![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Mol Cell Biol, July 1998, p. 4245-4251, Vol. 18, No. 7
Department of Genetics, University of
Pennsylvania Medical School, Philadelphia, Pennsylvania
19104-6145,1 and
Division of Molecular
Biology of the Cell I, German Cancer Research Centre, D-69120
Heidelberg, Germany2
Received 5 February 1998/Returned for modification 2 April
1998/Accepted 22 April 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Targeted Disruption of the Gene Encoding Hepatocyte
Nuclear Factor 3
Results in Reduced Transcription of
Hepatocyte-Specific Genes
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
 Top NextReferences
|
|---|
The winged helix transcription factor hepatocyte nuclear factor
3
(HNF3) is expressed in embryonic endoderm and its derivatives liver, pancreas, stomach, and intestine, as well as in testis and
ovary. We have generated mice carrying an Hnf3g-lacZ fusion which deletes most of the HNF3 coding sequence as well as 5.5 kb of
3' flanking region. Mice homozygous for the mutation are fertile,
develop normally, and show no morphological defects. The mild
phenotype change of the Hnf3g
/ mice can be
explained in part by an upregulation of HNF3
and HNF3
in the
liver of the mutant animals. Analysis of steady-state mRNA levels
as well as transcription rates showed that levels of expression of
several HNF3 target genes (phosphoenolpyruvate carboxykinase,
transferrin, tyrosine aminotransferase) were reduced by 50 to 70%,
indicating that HNF3 is an important activator of these genes in
vivo.
INTRODUCTION
|
TopPreviousNextReferences
|
|---|
Transcription factors control gene
expression in adult liver and hepatoma cell lines. These factors
contain various structural motifs to allow for high-specificity DNA
binding; among them are the divergent homeodomain proteins hepatocyte
nuclear factor 1 (HNF1) and HNF1; the winged helix proteins
HNF3, -, and -; the leucine zipper proteins C/EBP and -;
the orphan nuclear receptor HNF4; and the D site binding protein (DBP)
(reviewed in references 5 and
32). Liver-specific gene expression cannot be
achieved through the action of any individual transcription factor,
because none of these factors is expressed exclusively in liver. When
cis-regulatory elements of liver-specific genes were
analyzed in detail, binding sites for multiple transcription factors
were found. Therefore, the combinatorial action of the regulatory
proteins most likely produces the stringency of hepatic gene
expression.
The HNF3 proteins were discovered by their ability to bind to the
promoters of the genes encoding 1-antitrypsin (1-AT) and transthyretin (TTR) (8). Cloning of the cDNAs identified
three HNF3 genes (HNF3, -, and -) in mammals (14,
15). The HNF3 genes are closely related to the Drosophila
melanogaster gene forkhead, which is essential for the
proper formation of the foregut and hindgut in flies (30).
Therefore, it has been suggested that the HNF3 genes function in
mammalian liver and gut development (15). This hypothesis is
supported by the observation that the HNF3 genes are expressed very
early during the formation of definite endoderm, from which liver and
gut are derived (3, 19, 27).
During formation of the definite endoderm, HNF3 is activated first,
followed by HNF3, and finally HNF3 (3, 19, 27). The
three HNF3 genes have different anterior boundaries of expression in
the definite endoderm, suggesting that they are involved in the
regionalization of the primitive gut tube. In addition, HNF3 is
expressed in the node, and HNF3 and HNF3 are both expressed in
the notochord and floorplate (3, 19, 27). HNF3 is
absolutely required for notochord and floorplate formation, because
these structures are missing in embryos homozygous for a targeted null mutation in the HNF3 gene (2, 31). However, because of
the early lethality of the homozygous mutant embryos, the role of HNF3 in gut and liver development has not yet been assessed.
It is our goal to test the hypothesis that the HNF3 proteins have an
important function in endoderm development and hepatic specification. We have generated a mutation in the gene encoding HNF3 (Hnf3g) via gene targeting as a first step towards
this goal. This mutation deletes the entire DNA binding domain of the HNF3 protein and is therefore considered a null allele. Here we
discuss the phenotypic consequences of the mutation on embryonic development and hepatic function.
MATERIALS AND METHODS
|
TopPreviousNextReferences
|
|---|
Gene targeting.
