Previous Article | Next Article ![]()
Mol Cell Biol, July 1998, p. 4358-4367, Vol. 18, No. 7
Department of Biochemistry, Duke University
Medical Center, Durham, North Carolina 27710
Received 30 January 1998/Returned for modification 13 March
1998/Accepted 16 April 1998
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Targeting to Transcriptionally Active Loci by
the Hydrophilic N-Terminal Domain of Drosophila DNA
Topoisomerase I
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
REFERENCES
SUMMARY
|
|
|---|
DNA topoisomerase I (topo I) from Drosophila
melanogaster contains a nonconserved, hydrophilic N-terminal
domain of about 430 residues upstream of the conserved core domains.
Deletion of this N terminus did not affect the catalytic activity of
topo I, while further removal of sequences into the conserved regions inactivated its enzymatic activity. We have investigated the cellular function of the Drosophila topo I N-terminal domain with
top1-lacZ transgenes. There was at least one putative
nuclear localization signal within the first 315 residues of the
N-terminal domain that allows efficient import of the large chimeric
proteins into Drosophila nuclei. The top1-lacZ
fusion proteins colocalized with RNA polymerase II (pol II) at
developmental puffs on the polytene chromosomes. Either topo I or the
top1-lacZ fusion protein was colocalized with RNA pol II in
some but not all of the nonpuff, interband loci. However, the fusion
proteins as well as RNA pol II were recruited to heat shock puffs
during heat treatment, and they returned to the developmental puffs
after recovery from heat shock. By immunoprecipitation, we showed that
two of the largest subunits of RNA pol II coprecipitated with the
N-terminal 315-residue fusion protein by using antibodies against
-galactosidase. These data suggest that the topo I fusion protein
can be localized to the transcriptional complex on chromatin and that
the N-terminal 315 residues were sufficient to respond to cellular
processes, especially during the reprogramming of gene expression.
INTRODUCTION
|
|
|---|
Type I DNA topoisomerase (topo I) catalyzes a cycle of transesterification reactions, during which it generates transient single-strand DNA breaks; these reversible reactions result in the topological transformation of either single-strand or double-strand DNA molecules (8, 20, 55). Biochemical and genetic studies have demonstrated that topo I plays important roles in DNA replication, transcription, and recombination and in chromosome condensation and the maintenance of genome stability. The top1 gene is not essential for viability in yeast, and genetic analysis suggests that some of the biological functions of topo I can be performed by topo II (59). However, recent genetic screens of Saccharomyces cerevisiae have identified four complementation groups of mutants with mutations that, in combination with a top1 mutation, result in a lethal phenotype. Some of these synthetic lethal mutants have mutations in genes other than top2 (44). Therefore, it is possible that not all the biological functions of topo I can be substituted by topo II. Furthermore, because top1 is an essential gene in Drosophila melanogaster (30) and in mice (37), the functions of topo I may not be efficiently substituted by topo II in multicellular organisms.
One of the functions of topo I is to provide a swivel to facilitate the unwinding of the DNA duplex during the process of transcription or replication (56). Diametric DNA supercoiling can transiently accumulate in the front and in the wake of a transcriptional fork as proposed in the twin-domain DNA supercoiling model (33). Eukaryotic topo I can relieve both the positive and negative supercoils generated during the fork movement. By immunological studies, and the use of camptothecin to trap and map topo I cleavages, it has been shown that topo I is concentrated at transcriptionally active loci (15, 16, 49, 61). In addition, topo I can serve as a coactivator of specific gene expression and as a repressor of basal transcription in vitro through its association with the transcription complex TFIID (29, 36). The participation of topo I in transcriptional initiation has been shown by its effect on the assembly of a complex of TFIID and TFIIA on the promoter (45). These data reveal an essential role for topo I in transcription.
Based on the amino acid sequence alignment, eukaryotic topo I enzymes have conserved domains with about 500 amino acid residues in the central and C-terminal portions, while their N termini have little homology and have variable lengths, ranging from 140 residues in S. cerevisiae to 430 residues in D. melanogaster (20, 26). Despite the fact that the N-terminal sequences are not conserved, they are characterized by an abundance of acidic and basic residues, and by their sensitivity to proteolysis (32, 50). Studies with human (10, 50) and yeast (5) enzymes have shown that their N-terminal domains are dispensable for catalytic activity. Although, these N termini are not required for the strand passage activity of topo I, they may have important roles in the in vivo functions of topo I; this remains to be elucidated.
The hydrophilic N-terminal domain of Drosophila topo I is
unique, because it is much longer than that of other species, and it
contains clusters of serine and histidine residues that are shared by
other Drosophila gene products (6, 27). In this paper, we present data relating to the functions of the N terminus of
Drosophila topo I. The N terminus was inconsequential for
its catalytic activity, as is the case in other species. Furthermore, our studies of N-terminal fusion constructs with a reporter protein,
-galactosidase (
-gal) have demonstrated that the N-terminal domain directs the chimeric products to transcriptionally active loci
in the polytene chromosomes and that the fusion proteins are present in
a complex that also contains RNA polymerase II (pol II).
MATERIALS AND METHODS
|
|
|---|
Plasmid constructions. N-terminal deletion constructs are denoted ND, followed by the number of residues deleted from the N terminus. ND472 and ND582 were made by deleting DNA sequences in pETI.6 (27) from the NheI site near the T7 promoter to the unique SacI and StuI sites, respectively. ND423 was engineered by synthesizing a truncated topo I cDNA fragment with PCR. The primers used in this PCR were 5'GCCAAGGATCCGGAGGTTTGGCGATGG3' (nucleotides 1528 to 1543 in top1 cDNA) and 5'GAACAGGCCTGGCGGCTC3' (nucleotides 1994 to 2011). The italicized sequence in the first oligonucleotide is not homologous to topo I cDNA, and the underlined sequences in the oligonucleotides correspond to BamHI and StuI sites, respectively. After digestion with restriction enzymes BamHI and StuI, the PCR fragment was inserted into the BamHI-StuI sites of expression vector pETI.6 to generate ND423. All the constructs were first introduced to the bacterial strain AG1 (Stratagene, La Jolla, Calif.) and sequenced to confirm the junction DNA sequences before they were moved into the expression strain BL21 (DE3, pLysS) (Novagen, Inc., Madison, Wis.).
