This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Navas, P. A.
Right arrow Articles by Stamatoyannopoulos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navas, P. A.
Right arrow Articles by Stamatoyannopoulos, G.

 Previous Article  |  Next Article 

Mol Cell Biol, July 1998, p. 4188-4196, Vol. 18, No. 7
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Developmental Specificity of the Interaction between the Locus Control Region and Embryonic or Fetal Globin Genes in Transgenic Mice with an HS3 Core Deletion

Patrick A. Navas, Kenneth R. Peterson, Qiliang Li, Eva Skarpidi, Alex Rohde, Sara E. Shaw, Christopher H. Clegg, Haruhiko Asano, and George Stamatoyannopoulos*

Division of Medical Genetics, University of Washington, Seattle, Washington 98195

Received 8 January 1998/Returned for modification 3 March 1998/Accepted 16 April 1998

SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES

SUMMARY
Top
Next
References

The human beta -globin locus control region (LCR) consists of five erythroid-lineage-specific DNase I-hypersensitive sites (HSs) and is required for activation of the beta -globin locus chromatin domain and globin gene expression. Each DNase I-HS of the LCR consists of a highly conserved core element and flanking sequences. To analyze the functional role of the core elements of the HSs, we deleted a 234-bp fragment encompassing the core of HS3 (HS3c) from a beta -globin locus residing on a 248-kb beta -locus yeast artificial chromosome and analyzed its function in F2 progeny of transgenic mice. Human varepsilon -globin gene expression was absent at day 10 and severely reduced in the day 12 embryonic erythropoiesis of mice lacking HS3c. In contrast, gamma -globin gene expression was normal in embryonic erythropoiesis but it was absent in definitive erythropoiesis in the fetal liver. These results indicate that the core element of HS3 is necessary for varepsilon -globin gene transcription in embryonic cells and for gamma -globin gene transcription in definitive cells. Normal gamma -globin gene expression in embryonic cells and the absence of gamma -globin gene expression in definitive cells show that different HSs interact with gamma -globin gene promoters in these two stages of development. Such results provide direct evidence for developmental stage specificity of the interactions between the core elements of HSs and the promoters of the globin genes.

INTRODUCTION
Top
Previous
Next
References

The human beta -globin locus contains five actively transcribed genes that are arranged in their developmental order of expression. High-level expression of the beta -globin gene cluster is dependent on the presence of the locus control region (LCR) (18), an element characterized by a series of five DNase I-hypersensitive sites (HSs) located 6 to 22 kb upstream of the varepsilon -globin gene (9, 10, 18, 44). Naturally occurring deletions of this element result in changes in chromatin structure that extend at least 200 kb 3' of the deletion, transcriptional silencing of the beta -globin locus, and a phenotype of beta  thalassemia (4, 5, 12, 22). Functional properties of the LCR include activation of the beta -globin locus (10, 18), restriction of globin gene expression to cells of the erythroid cell lineage (18, 45), enhancement of globin gene expression (11, 18, 39), and protection from position effects of globin genes transferred in transgenic mice (13, 18, 25, 41).

Transgenic mice have been extensively used to study the developmental control of the beta -globin genes, the function of the LCR, and the role of individual HSs in beta -globin gene regulation. Linkage of individual HSs to individual globin genes have shown that HS2, HS3, and HS4 are capable of conferring position-independent expression of globin genes, with stronger activation of expression at a specific stage of development (14, 25). Several observations have led to a model suggesting that the HSs form a complex that directly interacts with globin gene promoters by looping of the intervening DNA (7, 28, 46). HS2, HS3, and HS4 have 200- to 400-bp core regions that are able to provide position-independent expression in transgenic mice (27, 34, 35, 37, 42). These HS core regions may be indispensable components of the LCR complex; deletions of the HS3 or HS4 core elements result in disruption of HS function and reduction of globin gene expression (3).

Discernment of the function of individual HSs and analysis of how the LCR interacts with individual genes during development require studies in the context of intact, native beta -globin loci. Entire beta -globin loci have been used to generate transgenic mice, by ligating two cosmids to produce a 70-kb fragment (40) or by using 248-kb (30) or 150-kb (15, 36) yeast artificial chromosomes harboring the beta -globin locus (beta -YACs). Mice carrying beta -YACs show correct regulation of the human globin genes, presumably because all the human cis-regulatory elements are present in the transferred sequences of the beta -globin locus and are properly recognized by the murine trans-acting environment. In beta -YAC transgenic mice, the varepsilon -globin gene is expressed during the embryonic stage of development and is confined to primitive erythropoiesis in the yolk sac. The gamma -globin genes are also expressed in the embryonic yolk sac, but unlike their murine homologous gene, beta h1, gamma -globin gene expression continues in the fetal liver stage of erythropoiesis. Human beta -globin gene expression occurs only in the cells of definitive erythropoiesis.

To delineate the role of HS3 in LCR function and globin gene expression during development, we produced beta -YAC transgenic mice carrying either large deletions of LCR sequences containing the individual HSs or the core elements of these sites. We have previously reported results obtained from extensive deletions of HS3 and HS2 (32). In the study summarized in this paper, we deleted the core element of HS3 of the LCR from a beta -globin locus residing on a 248-kb beta -YAC and used this beta -YAC to produce transgenic mice. In the embryonic yolk sac of these mice, varepsilon -globin gene expression was absent but gamma -globin gene expression was normal. However, gamma -globin gene expression was totally silent in erythroid cells originating in fetal liver. The levels of beta -globin gene expression were decreased and varied among the transgenic lines, indicating that beta -globin gene expression was influenced by the position of integration of the beta -YAC transgene into the murine genome. Based on these results, we propose that the core of the HS3 directly interacts with the globin gene promoters during embryonic and fetal development, resulting in activation of varepsilon -globin gene expression in the yolk sac and of gamma -globin gene expression in the fetal liver. Indirectly, our results also suggest that the LCR changes conformations during the course of development.

MATERIALS AND METHODS
Top
Previous
Next
References

Construction of a beta -YAC lacking HS3c (Delta HS3c). Plasmid pIII(0.7) contains a 784-bp PstI fragment encompassing the 225-bp 5' HS3c element and 559 bp of flanking DNA sequence (GenBank coordinates 4348 to 5132). Plasmid pIII(0.7) DNA was digested with the restriction enzyme PstI, and the 784-bp insert was subcloned into PstI-digested plasmid pALTER-1 (Promega, Madison, Wis.) to generate pALHS3(0.7). Two primers, each with two nucleotide substitutions, were synthesized and used to create EcoRI sites flanking the 5' HS3c element (GenBank coordinates 4541 to 4776) by site-directed mutagenesis with the Altered Sites II in vitro mutagenesis system (Promega) according to the manufacturer's protocol. The primer DNA sequences were 5' CCCTCACGGTGAATTCGCGAGCTGG 3' (proximal) and 5' GTAGTAGAATGAAGAATCTGCTATGC 3' (distal); the nucleotide substitutions are in boldface type and the EcoRI sites are underlined. Plasmid pIII(4.4), containing a 225-bp HpaI-KpnI fragment encompassing 5' HS3 (GenBank coordinates 3379 to 7764), was digested with restriction enzyme HindIII, and a 1.8-kb HindIII fragment containing 5' HS3 sequence was isolated and subcloned into HindIII-digested pUC19 in which the EcoRI and PstI sites had been ablated. The resultant plasmid, pUCHS3(1.8), which contained 5' HS3 (GenBank coordinates 3379 to 5172), was digested with restriction enzyme PstI to remove the 784-bp PstI fragment containing 5' HS3 sequence, and the mutagenized 784-bp fragment from plasmid pALHS3(0.7) was subcloned in its place to generate plasmid pUCHS3m. Plasmid pUCHS3m was digested with restriction enzyme EcoRI to remove the 234-bp EcoRI fragment containing the 5' HS3c element and circularized by the addition of T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.) to generate plasmid pUCDelta HS3c(1.6). Digestion of pUCDelta HS3c(1.6) with restriction enzyme HindIII generated a 1.6-kb HindIII fragment containing the 5' HS3 core deletion that was subcloned into the yeast-integrating-plasmid (YIP) vector pRS406 (Stratagene, La Jolla, Calif.), from which the SpeI restriction site had been deleted to produce plasmid pRSDelta HS3c(1.6). One microgram of pRSDelta HS3c(1.6) was linearized with SpeI at a unique site 3' of the 5' HS3 deletion and transformed into yeast spheroplasts (16). Transformants were selected for uracil prototrophy on complete medium lacking uracil, and proper intergration of the YIP in isolates containing YACs was determined by Southern blot hybridization analysis. Spontaneous excision of the YIP via homologous recombination was permitted by overnight growth in nonselective rich medium (yeast-peptone-dextrose) (47). Aliquots of the culture were plated on 5-fluoroorotic acid plates to select for loss of the URA3 gene due to excision of the YIP vector, which resulted in 5-fluoroorotic acid resistance. Deletion of the 5' HS3c element was determined by Southern blot hybridization analysis. (The approach used is summarized in Fig. 1.)


