAs may be functionally important. This spectrum of RNA
binding sites would allow for coordinate regulation of diverse RNAs and for both regulated and constitutive binding to mRNAs for which vigilin has different affinities.
The identification of a binding site in dystrophin mRNA by homology
to the HBT7 RNA site confirmed our prediction that vigilin could bind
other mRNAs. While the Becker form of muscular dystrophy is
characterized by a reduced level of dystrophin, there is as yet no
direct evidence for an in vivo role for vigilin in the metabolism of
dystrophin mRNA. The tight in vitro binding of vigilin to the
dystrophin mRNA binding site raises the possibility that this is a
biologically significant interaction, as does the presence of vigilin
in muscle and the ability of testosterone to induce vigilin binding
activity in Xenopus muscle (24). To directly assess the potential role of vigilin in dystrophin mRNA metabolism will require technically difficult studies with normal and dystrophic muscle.
In this work we describe an elaboration of in vitro genetic analysis in
which a relatively crude nucleic acid binding protein was used to
identify sequence and structural determinants important in the
interaction of the multi-KH-domain protein vigilin with mRNA. The
validity and utility of this analysis were demonstrated by our ability
to use information gained from this study to successfully predict the
presence of a strong binding site near the 3' end of human dystrophin
mRNA, while two RNAs which were chosen by using other criteria did
not bind vigilin. These data provide an analysis of the interaction of
this large and complex KH-domain protein with RNA and describe a
strategy for the identification of the still-unknown binding sites of
other RNA binding proteins.
ACKNOWLEDGMENTS
|
|
|---|
We are grateful to L. Kunkel for the dystrophin cDNA clone, to A. Martínez del Pozo for the gift of
-sarcin, and to R. Gumport for helpful comments on the manuscript.
This research was supported by NIH grants DK-50080 and HD-16720.
FOOTNOTES
* Corresponding author. Mailing address: Department of Biochemistry B-4 RAL, 600 S. Mathews Ave., University of Illinois, Urbana, IL 61801. Phone: (217) 333-1788. Fax: (217) 244-5858. E-mail: djshapir{at}uiuc.edu.
REFERENCES
|
|
|---|
| 1. | Arning, S., P. Grüter, G. Bilbe, and A. Krämer. 1996. Mammalian splicing factor SF1 is encoded by variant cDNAs and binds to RNA. RNA 2:794-810[Abstract]. |
| 2. |
Ashley, C. T., Jr.,
K. D. Wilkinson,
D. Reines, and S. T. Warren.
1993.
FMR1 protein: conserved RNP family domains and selective RNA binding.
Science
262:563-566 |
| 3. | Bartel, D. P., M. L. Zapp, M. R. Green, and J. W. Szostak. 1991. HIV-1 Rev regulation involves recognition of non-Watson-Crick base pairs in viral RNA. Cell 67:529-536[Medline]. |
| 4. | Battiste, J. L., R. Tan, A. D. Frankel, and J. R. Williamson. 1994. Binding of an HIV Rev peptide to Rev responsive element RNA induces formation of purine-purine base pairs. Biochemistry 33:2741-2747[Medline]. |
| 5. | Beelman, C. A., and R. Parker. 1995. Degradation of mRNA in eukaryotes. Cell 81:179-183[Medline]. |
| 6. | Belasco, J., and G. Brawerman. 1993. In Control of messenger RNA stability. Academic Press Inc., San Diego, Calif. |
| 7. |
Binkley, J.,
P. Allen,
D. M. Brown,
L. Green,
C. Tuerk, and L. Gold.
1995.
RNA ligands to human nerve growth factor.
Nucleic Acids Res.
23:3198-3205 |
| 8. |
Blackwell, T. K., and H. Weintraub.
1990.
Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection.
Science
250:1104-1110 |
| 9. |
Blume, J. E., and D. J. Shapiro.
1989.
Ribosome loading, but not protein synthesis, is required for estrogen stabilization of Xenopus laevis vitellogenin mRNA.
Nucleic Acids Res.
17:9003-9014 |
| 10. | Brock, M. L., and D. J. Shapiro. 1983. Estrogen stabilizes vitellogenin mRNA against cytoplasmic degradation. Cell 34:207-214[Medline]. |
| 11. |
Brown, D.,
J. Brown,
C. Kang,
L. Gold, and P. Allen.
1997.
Single-stranded RNA recognition by the bacteriophage T4 translational repressor, regA.
J. Biol. Chem.
272:14969-14974 |
| 12. | Buckanovich, R. J., and R. B. Darnell. 1997. The neuronal RNA binding protein Nova-1 recognizes specific RNA targets in vitro and in vivo. Mol. Cell. Biol. 17:3194-3201[Abstract]. |
| 13. |
Buckanovich, R. J.,
Y. Y. Yang, and R. B. Darnell.
1996.