NF fusion constructs were made by a two-step construction scheme to generate the Drosophila topo I N-terminal fusion constructs. They are designated NF, followed by a number representing the length of the topo I N-terminal sequence. The first step of cloning involved the vector, C4-
gal/BS (a generous gift from P. Schedl, Princeton
University), that was generated by inserting the lacZ gene
and simian virus 40 poly(A) tail sequences from pC4
gal
(52) into polylinker sites of Bluescript plasmid
(Stratagene). The ends generated from XmaI digestion of
C4-
gal/BS were flushed by treatments of either T4 DNA polymerase to
fill in ends or mung bean nuclease to remove protruding ends before the
second digestion with XhoI. Two inserts containing topo I
N-terminal domains, a 1.87-kb XhoI-StuI fragment
and a 3.0-kb XhoI-NdeI fragment, were purified by
digestions of the top1 cDNA clone, ctop1.2 (26, 27). The NdeI site of the
XhoI-NdeI fragment had been treated with T4 DNA
polymerase before the XhoI digestion. The
XhoI-StuI fragment was inserted into mung bean
nuclease-treated C4-
gal/BS to generate NF582, while the
XhoI-NdeI fragment was ligated to the T4
polymerase-treated vector DNA to create NF964.
Two shorter constructs, NF315 and NF438, were constructed from a PCR
product, which was amplified by the universal primer and
oligonucleotide I-56
(5'GCCAAGGATCCACGCCATCGGCACGCTT3') from ctop1.2.
The 3' end sequence of oligonucleotide I-56 corresponds to nucleotides
1572 to 1556 in top1 cDNA. The italicized sequence in the 5'
end is the nonhomologous part, and the underlined portion is a
BamHI site. The 1.45-kb PCR product was digested with two sets of enzymes: XhoI plus BamHI and
XhoI plus BclI. The resulting 1.4-kb
XhoI-BamHI fragment and 1.2-kb
XhoI-BclI fragment were cloned into
XhoI and BamHI sites of C4-
gal/BS to generate
NF438 and NF315, respectively.
These four constructs were verified by sequencing analysis at the
cloning junctions to ensure maintenance of the correct reading frame.
Furthermore, regions of top1 segments in three fusion
constructs, NF582, NF438, and NF315, were sequenced throughout to
confirm that no mutations were introduced during the cloning process. All constructs were then subcloned into NotI and
XhoI sites of pCaSpeRhsp83, a derivative of pCaSpeR
(40). Consequently, the resulting fusion genes are under the
control of the hsp83 promoter (25).
Expression of topo I and its truncation mutants in BL21 (DE3,
pLysS).
Bacterial cultures started from a 50-fold dilution of
overnight cultures were allowed to grow at 37°C for 2 h before
induction by adding isopropyl-
-D-thiogalactoside (IPTG)
to 1 mM. The induction proceeded for 5 h at 30°C, and the
cultures were pelleted by centrifugation and stored at
70°C. The
frozen bacterial pellet was thawed in lysis buffer (20 mM
NaPO4 [pH 7.0], 0.5 M NaCl, 2.5 mM EDTA, 5% glycerol, 1 mM phenylmethylsulfonyl fluoride, 1 µg of leupeptin and pepstatin per
ml). The bacterial lysate was sonicated to ensure complete lysis and to
reduce its viscosity. The cleared lysate was prepared by centrifugation
at 12,000 × g for 20 min. The expression of
Drosophila topo I was monitored by assaying supercoil
relaxation activity and by immunoblotting with an antibody against
Drosophila topo I in accordance with the procedures
described earlier (26).
Drosophila germ line transformation.
P-element-mediated transformation of Drosophila was carried
out as described by Rubin and Spradling (43, 48), with the modification of using a strain carrying a stable genomic source of
transposase (42). Second-chromosome-linked homozygous
transformants were used in the immunofluorescence microscopy because
the cytological mapping of chromosome puffs is more straightforward in
these strains. The lacZ control fly, 28-1 (generously
provided by P. Schedl, Princeton University), which expresses
-gal
protein under the control of the hsp83 promoter, was
generated with transformation vector pC4-hsp83AUG
gal, which was
derived from pC4-AUG-
gal plasmid (52).
Salivary gland staining.
Staining of salivary glands was
based on a method previously described (17). Briefly,
third-instar larvae were dissected in buffered 1% glutaraldehyde. The
color development of the tissue was carried out in 0.2% X-Gal
(5-bromo-4-chloro-3-indolyl-
-D galactopyranoside)
(Boehringer Mannheim Biochemicals, Indianapolis, Ind.) for 60 to 120 min. The stained salivary glands were stored in 100% glycerol and
imaged on a Leitz DMIL inverted microscope equipped with a Hamamatsu
C5810 camera.
Antibodies.
Rabbit antibodies against Drosophila
topo I were affinity purified on a Reacti-Gel agarose column (Pierce
Chemical Co., Rockford, Ill.) with covalently cross-linked recombinant
proteins, either full-length topo I or truncated ND423 protein. The
affinity-purified ND423 antibody was used to label the endogenous topo
I, since it could not react with the topo I N-terminal fusion proteins. Goat affinity-purified immunoglobulin G's (IgGs) specific for the
hyperphosphorylated carboxy-terminal domain in the largest subunit of
RNA pol II (anti-IIo), exon 2 of the largest subunit (anti-E2), and the
second-largest subunit of RNA pol II (anti-IIc) were generous gifts
from A. Greenleaf (Duke University). Rabbit anti-
-gal IgG was
purchased from Cappel Research Products (Organon Teknika Corporation,
Durham, N.C.). Similar immunofluorescence data were also obtained with
mouse anti-
-gal monoclonal antibodies (Boehringer Mannheim
Biochemicals). Species-specific secondary antibodies included
affinity-purified donkey IgGs (multiple-labeling grade) labeled with
either fluorescein isothiocyanate or indocarbocyanine (Cy3) (Jackson
ImmunoResearch Laboratories, Inc., West Grove, Pa.).