Lambda phage clones containing the murine
Hnf3g gene had been isolated from a mouse embryonic stem
cell (strain 129) library previously (11). A gene targeting
vector was constructed in the -galactosidase-containing plasmid pHM3
(12). A 3.2-kb BglII-SmaI (position
417 in the HNF-3 cDNA) fragment of the Hnf3g gene was used as the 5' homology and cloned in frame to the lacZ gene
of pHM3, while a 2.0-kb BamHI-XhoI fragment of
the 3' flanking region of the gene was used as the 3' homology. Thereby
an in-frame fusion was created between the amino-terminal 98 amino
acids of the Hnf3g protein and the -galactosidase
protein, which deletes the entire DNA binding domain as well as the
carboxy terminus of the HNF-3 protein. The targeting vector was
linearized with NotI, and 20 µg of DNA was electroporated
into 107 E14-1 embryonic stem cells (13). Stably
transfected cells were isolated after selection in 250 µg of G418
(Gibco) per ml, and 130 clones were analyzed by Southern blotting for
homologous recombination. A 2.2-kb
XhoI-HindIII fragment (probe C in Fig. 1)
located 3' to the Hnf3g gene was used as an external probe
for Southern analysis of DNA digested with EcoRI or
HindIII. Positively targeted clones were confirmed with
a probe fragment encoding the neomycin phosphotransferase gene (data
not shown). ES cells from the two correctly targeted clones were
injected into blastocysts derived from C57BL/6 mice. Blastocysts were
transferred to pseudopregnant NMRI females, and chimeric offspring were
identified by the presence of agouti hair. Chimeric males were mated to
C57BL/6 females to obtain ES-derived offspring that were analyzed by
Southern blotting of tail DNA to identify the heterozygous
(Hnf3g+/) mutants. Heterozygotes were mated
inter se to generate mutant (
/) mice. Embryos and mice were also
genotyped by PCR with three primers: Hnf3g 5'
(TCCCAAGCTTGGGCACTGGTGGCCA), Hnf3g 3'
(GTGGCAGCTGTAGTGGTGGCAG), and lacZ
(CGCCATTCGCCATTCAGGCTGC). PCRs were carried out for 30 cycles (94°C, 30 s; 70°C, 40 s; 72°C, 60 s) in a
buffer containing 1.5 mM MgCl2. The wild-type allele
produced a band of 511 bp, and the targeted allele produced a band of
326 bp.
-Galactosidase staining.
Embryos (E14.5) were dissected
in ice-cold phosphate-buffered saline, and the extraembryonic membranes
were saved for DNA preparation and genotyping by PCR. The embryos were
fixed in 4% formaldehyde for 30 min at 4°C. Subsequently, the
embryos were washed twice in phosphate-buffered saline and then
incubated in 15% sucrose at 37°C. After 4 h, the embryos were
transferred to a solution of 7% gelatin-15% sucrose and incubated at
37°C overnight. The embryos were then embedded in 7% gelatin-15%
sucrose, frozen in liquid nitrogen, and stored at 20°C.
Ten-micrometer sections were obtained on a cryostat and incubated in
staining solution for 2 days at 37°C. The staining solution consisted
of 4 mM K3(Fe(CN)6), 4 mM
K4(Fe(CN)6), 0.02% Nonidet P-40, 0.01%
Na-deoxycholate, 5 mM EGTA, 2 mM MgCl2, and 0.4 mg of
5-bromo-4-chloro-3-indolyl--D-galactopyranoside per ml.
Sections were briefly (30 s) counterstained in eosin, dehydrated,
embedded, and photographed.
RNA analysis. Total RNA from adult tissues was isolated after homogenization in guanidinium thiocyanate (6). RNA was separated in formaldehyde-containing agarose gels for Northern analysis as described previously (1). Hybond N filters (Amersham) were hybridized in a mixture of 50% formamide, 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 50 mM Na phosphate at pH 6.5, 8× Denhardt's solution, 1% sodium dodecyl sulfate, and 0.5 mg of total yeast RNA per ml with the probes indicated according to reference 26.
RNase protection analysis was carried out as follows. Antisense RNA probes were synthesized in the presence of 25 µCi of [-32P]UTP at 800 Ci/mmol and 4 µM UTP. The probes
were subsequently purified by phenol-chloroform extraction, followed by
two precipitations with 2 M NH4 acetate and 2.5 volumes of
ethanol. The RNA samples were dried under vacuum and resuspended in 30 µl of a hybridization buffer {80% deionized formamide, 40 mM PIPES
[piperazine-N,N'-bis(2-ethanesulfonic acid); pH
6.4], 400 mM NaCl, 1 mM EDTA} containing 100,000 dpm of each probe.