The onconeural antigen Nova-1 is a neuron-specific RNA-binding protein, the activity of which is inhibited by paraneoplastic antibodies.
J. Neurosci.
16:1114-1122 |
| 14. |
Burd, C. G., and G. Dreyfuss.
1994.
Conserved structures and diversity of functions of RNA-binding proteins.
Science
265:615-621 |
| 15. | Burd, C. G., and G. Dreyfuss. 1994. RNA binding specificity of hnRNP A1: significance of hnRNP A1 high-affinity binding sites in pre-mRNA splicing. EMBO J. 13:1197-1204[Medline]. |
| 16. | Cadwell, R. C., and G. F. Joyce. 1992. Randomization of genes by PCR mutagenesis. PCR Methods Appl. 2:28-33[Medline]. |
| 17. | Casey, J. L., D. M. Koeller, V. C. Ramin, R. D. Klausner, and J. B. Harford. 1989. Iron regulation of transferrin receptor mRNA levels requires iron-responsive elements and a rapid turnover determinant in the 3' untranslated region of the mRNA. EMBO J. 8:3693-3699[Medline]. |
| 18. |
Chagnovich, D.,
B. E. Fayos, and S. L. Cohn.
1996.
Differential activity of ELAV-like RNA-binding proteins in human neuroblastoma.
J. Biol. Chem.
271:33587-33591 |
| 19. | Chen, C. Y., and A. B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20:465-470[Medline]. |
| 20. | Chiang, C. M., and R. G. Roeder. 1993. Expression and purification of general transcription factors by FLAG epitope-tagging and peptide elution. Peptide Res. 6:62-64. |
| 21. | Dejgaard, K., and H. Leffers. 1996. Characterisation of the nucleic-acid-binding activity of KH domains. Different properties of different domains. Eur. J. Biochem. 241:425-431[Medline]. |
| 22. |
DeMaria, C. T., and G. Brewer.
1996.
AUF1 binding affinity to A+U-rich elements correlates with rapid mRNA degradation.
J. Biol. Chem.
271:12179-12184 |
| 23. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 24. | Dodson, R. E., M. R. Acena, and D. J. Shapiro. 1995. Tissue distribution, hormone regulation and evidence for a human homologue of the estrogen-inducible Xenopus laevis vitellogenin mRNA binding protein. J. Steroid Biochem. Mol. Biol. 52:505-515[Medline]. |
| 25. |
Dodson, R. E., and D. J. Shapiro.
1994.
An estrogen-inducible protein binds specifically to a sequence in the 3' untranslated region of estrogen-stabilized vitellogenin mRNA.
Mol. Cell. Biol.
14:3130-3138 |
| 26. |
Dodson, R. E., and D. J. Shapiro.
1997.
Vigilin, a ubiquitous protein with 14 K homology domains, is the estrogen-inducible vitellogenin mRNA 3'-untranslated region-binding protein.
J. Biol. Chem.
272:12249-12252 |
| 27. | Gibson, T. J., J. D. Thompson, and J. Heringa. 1993. The KH domain occurs in a diverse set of RNA-binding proteins that include the antiterminator NusA and is probably involved in binding to nucleic acid. FEBS Lett. 324:361-366[Medline]. |
| 28. | Gold, L., B. Polisky, O. Uhlenbeck, and M. Yarus. 1995. Diversity of oligonucleotide functions. Annu. Rev. Biochem. 64:763-797[Medline]. |
| 29. |
Görlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The determinants of RNA-binding specificity of the heterogeneous nuclear ribonucleoprotein C proteins.
J. Biol. Chem.
269:23074-23078 |
| 30. | Green, S., P. Walter, V. Kumar, A. Krust, J. M. Bornert, P. Argos, and P. Chambon. 1986. Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134-139[Medline]. |
| 31. | Heinrichs, V., and B. S. Baker. 1995. The Drosophila SR protein RBP1 contributes to the regulation of doublesex alternative splicing by recognizing RBP1 RNA target sequences. EMBO J. 14:3987-4000[Medline]. |
| 32. |
Jellinek, D.,
C. K. Lynott,
D. B. Rifkin, and N. Janjic.
1993.
High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding.