Polytene chromosome squashes and immunofluorescence microscopy. Preparations of polytene chromosome squashes and immunofluorescence staining were as described by Weeks et al. (57, 58). Briefly, salivary glands from late-third-instar larvae were dissected in phosphate-buffered saline-0.5% Triton X-100 (PBS-T) and fixed in 3.7% formaldehyde-PBS-T. Polytene chromosomes were then squashed in 45% acetic acid-1% formaldehyde. For heat shock treatment, third-instar larvae were placed inside microcentrifuge tubes with small ventilation holes on the lids and submerged in a 37°C water bath for the desired length of time.
The dilutions of primary antibodies used in immunofluorescence staining were as follows: rabbit anti-topo I, 1:200; rabbit anti-ND423, 1:100; rabbit anti-
-gal, 1:100 to 1:200; mouse monoclonal anti-
-gal, 25 µg/ml; and goat anti-IIo, 1:25. The secondary antibodies were
adjusted to a 1-µg/ml final concentration. Normal donkey serum (4%)
was used as blocking reagent before primary- and secondary-antibody incubations. Chromosome squashes were stained with 20 ng of DAPI (4',6-diamidino-2-phenylindole dihydrochloride) per ml for 60 s
before being mounted. Fluorescence images were viewed under a Zeiss
Axiophot microscope through a Zeiss ×40 Plan-NEOFLUAR objective (oil
immersion; NA 1.4), and captured with a Photometrics STAR I cooled
charge-coupled device imaging system. Image manipulations were carried
out with Adobe Photoshop version 3.0.4 software.
Immunoprecipitation of
-gal fusion proteins.
Overnight
embryos were homogenized in a lysis buffer (50 mM Tris [pH 8.0], 1%
Nonidet P-40, 500 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol), supplemented with 1 mM phenylmethylsulfonyl fluoride and 1 µg of
pepstatin, leupeptin, and aprotinin per ml. Lysates were spun in a
microcentrifuge for 30 min at 4°C, and the supernatant was used for
the immunoprecipitation reaction. These extracts were precleared with
protein A agarose beads (Sigma, St. Louis, Mo.; catalog no., P9424) at
4°C for 20 min. Specific antibodies and protein A beads were added to
the precleared extracts, and the incubation continued for 1 h at
4°C; then the beads were washed twice with lysis buffer and twice
with radioimmunoprecipitation assay buffer (50 mM Tris-HCl [pH 7.5],
150 mM NaCl, 1% Nonidet P-40, 0.5% Na deoxycholate, 0.1% sodium
dodecyl sulfate [SDS]). The washed products were then analyzed by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting.
RESULTS
|
|
|---|
Amino-terminal truncations of Drosophila DNA topo I. To test the possible biochemical functions of the nonconserved N-terminal domain of the Drosophila enzyme, we constructed a series of N-terminal truncation mutants: ND423, ND472, and ND582 (see Materials and Methods). ND423 lacks the first 423 residues of topo I and contains 549 residues corresponding to the highly homologous domains. ND472 and ND582 lack additional N-terminal sequences and portions of the conserved sequences (Fig. 1a and b). These constructs and a full-length topo I cDNA were cloned into inducible bacterial expression vector pET3b under the control of a phage T7 promoter (51).
|
|
Construction and expression of top1-lacZ fusion
proteins.
Although the hydrophilic N terminus is not required for
in vitro topo I activity, it may contain important properties that are
essential in vivo. We explored this possibility by constructing vectors
expressing fusion peptides of topo I with
-gal in
Drosophila cells. Four fusion constructs, NF315, NF438,
NF582, and NF964, in which increasing amounts of amino-terminal
sequence were fused to
-gal by in-frame fusion, were generated (Fig.
1c and d; see details in Materials and Methods). These chimeric
constructs were under the control of the hsp83 promoter and
were cloned into a P-element transposon vector derived from pCaSpeR
(Fig. 1d). Stable transgenic lines were obtained by microinjecting
vector DNAs into fly embryos and following established germ line
transformation procedures (43, 48).
-gal (Fig.
3b). All the samples contained endogenous topo I (135 kDa), and
additional species of 158, 174, and 196 kDa were also detected in
extracts from strains NF315, NF438, and NF582, respectively (Fig. 3a,
lanes 2 to 10). The sizes of these fusion products were consistent with
the predicted molecular masses. These fusion peptides also reacted with
anti-
-gal antibody (Fig. 3b, lanes 2 to 10). Three independent
transformants were analyzed for each fusion construct, and all showed
fusion products of the same size for each construct.
|
Nuclear localization of top1-lacZ fusion proteins.
Since topo I is a nuclear enzyme, it is possible that one of the
functions residing in the nonconserved N-terminal domain is nuclear
localization. We examined the subcellular distribution of the fusion
proteins by a histochemical
-gal staining assay, which converted
X-Gal into blue precipitates. While salivary glands from the wild-type
control showed no endogenous
-gal activity (Fig.
4c), the transgenic fly (28-1), which
carried
-gal driven by an hsp83 promoter, showed an even
distribution of the stains throughout the salivary gland (Fig. 4b). In
this nonfusion
-gal control, nuclear staining varied from a slight
accumulation to exclusion from the nucleus. Therefore,
-gal does not
have a specific nuclear localization function, a finding consistent
with the earlier observations that
-gal expressed in yeast cells was
not imported into nuclei (39, 47). In a marked contrast,
specific and intense staining was restricted to the nuclei in the
salivary gland and surrounding tissue in the NF315 transgenic fly (Fig.
