INTRODUCTION

Top Previous Next References

Type I DNA topoisomerase (topo I) catalyzes a cycle of transesterification reactions, during which it generates transient single-strand DNA breaks; these reversible reactions result in the topological transformation of either single-strand or double-strand DNA molecules (8, 20, 55). Biochemical and genetic studies have demonstrated that topo I plays important roles in DNA replication, transcription, and recombination and in chromosome condensation and the maintenance of genome stability. The top1 gene is not essential for viability in yeast, and genetic analysis suggests that some of the biological functions of topo I can be performed by topo II (59). However, recent genetic screens of Saccharomyces cerevisiae have identified four complementation groups of mutants with mutations that, in combination with a top1 mutation, result in a lethal phenotype. Some of these synthetic lethal mutants have mutations in genes other than top2 (44). Therefore, it is possible that not all the biological functions of topo I can be substituted by topo II. Furthermore, because top1 is an essential gene in Drosophila melanogaster (30) and in mice (37), the functions of topo I may not be efficiently substituted by topo II in multicellular organisms.

One of the functions of topo I is to provide a swivel to facilitate the unwinding of the DNA duplex during the process of transcription or replication (56). Diametric DNA supercoiling can transiently accumulate in the front and in the wake of a transcriptional fork as proposed in the twin-domain DNA supercoiling model (33). Eukaryotic topo I can relieve both the positive and negative supercoils generated during the fork movement. By immunological studies, and the use of camptothecin to trap and map topo I cleavages, it has been shown that topo I is concentrated at transcriptionally active loci (15, 16, 49, 61). In addition, topo I can serve as a coactivator of specific gene expression and as a repressor of basal transcription in vitro through its association with the transcription complex TFIID (29, 36). The participation of topo I in transcriptional initiation has been shown by its effect on the assembly of a complex of TFIID and TFIIA on the promoter (45). These data reveal an essential role for topo I in transcription.

Based on the amino acid sequence alignment, eukaryotic topo I enzymes have conserved domains with about 500 amino acid residues in the central and C-terminal portions, while their N termini have little homology and have variable lengths, ranging from 140 residues in S. cerevisiae to 430 residues in D. melanogaster (20, 26). Despite the fact that the N-terminal sequences are not conserved, they are characterized by an abundance of acidic and basic residues, and by their sensitivity to proteolysis (32, 50). Studies with human (10, 50) and yeast (5) enzymes have shown that their N-terminal domains are dispensable for catalytic activity. Although, these N termini are not required for the strand passage activity of topo I, they may have important roles in the in vivo functions of topo I; this remains to be elucidated.

The hydrophilic N-terminal domain of Drosophila topo I is unique, because it is much longer than that of other species, and it contains clusters of serine and histidine residues that are shared by other Drosophila gene products (6, 27). In this paper, we present data relating to the functions of the N terminus of Drosophila topo I. The N terminus was inconsequential for its catalytic activity, as is the case in other species. Furthermore, our studies of N-terminal fusion constructs with a reporter protein, -galactosidase (-gal) have demonstrated that the N-terminal domain directs the chimeric products to transcriptionally active loci in the polytene chromosomes and that the fusion proteins are present in a complex that also contains RNA polymerase II (pol II).

MATERIALS AND METHODS

Top Previous Next References

Plasmid constructions. N-terminal deletion constructs are denoted ND, followed by the number of residues deleted from the N terminus. ND472 and ND582 were made by deleting DNA sequences in pETI.6 (27) from the NheI site near the T7 promoter to the unique SacI and StuI sites, respectively. ND423 was engineered by synthesizing a truncated topo I cDNA fragment with PCR. The primers used in this PCR were 5'GCCAAGGATCCGGAGGTTTGGCGATGG3' (nucleotides 1528 to 1543 in top1 cDNA) and 5'GAACAGGCCTGGCGGCTC3' (nucleotides 1994 to 2011). The italicized sequence in the first oligonucleotide is not homologous to topo I cDNA, and the underlined sequences in the oligonucleotides correspond to BamHI and StuI sites, respectively. After digestion with restriction enzymes BamHI and StuI, the PCR fragment was inserted into the BamHI-StuI sites of expression vector pETI.6 to generate ND423. All the constructs were first introduced to the bacterial strain AG1 (Stratagene, La Jolla, Calif.) and sequenced to confirm the junction DNA sequences before they were moved into the expression strain BL21 (DE3, pLysS) (Novagen, Inc., Madison, Wis.).