View larger version (19K):
[in this window]
[in a new window]
  		FIG. 1.   beta -Globin locus and the location of the HS3c deletion. (A) Five DNase I-HSs are located 6 to 22 kb 5' of the varepsilon -globin gene, and a single HS (3' HS1) is located approximately 20 kb 3' of the beta -globin gene. (B) A 784-bp PstI fragment containing the HS3c was subcloned into pALTER-1 for site-directed mutagenesis. (C) The HphI and Fnu4HI restriction sites, flanking the core element of HS3, were mutagenized to create EcoRI sites. Digestion with EcoRI simultaneously eliminated the core element of HS3 and left a diagnostic EcoRI restriction site. (D) The 1.6-kb HindIII fragment was subcloned into the YIP used to introduce the deletion into the beta -YAC via homologous recombination.

YAC purification and production of transgenic mice. The Delta HS3c beta -YAC yeast strain was grown and agarose plugs were prepared as previously described (20). Preparative plugs were loaded on a 0.5% MP agarose gel (Boehringer Mannheim), and the DNA was fractionated by pulsed-field gel electrophoresis (PFGE) (CHEF DRII apparatus; Bio-Rad, Hercules, Calif.) in 0.5× TBE (44.5 mM Tris, 44.5 mM boric acid, 1 M EDTA) at 200 V with a 60-s switch for 20 h at 12°C. A portion of the gel was stained with ethidium bromide to determine the migration distance of the Delta HS3c beta -YAC, and the YAC DNA was cut from the gel. The gel slice containing the YAC DNA and a second slice containing a yeast chromosome were rotated 90° relative to their original directions of mobility and electrophoresed in a 4% low-melting-point agarose (LMPA) (NuSieve GTG; FMC, Rockland, Maine) in 0.5× TBE at 47 V for 15 h to concentrate the YAC. The yeast lane was stained with ethidium bromide to determine the migration distance of the beta -YAC DNA into the 4% LMPA. A slice of approximately 8 mm was weighed and equilibrated in a 100× volume of 10 mM Tris-HCl (pH 7.5)-250 µM EDTA-100 mM NaCl for 1 h at room temperature without agitation. The gel slice was placed in a microcentrifuge tube, and the agarose was melted at 68°C for 10 min and then immediately placed at 42.5°C for 5 min. Two units of beta -agarase (New England Biolabs, Beverly, Mass.) per 100 mg of agarose was added and digested overnight at 42.5°C. Integrity of the YAC DNA was determined by PFGE as described above prior to its injection into fertilized mouse eggs. DNA concentration was determined by fluorometry (Pharmacia, Piscataway, N.J.), and the YAC DNA was diluted to a final concentration of 2.0 ng/µl with a solution containing 10 mM Tris-HCl (pH 7.5), 250 µM EDTA, and 100 mM NaCl and filtered through a 0.22-µm-pore-size Acrodisk (Gelman, Ann Arbor, Mich.) just prior to injection.

Structural analysis of Delta HS3c beta -YAC transgenic mice. Transgenic founder (F0) animals were identified by hybridization of tail DNA slot blots with a gamma -globin gene probe. Founders were bred to produce F1 progeny for structure-function analysis. Fresh liver cell suspensions were prepared as follows. Liver was cut into small pieces and then mechanically sheared by successive passage through a 16-gauge syringe. The cells were washed twice with Dulbecco's phosphate-buffered saline and resuspended at a concentration of 3 × 107 cells/ml in phosphate-buffered saline. An equal volume of 2% LMPA (Seaplaque GTG agarose) was added to the liver suspension, and plugs were cast. The plugs were incubated in LDS solution (1% lithium dodecyl sulfate, 100 mM EDTA [pH 8.0], 10 mM Tris-HCl [pH 8.0]) at 37°C for 1 h, followed by a second incubation overnight. The plugs were then washed twice for 30 min in 0.2× NDS (0.2% lauryl sarcosinate, 100 mM EDTA, 2 mM Tris base [pH 9.5]), followed by three 30-min washes in TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA [pH 8.0]). The plugs were stored at 4°C in TE.

Twelve agarose plugs were digested overnight at 50°C with 20 U of SfiI (Boehringer Mannheim) in a total volume of 200 µl after preequilibration in 200 µl of 1× SfiI buffer. The DNAs were fractionated by PFGE with a 1% agarose gel (SeaKem Gold GTG; FMC) at 200 V with a 14-s switch for 22 h at 14°C in 0.5× TBE. The gels were capillary blotted overnight onto nylon membranes (Hybond N+; Amersham, Arlington Heights, Ill.) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The nylon membrane was cut into strips representing individual lanes, and each strip was hybridized with a different probe spanning the beta -globin locus from 5' HS3 to the hereditary persistence of fetal hemoglobin type 6 (HPFH6) breakpoint. After overnight hybridization and washing, the strips were reassembled and subjected to autoradiography. A 140-kb SfiI fragment is the expected size for an intact Delta HS3c beta -YAC, and fragments of different sizes indicate that Delta HS3c beta -YAC copies have deletions. The probes used were as follows: 0.7-kb PstI 5' HS3, 1.9-kb HindIII 5' HS2, the 3.7-kb EcoRI varepsilon -globin gene, the 2.4-kb EcoRI 3' Agamma -globin gene, 1.0-kb EcoRV psi beta , the 2.1-kb PstI 5' delta -globin gene, the 0.9-kb EcoRI-BamHI beta -globin gene, 1.4-kb XbaI DF10 (3' HS1), 1.9-kb BglII HPFH3, 0.5-kb HindIII H500, and 1.5-kb EcoRI-BglII HPFH6. All fragments were radiolabeled with a Decaprime II random labeling kit (Ambion, Austin, Tex.). The 5' delta -globin gene, HPFH3, and HPFH6 probe templates were gifts of N. P. Anagnou (University of Crete), DF10 was a gift from D. Fleenor (Duke University), and H500 was a gift from D. Mager (University of British Columbia).

Copy number determination. Agarose plugs containing transgenic mouse liver DNA were digested overnight with the restriction enzyme AccI, and the DNAs were fractionated by agarose gel electrophoresis and blotted to a nylon membrane as described above. Copy number was determined by comparing human Agamma -globin gene and murine Thy1.1 (gift from R. Perlmutter) hybridization signals by Southern blot hybridization. Thy1.1 serves as an internal diploid control. To ensure equal levels of labeling of both the Agamma -globin gene and Thy1.1 fragments, the following construct was synthesized. A 753-bp HindIII fragment containing sequences 3' of the Agamma -globin gene (GenBank coordinates 41382 to 42135) was cloned into pW126, a pBluescript (Stratagene) plasmid containing a 544-bp BamHI Thy1.1 cDNA, to produce pThy1.1/3' Agamma (753). Digestion with XbaI and XhoI released a 1.3-kb fragment that was labeled with a Decaprime II random labeling kit (Ambion). As an internal control during Southern blot hybridization, we digested pThy1.1/3' Agamma (753) with PstI and ScaI to release a 2.6-kb Agamma fragment and a 1.6-kb Thy1.1 fragment. Approximately 10 pg of this control was electrophoresed alongside the digested mouse genomic DNAs. Hybridization signals were quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). The ratio of Agamma to Thy1.1 was calculated from the plasmid control, and this ratio was used to correct for differences in specific activities between the two probes. The corrected Thy1.1 values were divided by 2 to obtain a single copy value for each lane containing genomic DNA. Delta HS3c beta -YAC copy number was determined by dividing the Agamma signal by the corrected Thy1.1 single-copy value.