The samples were heated to 95°C for 5 min and then incubated at
54°C overnight. Unhybridized probes were digested through addition of
0.3 ml of RNase buffer (10 mM Tris-Cl [pH 7.5], 300 mM NaCl, 5 mM
EDTA) containing 4 µg of RNase A per ml and 1,000 U of RNase
T1 at room temperature for 1 h. The RNases were
hydrolyzed at 37°C for 15 min after addition of 4.5 µl of 10-mg/ml
proteinase K. The samples were extracted once with phenol-chloroform, and the aqueous supernatant containing the double-stranded RNA was
precipitated with 1 ml of ethanol after addition of 5 µg of tRNA. The
precipitate was collected through a 15-min centrifugation step. The
pellets were washed in 70% ethanol and dissolved in a loading buffer
containing 50% deionized formamide and 5 mM EDTA. The RNA fragments
obtained were separated on denaturing 6% acrylamide gels, and the
radioactive bands were visualized by autoradiography. The probes used
for Hnf3a, -b and -g (probe A in Fig.
1) were described previously (11). Two fragments (154 and
338 bp) of the ubiquitously expressed gene for TATA-box binding protein
(28) were subcloned and used as templates for the synthesis
of a control probe. Northern blot filters as well as dried RNase
protection gels were exposed to phosphor storage screens, and the
resulting signals were quantified on a phosphorimager (Molecular
Dynamics).
Nuclear run-on transcription assay.
Nuclei were prepared
from the livers of 8-month-old males (three
Hnf3g/ mutants and three wild-type
littermates) according to the method of Marzluff and Huang
(17) after perfusion with ice-cold 0.14 M NaCl-10 mM
Tris-HCl (pH 8). Nuclear transcription activity was determined by
measuring the incorporation of [-32P]UTP and with
2 × 107 nuclei per reaction. Nascent transcripts were
isolated (4) and hybridized to filter-bound cDNAs for mouse
albumin, glucose-6-phosphatase (G6Pase), tyrosine-aminotransferase
(TAT), transferrin (Tf), and phosphoenolpyruvate-carboxykinase (PEPCK).
Filters were washed to high stringency, and signals were quantified
with a phosphorimager.
RESULTS
|
TopPreviousNextReferences
|
|---|
Gene targeting of Hnf3g.
In order to investigate the
potential role of the winged helix transcription factor HNF3 in
endoderm development, we generated mice lacking a functional
product of this gene by homologous recombination. The Hnf3g
locus had been cloned previously from a 129Sv mouse strain genomic
library (11). We constructed a targeting vector that deletes
the entire winged helix DNA binding domain and carboxy-terminal region
of the protein and that creates an in-frame fusion with a
lacZ-neo fusion cassette. Because Hnf3g is
expressed in embryonic stem cells (11), we utilized a
promoterless targeting construct to enrich for homologous recombinants.
This strategy is based on the fact that random integration of a
promoterless neomycin resistance cassette will only rarely result in
neomycin-resistant ES cell colonies, whereas targeted integration into
the actively transcribed Hnf3g locus will produce
neomycin-resistant colonies. The complete targeting strategy is
depicted in Fig. 1A.
|
allele as
schematized in Fig. 1A. Germ line chimeras and mice heterozygous for
the Hnf3g mutation were obtained for both ES cell lines as
described in Materials and Methods. In all parameters studied, both
lines gave identical results, indicating that the phenotype observed is
indeed due to the targeted mutation in the Hnf3g locus and
is not caused by another, unrelated mutation derived from the ES cell
clones. In the following discussion, we have combined the results
obtained from both lines.
We expected that replacement of the HNF3 coding region with the
lacZ gene would result in expression of -galactosidase in all cells that normally express HNF3. When staining embryos and adult tissues (data not shown) or frozen sections (Fig.