Expression of topo I and its truncation mutants in BL21 (DE3, pLysS). Bacterial cultures started from a 50-fold dilution of overnight cultures were allowed to grow at 37°C for 2 h before induction by adding isopropyl--D-thiogalactoside (IPTG) to 1 mM. The induction proceeded for 5 h at 30°C, and the cultures were pelleted by centrifugation and stored at 70°C. The frozen bacterial pellet was thawed in lysis buffer (20 mM NaPO₄ [pH 7.0], 0.5 M NaCl, 2.5 mM EDTA, 5% glycerol, 1 mM phenylmethylsulfonyl fluoride, 1 µg of leupeptin and pepstatin per ml). The bacterial lysate was sonicated to ensure complete lysis and to reduce its viscosity. The cleared lysate was prepared by centrifugation at 12,000 × g for 20 min. The expression of Drosophila topo I was monitored by assaying supercoil relaxation activity and by immunoblotting with an antibody against Drosophila topo I in accordance with the procedures described earlier (26).

Drosophila germ line transformation. P-element-mediated transformation of Drosophila was carried out as described by Rubin and Spradling (43, 48), with the modification of using a strain carrying a stable genomic source of transposase (42). Second-chromosome-linked homozygous transformants were used in the immunofluorescence microscopy because the cytological mapping of chromosome puffs is more straightforward in these strains. The lacZ control fly, 28-1 (generously provided by P. Schedl, Princeton University), which expresses -gal protein under the control of the hsp83 promoter, was generated with transformation vector pC4-hsp83AUGgal, which was derived from pC4-AUG-gal plasmid (52).

Salivary gland staining. Staining of salivary glands was based on a method previously described (17). Briefly, third-instar larvae were dissected in buffered 1% glutaraldehyde. The color development of the tissue was carried out in 0.2% X-Gal (5-bromo-4-chloro-3-indolyl--D galactopyranoside) (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) for 60 to 120 min. The stained salivary glands were stored in 100% glycerol and imaged on a Leitz DMIL inverted microscope equipped with a Hamamatsu C5810 camera.

Polytene chromosome squashes and immunofluorescence microscopy. Preparations of polytene chromosome squashes and immunofluorescence staining were as described by Weeks et al. (57, 58). Briefly, salivary glands from late-third-instar larvae were dissected in phosphate-buffered saline-0.5% Triton X-100 (PBS-T) and fixed in 3.7% formaldehyde-PBS-T. Polytene chromosomes were then squashed in 45% acetic acid-1% formaldehyde. For heat shock treatment, third-instar larvae were placed inside microcentrifuge tubes with small ventilation holes on the lids and submerged in a 37°C water bath for the desired length of time.

RESULTS

Top Previous Next References

Amino-terminal truncations of Drosophila DNA topo I. To test the possible biochemical functions of the nonconserved N-terminal domain of the Drosophila enzyme, we constructed a series of N-terminal truncation mutants: ND423, ND472, and ND582 (see Materials and Methods). ND423 lacks the first 423 residues of topo I and contains 549 residues corresponding to the highly homologous domains. ND472 and ND582 lack additional N-terminal sequences and portions of the conserved sequences (Fig. 1a and b). These constructs and a full-length topo I cDNA were cloned into inducible bacterial expression vector pET3b under the control of a phage T7 promoter (51).