Measurement of globin mRNA synthesis. Total RNA was isolated from F2 transgenic tissues with the RNAgents Isolation system (Promega). Human and murine globin RNA were quantitated by RNase protection analysis with an RPA II kit (Ambion). RNA probes were synthesized with a MAXIscript transcription kit (Ambion). Template DNAs used to measure human varepsilon -, gamma -, and beta -globin mRNAs were pT7H varepsilon (188), pT7Agamma m(170), and pT7beta m, respectively (26). Template DNAs used to measure murine alpha and zeta  globin mRNAs were pT7Malpha and pT7Mzeta , respectively (1). RNAs were isolated from day 10 yolk sac (1,000 ng), day 12 liver (500 ng), day 12 blood (80 ng), day 14 liver (500 ng), and adult blood (80 ng). Signals were quantitated with a PhosphorImager (Molecular Dynamics).

Immunofluorescent detection of human globin chains. Globin chains were visualized by staining fixed cells with varepsilon -, gamma -, or beta -globin-specific monoclonal antibodies. Cytocentrifuge smears were fixed in methanol and incubated with appropriate antibodies. A second antibody [goat F(ab')2 anti-mouse fluorescein isothiocyanate-conjugated immunoglobulin G; Dupont, Wilmington, Del.] that is reactive to the mouse monoclonal antibodies was added to allow color detection of the globin proteins.

RESULTS
Top
Previous
Next
References

Structural analysis of transgenic mice. Previous studies have shown that YAC transgenes frequently have deletions of the 5' and 3' sequences, thus requiring detailed structural analysis of the YAC DNA integrated in transgenic mice (30-33). Identification of mice bearing intact beta -globin loci is an essential prerequisite to functional studies. The continuity of the beta -globin locus within individual YAC copies was determined as described in Materials and Methods and shown in Fig. 2. Four lines had at least one intact 140-kb SfiI fragment and were used in this study. The presence of HS4, which resides upstream of the 5' SfiI site used in our structural analysis, was confirmed in all lines (Fig. 3). Line A has an intact 140-kb fragment and an additional 120-kb fragment containing a beta -globin locus with a deletion 3' to the delta -globin gene. Thus, line A has two copies of varepsilon -, Ggamma -, Agamma -, and delta -globin genes but a single beta -globin gene. Line B has a single 140-kb fragment containing the entire beta -globin locus. Line C has two intact beta -globin loci of 150 and 160 kb. Line D contains an intact beta -globin locus on a 135-kb fragment which is missing sequences downstream of the beta -globin gene, including 3' HS1; the deletion in the 135-kb fragment, however, spares the enhancer element (2, 23, 43), which is located 0.4 kb 3' of the beta -globin locus (Fig. 4). Structural rearrangements of some YAC copies (deletions of the 5' or 3' end or both ends) are common in beta -YAC transgenics (31-33). However, if the beta -globin locus itself is intact (i.e., from 5' HS4 through the beta -globin gene enhancer), developmental expression of the globin genes is normal both temporally and spatially and there is position-independent, copy-number-dependent expression of the globin genes (33).


View larger version (43K):
[in this window]
[in a new window]
  		FIG. 2.   Structures of the beta -YAC globin loci of Delta HS3c beta -YAC transgenic mouse lines. The upper part of the figure shows the 140-kb SfiI fragment encompassing most of the beta -globin locus from 5' HS3 to the breakpoint of HPFH6 approximately 53 kb downstream of the beta -globin gene. Arrows indicate HSs. Agarose plugs containing high-molecular-weight DNA from liver tissue were isolated from four Delta HS3c beta -YAC transgenic lines. The plugs were digested with SfiI, fractionated by PFGE, and subjected to Southern hybridization analyses. The location of each of the probes used in the structural analysis is identified on the map. Schematic representations of the structures of the SfiI fragments are drawn below each autoradiogram. (A) Line A has an intact 140-kb fragment and an additional 120-kb fragment which is deleted from sequences 3' of the delta -globin gene. (B) Line B has a single 140-kb fragment identified by each of the probes. (C) Line C has a 150-kb fragment containing the intact locus from 5' HS3 to position H500 (placed between the breakpoints of HPFH3 and HPFH6). A second 160-kb fragment extends from 5' HS3 to the beta -globin gene. This fragment can be seen in the doublets apparent in the lighter exposure of the same autoradiogram in the upper portion of panel C. (D) Line D has a 140-kb fragment containing an intact beta -globin locus and two additional fragments of 120 and 170 kb, from both of which most of the beta -globin locus is deleted. The first lane in each of the autoradiograms contains control DNA from a mouse erythroleukemia cell line containing a single intact beta -YAC, as determined by structural analysis and fluorescent in situ hybridization.


View larger version (31K):
[in this window]
[in a new window]
  		FIG. 3.   Southern analysis of the HS3c deletion showing the presence of HS4 in the Delta HS3c beta -YAC transgenic lines. (A) A map of the wild-type 784-bp PstI fragment (GeneBank coordinates indicated) and the 550-bp PstI fragment deleted from the HS3c elements is shown above the autoradiograph. All DNA samples were digested with PstI. Lane WT contains DNA from a transgenic mouse line carrying a wild-type beta -YAC. Lanes A to D correspond to the four lines of Fig. 2. Each line has the predicted 550-bp fragment which is diagnostic of the HS3c deletion. The probe was the 784-bp PstI HS3 fragment. M, molecular weight. (B) HS2 to -4 reside on a 10.4-kb EcoRI fragment (GeneBank coordinates indicated) in the wild-type beta -globin locus. As shown in the diagram, the creation of an EcoRI site by site-directed mutagenesis and subsequent deletion of the HS3c element results in a 4.5-kb EcoRI fragment containing HS4 and a 5.6-kb fragment containing HS2. The autoradiogram shows the results of EcoRI digestion of samples from the control (lane WT) and lines A to D. Notice that all lines contain a 5.6- and a 4.5-kb fragment, indicating that HS4 is linked to the HS3c deletion. The probe was the 1.4-kb SpeI-HindIII fragment spanning the HS3c element. M, molecular size (in kilobases).


View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.   Detection of the 3' beta  enhancer (3'beta enh) in line D by Southern analysis. (A) Map of the location of the 260-bp PstI fragment containing the 3' beta  enhancer (indicated by the hatched box) relative to the beta -globin gene (indicated by the black box). Restriction enzyme sites and GenBank coordinates are shown below the map. The fragment sizes in wild-type DNA indicated below the map are 4.9 kb for BglII, 3.7 kb for EcoRI, and 1.9 kb for EcoRI-XbaI. (B) Southern analysis of DNAs from the wild-type (WT) beta -YAC line and line D digested with the restriction enzymes indicated above each lane as follows: B, BglII; E, EcoRI; and E/X, EcoRI-XbaI. The probe was a 771-bp EcoRI-PstI fragment indicated in panel A as a solid bar. Migration positions of lambda HindIII size markers are indicated to the right of the autoradiogram, and positions of molecular size markers (M) (in kilobases) are indicated to the left.

Deletion of the HS3 core element abolishes varepsilon -globin gene expression during embryonic erythropoiesis. Transgenic mice carrying a wild-type beta -YAC express human varepsilon -globin mRNA in the yolk sac stage of erythropoiesis. varepsilon -Globin mRNA ranges from 10 to 20% of murine alpha - plus zeta -globin mRNA (per copy) in the yolk sac, and it continues to be synthesized in circulating embryonic erythroblasts. Synthesis peaks in the embryonic erythroblasts at about day 12 of development.