4a). Similar staining patterns were also observed from NF438 and NF582
(data not shown). Consistent with the immunoblot experiments, no
staining was observed in the NF964 fly, suggesting that there is very
little or no expression of the functional fusion peptide from NF964. The clear differentials between the cytoplasmic and nuclear staining in
NF315 suggest that the N-terminal 315 residues in topo I contain a
signal for nuclear localization to allow efficient import of large
-gal fusion proteins into nuclei.
|
Localization of top1-lacZ fusion proteins on the developmental puffs in polytene chromosomes. Both biochemical and genetic studies have suggested that there are important functions for topo I in transcription (20, 55). For example, topo I is associated with the chromatin domains, where there is active transcription (38, 49, 61). Furthermore, topo I has been shown to colocalize with RNA pol II in developmental puffs of the polytene chromosomes by immunofluorescence staining (15). Since the top1-lacZ fusion proteins were efficiently transported into nuclei, we proceeded to examine if these proteins can be targeted to regions of transcription just like the full-length topo I.
Polytene chromosome squashes prepared as described previously (58) were reacted with primary antibodies against either
-gal (anti-
-gal) or the largest subunit of RNA pol II (anti-IIo)
and then with the appropriate secondary antibodies with different fluorescence labels to reveal the localization of antigens in the same
polytene chromosome preparation. Control experiments using either
preimmune serum or normal serum before the secondary antibody or
secondary antibody alone did not reveal any specific signals (data not
shown). However, specific fluorescence signals were observed with
either anti-
-gal or anti-IIo antibodies. A typical experiment with
the chromosome squashes obtained from the NF438 transgenic fly is shown
in Fig. 5. The localization of the NF438
fusion protein was revealed by the green fluorescence resulting from
fluorescein isothiocyanate-conjugated anti-rabbit IgGs reacting with
the anti-
-gal antibodies (Fig. 5b). The transcriptionally active
chromosome puffs are readily identified by the morphology of the
chromosome banding patterns, as well as by the RNA pol IIo
immunofluorescence staining, shown here as the red fluorescence from
the Cy3-conjugated secondary antibodies (Fig. 5a). Earlier work has
established that this affinity-purified anti-IIo antibody selectively
reacts with the phosphorylated form of the 215-kDa subunit of RNA pol
II, which is highly enriched in the chromosome puffs (58).
The colocalization of the NF438 and RNA pol IIo was evident in the
merged images as the orange-yellow staining (Fig. 5c).
|
-gal antibody.
|
-gal antibodies were used in
the immunofluorescence experiments to monitor the localization of
endogenous topo I and the top1-lacZ fusion protein on the
polytene chromosomes of untreated and heat-treated third-instar larvae. The endogenous topo I colocalized with the NF315 fusion protein at the
major developmental puffs (left panels of Fig. 6b). Similar to what was
observed between top1-lacZ fusion protein and RNA pol IIo,
the colocalization between endogenous topo I and topo I fusion protein
was apparent in some but not all of the nonpuff loci. The longer fusion
constructs, including NF438 and NF582, did not have significantly
different staining patterns for these interband, nonpuff loci (data not
shown). However, strict colocalization of these two antigens was found
at chromosomal puffs induced by heat shock at 37°C for 20 min (right
panels of Fig. 6b). These experiments demonstrate that both the
top1-lacZ fusion protein and endogenous topo I have similar
patterns of association with chromosomal puffs in these transgenic
flies. Moreover, they provide an additional control that the
localization of the N-terminal topo I protein at the transcriptionally
active loci is unlikely due to a nonspecific interaction.
Time course of recruitment of top1-lacZ fusion proteins upon heat shock treatment. The above experiments demonstrate that the N terminus of topo I is capable of recruiting top1-lacZ fusion proteins to transcriptionally active loci induced by heat shock. An environmental stress like heat shock can repress the developmental puffs and induce new chromosomal puffs (3), thus providing an excellent system to monitor the movement of topo I fusion proteins during the reprogramming of gene expression. We examined the rate at which this recruitment takes place and whether the N-terminal domain could mobilize the fusion proteins from heat shock loci during the recovery from heat treatment. Chromosome squashes prepared from transgenic strain NF315 that had undergone heat shock treatment for various times were used in these studies. Only the merged images are shown here. Yellow-orange staining shows the colocalization of RNA pol IIo and top1-lacZ fusion protein (Fig. 7). Fluorescence images of DAPI-stained squashes were also recorded to facilitate the identification of chromosome bands and puffs (Fig. 7a' to j'). Before heat shock, strong ecdysone-induced puffs 74EF and 75B were clearly marked with both antigens (Fig. 7a), while the heat shock loci, 87A and 87C, were not labeled with either antigen (Fig. 7b). The staining of 74EF and 75B was significantly reduced after 10 min of heat shock (Fig. 7c), and staining disappeared completely in the samples with 20 (Fig. 7e) and 60 (Fig. 7g) min of heat treatment. There was a parallel accumulation of both proteins at heat shock loci after 10 (Fig. 7d) and 20 (Fig. 7f) min of heat shock treatment. After a prolonged heat treatment, heat shock puffs regressed slightly, and the presence of both proteins persisted, albeit in lesser amounts (60-min point in Fig. 7h). The dynamic movement of these proteins at chromosome puffs was also apparent during the cessation of heat treatment. After 60 min of recovery from heat treatment, the program for normal developmental expression resumed, with both proteins reentering the 74EF and 75B puffs (Fig. 7i) along with their coordinated departure from the heat shock loci (Fig. 7j). We only highlighted 74EF and 75B for developmental puffs and 87A and 87C for heat shock puffs in these experiments, but similar dynamic movement of these proteins was also observed on other major developmental and heat shock puffs. These results show that the N-terminal 315 residues can mobilize the fusion proteins to new loci during the reprogramming of gene expression as efficiently as the holoenzyme of topo I.
|
Coimmunoprecipitation of RNA pol II with top1-lacZ fusion protein. Although we have demonstrated the colocalization of top1-lacZ fusion protein with RNA pol II by immunofluorescence microscopy, the coincidence of these two proteins at the level of immunofluorescence experiments may not necessarily imply that the N-terminal topo I fusion protein participates in a transcriptional complex. Therefore, we exploited an immunoprecipitation assay to determine whether the N-terminal topo I fusion protein is a part of a macromolecular transcriptional complex.