View larger version (29K): [in this window] [in a new window]   FIG. 1.   Drosophila topo I N-terminal deletion and top1-lacZ fusion constructs. (a) Schematic diagram of the structural features of the enzyme. The top of the panel indicates the number of amino acid residues. In the lower part of the panel, the hatched boxes (II, III, IV, and VI) represent regions of amino acid sequence homology among topo I proteins from humans, Drosophila melanogaster, Arabidopsis thaliana, and budding and fission yeasts (26). The active-site tyrosine is shown as Y, and +/ and +++/ refer to charged and hydrophilic residues. (b) ND423, ND472, and ND582 are three proteins with N-terminal deletions; they have codons for amino acid residues from 1 to 423, 472, and 582, respectively, removed from the full-length top1 cDNA. (c) Fusion constructs of N-terminal segments of topo I and -gal. NF stands for N-terminal fusion, and the suffix numbers are the numbers of amino acid residues of topo I remaining in the fusion constructs. (d) Linear representation of pCaSpeRhsp83 plasmid with the top1-lacZ insert (not drawn to scale). The solid arrowheads indicate the 5' and 3' terminal repeats of the P element, and the thin arrows show the direction of transcription.

View larger version (43K): [in this window] [in a new window]   FIG. 2.   Supercoil relaxation activities of bacterial extracts expressing topo I and truncation mutants. Supercoiled plasmid DNA substrate was incubated with extracts prepared from bacteria expressing the full-length protein (lanes 1 to 4), ND423 (lanes 5 to 8), ND472 (lanes 9 to 12), ND582 (lanes 13 to 16), and vector pET3b (lanes 17 to 20). The DNA products were analyzed by agarose gel electrophoresis, and the positions of supercoiled (SC) as well as relaxed-circular (RC) DNA are indicated on the left side. Four successive 10-fold dilutions were carried out in each set of the activity assays. Lanes 1, 5, 9, 13, and 17 show the assays of undiluted extracts, while lanes 4, 8, 12, 16, and 20 show the assays with 1,000-fold-diluted extracts. Expression plasmid DNAs, present in higher concentrations in the reaction mixtures, were visible in lanes 9 and 17.

Construction and expression of top1-lacZ fusion proteins. Although the hydrophilic N terminus is not required for in vitro topo I activity, it may contain important properties that are essential in vivo. We explored this possibility by constructing vectors expressing fusion peptides of topo I with -gal in Drosophila cells. Four fusion constructs, NF315, NF438, NF582, and NF964, in which increasing amounts of amino-terminal sequence were fused to -gal by in-frame fusion, were generated (Fig. 1c and d; see details in Materials and Methods). These chimeric constructs were under the control of the hsp83 promoter and were cloned into a P-element transposon vector derived from pCaSpeR (Fig. 1d). Stable transgenic lines were obtained by microinjecting vector DNAs into fly embryos and following established germ line transformation procedures (43, 48).

View larger version (83K): [in this window] [in a new window]   FIG. 3.   Expression of top1-lacZ fusion proteins in transgenic flies. Protein extracts from adult flies were prepared as described previously (30), and about 50 µg of total protein from each transgenic sample was loaded on an SDS-5% PAGE gel. Western blots were probed with either affinity purified rabbit anti-topo I antibody (a) or rabbit anti--gal antibody (b). Lane 1 contains a protein extract from wild-type flies, and lane 14 contains a protein extract from 28-1 flies (a transgenic strain transformed with a control construct of -gal). Lanes 2 to 13 contain adult fly extracts from the following independent transformants: NF315 (lanes 2, 3, and 4), NF438 (lanes 5, 6, and 7), NF582 (lanes 8, 9, and 10), and NF964 (lanes 11, 12, and 13). Arrows indicate the migration positions of different fusion products. The solid and open arrowheads label the positions of endogenous topo I and -gal, respectively. Molecular masses for size markers in kilodaltons are indicated under M.