2), we were surprised by the lack of
-galactosidase activity in liver, stomach, pancreas, and small
intestine (Fig. 2B). Expression of -galactosidase in the nasal and
colonic epithelia, on the other hand, correlates well with that of
HNF3 (Fig. 2A and C). Through the analysis of
cis-regulatory elements of HNF3 in transgenic mice and
cell lines, we have recently shown that an important cis-regulatory element resides 3' of the HNF3 coding
region (9). Deletion of 5 kb of 3' flanking region removes
these cis-regulatory elements and silences the
Hnf3g-lacZ allele in liver, pancreas, stomach, and small
intestine. This observation also indicates a complex regulation of the
Hnf3g locus, because transcription of the locus in colonic
and nasal epithelia is regulated independently of the other sites of
expression.
|
had been suggested to function in the regionalization
of the primitive gut tube, we investigated the development of the
liver, pancreas, stomach, and intestine. Mice heterozygous for the
HNF3 mutation were crossed inter se, and embryos were collected from
various stages of gestation. As shown in Fig.
3, no morphological abnormalities were
observed in the liver, pancreas, and gastrointestinal tract of the
HNF3/ embryos. Thus, by morphological criteria,
HNF3 is not required for specification of endoderm-derived organs.
|
HNF3 and - mRNAs are increased in the liver
of HNF3/ mice.
In light of the normal
development of the HNF3/ embryos, we wanted to
ascertain that we had indeed generated a null allele of
Hnf3g. Therefore, we analyzed HNF3 transcripts in total
liver RNA obtained from adult wild-type or homozygous mutant mice by RNase protection analysis. As shown in Fig. 1C, HNF3 mRNA was absent from the livers of mutant animals, proving that we had generated
a null allele for Hnf3g. No HNF3 mRNA was present in any other organs analyzed (data not shown).
and HNF3, by RNase protection analysis. As shown
in Fig. 1C and 4A, the two mRNAs are
upregulated in the mutant livers by approximately 60%. We wanted
to investigate whether this up-regulation of HNF3 and HNF3
occurs only in the liver or in all tissues where the three HNF3 genes
are coexpressed. Therefore, we compared HNF3 and HNF3 mRNA
levels in stomach and colon of wild-type and HNF3/
mice (Fig. 4B and C). In contrast to the situation in liver, the
expression of HNF3 and - is not altered in these tissues. This
finding indicates that HNF3 functions as a negative regulator of
Hnf3a and Hnf3b in liver. Although our genetic
approach does not distinguish between direct and indirect effects, it
seems possible that in the case of Hnf3b, HNF3 would act
through the previously identified HNF3 binding site within the promoter
(22). The observed derepression of Hnf3a and
Hnf3b could also contribute to the mild phenotype effect
observed in the Hnf3g mutant animals.
|
and HNF3 mRNAs,
an additional possibility for explaining the mild effect on the hepatic phenotype of the Hnf3g/ mice is increased
activity of the other liver-enriched transcription factors, notably the
divergent homeodomain proteins HNF1 and HNF1 and the orphan
nuclear receptor HNF4. This is plausible in light of the fact that the
promoters and enhancers of many genes encoding liver-enriched proteins
contain binding sites for several of these transcription factors
(5). In order to address this possibility, total liver RNA
from wild-type and Hnf3g/ mice was analyzed
by RNase protection assay for the expression of HNF1, HNF1, and
HNF4. As shown in Fig. 4D, no significant differences were observed.
Liver-specific transcription is impaired in
Hnf3g/ mice.
When heterozygous animals
of mixed background (129Sv × C57BL6) were crossed inter se and
the offspring were genotyped at 4 weeks of age, no deviation from the
expected Mendelian distribution was observed (49:105:47; +/+:
+/:/). No differences in the growth characteristics or final
weight attained between wild-type and mutant animals were found.
Biochemical analysis of plasma obtained from mutant mice did not reveal
any differences in glucose, cholesterol, triglycerides, and amino acids
(data not shown). Histological sections of the liver, stomach, and
intestine (the major sites of Hnf3g expression) of adult
wild-type and mutant animals were investigated, but no morphological
differences were found (data not shown). In addition, both male and
female mutants were found to be fertile, although HNF3 mRNA had
been demonstrated in ovary and testis (11, 15).
in vivo. In order to
address this question, we isolated total liver RNA from adult wild-type and mutant animals and analyzed the steady-state mRNA levels of various HNF3 targets by Northern blotting and RNase protection analysis. A subset of these results are shown in Fig.