Developmental studies were performed with yolk sac and blood samples from day 10 F2 embryos and with blood samples from day 12 and 14 F2 fetuses. Staining of fixed yolk sac or blood preparations with anti-human varepsilon -globin fluorescent monoclonal antibody failed to detect any varepsilon -globin in the primitive erythroblasts of the Delta HS3c transgenic embryos (not shown). Total RNA from yolk sac and blood samples from multiple embryos of the same litter were subjected to RNase protection analysis with human varepsilon - and gamma -globin and mouse alpha - and zeta -globin antisense RNA probes. In contrast to the wild-type beta -YAC controls, varepsilon -globin mRNA was undetectable in day 10 yolk sac from all four Delta HS3c beta -YAC lines (Fig. 5). In the day 12 blood, where peak values of varepsilon -globin mRNA are normally found, varepsilon -globin mRNA was not detected in one of the lines and was 1.5% or less in the other three lines (Fig. 6). These data suggest that the HS3 core element is necessary for varepsilon -globin gene transcription during the embryonic stage of erythropoiesis.


View larger version (78K):
[in this window]
[in a new window]
  		FIG. 5.   Expression of the human varepsilon -globin gene in day 10 embryonic yolk sacs from F2 progeny of beta -YAC transgenic lines containing the deletion of the HS3c element. Two littermates were examined from each transgenic line. Lanes 1, RNase protections with antisense probes for human varepsilon - and gamma -globin and murine alpha - and zeta -globin mRNAs; lanes 2, RNase protections with only a human varepsilon -globin mRNA antisense probe in order to unambiguously test for the presence of varepsilon -globin mRNA. Notice the presence of varepsilon -globin mRNA in the control (wild type [WT]) and its complete absence in the lanes of lines A to D. The migrations of the protected fragments are shown to the right of the autoradiogram; the size of each fragment (in bases) is shown in parentheses. Huvarepsilon , human varepsilon -globin; Hugamma , human gamma -globin; Moalpha , mouse alpha -globin; mozeta , mouse zeta -globin.


View larger version (89K):
[in this window]
[in a new window]
  		FIG. 6.   mRNA analysis of F2 progeny of beta -YAC transgenic mice carrying a deletion of the HS3c element. Total RNA was isolated from day 12 liver and blood, day 14 liver, and adult blood from two or three F2 littermates from each line and subjected to RNase protection analysis. The migrations of the protected fragments are shown to the right of each autoradiogram; the size of each fragment (in bases) is shown in parentheses. Panels A to D correspond to lines A to D. Lanes b contain blood mRNA; lanes l contain liver RNA. Notice in the day 12 (12d) samples of all lines the normal levels of gamma -globin mRNA in the blood (see also Table 1) and the striking decreases in levels of gamma -globin mRNA in the day 12 and 14 liver mRNA preparations. Also notice the variation in beta -globin mRNA levels in the day 12 or 14 liver samples as well as in the adult blood. See the legend to Fig. 5 for clarification of the abbreviations.

Normal gamma -globin gene expression in the embryonic cells of Delta HS3c transgenic mice. In contrast to the severe reduction of varepsilon -globin gene expression, gamma -globin gene expression was normal in embryonic erythrocytes. Multiple embryos from the same litter were used for RNase protection assays to minimize experimental error and determine sample variation. As shown in Table 1, all lines displayed, in the day 10 yolk sac, levels of gamma -globin mRNA that were similar to those observed in control wild-type beta -YAC mice. Similar results were obtained with day 12 fetal blood (Fig. 6), which consisted mostly of nucleated erythrocytes of yolk sac origin. Mean levels of gamma -globin mRNA were 71 and 72% of those of the controls on days 10 and 12, respectively, but the difference from levels in the wild-type beta -YAC control mice was not statistically significant. Most importantly, there was only a small degree of variation in the per copy levels of gamma -globin mRNA between lines; levels of gamma -globin mRNA in Delta HS3c embryos varied by 1.5-fold, indicating the absence of position effects. A statistical measure of variability is the coefficient of variation (sigma /µ) in the levels of per copy expression between lines. Coefficients of variation smaller than 0.5 in levels of globin gene expression between lines denote a small, statistically insignificant degree of variation (25, 35). As calculated from the data of Table 1, the coefficients of variation in the levels of per copy gamma -globin gene expression were 0.16 and 0.26 for day 10 and 12 embryonic erythropoiesis in the Delta HS3c lines and 0.26 and 0.27 for day 10 and 12 embryonic erythropoiesis in the wild-type beta -YAC controls. These results show that the level of gamma -globin gene expression in the embryonic cells of the Delta HS3c mice was nearly normal and that it was not influenced by the position of integration of the transgene.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Human globin mRNA levels per copy of transgene and copy of endogenous murine alpha -globin gene in Delta HS3c mice and wild-type beta -YAC control mice

Deletion of the HS3 core abolishes gamma -globin gene expression in definitive erythroid cells. The definitive stage of erythropoiesis begins in the murine fetal liver on day 10.5, and it is characterized by the exclusive transcription of the two adult globins, beta -major and beta -minor. In transgenic mice carrying a wild-type human beta -YAC, the gamma -globin genes were active in the fetal liver and the mean gamma -globin mRNA level in the livers of the day 12 wild-type beta -YAC fetuses was 16.1% ± 6.7% of the murine alpha - and zeta -globin mRNA levels (Table 1). In contrast, levels of gamma -globin mRNA in the day 12 livers of Delta HS3c transgenic fetuses were strikingly reduced and ranged from 1.3 to 2.2% of levels of murine alpha - and zeta -globin (Fig. 6 and Table 1). In wild-type beta -YAC transgenics there is a rapid switch from gamma - to beta -globin, so that by day 14 the mean level of gamma -globin mRNA in fetal liver is 6.4% ± 3.4% of the levels of murine alpha - and zeta -globin mRNA (Table 1). gamma -Globin mRNA was not detectable by the RNase protection assay in the livers of the 14-day-old fetuses of the four Delta HS3c lines (Table 1).

Embryonic erythroblasts contaminate the fetal livers of transgenic mice and contribute to the species of globin mRNAs detected in the fetal liver preparations from early fetuses (reference 38 and unpublished data). It was therefore possible that the low levels of gamma -globin mRNA present in the liver RNA samples of the day 12 Delta HS3c fetuses derived from contaminating embryonic erythroblasts. To test this possibility, day 12 fetal liver preparations were stained with anti-gamma -globin-chain monoclonal antibodies. As shown in Fig. 7A and B, only embryonic erythroblasts of yolk sac origin, characterized by their large size, their large cytoplasm/nucleus ratio, and their pycnotic nucleus, stained with the anti-gamma -globin-chain fluorescent antibody. There was no fluorescent labeling of the definitive erythroblasts other than background staining. These results suggest that the gamma -globin mRNA measured in the livers of the day 12 Delta HS3c fetuses derived from embryonic erythroblasts and that there was no detectable gamma -globin gene expression in the definitive erythroid cells of fetal liver origin.