Nuclear localization of top1-lacZ fusion proteins. Since topo I is a nuclear enzyme, it is possible that one of the functions residing in the nonconserved N-terminal domain is nuclear localization. We examined the subcellular distribution of the fusion proteins by a histochemical -gal staining assay, which converted X-Gal into blue precipitates. While salivary glands from the wild-type control showed no endogenous -gal activity (Fig. 4c), the transgenic fly (28-1), which carried -gal driven by an hsp83 promoter, showed an even distribution of the stains throughout the salivary gland (Fig. 4b). In this nonfusion -gal control, nuclear staining varied from a slight accumulation to exclusion from the nucleus. Therefore, -gal does not have a specific nuclear localization function, a finding consistent with the earlier observations that -gal expressed in yeast cells was not imported into nuclei (39, 47). In a marked contrast, specific and intense staining was restricted to the nuclei in the salivary gland and surrounding tissue in the NF315 transgenic fly (Fig. 4a). Similar staining patterns were also observed from NF438 and NF582 (data not shown). Consistent with the immunoblot experiments, no staining was observed in the NF964 fly, suggesting that there is very little or no expression of the functional fusion peptide from NF964. The clear differentials between the cytoplasmic and nuclear staining in NF315 suggest that the N-terminal 315 residues in topo I contain a signal for nuclear localization to allow efficient import of large -gal fusion proteins into nuclei.

View larger version (99K): [in this window] [in a new window]   FIG. 4.   Nuclear localization of the top1-lacZ fusion protein in salivary glands detected by X-Gal staining for -gal activity. Salivary glands from third-instar larvae of NF315 (a), 28-1 (b), and wild-type (c) flies were prepared as described in Materials and Methods. The -gal activity is readily detected in the nuclei of NF315 transgenic animals and is shown as the dark staining. Note that the smaller nuclei of adjacent tissue also exhibit the activity (a). Scale bar (b), 100 µm.

Localization of top1-lacZ fusion proteins on the developmental puffs in polytene chromosomes. Both biochemical and genetic studies have suggested that there are important functions for topo I in transcription (20, 55). For example, topo I is associated with the chromatin domains, where there is active transcription (38, 49, 61). Furthermore, topo I has been shown to colocalize with RNA pol II in developmental puffs of the polytene chromosomes by immunofluorescence staining (15). Since the top1-lacZ fusion proteins were efficiently transported into nuclei, we proceeded to examine if these proteins can be targeted to regions of transcription just like the full-length topo I.

View larger version (55K): [in this window] [in a new window]   FIG. 5.   top1-lacZ fusion products colocalize with RNA pol IIo on developmental puffs. Preparations of chromosome squashes from transgenic flies carrying NF438 were reacted with goat anti-IIo and rabbit anti--gal, followed by species-specific, fluorescence-tagged secondary antibody. Red fluorescence for RNA pol IIo (a) and green fluorescence for -gal (b) are shown. Panel c is a superimposed fluorescence image of panels a and b, showing blended colors of green and red at the indicated developmental puffs. The asterisk in panel c marks cytological position 66B, which is enriched in topo I fusion protein but not RNA pol IIo.

View larger version (46K): [in this window] [in a new window]   View larger version (84K): [in this window] [in a new window]   FIG. 6.   top1-lacZ fusion products are recruited to chromosome puffs as the endogenous topo I. (a) Extracts from wild-type (WT) and NF315 adult flies were separated on an SDS-7% PAGE gel. Western blots were probed with either mouse anti--gal or affinity-purified rabbit anti-ND423 antibodies. The arrow indicates the top1-lacZ fusion protein. The size markers are marked on the left of the Western blot. (b) Immunofluorescence images of both untreated and heat-shocked polytene chromosomes double stained with affinity-purified rabbit anti-ND423 and mouse anti--gal. DAPI-stained fluorescence images were used to identify chromosome bands and puffs. The symbols  and identify developmental puffs 74EF and 75B, respectively; the symbols  and indicate heat shock puffs 87A and 87C, respectively.