Embryo extracts from NF315 were processed for immunoprecipitation by using either rabbit anti-
-gal antibodies or a preimmune serum. The
immunoprecipitated complex was washed and analyzed by Western blotting;
the blots were probed with antibodies against the largest (IIa) and the
second-largest (IIc) subunits of RNA pol II and
-gal (left, middle,
and right panels, respectively, of Fig.
8). These panels show that anti-
-gal
antibodies immunoprecipitated the 158-kDa top1-lacZ fusion
protein and that both the 215- and 140-kDa subunits of RNA pol II were
present in this immunocomplex. The preimmune serum did not precipitate
either the top1-lacZ fusion or the RNA pol II subunits (Fig.
8). Furthermore, when embryo extracts from wild-type flies were used in
the immunoprecipitation, no RNA pol II signal was detected (data not
shown). These results demonstrate the presence of the topo I fusion
protein in an immunocomplex containing RNA pol II, and imply a physical
interaction between the N-terminal domain of topo I and the
macromolecular complex involved in transcription.
|
DISCUSSION
|
|
|---|
The function of the hydrophilic N termini in eukaryotic topo I presents an interesting question. The nonconserved N terminus accounts for nearly half of the molecule in Drosophila topo I. As indicated by earlier results with yeast and human topo I (5, 10, 50), topo I from the fruit fly does not require its N terminus for its catalytic activity. It is conceivable that the N terminus may play a regulatory role(s) for topo I activity in vivo. One of the phosphorylation sites in topo I has been mapped to a serine residue in the N terminus (12), and the phosphorylation of serine and threonine residues can stimulate supercoil relaxation and DNA cleavage activities (13, 28, 41, 54). It is also possible that the N terminus has additional roles that are important for the intracellular function of topo I.
Since topo I is a nuclear protein, its N terminus may function in
nuclear import. In a heterologous yeast expression system, full-length
human topo I can be imported into yeast nuclei, while removal of a
70-residue segment in the N terminus of human topo I results in its
distribution in the cytoplasm (1). Using a chromogenic assay
of
-gal to detect the localization of top1-lacZ fusion
constructs, we have shown that the N-terminal 315 residues are able to
direct the chimeric protein into Drosophila nuclei. It has
been documented that the efficiency of nuclear import is very sensitive
to the context of the nuclear localization sequence that is linked to
this bacterial enzyme (39). Therefore, the N-terminal 315 residues of Drosophila topo I must contain potent nuclear
localization sequences which are competent in importing these large
-gal fusion proteins into nuclei. While the nuclear localization
signal (NLS) in the N terminus of topo I remains to be defined,
sequence analysis revealed a possible candidate NLS from residues 135 to 150 (KRSSKDKERRDKDKDR). This putative NLS contains two clusters of
basic amino acids spaced nine residues apart, in agreement with
previously described bipartite NLSs (11, 22). We have made a
construct that expresses, in yeast, a green fluorescent protein with
these 16 amino acid residues placed at its C terminus and have found
that it was not imported into yeast nuclei (data not shown). This
result does not necessarily address the issue of whether this sequence
can serve as an NLS in Drosophila cells. It is possible that
other basic residues in this hydrophilic tail may serve such a
function. Alternatively, the NLS may require adjacent residues in
addition to the 16-mer sequence tested here.
We have also demonstrated that the N-terminal 315 residues can target top1-lacZ fusion proteins to transcriptionally active loci, where the functions of topo I are required. Mapping the topo I binding site by DNA cleavage reactions has shown that the distribution of topo I is enriched in the regions of chromatin with active transcription (38, 49, 61). Immunofluorescence experiments have also demonstrated that topo I is concentrated at the chromosome puffs in Drosophila salivary glands (15). Our data indicated that the N-terminal 315 residues were sufficient to direct a large bacterial protein to the puffs where the hyperphosphorylated form of RNA pol II was also present. While RNA pol IIo is always concentrated in the chromosome puffs, its distribution in the interbands is not uniform and does not coincide with the distribution of the hypophosphorylated form of RNA pol II (58). The interband distributions of both topo I and the top1-lacZ fusion protein (Fig. 5) also were not always coincident with that of RNA pol IIo. Earlier work also showed that the distribution of topo I holoenzyme in the chromatin interband is not completely coincident with that of RNA pol II (15). The biochemical bases for these different patterns of interband distribution are unclear. Our data did not address the localizations of RNA pol I, pol IIa, or pol III at the transcriptionally active loci. However, the fusion protein is also found in the nucleolus organizers in the polytene chromosome squashes (data not shown), regions where ribosomal DNA (rDNA) undergoes active transcription. It is noteworthy that many lines of evidence have linked topo I to rDNA transcription (15, 23, 38, 61). Therefore, the N-terminal topo I sequence may be capable of targeting to rDNA transcription loci.
As a reaction to an environmental stress like heat shock, chromatin undergoes rapid and dynamic remodeling to turn off most of the gene expression and to turn on the genes specifically associated with heat shock responses (reviewed in reference 31). The induction of heat shock loci, which results in the synthesis of heat shock proteins and RNA, is accomplished by the recruitment of RNA pol II, transcription factors, and other chromosomal proteins including topo I to heat shock puffs (15, 19, 24, 46, 53, 58). Our immunofluorescence data demonstrated that the topo I N-terminal sequence enables rapid mobilization of topo I to the heat shock puffs. This dynamic mobilization of top1-lacZ fusion proteins was also observed when heat shock puffs regressed during a prolonged heat treatment and when the developmental puffs were reestablished after the cessation of heat shock. Therefore, the ability of topo I to respond to cellular processes, especially during the reprogramming of gene expression, may reside completely in the N-terminal 315 residues.