View larger version (123K):
[in this window]
[in a new window]
  		FIG. 7.   Staining with fluoroscein isothiocyanate conjugated anti-human globin-chain antibodies of day 12 fetal liver preparations of F2 transgenic mice carrying the HS3c deletion. (A and B) Staining with anti-gamma -globin-chain antibodies. Notice that only the embryonic erythroblasts, recognized by their large size and high cytoplasm/nucleus ratio, are stained. (C and D) Staining with the anti-beta -globin-chain antibodies. Notice the heterogeneity of beta -globin-chain synthesis among the erythroblasts of definitive erythropoiesis; several nonstained embryonic erythrocytes can be seen in the background of panels C and D.

beta -Globin gene expression in Delta HS3c beta -YAC transgenic mice is decreased and position dependent. In wild-type beta -YAC mice, beta -globin gene expression is similar to that of the endogenous murine genes and there is relatively small variation in the levels of per copy beta -globin gene expression among lines. beta -Globin gene expression is copy number dependent, indicating that the genes of the beta -YAC are protected from position effects (31-33). The small degree of variation in levels of beta -globin gene expression in the wild-type beta -YAC mice is reflected in the small coefficient of variation (0.35) of the control lines, shown in Table 1. beta -Globin gene expression in the Delta HS3c mice was significantly lower than that in control mice, and per copy levels of beta -globin gene expression displayed striking variation. The per copy levels of beta -globin mRNA varied, among the four lines, 10- and 17-fold in the day 12 and 14 fetal liver definitive erythroblasts and 19.8-fold in adult erythrocytes (Table 1), indicating that beta -globin gene expression is strongly influenced by the position of integration of the transgene. Coefficients of variation for the levels of per copy beta -globin gene expression for the day 12 and 14 fetuses and the adult mice were 0.8, 0.79, and 0.77, respectively. The presence of strong position effects was also reflected in the striking heterogeneity in the staining of the definitive erythroblasts of the fetal liver preparations with the anti-beta -globin-chain fluorescent antibody (Fig. 7C and 7D).

DISCUSSION
Top
Previous
Next
References

Developmental specificity of the interaction between the core of HS3 and globin genes. Our results show that deletion of the core sequence of DNase I-hypersensitive site 3 of the LCR results in the absence of varepsilon -globin gene expression in day 10 embryonic cells and in the absence of gamma -globin gene expression in the cells of definitive erythropoiesis in the fetal liver. These results provide direct evidence that there is developmental specificity in the interactions between the LCR and the globin genes: in the presence of an otherwise intact LCR, the core of HS3 is necessary for the activation of the varepsilon -globin gene in embryonic cells and for activation of the gamma -globin gene in definitive cells.

That the HSs of the LCR may display developmental specificities was first shown by Fraser et al. in experiments with transgenic mice (14). Those authors produced a series of recombinant constructs in which LCR sequences containing DNase I-HS1, -2, -3, and -4 were linked to an ~36-kb cosmid containing the region of the beta -globin locus from the Ggamma -globin gene to the beta -globin gene (14). Transgenic mice carrying the HS2-Ggamma to -beta cosmid expressed the gamma -globin gene in the yolk sac and the beta -globin gene in the adult cells, suggesting that HS2 interacts equally well with the gamma - and beta -globin genes. In contrast, the mice carrying the HS3-Ggamma to -beta cosmid were characterized by high gamma -globin expression in embryos and fetuses and low beta -globin expression in adults, indicating a preferential interaction of HS3 with the gamma -globin gene. The opposite phenotype was observed in HS4-Ggamma to -beta transgenics (14). Developmental specificity of HS3 was also demonstrated in a study of transgenic mice carrying HS3-gamma beta and HS2-gamma beta constructs that showed a qualitative difference between HS2 and HS3 with respect to gamma -globin gene expression (25). Our results support these previous conclusions and, further, provide evidence that specific sequences of the LCR interact with specific globin genes at specific stages of development.

Bungert et al. (3) have produced transgenic mice carrying either a deletion of HS3c or a replacement of HS3c with HS4c in the context of a 150-kb beta -YAC. One Delta HS3c line showed nearly normal gamma -globin gene expression and the near absence of varepsilon -globin gene expression in the yolk sac cells. Two lines with substitutions of HS4c for HS3c had a significant reduction of varepsilon -globin gene expression, as would be expected if HS3c is necessary for activation of the varepsilon -globin gene in embryonic cells.

The LCR may change conformations during development. Studies of gamma - and beta -globin primary transcripts in fetal erythroid cells of transgenic mice carrying a normal beta -globin locus have shown that the LCR interacts with only one gene at any given time and that it switches back and forth between the two genes in a flip-flop type of mechanism (46). Similar results have been obtained by Fraser et al. (12a) with embryonic cells in which both the varepsilon - and the gamma -globin gene are transcribed from a single locus. Such oscillations of the interactions of the LCR with the varepsilon - and the gamma -globin genes should occur in the embryonic cells of transgenic mice carrying the Delta HS3c beta -YAC. If the gamma -globin genes of the embryonic cells interacted with the mutant HS3 whose core is deleted, these gamma -globin genes should have been transcriptionally inactive. Since gamma -globin gene expression was normal in the embryonic cells of the Delta HS3c mice, an HS of the LCR other than HS3 should have engaged the gamma -globin gene and activated its promoter. These results suggest that different HSs of the LCR interact with the gamma - or the varepsilon -globin gene in an embryonic cell. On the basis of the transcriptional behavior of the gamma -globin genes in embryonic cells (normal expression) and in fetal cells (no expression), we can also conclude that different HSs of the LCR interact with the gamma -globin genes of the embryonic cells or with the gamma -globin genes of the fetal cells.

The prevailing hypothesis of the structure-function relationship of the LCR is that LCR sequences interact with various constitutive and erythroid-lineage-specific transcriptional factors in a way that leads to formation of a complex (holocomplex [46]). Perhaps this complex attains a specific conformation which is optimal for interaction of the LCR with a globin gene. The strikingly different phenotypes of gamma -globin gene expression in embryonic and fetal cells raise the possibility that the LCR attains different conformations in order to interact with the gamma -globin genes of embryonic cells or with the gamma -globin genes of definitive cells. The conformation of the LCR may change as the transcriptional milieu of the erythroid cells changes during the course of development.

Role of the core of HS3 in the opening of the beta -globin locus chromatin domain in embryonic and in definitive erythroid cells. Although beta -globin mRNA was present in the Delta HS3c adult mice, beta -globin mRNA levels varied by 19.8-fold among lines, indicating that beta -globin gene expression is strongly influenced by the position of integration of the transgene. These results support previous suggestions that the core of HS3 is required for opening of the globin chromatin domain in cells of definitive (liver-stage) erythropoiesis (6). In contrast to the position-sensitive beta -globin gene expression in definitive erythroid cells, there was minimal variation in levels of gamma -globin mRNA among the Delta HS3c lines, indicating that gamma -globin gene expression in the embryonic cells of the Delta HS3c transgenic mice is not influenced by the position of the integration of the transgene. These results suggest that, in contrast to the adult cells, the core of HS3 is not an important contributor to the function of the LCR, which opens the globin locus domain in embryonic cells. Apparently, in the Delta HS3c mice the domain-opening function of the LCR is conducted by other DNase I HSs.

The phenotypes of deletions that remove the core of HS3 as well as the sequences flanking the core. Peterson et al. (32) have deleted 2.3 kb of HS3 (including the HS3 core) in the context of a 248-kb beta -YAC. Transgenic mice carrying these Delta HS3 beta -YACs displayed, in embryonic cells, about a threefold reduction in varepsilon -globin gene expression compared to that of controls but no reduction of gamma -globin gene expression in the fetal cells. Hug et al. (19) deleted 2.3 kb of murine HS3 through homologous recombination in embryonic stem cells and analyzed murine globin gene expression in chimeric mice; there was only a small (about 20%) reduction in expression of the murine globin genes in embryonic or in definitive erythropoiesis. It thus appears that the specific effects on varepsilon - and gamma -globin gene expression produced by the HS3 core deletions are not observed when the sequences flanking the core are also deleted. One way of reconciling these results is to assume that the core of HS3 and the HS3 flanking sequences possess different, but complementary, functions. The sequences flanking the core of HS3 may function by engaging a globin gene and positioning it in a way that allows optimal interaction of the gene with the HS3 core element; the HS3 core element, on the other hand, may interact with the transcriptional complex of the gene, thus activating globin gene expression. When the core element is deleted, as in the Delta HS3c beta -YAC, the HS3 flanking region still interacts with the globin gene but activation of transcription does not occur. When the whole HS3 is deleted, another HS interacts with the gamma -globin gene and there is minimal effect on gene expression. Redundancy of the functions of HSs is supported by several observations (8, 19, 32), and there is evidence from various experiments suggesting that the flanking sequences of HSs have a role in HS function (21, 24, 29).