Time course of recruitment of top1-lacZ fusion proteins upon heat shock treatment. The above experiments demonstrate that the N terminus of topo I is capable of recruiting top1-lacZ fusion proteins to transcriptionally active loci induced by heat shock. An environmental stress like heat shock can repress the developmental puffs and induce new chromosomal puffs (3), thus providing an excellent system to monitor the movement of topo I fusion proteins during the reprogramming of gene expression. We examined the rate at which this recruitment takes place and whether the N-terminal domain could mobilize the fusion proteins from heat shock loci during the recovery from heat treatment. Chromosome squashes prepared from transgenic strain NF315 that had undergone heat shock treatment for various times were used in these studies. Only the merged images are shown here. Yellow-orange staining shows the colocalization of RNA pol IIo and top1-lacZ fusion protein (Fig. 7). Fluorescence images of DAPI-stained squashes were also recorded to facilitate the identification of chromosome bands and puffs (Fig. 7a' to j'). Before heat shock, strong ecdysone-induced puffs 74EF and 75B were clearly marked with both antigens (Fig. 7a), while the heat shock loci, 87A and 87C, were not labeled with either antigen (Fig. 7b). The staining of 74EF and 75B was significantly reduced after 10 min of heat shock (Fig. 7c), and staining disappeared completely in the samples with 20 (Fig. 7e) and 60 (Fig. 7g) min of heat treatment. There was a parallel accumulation of both proteins at heat shock loci after 10 (Fig. 7d) and 20 (Fig. 7f) min of heat shock treatment. After a prolonged heat treatment, heat shock puffs regressed slightly, and the presence of both proteins persisted, albeit in lesser amounts (60-min point in Fig. 7h). The dynamic movement of these proteins at chromosome puffs was also apparent during the cessation of heat treatment. After 60 min of recovery from heat treatment, the program for normal developmental expression resumed, with both proteins reentering the 74EF and 75B puffs (Fig. 7i) along with their coordinated departure from the heat shock loci (Fig. 7j). We only highlighted 74EF and 75B for developmental puffs and 87A and 87C for heat shock puffs in these experiments, but similar dynamic movement of these proteins was also observed on other major developmental and heat shock puffs. These results show that the N-terminal 315 residues can mobilize the fusion proteins to new loci during the reprogramming of gene expression as efficiently as the holoenzyme of topo I. 

View larger version (100K): [in this window] [in a new window]   View larger version (105K): [in this window] [in a new window]   FIG. 7.   Localization of top1-lacZ fusion products to the developmental and heat shock-induced puffs during heat treatment. Polytene chromosome squashes were prepared from NF315 flies with no heat shock (a and b); heat treatment for 10 (c and d), 20 (e and f), or 60 (g and h) min; or recovery at 25°C for 60 min after heat shock for 60 min (i and j). They were then immunostained with anti--gal and anti-IIo antibodies. Merged images are shown here for comparing the colocalizations of topo I fusion protein and RNA pol IIo. Panels a' to j' are identical to panels a to j except that DAPI fluorescence micrographs are presented for identifying chromosome puffs.

Coimmunoprecipitation of RNA pol II with top1-lacZ fusion protein. Although we have demonstrated the colocalization of top1-lacZ fusion protein with RNA pol II by immunofluorescence microscopy, the coincidence of these two proteins at the level of immunofluorescence experiments may not necessarily imply that the N-terminal topo I fusion protein participates in a transcriptional complex. Therefore, we exploited an immunoprecipitation assay to determine whether the N-terminal topo I fusion protein is a part of a macromolecular transcriptional complex.

Embryo extracts from NF315 were processed for immunoprecipitation by using either rabbit anti--gal antibodies or a preimmune serum. The immunoprecipitated complex was washed and analyzed by Western blotting; the blots were probed with antibodies against the largest (IIa) and the second-largest (IIc) subunits of RNA pol II and -gal (left, middle, and right panels, respectively, of Fig.

View larger version (74K): [in this window] [in a new window]   FIG. 8.   Coimmunoprecipitation of RNA pol II with the top1-lacZ fusion product. Samples from immunoprecipitation with either rabbit preimmune serum (pre-immu) or rabbit anti--gal (IP) were separated on an SDS-7% PAGE gel. Western blots were probed with either affinity-purified goat anti-E2 (exon 2 of RNA pol IIa; left panel), anti-IIc (middle panel), or mouse anti--gal (right panel). The open arrowhead indicates RNA pol IIa, while the solid arrowhead designates IIc, the second-largest subunit of RNA pol II. The arrow indicates the top1-lacZ fusion product. Degradation products from the top1-lacZ protein were also detected in an anti--gal blot.