The biochemical basis for the recruitment of topo I to transcriptionally active loci is not yet established. There are a number of possible mechanisms underlying the association of topo I with a transcriptional complex. First, the binding might be mediated through RNA transcripts. In this case, one would expect a lag between the localization of the topo I fusion protein and RNA pol II. However, the topo I fusion protein appears to colocalize with RNA pol II in the newly established heat shock loci even at the earliest detectable point of the heat treatment (Fig. 7d). While the developmental puffs have not yet regressed, both topo I fusion protein and RNA pol II have already begun to depart from these puffs (compare Fig. 7c' and c). These experiments suggest that there is no significant lapse in time between the movements of the topo I fusion protein and RNA pol II from the chromosome puffs. Furthermore, by using a procedure of RNase treatment that can remove nuclear ribonucleoprotein complexes from polytene chromosome squashes (2), it was found that immunostaining signals of both topo I fusion protein and RNA pol II were not diminished in comparison with those from the control experiment without RNase treatment (data not shown).
A second possible mechanism for topo I targeting to the transcriptional complex is that topo I may recognize special DNA structures associated with a chromatin region undergoing active transcription. Such structures could be, for example, the positive and negative supercoils present in the front and in the wake, respectively, of a transcription fork (33). Eukaryotic topo I is known to be able to recognize and bind to both positively and negatively supercoiled DNA (7, 34, 38, 60). However, this explanation can be ruled out, since preferential binding of topo I to supercoiled DNA is mediated through the conserved catalytic core domains (34) and the N-terminal 315 residues lack the conserved core domains.
The localization of topo I to the transcriptionally active loci could be mediated through protein-protein interactions between the N terminus of topo I and the transcriptional complexes. The hydrophilic patches in the topo I N terminus may provide a surface for such protein-protein interactions. Recent biochemical data demonstrated an interaction of the human topo I N terminus with either an abundant nucleolar protein, nucleolin, or Simian virus 40 T antigen (4, 21). By immunoprecipitation assays, we have demonstrated that the two largest subunits of RNA pol II coprecipitated with the top1-lacZ fusion protein. This result does not address the question of whether topo I is directly associated with RNA pol II. However, topo I has been shown to collaborate with transcription factor TFIID and to function as a coactivator of specific activation and as a repressor in in vitro transcription reactions (29, 36). This coactivation by topo I is due to the participation of topo I in the formation of an active TFIID-TFIIA initiation complex (45). Interestingly, a topo I mutant with the active-site tyrosine replaced with phenylalanine still functions as a coactivator, suggesting that coactivation does not require the catalytic activity of topo I (36, 45). Together, these data suggest that the colocalization of topo I with RNA pol II at chromosome puffs could be mediated through the protein-protein interaction within the transcriptional initiation complex and that this interaction surface may only involve the N-terminal 315 residues. Although we have not yet identified the minimal interaction sequence, further investigation of the physical contact between the N terminus of topo I and the transcriptional complex will provide insight into the molecular mechanism of the role of topo I in gene expression.
In summary, we have generated a series of Drosophila
transgenes of the N-terminal topo I sequences linked to
-gal and
have used them to demonstrate that the N-terminal 315 residues of topo I can target the fusion proteins to transcriptionally active loci on
chromosomes. These topo I fusion transgenes may provide useful biochemical and genetic tools to further probe the biological functions
of topo I.
ACKNOWLEDGMENTS
|
|
|---|
We are grateful to Paul Schedl for helpful discussion and for
providing plasmid vectors as well as a fly strain carrying the
-gal
transgene. We thank Arno Greenleaf for generously providing us the
affinity-purified antibodies against RNA pol II. We appreciate Alice
Chen and Steve Chang for their excellent technical assistance, and
acknowledge the Department of Cell Biology at Duke University for the
use of its fluorescence microscope facility.
This work is supported by a grant GM29006 from NIH.
FOOTNOTES
* Corresponding author. Mailing address: Department of Biochemistry, Duke University Medical Center, Durham, NC 27710. Phone: (919) 684-6501. Fax: (919) 684-8885. E-mail: hsieh{at}biochem.duke.edu.
REFERENCES
|
|
|---|
| 1. |
Alsner, J.,
J. Q. Svejstrup,
E. Kjeldsen,
B. S. Sorensen, and O. Westergaard.
1992.
Identification of an N-terminal domain of eukaryotic DNA.
J. Biol. Chem.
267:12408-12411 |
| 2. |
Amero, S. A.,
M. J. Matunis,
E. L. Matunis,
J. W. Hockensmith,
G. Raychaudhuri, and A. L. Beyer.
1993.
A unique ribonucleoprotein complex assembles preferentially on ecdysone-responsive sites in Drosophila melanogaster.
Mol. Cell. Biol.
13:5323-5330 |
| 3. | Ashburner, M., and J. J. Bonner. 1979. The induction of gene activity in Drosophila by heat shock. Cell 17:241-254[Medline]. |
| 4. |
Bharti, A. K.,
M. O. J. Olson,
D. M. Kufe, and E. H. Rubin.
1996.
Identification of a nucleolin binding site in human topoisomerase I.
J. Biol. Chem.
271:1993-1997 |
| 5. |
Bjornsti, M. A., and J. C. Wang.
1987.
Expression of yeast DNA topoisomerase I can complement a conditional-lethal DNA topoisomerase I mutation in Escherichia coli.
Proc. Natl. Acad. Sci. USA
84:8971-8975 |
| 6. | Brown, S. D., C. Zhang, A. Chen, and T.-S. Hsieh. 1998. Structure of the Drosophila DNA topoisomerase I gene and expression of messages with different lengths in 3' untranslated region. Gene 211:195-203[Medline]. |
| 7. | Caserta, M., A. Amadei, G. Camilloni, and E. Di Mauro. 1990. Regulation of the function of eukaryotic DNA topoisomerase I: analysis of the binding step and of the catalytic constants of topoisomerization as a function of DNA topology. Biochemistry 29:8152-8157[Medline]. |
| 8. | Champoux, J. J. 1990. Mechanistic aspects of type-I topoisomerases, p. 217-242. In N. R. Cozzarelli, and J. C. Wang (ed.), DNA topology and its biological effects. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 9. |
Champoux, J. J., and R. Dulbecco.
1972.
An activity from mammalian cells that untwists superhelical DNA a possible swivel for DNA replication.