5A, demonstrating that mRNA levels
for TAT, Tf, and PEPCK are reduced in Hnf3g/
mice, while those of G6Pase, serine dehydratase (SDH), TTR, and albumin
are not changed. The magnitude of the effect was estimated after
quantification of the signals on a phosphorimager and was approximately
70% for TAT and 50% for both PEPCK and Tf (Fig. 5B). Despite the
decrease in mRNAs for gluconeogenic enzymes, the
Hnf3g/ mice are euglycemic under normal
feeding conditions or when fed a carbohydrate-free diet (data not
shown). In addition, we analyzed steady-state mRNA levels for
glycogen synthetase, carbamoylphosphate synthetase, 1-AT, and
apolipoproteins AI, AII, and E, but found no difference from controls
(data not shown).
|
is an important factor in their regulation.
DISCUSSION
|
TopPreviousNextReferences
|
|---|
HNF3 regulates liver-specific gene expression.
Mice
carrying a null mutation of the gene encoding the winged helix
transcription factor HNF3 exhibit a surprisingly mild phenotype,
considering the early embryonic activation of the Hnf3g gene
(19). A subset of liver-enriched transcripts which had been
shown to be regulated by the HNF3 proteins through in vitro DNA binding
or transfection assays was reduced in the mutant livers, an effect
which is due to decreased transcriptional activity of the corresponding
genes. The absence of a decrease in albumin, 1-AT, and other hepatic
mRNA levels could possibly be explained in part by compensatory
binding of the HNF3 and HNF3 proteins, the levels of which are
increased in the Hnf3g/ mice. This notion is
supported by competition studies with hepatoma cells (29),
which showed that overexpression of the DNA binding domain of HNF3,
which was used to titrate all HNF3 activity, led to a decrease in the
mRNA levels for albumin, TTR, Tf, PEPCK, and aldolase B of up to
95%. Alternatively, these genes may be redundantly regulated by a
combination of liver-enriched and ubiquitous transcription factors, any
one of which might play only a minor role in its regulation. A similar
observation has been made by Pontoglio and coworkers in the case of
gene targeting of HNF1 (24), where many of the previously
known HNF1 targets identified in vitro were not altered in the mutant
animals.
Why are there three HNF3 genes?
Since the expression domain of
HNF3 in the endoderm-derived tissues is contained within those of
HNF3 and HNF3, the question arises of why has HNF3 been
retained through evolution? One possibility was raised by the original
observation of Lai et al. (15) that the HNF3 proteins have
distinct binding affinities with respect to the sites contained in the
TTR promoter in vitro, suggesting that the HNF3 proteins could be
regulating different subsets of genes. Here we have shown that removal
of the HNF3 protein influences some, but not all, of the known HNF3
targets in vivo. One could envision that the down-regulation of HNF3
and HNF3 and the concurrent up-regulation of HNF3 during late
embryonic development cause a shift in the occupancy of HNF3 sites,
thereby fine-tuning the transcriptional control in the liver. In this
context, it is interesting to note that the HNF3 proteins have been
suggested to permit gene activation of their target genes by remodeling
of the chromatin structure (18). The proposed shift in HNF3
binding, which occurs relatively late in hepatic development, could
thus facilitate the late (perinatal) activation of the gluconeogenic
enzymes.
mRNA has been shown to be expressed from E8.5 onward, first
in the invaginating hindgut and ventral endoderm and subsequently in
all endoderm-derived tissues posterior to the liver and stomach. Based
on this expression pattern, it was suggested that HNF3 could
function in the regionalization of endoderm-derived tissues and,
specifically, in the differentiation of the liver, stomach, and small
and large intestine (19). Through ablation of HNF3 function by targeted mutagenesis, we have clearly demonstrated that
HNF3 by itself is not required for embryonic development and
morphogenesis. A possible explanation for this normal embryonic phenotype is suggested by the observation that the other members of the
gene family, Hnf3a and Hnf3b, are upregulated in
the Hnf3g/ mice. This indicates that HNF3
acts, directly or indirectly, as a repressor of these genes.
Alternatively, the upregulation of Hnf3a and
Hnf3b in the liver might be due to an as yet unknown compensatory mechanism which allows the mice to survive in the absence of HNF3 protein.