Proc. Natl. Acad. Sci. USA
90:11227-11231 |
| 33. | Kjems, J., B. J. Calnan, A. D. Frankel, and P. A. Sharp. 1992. Specific binding of a basic peptide from HIV-1 Rev. EMBO J. 11:1119-1129[Medline]. |
| 34. | Kruse, C., A. Grünweller, H. Notbohm, S. Kügler, W. G. Purschke, and P. K. Müller. 1996. Evidence for a novel cytoplasmic tRNA-protein complex containing the KH-multidomain protein vigilin. Biochem. J. 320:247-252. |
| 35. | Kügler, S., A. Grünweller, C. Probst, M. Klinger, P. K. Müller, and C. Kruse. 1996. Vigilin contains a functional nuclear localisation sequence and is present in both the cytoplasm and the nucleus. FEBS Lett. 382:330-334[Medline]. |
| 36. | Kühn, L. C., A. McClelland, and F. H. Ruddle. 1984. Gene transfer, expression, and molecular cloning of the human transferrin receptor gene. Cell 37:95-103[Medline]. |
| 37. | Lacadena, J., A. Martínez del Pozo, J. L. Barbero, J. M. Mancheño, M. Gasset, M. Oñaderra, C. López-Otín, S. Ortega, J. García, and J. G. Gavilanes. 1994. Overproduction and purification of biologically active native fungal alpha-sarcin in Escherichia coli. Gene 142:147-151[Medline]. |
| 38. | Leffers, H., K. Dejgaard, and J. E. Celis. 1995. Characterisation of two major cellular poly(rC)-binding human proteins, each containing three K-homologous (KH) domains. Eur. J. Biochem. 230:447-453[Medline]. |
| 39. |
Levine, T. D.,
F. Gao,
P. H. King,
L. G. Andrews, and J. D. Keene.
1993.
Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs.
Mol. Cell. Biol.
13:3494-3504 |
| 40. |
Liu, M. Y.,
H. Yang, and T. Romeo.
1995.
The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability.
J. Bacteriol.
177:2663-2672 |
| 41. |
Lorincz, M. A.,
J. A. Holt, and G. L. Greene.
1985.
Monoclonal antibody recognition of multiple forms of estrogen receptor tagged with [125I]methoxy-iodovinyl estradiol in ovarian carcinomas.
J. Clin. Endocrinol. Metab.
61:412-417 |
| 42. |
Matunis, M. J.,
W. M. Michael, and G. Dreyfuss.
1992.
Characterization and primary structure of the poly(C)-binding heterogeneous nuclear ribonucleoprotein complex K protein.
Mol. Cell. Biol.
12:164-171 |
| 43. |
McKnight, G. L.,
J. Reasoner,
T. Gilbert,
K. O. Sundquist,
B. Hokland,
P. A. McKernan,
J. Champagne,
C. J. Johnson,
M. C. Bailey,
R. Holly,
P. J. O'Hara, and J. F. Oram.
1992.
Cloning and expression of a cellular high density lipoprotein-binding protein that is up-regulated by cholesterol loading of cells.
J. Biol. Chem.
267:12131-12141 |
| 44. | Müllner, E. W., B. Neupert, and L. C. Kühn. 1989. A specific mRNA binding factor regulates the iron-dependent stability of cytoplasmic transferrin receptor mRNA. Cell 58:373-382[Medline]. |
| 45. | Musco, G., G. Stier, C. Joseph, M. A. Castiglione Morelli, M. Nilges, T. J. Gibson, and A. Pastore. 1996. Three-dimensional structure and stability of the KH domain: molecular insights into the fragile X syndrome. Cell 85:237-245[Medline]. |
| 46. | Nandabalan, K., and G. S. Roeder. 1995. Binding of a cell-type-specific RNA splicing factor to its target regulatory sequence. Mol. Cell. Biol. 15:1953-1960[Abstract]. |
| 47. | Neu-Yilik, G., H. Zorbas, T. R. Gloe, H. M. Raabe, T. A. Hopp-Christensen, and P. K. Müller. 1993. Vigilin is a cytoplasmic protein. A study on its expression in primary cells and in established cell lines of different species. Eur. J. Biochem. 213:727-736[Medline]. |
| 48. |
Nielsen, D. A., and D. J. Shapiro.
1990.
Estradiol and estrogen receptor-dependent stabilization of a minivitellogenin mRNA lacking 5,100 nucleotides of coding sequence.
Mol. Cell. Biol.
10:371-376 |
| 49. | Plenz, G., Y. Gan, H. M. Raabe, and P. K. Müller. 1993. Expression of vigilin in chicken cartilage and bone. Cell Tissue Res 273:381-389[Medline]. |
| 50. | Plenz, G., S. Kügler, S. Schnittger, H. Rieder, C. Fonatsch, and P. K. Müller. 1994. The human vigilin gene: identification, chromosomal localization and expression pattern. Hum. Genet. 93:575-582[Medline]. |
| 51. |
Ree, A. H.,
H. K. Knutsen,
B. F. Landmark,
W. Eskild, and V. Hansson.
1992.