The HS3 core and embryonic expression of the gamma -globin gene. Several species have genes which are orthologous to the gamma -globin genes of primates, but they are expressed only in embryonic cells. The beta h1 gene of the mouse is such an example. The expression of the gamma -globin genes of primates was initially limited to the embryonic stage of erythropoiesis until the so-called fetal recruitment of the gamma -globin genes; i.e., the expression of gamma -globin genes in the definitive cells of the fetal liver stage of erythropoiesis occurred about 30 to 50 million years ago (17). As we show here, when the core of HS3 is deleted, the gamma -globin gene becomes an embryonic gene, i.e., it is expressed exclusively in embryonic cells. This reversion of the gamma -globin gene to its ancestral developmental pattern raises the possibility that the sequences of the core of HS3 may have contributed to the recruitment of its expression in fetal erythroid cells. Mutations that accumulated, during the evolution of primates, either in the gamma -globin gene promoter, in the HS3 core sequence, or in both may have created the protein binding site(s) which allows the interaction between the core of HS3 and the gamma -globin gene to occur in the cells of fetal liver erythropoiesis.

ACKNOWLEDGMENTS
Top
Previous
Next
References

We thank Richard Swank for comments on the manuscript.

This work was supported by National Institutes of Health grants DK45365, HL53750, and HL20899.

FOOTNOTES

* Corresponding author. Mailing address: University of Washington, Division of Medical Genetics, Box 357720, Seattle, WA 98195. Phone: (206) 543-3526. Fax: (206) 543-3050. E-mail: gstam{at}u.washington.edu.