In summary, the predominant role of HNF3 lies far down in the
hierarchy of transcription factors in the direct control of a subset of
the genes encoding liver-specific enzymes. Since many genes expressed
in the endoderm or endoderm-derived tissues have binding sites for
several of the hepatocyte-enriched transcription factors, it is not too
surprising that loss of a single factor, as shown for HNF3 and,
previously, HNF1 (24), is well compensated for. In order
to uncover potential additional functions of HNF3, future studies
combining the mutations for all three HNF3 proteins (tissue specific or
inducible for HNF3) will be needed to define in more detail the role
of the HNF3 proteins in vivo.
ACKNOWLEDGMENTS
|
TopPreviousNextReferences
|
|---|
We are grateful to J. Blendy, P. Monaghan, and F. Tronche for comments on the manuscript. We thank S. Ridder, H. Kern, W. Fleischer, E. Schmid, and A. Sukman for expert technical assistance.
This work was supported by the Deutsche Forschungsgemeinschaft through SFB 229, the Fonds der Chemischen Industrie, the European Community (grant BI02-CT93-0319), the McCabe Foundation, and the Center for Molecular Studies in Digestive and Liver Disease at the University of Pennsylvania (P30 DK50306).
FOOTNOTES
* Corresponding author. Mailing address: Department of Genetics, University of Pennsylvania Medical School, 415 Curie Blvd., Philadelphia, PA 19104-6145. Phone: (215) 898-8759. Fax: (215) 573-5892. E-mail: kaestner{at}mail.med.upenn.edu.
REFERENCES
|
TopPrevious |
|---|
| 1. |
Alwine, J. C.,
D. J. Kemp, and G. R. Stark.
1977.
Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxmethy-paper and hybridization with DNA probes.
Proc. Natl. Acad. Sci. USA
74:5350-5354 |
| 2. | Ang, S. L., and J. Rossant. 1994. HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78:561-574[Medline]. |
| 3. | Ang, S. L., A. Wierda, D. Wong, K. A. Stevens, S. Cascio, J. Rossant, and K. S. Zaret. 1993. The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins. Development 119:1301-1315[Abstract]. |
| 4. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1995. In Current protocols in molecular biology. John Wiley and Sons, New York, N.Y. |
| 5. | Cereghini, S. 1996. Liver-enriched transcription factors and hepatocyte differentiation. FASEB J. 10:267-282[Abstract]. |
| 6. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation. Anal. Biochem. 162:156-159[Medline]. |
| 7. | Costa, R. H. 1994. Hepatocyte nuclear factor 3/forkhead protein family: mammalian transcription factors that possess divergent cellular expression patterns and binding specificities, p. 183-206. In F. Tronche, and M. Yaniv (ed.), Liver gene expression. R. G. Landes Company, Austin, Tex. |
| 8. |
Costa, R. H.,
D. R. Grayson, and J. E. Darnell, Jr.
1989.
Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and 1-antitrypsin genes.
Mol. Cell. Biol.
9:1415-1425 |
| 9. | Hiemisch, H., G. Schütz, and K. H. Kaestner. 1997. Transcriptional regulation in endoderm development: characterization of an enhancer controlling Hnf3g expression by transgenesis and targeted mutagenesis. EMBO J. 16:3995-4006[Medline]. |
| 10. |
Hummler, E.,
T. J. Cole,
J. A. Blendy,
R. Ganss,
A. Aguzzi,
W. Schmid,
F. Beermann, and G. Schütz.
1994.
Targeted mutation of the CREB gene: compensation within the CREB/ATF family of transcription factors.
Proc. Natl. Acad. Sci. USA
91:5647-5651 |
| 11. | Kaestner, K. H., H. Hiemisch, B. Luckow, and G. Schütz. 1994. The HNF-3 gene family of transcription factors in mice: gene structure, cDNA sequence, and mRNA distribution. Genomics 20:377-385[Medline]. |
| 12. | Kaestner, K. H., L. Montoliu, H. Kern, M. Thulke, and G. Schütz. 1994. Universal beta-galactosidase cloning vectors for promoter analysis and gene targeting. Gene 148:67-70[Medline]. |
| 13. |
Kühn, R.,
K. Rajewski, and W. Müller.
1991.
Generation and analysis of interleukin-4 deficient mice.
Science
254:707-710 |
| 14. |
Lai, E.,
V. R. Prezioso,
E. Smith,
O. Litvin,
R. H. Costa, and J. E. Darnell, Jr.
1990.
HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally.
Genes Dev.