The function of the hydrophilic N termini in eukaryotic topo I presents an interesting question. The nonconserved N terminus accounts for nearly half of the molecule in Drosophila topo I. As indicated by earlier results with yeast and human topo I (5, 10, 50), topo I from the fruit fly does not require its N terminus for its catalytic activity. It is conceivable that the N terminus may play a regulatory role(s) for topo I activity in vivo. One of the phosphorylation sites in topo I has been mapped to a serine residue in the N terminus (12), and the phosphorylation of serine and threonine residues can stimulate supercoil relaxation and DNA cleavage activities (13, 28, 41, 54). It is also possible that the N terminus has additional roles that are important for the intracellular function of topo I.

Since topo I is a nuclear protein, its N terminus may function in nuclear import. In a heterologous yeast expression system, full-length human topo I can be imported into yeast nuclei, while removal of a 70-residue segment in the N terminus of human topo I results in its distribution in the cytoplasm (1). Using a chromogenic assay of -gal to detect the localization of top1-lacZ fusion constructs, we have shown that the N-terminal 315 residues are able to direct the chimeric protein into Drosophila nuclei. It has been documented that the efficiency of nuclear import is very sensitive to the context of the nuclear localization sequence that is linked to this bacterial enzyme (39). Therefore, the N-terminal 315 residues of Drosophila topo I must contain potent nuclear localization sequences which are competent in importing these large -gal fusion proteins into nuclei. While the nuclear localization signal (NLS) in the N terminus of topo I remains to be defined, sequence analysis revealed a possible candidate NLS from residues 135 to 150 (KRSSKDKERRDKDKDR). This putative NLS contains two clusters of basic amino acids spaced nine residues apart, in agreement with previously described bipartite NLSs (11, 22). We have made a construct that expresses, in yeast, a green fluorescent protein with these 16 amino acid residues placed at its C terminus and have found that it was not imported into yeast nuclei (data not shown). This result does not necessarily address the issue of whether this sequence can serve as an NLS in Drosophila cells. It is possible that other basic residues in this hydrophilic tail may serve such a function. Alternatively, the NLS may require adjacent residues in addition to the 16-mer sequence tested here.

We have also demonstrated that the N-terminal 315 residues can target top1-lacZ fusion proteins to transcriptionally active loci, where the functions of topo I are required. Mapping the topo I binding site by DNA cleavage reactions has shown that the distribution of topo I is enriched in the regions of chromatin with active transcription (38, 49, 61). Immunofluorescence experiments have also demonstrated that topo I is concentrated at the chromosome puffs in Drosophila salivary glands (15). Our data indicated that the N-terminal 315 residues were sufficient to direct a large bacterial protein to the puffs where the hyperphosphorylated form of RNA pol II was also present. While RNA pol IIo is always concentrated in the chromosome puffs, its distribution in the interbands is not uniform and does not coincide with the distribution of the hypophosphorylated form of RNA pol II (58). The interband distributions of both topo I and the top1-lacZ fusion protein (Fig. 5) also were not always coincident with that of RNA pol IIo. Earlier work also showed that the distribution of topo I holoenzyme in the chromatin interband is not completely coincident with that of RNA pol II (15). The biochemical bases for these different patterns of interband distribution are unclear. Our data did not address the localizations of RNA pol I, pol IIa, or pol III at the transcriptionally active loci. However, the fusion protein is also found in the nucleolus organizers in the polytene chromosome squashes (data not shown), regions where ribosomal DNA (rDNA) undergoes active transcription. It is noteworthy that many lines of evidence have linked topo I to rDNA transcription (15, 23, 38, 61). Therefore, the N-terminal topo I sequence may be capable of targeting to rDNA transcription loci.