REFERENCES
Top
Previous

1. Baron, M. H., and T. Maniatis. 1986. Rapid reprogramming of globin gene expression in transient heterokaryons. Cell 46:591-602[Medline].
2. Behringer, R. R., R. E. Hammer, R. L. Brinster, R. D. Palmiber, and T. M. Townes. 1987. Two 3' sequences direct adult erythroid-specific expression of human beta -globin gene in transgenic mice. Proc. Natl. Acad. Sci. USA 84:7056-7060[Abstract/Free Full Text].
3. Bungert, J., U. Dave, K.-C. Lim, K. H. Lieuw, J. A. Shavit, Q. Liu, and J. D. Engel. 1995. Synergistic regulation of human beta -globin gene switching by locus control region elements HS3 and HS4. Genes Dev. 9:3083-3096[Abstract/Free Full Text].
4. Curtin, P., M. Pirastu, Y. W. Kan, J. A. Gobert-Jones, A. D. Stephens, and H. Lehmann. 1985. A distant gene deletion affects beta -globin gene function in an atypical gamma delta beta -thalassemia. J. Clin. Invest. 76:1554-1558.
5. Driscoll, M. C., C. S. Dobkin, and B. P. Alter. 1989. gamma delta beta -Thalassemia due to a de novo mutation deleting the 5' beta -globin gene activation-region hypersensitive sites. Proc. Natl. Acad. Sci. USA 86:7470-7474[Abstract/Free Full Text].
6. Ellis, J., K. C. Tan-Un, A. Harper, D. Michalovich, N. Yannoutsos, S. Philipsen, and F. Grosveld. 1996. A dominant chromatin-opening activity in 5' hypersensitive site 3 of the human beta -globin locus control region. EMBO J. 15:562-568[Medline].
7. Felsenfeld, G. 1992. Chromatin as an essential part of the transcriptional mechanism. Nature (London) 355:219-224[Medline].
8. Fiering, S., E. Epner, K. Robinson, Y. Zhuang, A. Telling, M. Hu, D. I. Martin, T. Enver, T. J. Ley, and M. Groudine. 1995. Targeted deletion of 5'HS2 of the murine beta -globin LCR reveals that it is not essential for proper regulation of the beta -globin locus. Genes Dev. 9:2203-2213[Abstract/Free Full Text].
9. Forrester, W. C., C. Thompson, J. T. Elder, and M. Groudine. 1986. A developmentally stable chromatin structure in the human beta -globin gene cluster. Proc. Natl. Acad. Sci. USA 83:1359-1363[Abstract/Free Full Text].
10. Forrester, W. C., S. Takegawa, T. Papayannopoulou, G. Stamatoyannopoulos, and M. Groudine. 1987. Evidence for a locus activation region: the formation of developmentally stable hypersensitive sites in globin-expressing hybrids. Nucleic Acids Res. 15:10159-10177[Abstract/Free Full Text].
11. Forrester, W. C., U. Novak, R. Gelinas, and M. Groudine. 1989. Molecular analysis of the human beta -globin locus activation region. Proc. Natl. Acad. Sci. USA 86:5439-5443[Abstract/Free Full Text].
12. Forrester, W. C., E. Epner, M. C. Driscoll, T. Enver, M. Brice, T. Papayannopoulou, and M. Groudine. 1990. A deletion of the human beta -globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta -globin locus. Genes Dev. 4:1637-1649[Abstract/Free Full Text].
12a. Fraser, P., et al. Personal communication.
13. Fraser, P., J. Hurst, P. Collis, and F. Grosveld. 1990. DNaseI hypersensitive sites 1, 2 and 3 of the human beta -globin dominant control region direct position-independent expression. Nucleic Acids Res. 18:3503-3508[Abstract/Free Full Text].
14. Fraser, P., S. Pruzina, M. Antoniou, and F. Grosveld. 1993. Each hypersensitive site of the human beta -globin locus control region confers a different developmental pattern of expression on the globin genes. Genes Dev. 7:106-113[Abstract/Free Full Text].
15. Gaensler, K. M. L., M. Kitamura, and Y. W. Kan. 1993. Germ-line transmission and developmental regulation of a 150-kb yeast artificial chromosome containing the human beta -globin locus in transgenic mice. Proc. Natl. Acad. Sci. USA 90:11381-11385[Abstract/Free Full Text].
16. Gnirke, A., C. Huxley, K. Peterson, and M. V. Olson. 1993. Microinjection of intact 200- to 500-kb fragments of YAC DNA into mammalian cells. Genomics 15:659-667[Medline].
17. Goodman, M., J. Czelusniak, B. F. Koop, D. A. Tagle, and J. L. Slighton. 1987. Globin: a case study in molecular phylogeny. Cold Spring Harbor Symp. Quant. Biol. 52:875-900[Abstract/Free Full Text].
18. Grosveld, F., G. B. van Assendelft, D. R. Greaves, and G. Kollias. 1987. Position-independent, high-level expression of the human beta -globin gene in transgenic mice. Cell 51:975-985[Medline].
19. Hug, B. A., R. L. Wesselschmidt, S. Fiering, M. A. Bender, E. Epner, M. Groudine, and T. J. Ley. 1996. Analysis of mice containing a targeted deletion of beta -globin locus control region 5' hypersensitive site 3. Mol. Cell. Biol. 16:2906-2912[Abstract].
20. Huxley, C., and A. Gnirke. 1991. Transfer of yeast artificial chromosomes from yeast to mammalian cells. Bioessays 13:545-550[Medline].
21. Jackson, J. D., H. Petrykowska, S. Philipsen, W. Miller, and R. Hardison. 1996. Role of DNA sequences outside of the cores of DNase hypersensitive sites (HSs) in functions of the beta -globin locus control region. Domain opening and synergism between HS2 and HS3. J. Biol. Chem. 271:11871-11878[Abstract/Free Full Text].
22. Kioussis, D., E. Vanin, T. deLange, R. A. Flavell, and F. G. Grosveld. 1983. beta -Globin gene inactivation by DNA translocation in gamma beta -thalassaemia. Nature (London) 306:662-666[Medline].
23. Kollias, G., J. Hurst, E. deBoer, and F. Grosveld. 1987. The human beta -globin gene contains a downstream developmental specific enhancer. Nucleic Acids Res. 15:5739-5747[Abstract/Free Full Text].
24. Li, Q., B. Zhou, P. Powers, T. Enver, and G. Stamatoyannopoulos. 1990. beta -Globin locus activation regions: conservation of organization, structure, and function. Proc. Natl. Acad. Sci. USA 87:8207-8211[Abstract/Free Full Text].
25. Li, Q., and J. A. Stamatoyannopoulos. 1994. Position independence and proper developmental control of gamma -globin gene expression require both a 5' locus control region and a downstream sequence element. Mol. Cell. Biol. 14:6087-6096[Abstract/Free Full Text].
26. Li, Q., C. Clegg, K. Peterson, S. Shaw, N. Raich, and G. Stamatoyannopoulos. 1997. Binary transgenic mouse model for studying the trans control of globin gene switching: evidence that GAGA-1 is an in vivo repressor of human varepsilon  gene expression. Proc. Natl. Acad. Sci. USA 94:2444-2448[Abstract/Free Full Text].
27. Liu, D., J. C. Chang, P. Moi, W. Liu, Y. W. Kan, and P. T. Curtin. 1992. Dissection of the enhancer activity of beta -globin 5' DNase I-hypersensitive site 2 in transgenic mice. Proc. Natl. Acad. Sci. USA 89:3899-3903[Abstract/Free Full Text].
28. Milot, E., J. Strouboulis, T. Trimborn, M. Wijgerde, E. de Boer, A. Langeveld, K. Tan-Un, W. Vergeer, N. Yannoutsos, F. Grosveld, and P. Fraser. 1996. Heterochromatin effects on the frequency and duration of LCR-mediated gene transcription. Cell 87:105-114[Medline].
29. Moon, A. M., and T. J. Ley. 1990. Conservation of the primary structure, organization, and function of the human and mouse beta -globin locus-activating regions. Proc. Natl. Acad. Sci. USA 87:7693-7697[Abstract/Free Full Text].
30. Peterson, K. R., C. H. Clegg, C. Huxley, B. M. Josephson, H. S. Haugen, T. Furukawa, and G. Stamatoyannopoulos. 1993. Transgenic mice containing a 248-kb yeast artificial chromosome carrying the human beta -globin locus display proper developmental control of human globin genes. Proc. Natl. Acad. Sci. USA 90:7593-7597[Abstract/Free Full Text].
31. Peterson, K. R., Q. Li, C. H. Clegg, T. Furukawa, P. A. Navas, E. J. Norton, T. G. Kimbrough, and G. Stamatoyannopoulos. 1995. Use of yeast artificial chromosomes (YACs) in studies of mammalian development: production of beta -globin locus YAC mice carrying human globin developmental mutants. Proc. Natl. Acad. Sci. USA 92:5655-5659[Abstract/Free Full Text].
32. Peterson, K. R., C. H. Clegg, P. A. Navas, E. J. Norton, T. G. Kimbrough, and G. Stamatoyannopoulos. 1996. Effect of deletion of 5'HS3 or 5'HS2 of the human beta -globin locus control region on the developmental regulation of globin gene expression in beta -globin locus yeast artificial chromosome transgenic mice. Proc. Natl. Acad. Sci. USA 93:6605-6609[Abstract/Free Full Text].
33. Peterson, K. R., P. A. Navas, Q. Li, C. H. Clegg, and G. Stamatoyannopoulos. Human beta -globin locus YAC transgenic mice: relationship of transgene structural integrity to globin gene function using 248 kb and 155 kb beta -globin YACs. Submitted for publication.
34. Philipsen, S., D. Talbot, P. Fraser, and F. Grosveld. 1990. The beta -globin dominant control region: hypersensitive site 2. EMBO J. 9:2159-2167[Medline].
35. Philipsen, S., S. Pruzina, and F. Grosveld. 1993. The minimal requirements for activity in transgenic mice of hypersensitive site 3 of the beta -globin locus control region. EMBO J. 12:1077-1085[Medline].
36. Porcu, S., M. Kitamura, E. Witkowska, Z. Zhang, A. Mutero, C. Lin, J. Chang, and K. M. L. Gaensler. 1997. The human beta  globin locus introduced by YAC transfer exhibits a specific and reproducible pattern of developmental regulation in transgenic mice. Blood 90:4602-4609[Abstract/Free Full Text].
37. Pruzina, S., O. Hanscombe, D. Whyatt, F. Grosveld, and S. Philipsen. 1991. Hypersensitive site 4 of the human beta -globin locus control region. Nucleic Acids Res. 19:1413-1419[Abstract/Free Full Text].
38. Raich, N., T. Enver, B. Nakamoto, B. Josephson, T. Papayannopoulou, and G. Stamatoyannopoulos. 1990. Autonomous developmental control of human embryonic globin gene switching in transgenic mice. Science 250:1147-1149[Abstract/Free Full Text].
39. Ryan, T. M., R. R. Behringer, N. C. Martin, T. M. Townes, R. D. Palmiter, and R. L. Brinster. 1989. A single erythroid-specific DNase I super-hypersensitive site activates high levels of human beta -globin gene expression in transgenic mice. Genes Dev. 3:314-323[Abstract/Free Full Text].
40. Strouboulis, J., N. Dillon, and F. Grosveld. 1992. Developmental regulation of a complete 70-kb human beta -globin locus in transgenic mice. Genes Dev. 6:1857-1864[Abstract/Free Full Text].
41. Talbot, D., P. Collis, M. Antoniou, M. Vidal, F. Grosveld, and D. R. Greaves. 1989. A dominant control region from the human beta -globin locus conferring integration site-independent gene expression. Nature (London) 338:352-355[Medline].
42. Talbot, D., S. Philipsen, P. Fraser, and F. Grosveld. 1990. Detailed analysis of the site 3 region of the human beta -globin dominant control region. EMBO J. 9:2169-2177[Medline].
43. Trudel, M., and F. Costantini. 1987. A 3' enhancer contributes to the stage-specific expression of the human beta -globin gene. Genes Dev. 1:954-961[Abstract/Free Full Text].
44. Tuan, D., W. Solomon, Q. Li, and I. M. London. 1985. The "beta -like-globin" gene domain in human erythroid cells. Proc. Natl. Acad. Sci. USA 82:6384-6388[Abstract/Free Full Text].
45. van Assendelft, G. B., O. Hanscombe, F. Grosveld, and D. R. Greaves. 1989. The beta -globin dominant control region activates homologous and heterologous promoters in a tissue-specific manner. Cell 56:969-977[Medline].
46. Wijgerde, M., F. Grosveld, and P. Fraser. 1995. Transcription complex stability and chromatin dynamics in vivo. Nature (London) 377:209-213[Medline].
47. Winston, F., F. Chumley, and G. R. Fink. 1983. Eviction and transplacement of mutant genes in yeast. Methods Enzymol. 101:211-228[Medline].