Down-regulation of messenger ribonucleic acid (mRNA) for the estrogen receptor (ER) by phorbol ester requires ongoing RNA synthesis but not protein synthesis. Is hormonal control of ER mRNA degradation mediated by an RNA molecule?
Endocrinology
131:1810-1814 |
| 52. |
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450 |
| 53. |
Saceda, M.,
C. Knabbe,
R. B. Dickson,
M. E. Lippman,
D. Bronzert,
R. K. Lindsey,
M. M. Gottardis, and M. B. Martin.
1991.
Post-transcriptional destabilization of estrogen receptor mRNA in MCF-7 cells by 12-O-tetradecanoylphorbol-13-acetate.
J. Biol. Chem.
266:17809-17814 |
| 54. | Schmidt, C., B. Henkel, E. Poschl, H. Zorbas, W. G. Purschke, T. R. Gloe, and P. K. Müller. 1992. Complete cDNA sequence of chicken vigilin, a novel protein with amplified and evolutionary conserved domains. Eur. J. Biochem. 206:625-634[Medline]. |
| 55. |
Siebel, C. W.,
A. Admon, and D. C. Rio.
1995.
Soma-specific expression and cloning of PSI, a negative regulator of P element pre-mRNA splicing.
Genes Dev.
9:269-283 |
| 56. |
Singh, R.,
J. Valcarcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176 |
| 57. | Siomi, H., M. Choi, M. C. Siomi, R. L. Nussbaum, and G. Dreyfuss. 1994. Essential role for KH domains in RNA binding: impaired RNA binding by a mutation in the KH domain of FMR1 that causes fragile X syndrome. Cell 77:33-39[Medline]. |
| 58. |
Siomi, H.,
M. J. Matunis,
W. M. Michael, and G. Dreyfuss.
1993.
The pre-mRNA binding K protein contains a novel evolutionarily conserved motif.
Nucleic Acids Res.
21:1193-1198 |
| 59. | Siomi, M. C., H. Siomi, W. H. Sauer, S. Srinivasan, R. L. Nussbaum, and G. Dreyfuss. 1995. FXR1, an autosomal homolog of the fragile X mental retardation gene. EMBO J. 14:2401-2408[Medline]. |
| 60. | Siomi, M. C., Y. Zhang, H. Siomi, and G. Dreyfuss. 1996. Specific sequences in the fragile X syndrome protein FMR1 and the FXR proteins mediate their binding to 60S ribosomal subunits and the interactions among them. Mol. Cell. Biol. 16:3825-3832[Abstract]. |
| 61. |
Swanson, M. S., and G. Dreyfuss.
1988.
Classification and purification of proteins of heterogeneous nuclear ribonucleoprotein particles by RNA-binding specificities.
Mol. Cell. Biol.
8:2237-2241 |
| 62. | Tacke, R., and J. L. Manley. 1995. The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities. EMBO J. 14:3540-3551[Medline]. |
| 63. | Takagaki, Y., and J. L. Manley. 1997. RNA recognition by the human polyadenylation factor CstF. Mol. Cell. Biol. 17:3907-3914[Abstract]. |
| 64. |
Tsai, D. E.,
D. S. Harper, and J. D. Keene.
1991.
U1-snRNP-A protein selects a ten nucleotide consensus sequence from a degenerate RNA pool presented in various structural contexts.
Nucleic Acids Res.
19:4931-4936 |
| 65. | Tuerk, C., S. Eddy, D. Parma, and L. Gold. 1990. Autogenous translational operator recognized by bacteriophage T4 DNA polymerase. J. Mol. Biol. 213:749-761[Medline]. |
| 66. |
Wang, J.,
Z. Dong, and L. R. Bell.
1997.
Sex-lethal interactions with protein and RNA. Roles of glycine-rich and RNA binding domains.
J. Biol. Chem.
272:22227-22235 |
| 67. |
Wang, L. L.,
S. Richard, and A. S. Shaw.
1995.
P62 association with RNA is regulated by tyrosine phosphorylation.
J. Biol. Chem.
270:2010-2013 |
| 68. | Wang, X., and S. A. Liebhaber. 1996. Complementary change in cis determinants and trans factors in the evolution of an mRNP stability complex. EMBO J. 15:5040-5051[Medline]. |
| 69. | Wintersberger, U., C. Kühne, and A. Karwan. 1995. Scp160p, a new yeast protein associated with the nuclear membrane and the endoplasmic reticulum, is necessary for maintenance of exact ploidy. Yeast 11:929-944[Medline]. |
| 70. | Zuker, M. 1989. Computer prediction of RNA structure. Methods Enzymol. 180:262-288[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»