Proc. Natl. Acad. Sci. USA
69:143-146 |
| 10. |
D'Arpa, P.,
P. S. Machlin,
H. de Ratrie,
N. F. Rothfield,
D. W. Cleveland, and W. C. Earnshaw.
1988.
cDNA cloning of human DNA topoisomerase I: catalytic activity of a 67.7-kDa carboxyl-terminal fragment.
Proc. Natl. Acad. Sci. USA
85:2543-2547 |
| 11. |
Dingwall, C., and R. A. Laskey.
1991.
Nuclear targeting sequences a consensus?
Trends Biochem. Sci.
16:478-481[Medline].
|
| 12. | Durban, E., M. Goodenough, J. Mills, and H. Busch. 1985. Topoisomerase I phosphorylation in vitro and in rapidly growing Novikoff hepatoma. EMBO J. 4:2921-2926[Medline]. |
| 13. | Durban, E., J. S. Mills, D. Roll, and H. Busch. 1983. Phosphorylation of purified Novikoff hepatoma topoisomerase I. Biochem. Biophys. Res. Commun. 111:897-905[Medline]. |
| 14. | Elder, R. T., O. C. Uhlenbeck, and P. Szabo. 1980. 4S RNA gene organization in Drosophila melanogaster, p. 317-323. In D. Söll, J. N. Abelson, and P. R. Schimmel (ed.), Transfer RNA: biological aspects, vol. 9B. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 15. |
Fleischmann, G.,
G. Pflugfelder,
E. K. Steiner,
K. Javaherian,
G. C. Howard,
J. C. Wang, and S. C. R. Elgin.
1984.
Drosophila DNA topoisomerase I is associated with transcriptionally active regions of the genome.
Proc. Natl. Acad. Sci. USA
81:6958-6962 |
| 16. | Gilmour, D. S., G. Pflugfelder, J. C. Wang, and J. T. Lis. 1986. Topoisomerase I interacts with transcribed regions in Drosophila cells. Cell 44:401-407[Medline]. |
| 17. | Glaser, R. L., M. F. Wolfner, and J. T. Lis. 1986. Spatial and temporal pattern of hsp26 expression during normal development. EMBO J. 5:747-754[Medline]. |
| 18. | Glew, L., R. Lo, M. Nichols, D. Söll, and J. Bell. 1986. The nucleotide sequence, localization and transcriptional properties of a tRNALeu gene from Drosophila melanogaster. Gene 44:307-314[Medline]. |
| 19. | Greenleaf, A. L., U. Plagens, M. Jamrich, and E. K. Bautz. 1978. RNA polymerase B (or II) in heat induced puffs of Drosophila polytene chromosomes. Chromosoma 65:127-136[Medline]. |
| 20. | Gupta, M., A. Fujimori, and Y. Pommier. 1995. Eukaryotic DNA topoisomerases I. Biochim. Biophys. Acta 1262:1-14[Medline]. |
| 21. |
Haluska, P., Jr.,
A. Saleem,
T. K. Edwards, and E. H. Rubin.
1998.
Interaction between the N-terminus of human topoisomerase I and SV40 large T antigen.
Nucleic Acids Res.
26:1841-1847 |
| 22. | Hicks, G. R., and N. V. Raikhel. 1995. Protein import into the nucleus: an integrated view. Annu. Rev. Cell Dev. Biol. 11:155-188. [Medline] |
| 23. | Higashinakagawa, T., H. Wahn, and R. H. Reeder. 1977. Isolation of ribosomal gene chromatin. Dev. Biol. 55:375-386[Medline]. |
| 24. | Holt, T. K. 1970. Local protein accumulation during gene activation. I. Quantitative measurements on dye binding capacity at subsequent stages of puff formation in Drosophila hydei. Chromosoma 32:64-78[Medline]. |
| 25. |
Horabin, J. I., and P. Schedl.
1993.
Regulated splicing of the Drosophila sex-lethal male exon involves a blockage mechanism.
Mol. Cell. Biol.
13:1408-1414 |
| 26. | Hsieh, T., M. P. Lee, and S. D. Brown. 1994. Structure of eukaryotic type I DNA topoisomerase. Adv. Pharmcol. 29:191-200. |
| 27. |
Hsieh, T.-S.,
S. D. Brown,
P. Huang, and J. Fostel.
1992.
Isolation and characterization of a gene encoding DNA topoisomerase I in Drosophila melanogaster.
Nucleic Acids Res.
20:6177-6182 |
| 28. | Kaiserman, H. B., T. S. Ingebritsen, and R. M. Benbow. 1988. Regulation of Xenopus laevis DNA topoisomerase I activity by phosphorylation in vitro. Biochemistry 27:3216-3222[Medline]. |
| 29. |
Kretzschmar, M.,
M. Meisterernst, and R. G. Roeder.
1993.
Identification of human DNA topoisomerase I as a cofactor for activator-dependent transcription by RNA polymerase II.
Proc. Natl. Acad. Sci. USA
90:11508-11512 |
| 30. |
Lee, M. P.,
S. D. Brown,
A. Chen, and T.-S. Hsieh.
1993.
DNA topoisomerase I is essential in Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
90:6656-6660 |
| 31. | Lis, J. T., and C. Wu. 1993. Protein traffic on the heat shock promoter: parking, stalling, and trucking along. Cell 74:1-4[Medline]. |
| 32. |
Liu, L. F., and K. G. Miller.
1981.
Eukaryotic DNA topoisomerases: two forms of type I DNA topoisomerases from HeLa cell nuclei.
Proc. Natl. Acad. Sci. USA
78:3487-3491 |
| 33. |
Liu, L. F., and J. C. Wang.
1987.
Supercoiling of the DNA template during transcription.