Mol Cell Biol, July 1998, p. 4188-4196, Vol. 18, No. 7
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Sankaran, V. G., Menne, T. F., Xu, J., Akie, T. E., Lettre, G., Van Handel, B., Mikkola, H. K. A., Hirschhorn, J. N., Cantor, A. B., Orkin, S. H. (2008). Human Fetal Hemoglobin Expression Is Regulated by the Developmental Stage-Specific Repressor BCL11A. Science 322: 1839-1842 [Abstract] [Full Text]  
  • Harju-Baker, S., Costa, F. C., Fedosyuk, H., Neades, R., Peterson, K. R. (2008). Silencing of A{gamma}-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the -566 GATA Site. Mol. Cell. Biol. 28: 3101-3113 [Abstract] [Full Text]  
  • Chang, K.-H., Nelson, A. M., Cao, H., Wang, L., Nakamoto, B., Ware, C. B., Papayannopoulou, T. (2006). Definitive-like erythroid cells derived from human embryonic stem cells coexpress high levels of embryonic and fetal globins with little or no adult globin. Blood 108: 1515-1523 [Abstract] [Full Text]  
  • Xu, X., Scott, M. M., Deneris, E. S. (2006). Shared Long-Range Regulatory Elements Coordinate Expression of a Gene Cluster Encoding Nicotinic Receptor Heteromeric Subtypes. Mol. Cell. Biol. 26: 5636-5649 [Abstract] [Full Text]  
  • Yu, M., Han, H., Xiang, P., Li, Q., Stamatoyannopoulos, G. (2006). Autonomous Silencing as Well as Competition Controls {gamma}-Globin Gene Expression during Development.. Mol. Cell. Biol. 26: 4775-4781 [Abstract] [Full Text]  
  • Navas, P. A., Li, Q., Peterson, K. R., Stamatoyannopoulos, G. (2006). Investigations of a Human Embryonic Globin Gene Silencing Element Using YAC Transgenic Mice.. Exp. Biol. Med. 231: 328-334 [Abstract] [Full Text]  
  • Hu, X., Bulger, M., Bender, M. A., Fields, J., Groudine, M., Fiering, S. (2006). Deletion of the core region of 5' HS2 of the mouse {beta}-globin locus control region reveals a distinct effect in comparison with human {beta}-globin transgenes. Blood 107: 821-826 [Abstract] [Full Text]  
  • Harju, S., Navas, P. A., Stamatoyannopoulos, G., Peterson, K. R. (2005). Genome Architecture of the Human {beta}-Globin Locus Affects Developmental Regulation of Gene Expression. Mol. Cell. Biol. 25: 8765-8778 [Abstract] [Full Text]  
  • Xiang, P., Han, H., Barkess, G., Olave, I., Fang, X., Yin, W., Stamatoyannopoulos, G., Li, Q. (2005). Juxtaposition of the HPFH2 enhancer is not sufficient to reactivate the {gamma}-globin gene in adult erythropoiesis. Hum Mol Genet 14: 3047-3056 [Abstract] [Full Text]  
  • Fang, X., Sun, J., Xiang, P., Yu, M., Navas, P. A., Peterson, K. R., Stamatoyannopoulos, G., Li, Q. (2005). Synergistic and Additive Properties of the Beta-Globin Locus Control Region (LCR) Revealed by 5'HS3 Deletion Mutations: Implication for LCR Chromatin Architecture. Mol. Cell. Biol. 25: 7033-7041 [Abstract] [Full Text]  
  • Patrinos, G. P., de Krom, M., de Boer, E., Langeveld, A., Imam, A.M. A., Strouboulis, J., de Laat, W., Grosveld, F. G. (2004). Multiple interactions between regulatory regions are required to stabilize an active chromatin hub. Genes Dev. 18: 1495-1509 [Abstract] [Full Text]  
  • Navas, P. A., Swank, R. A., Yu, M., Peterson, K. R., Stamatoyannopoulos, G. (2003). Mutation of a transcriptional motif of a distant regulatory element reduces the expression of embryonic and fetal globin genes. Hum Mol Genet 12: 2941-2948 [Abstract] [Full Text]  
  • Jackson, D. A., McDowell, J. C., Dean, A. (2003). {beta}-Globin locus control region HS2 and HS3 interact structurally and functionally. Nucleic Acids Res 31: 1180-1190 [Abstract] [Full Text]  
  • Hu, X., Bulger, M., Roach, J. N., Eszterhas, S. K., Olivier, E., Bouhassira, E. E., Groudine, M. T., Fiering, S. (2003). Promoters of the murine embryonic beta -like globin genes Ey and beta h1 do not compete for interaction with the beta -globin locus control region. Proc. Natl. Acad. Sci. USA 100: 1111-1115 [Abstract] [Full Text]  
  • Li, Q., Peterson, K. R., Fang, X., Stamatoyannopoulos, G. (2002). Locus control regions. Blood 100: 3077-3086 [Abstract] [Full Text]  
  • Harju, S., McQueen, K. J., Peterson, K. R. (2002). Chromatin Structure and Control of {beta}-Like Globin Gene Switching. Exp. Biol. Med. 227: 683-700 [Abstract] [Full Text]  
  • Navas, P. A., Li, Q., Peterson, K. R., Swank, R. A., Rohde, A., Roy, J., Stamatoyannopoulos, G. (2002). Activation of the {beta}-like globin genes in transgenic mice is dependent on the presence of the {beta}-locus control region. Hum Mol Genet 11: 893-903 [Abstract] [Full Text]  
  • De Val, S., Ponticos, M., Antoniv, T. T., Wells, D. J., Abraham, D., Partridge, T., Bou-Gharios, G. (2002). Identification of the Key Regions within the Mouse Pro-alpha 2(I) Collagen Gene Far-upstream Enhancer. J. Biol. Chem. 277: 9286-9292 [Abstract] [Full Text]  
  • Yu, T., Thomas, D. M., Zhu, W., Goodman, M., Gumucio, D. L. (2002). Regulation of fetal versus embryonic gamma globin genes: appropriate developmental stage expression patterns in the presence of HS2 of the locus control region. Blood 99: 1082-1084 [Abstract] [Full Text]  
  • Bender, M. A., Roach, J. N., Halow, J., Close, J., Alami, R., Bouhassira, E. E., Groudine, M., Fiering, S. N. (2001). Targeted deletion of 5'HS1 and 5'HS4 of the {beta}-globin locus control region reveals additive activity of the DNaseI hypersensitive sites. Blood 98: 2022-2027 [Abstract] [Full Text]  
  • Molete, J. M., Petrykowska, H., Bouhassira, E. E., Feng, Y.-Q., Miller, W., Hardison, R. C. (2001). Sequences Flanking Hypersensitive Sites of the {beta}-Globin Locus Control Region Are Required for Synergistic Enhancement. Mol. Cell. Biol. 21: 2969-2980 [Abstract] [Full Text]  
  • Duan, Z., Stamatoyannopoulos, G., Li, Q. (2001). Role of NF-Y in In Vivo Regulation of the {gamma}-Globin Gene. Mol. Cell. Biol. 21: 3083-3095 [Abstract] [Full Text]  
  • Rubin, J. E., Pasceri, P., Wu, X., Leboulch, P., Ellis, J. (2000). Locus control region activity by 5'HS3 requires a functional interaction with beta -globin gene regulatory elements: expression of novel beta /gamma -globin hybrid transgenes. Blood 95: 3242-3249 [Abstract] [Full Text]  
  • Lee, C.-H., Murphy, M. R., Lee, J.-S., Chung, J. H. (1999). Targeting a SWI/SNF-related chromatin remodeling complex to the beta -globin promoter in erythroid cells. Proc. Natl. Acad. Sci. USA 96: 12311-12315 [Abstract] [Full Text]  
  • Bulger, M., Groudine, M. (1999). Looping versus linking: toward a model for long-distance gene activation. Genes Dev. 13: 2465-2477 [Full Text]  
  • Lee, J.-S., Lee, C.-H., Chung, J. H. (1999). The beta -globin promoter is important for recruitment of erythroid Kruppel-like factor to the locus control region in erythroid cells. Proc. Natl. Acad. Sci. USA 96: 10051-10055 [Abstract] [Full Text]  
  • Zhu, W., TomHon, C., Mason, M., Campbell, T., Shelden, E., Richards, N., Goodman, M., Gumucio, D. L. (1999). Analysis of Linked Human {varepsilon} and {gamma} Transgenes: Effect of Locus Control Region Hypersensitive Sites 2 and 3 or a Distal YY1 Mutation on Stage-Specific Expression Patterns. Blood 93: 3540-3549 [Abstract] [Full Text]  
  • Sargent, T. G., DuBois, C. C., Buller, A. M., Lloyd, J. A. (1999). The Roles of 5'-HS2, 5'-HS3, and the gamma -Globin TATA, CACCC, and Stage Selector Elements in Suppression of beta -Globin Expression in Early Development. J. Biol. Chem. 274: 11229-11236 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Navas, P. A.
Right arrow Articles by Stamatoyannopoulos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Navas, P. A.
Right arrow Articles by Stamatoyannopoulos, G.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»