As a reaction to an environmental stress like heat shock, chromatin undergoes rapid and dynamic remodeling to turn off most of the gene expression and to turn on the genes specifically associated with heat shock responses (reviewed in reference 31). The induction of heat shock loci, which results in the synthesis of heat shock proteins and RNA, is accomplished by the recruitment of RNA pol II, transcription factors, and other chromosomal proteins including topo I to heat shock puffs (15, 19, 24, 46, 53, 58). Our immunofluorescence data demonstrated that the topo I N-terminal sequence enables rapid mobilization of topo I to the heat shock puffs. This dynamic mobilization of top1-lacZ fusion proteins was also observed when heat shock puffs regressed during a prolonged heat treatment and when the developmental puffs were reestablished after the cessation of heat shock. Therefore, the ability of topo I to respond to cellular processes, especially during the reprogramming of gene expression, may reside completely in the N-terminal 315 residues.

The biochemical basis for the recruitment of topo I to transcriptionally active loci is not yet established. There are a number of possible mechanisms underlying the association of topo I with a transcriptional complex. First, the binding might be mediated through RNA transcripts. In this case, one would expect a lag between the localization of the topo I fusion protein and RNA pol II. However, the topo I fusion protein appears to colocalize with RNA pol II in the newly established heat shock loci even at the earliest detectable point of the heat treatment (Fig. 7d). While the developmental puffs have not yet regressed, both topo I fusion protein and RNA pol II have already begun to depart from these puffs (compare Fig. 7c' and c). These experiments suggest that there is no significant lapse in time between the movements of the topo I fusion protein and RNA pol II from the chromosome puffs. Furthermore, by using a procedure of RNase treatment that can remove nuclear ribonucleoprotein complexes from polytene chromosome squashes (2), it was found that immunostaining signals of both topo I fusion protein and RNA pol II were not diminished in comparison with those from the control experiment without RNase treatment (data not shown).

A second possible mechanism for topo I targeting to the transcriptional complex is that topo I may recognize special DNA structures associated with a chromatin region undergoing active transcription. Such structures could be, for example, the positive and negative supercoils present in the front and in the wake, respectively, of a transcription fork (33). Eukaryotic topo I is known to be able to recognize and bind to both positively and negatively supercoiled DNA (7, 34, 38, 60). However, this explanation can be ruled out, since preferential binding of topo I to supercoiled DNA is mediated through the conserved catalytic core domains (34) and the N-terminal 315 residues lack the conserved core domains.

The localization of topo I to the transcriptionally active loci could be mediated through protein-protein interactions between the N terminus of topo I and the transcriptional complexes. The hydrophilic patches in the topo I N terminus may provide a surface for such protein-protein interactions. Recent biochemical data demonstrated an interaction of the human topo I N terminus with either an abundant nucleolar protein, nucleolin, or Simian virus 40 T antigen (4, 21). By immunoprecipitation assays, we have demonstrated that the two largest subunits of RNA pol II coprecipitated with the top1-lacZ fusion protein. This result does not address the question of whether topo I is directly associated with RNA pol II. However, topo I has been shown to collaborate with transcription factor TFIID and to function as a coactivator of specific activation and as a repressor in in vitro transcription reactions (29, 36). This coactivation by topo I is due to the participation of topo I in the formation of an active TFIID-TFIIA initiation complex (45). Interestingly, a topo I mutant with the active-site tyrosine replaced with phenylalanine still functions as a coactivator, suggesting that coactivation does not require the catalytic activity of topo I (36, 45). Together, these data suggest that the colocalization of topo I with RNA pol II at chromosome puffs could be mediated through the protein-protein interaction within the transcriptional initiation complex and that this interaction surface may only involve the N-terminal 315 residues. Although we have not yet identified the minimal interaction sequence, further investigation of the physical contact between the N terminus of topo I and the transcriptional complex will provide insight into the molecular mechanism of the role of topo I in gene expression.

In summary, we have generated a series of Drosophila transgenes of the N-terminal topo I sequences linked to -gal and have used them to demonstrate that the N-terminal 315 residues of topo I can target the fusion proteins to transcriptionally active loci on chromosomes. These topo I fusion transgenes may provide useful biochemical and genetic tools to further probe the biological functions of topo I.