Proc. Natl. Acad. Sci. USA
84:7024-7027 |
| 34. | Madden, K. R., L. Stewart, and J. J. Champoux. 1995. Preferential binding of human topoisomerase I to superhelical DNA. EMBO J. 14:5399-5409[Medline]. |
| 35. | Mason, P. J., L. M. C. Hall, and J. Gausz. 1984. The expression of heat shock genes during normal development in Drosophila melanogaster (heat shock/abundant transcripts/developmental regulation). Mol. Gen. Genet. 194:73-78. |
| 36. | Merino, A., K. R. Madden, W. S. Lane, J. J. Champoux, and D. Reinberg. 1993. DNA topoisomerase I is involved in both repression and activation of transcription. Nature 365:227-232[Medline]. |
| 37. | Morham, S. G., K. D. Kluckman, N. Voulomanos, and O. Smithies. 1996. Targeted disruption of the mouse topoisomerase I gene by camptothecin selection. Mol. Cell. Biol. 16:6804-6809[Abstract]. |
| 38. | Muller, M. T., W. P. Pfund, V. B. Mehta, and D. K. Trask. 1985. Eukaryotic type I topoisomerase is enriched in the nucleolus and catalytically active on ribosomal DNA. EMBO J. 4:1237-1243[Medline]. |
| 39. |
Nelson, M., and P. Silver.
1989.
Context affects nuclear protein localization in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:384-389 |
| 40. | Pirrotta, V. 1988. Vectors for P-mediated transformation in Drosophila, p. 437-456. In R. L. Rodriguez, and D. T. Denhardt (ed.), Vectros, a survey of molecular cloning vectors and their uses. Butterworths, Boston, Mass. |
| 41. |
Pommier, Y.,
D. Kerrigan,
K. D. Hartman, and R. I. Glazer.
1990.
Phosphorylation of mammalian DNA topoisomerase I and activation by protein kinase C.
J. Biol. Chem.
265:9418-9422 |
| 42. |
Robertson, H. M.,
C. R. Preston,
R. W. Phillis,
D. M. Johnson-Schlitz,
W. K. Benz, and W. R. Engels.
1988.
A stable genomic source of P element transposase in Drosophila melanogaster.
Genetics
118:461-470 |
| 43. |
Rubin, G. M., and A. C. Spradling.
1982.
Genetic transformation of Drosophila with transposable element.
Science
218:348-353 |
| 44. | Sadoff, B. U., S. Heath-Pagliuso, I. B. Castano, Y. Zhu, F. S. Kieff, and M. F. Christman. 1995. Isolation of mutants of Saccharomyces cerevisiae requiring DNA topoisomerase I. Genetics 141:465-479[Abstract]. |
| 45. |
Shykind, B. M.,
J. Kim,
L. Stewart,
J. J. Champoux, and P. A. Sharp.
1997.
Topoisomerase I enhances TFIID-TFIIA complex assembly during activation of transcription.
Genes Dev.
11:397-407 |
| 46. | Silver, L. M., and S. C. Elgin. 1979. Immunofluorescent analysis of chromatin structure in relation to gene activity: a speculative essay. Curr. Top. Dev. Biol. 13:71-88. |
| 47. |
Silver, P. A.,
L. Keegan, and M. Ptashne.
1984.
Amino terminus of the yeast GAL4 gene product is sufficient for nuclear localization.
Proc. Natl. Acad. Sci. USA
81:5951-5955 |
| 48. |
Spradling, A. C., and G. M. Rubin.
1982.
Transposition of cloned P elements into Drosophila germ line.
Science
218:341-347 |
| 49. | Stewart, A. F., R. E. Herrera, and A. Nordheim. 1990. Rapid induction of c-fos transcription reveals quantitative linkage of RNA polymerase II and DNA topoisomerase I enzyme activities. Cell 60:141-149[Medline]. |
| 50. |
Stewart, L.,
G. C. Ireton, and J. J. Champoux.
1996.
The domain organization of human topoisomerase I.
J. Biol. Chem.
271:7602-7608 |
| 51. | Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89[Medline]. |
| 52. | Thummel, C. S., A. M. Boulet, and H. D. Lipshitz. 1988. Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74:445-456[Medline]. |
| 53. | Tsukiyama, T., P. B. Becker, and C. Wu. 1994. ATP-dependent nucleosome disruption at a heat-shock promoter binding of GAGA transcription factor. Nature 367:525-532[Medline]. |
| 54. | Turman, M. A., and A. Douvas. 1993. A casein kinase type II (CKII)-like nuclear protein kinase associates with, phosphorylates, and activates topoisomerase I. Biochem. Med. Metab. Biol. 50:210-225[Medline]. |
| 55. | Wang, J. C. 1996. DNA topoisomerases. Annu. Rev. Biochem. 65:635-692[Medline]. |
| 56. |
Wang, J. C.
1971.
Interaction between DNA and Escherichia coli protein .
J. Mol. Biol.
55:523-533[Medline].
|
| 57. |
Weeks, J. R.,
D. E. Coulter, and A. L. Greenleaf.
1982.
Immunological studies of RNA polymerase II using antibodies to subunits of Drosophila and wheat germ enzyme.
J. Biol. Chem.
257:5884-5892 |
| 58. |
Weeks, J. R.,
S. E. Hardin,
J. Shen,
J. M. Lee, and A. L. Greenleaf.
1993.
Locus-specific variation in phosphorylation state of RNA polymerase II in vivo: correlations with gene activity and transcript processing.
Genes Dev.
7:2329-2344 |
| 59. | Yanagida, M., and R. Sternglanz. 1990. Genetics of DNA topoisomerases, p. 299-320. In N. R. Cozzarelli, and J. C. Wang (ed.), DNA topology and its biological effects. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 60. | Zechiedrich, E. L., and N. Osheroff. 1990. Eukaryotic topoisomerases recognize nucleic acid topology by preferentially interacting with DNA crossovers. EMBO J. 9:4555-4562[Medline]. |
| 61. |
Zhang, H.,
J. C. Wang, and L. F. Liu.
1988.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes.
Proc. Natl. Acad. Sci. USA
85:1060-1064 |
| 62. | Zimmerman, J. L., W. Petri, and M. Meselson. 1983. Accumulation of a specific subset of D. melanogaster heat shock mRNAs in normal development without heat shock. Cell 32:1161-1170[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»