4:1427-1436 |
| 15. |
Lai, E.,
V. R. Prezioso,
W. F. Tao,
W. S. Chen, and J. E. Darnell, Jr.
1991.
Hepatocyte nuclear factor 3 alpha belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head.
Genes Dev.
5:416-427 |
| 16. | Liu, J., and R. W. Hanson. 1991. Regulation of phosphoenolpyruvate carboxykinase (GTP) gene transcription. Mol. Cell. Biochem. 104:89-100[Medline]. |
| 17. | Marzluff, W. F., and R. C. C. Huang. 1985. Transcription of RNA in isolated nuclei, p. 89-129. In B. D. Hames, and S. J. Higgins (ed.), Transcription and translation: a practical approach. IRL Press, Oxford, United Kingdom. |
| 18. | McPherson, C. E., E. Y. Shim, D. S. Friedman, and K. S. Zaret. 1993. An active tissue-specific enhancer and bound transcription factors existing in a precisely positioned nucleosomal array. Cell 75:387-398[Medline]. |
| 19. | Monaghan, A. P., K. H. Kaestner, E. Grau, and G. Schütz. 1993. Postimplantation expression patterns indicate a role for the mouse forkhead/HNF-3 alpha, beta and gamma genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm. Development 119:567-578[Abstract]. |
| 20. |
Nitsch, D.,
M. Boshart, and G. Schutz.
1993.
Activation of the tyrosine aminotransferase gene is dependent on synergy between liver-specific and hormone-responsive elements.
Proc. Natl. Acad. Sci. USA
90:5479-5483 |
| 21. |
Nitsch, D., and G. Schütz.
1993.
The distal enhancer implicated in the developmental regulation of the tyrosine aminotransferase gene is bound by liver-specific and ubiquitous factors.
Mol. Cell. Biol.
13:4494-4504 |
| 22. |
Pani, L.,
X. Quian,
D. Clevidence, and R. H. Costa.
1992.
The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3 involves a cell-specific factor and positive autoactivation.
Mol. Cell. Biol.
12:552-562 |
| 23. |
Philippe, J.,
C. Morel, and V. R. Prezioso.
1994.
Glucagon gene expression is negatively regulated by hepatocyte nuclear factor 3.
Mol. Cell. Biol.
14:3514-3523 |
| 24. | Pontoglio, M., J. Barra, M. Hadchouel, A. Doyen, C. Kress, J. P. Bach, C. Babinet, and M. Yaniv. 1996. Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome. Cell 84:575-585[Medline]. |
| 25. | Rudnicki, M. A., T. Braun, S. Hinuma, and R. Jaenisch. 1992. Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development. Cell 71:383-390[Medline]. |
| 26. | Ruppert, S., M. Boshart, F. X. Bosch, W. Schmid, R. E. K. Fournier, and G. Schütz. 1990. Two genetically defined trans-actin loci coordinately regulate overlapping sets of liver-specific genes. Cell 61:895-904[Medline]. |
| 27. | Sasaki, H., and B. L. Hogan. 1993. Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118:47-59[Abstract]. |
| 28. |
Tamura, T.,
K. Sumita,
J. Fujino,
A. Aojama,
M. Horiskoshi,
A. Hoffmann, and R. G. Roeder.
1991.
Striking homology of the "variable" N-terminal as well as "conserved core" domains of the mouse and human TATA-factors (TFIID).
Nucleic Acids Res.
19:3861-3865 |
| 29. | Vallet, V., M. Bens, B. Antoine, F. Levrat, L. Miquerol, A. Kahn, and A. Vandewalle. 1995. Transcription factors and aldolase B gene expression in microdissected renal proximal tubules and derived cell lines. Exp. Cell Res. 216:363-370[Medline]. |
| 30. | Weigel, D., G. Jürgens, F. Küttner, E. Seifert, and H. Jäckle. 1989. The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell 57:645-665[Medline]. |
| 31. | Weinstein, D. C., A. Ruiz i Altaba, W. S. Chen, P. Hoodless, V. R. Prezioso, T. M. Jessell, and J. E. Darnell, Jr. 1994. The winged-helix transcription factor HNF-3 beta is required for notochord development in the mouse embryo. Cell 78:575-588[Medline]. |
| 32. | Zaret, K. S. 1996. Molecular genetics of early liver development. Annu. Rev. Physiol. 58:231-251[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
