MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, H.-J.
Right arrow Articles by RajBhandary, U. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, H.-J.
Right arrow Articles by RajBhandary, U. L.

Mol Cell Biol, August 1998, p. 4418-4425, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Tetracycline-Regulated Suppression of Amber Codons in Mammalian Cells

Ho-Jin Park and Uttam L. RajBhandary*

Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

Received 13 March 1998/Returned for modification 30 April 1998/Accepted 11 May 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

As an approach to inducible suppression of nonsense mutations in mammalian cells, we described recently an amber suppression system in mammalian cells dependent on coexpression of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) along with the E. coli glutamine-inserting amber suppressor tRNA. Here, we report on tetracycline-regulated expression of the E. coli GlnRS gene and, thereby, tetracycline-regulated suppression of amber codons in mammalian HeLa and COS-1 cells. The E. coli GlnRS coding sequence attached to a minimal mammalian cell promoter was placed downstream of seven tandem tetracycline operator sequences. Cotransfection of HeLa cell lines expressing a tetracycline transactivator protein, carrying a tetracycline repressor domain linked to part of a herpesvirus VP16 activation domain, with the E. coli GlnRS gene and the E. coli glutamine-inserting amber suppressor tRNA gene resulted in suppression of the amber codon in a reporter chloramphenicol acetyltransferase gene. The tetracycline transactivator-mediated expression of E. coli GlnRS was essentially completely blocked in HeLa or COS-1 cells grown in the presence of tetracycline. Concomitantly, both aminoacylation of the suppressor tRNA and suppression of the amber codon were reduced significantly in the presence of tetracycline.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

As in the case of Escherichia coli, the availability of mammalian cell lines carrying nonsense suppressor tRNA genes will greatly facilitate the genetic analysis of animal cells and animal viruses. The suppressor tRNAs are also likely to be useful for a variety of other purposes. For example, suppressor tRNAs have been used for diphtheria toxin-mediated ablation of photoreceptor cells in studies of cell-cell interactions during the neuronal development of the optic system in Drosophila melanogaster (27). Toxin-mediated cell ablation dependent on suppressor tRNA has also been suggested as a possibility for cancer therapy (32). In addition, the finding that nonsense mutations in genes are often responsible for a variety of human genetic diseases has led to suggestions of the use of suppressor tRNAs as a tool in gene therapy (2, 40). Interestingly, the direct injection of plasmid DNA carrying an ochre suppressor tRNA gene partially suppresses the effect of an ochre nonsense mutation in the dystrophin gene in mice (23, 30).

Classical genetic selections have not yielded any mammalian cell lines carrying nonsense suppressor tRNA genes. Suppressor tRNAs have, however, been generated by in vitro mutagenesis of tRNA genes and shown to be functional in mammalian cells and in Drosophila (4, 5, 28, 29). Cell lines carrying suppressor tRNA genes have been made; however, constitutive expression of suppressor tRNA genes is detrimental to mammalian cells and to Drosophila (11, 22, 29).

To overcome the problem of toxicity of constitutive expression of suppressor tRNAs in mammalian cells, we are investigating approaches for the generation of inducible suppressors in mammalian cells. Previously, we reported on the generation of BSC-40 monkey kidney cell lines carrying an inducible human serine amber suppressor tRNA gene (34). The induction relied on temperature-dependent amplification of the suppressor tRNA gene, linked to a simian virus 40 (SV40) origin of DNA replication (ori), in a cell line carrying a temperature-sensitive SV40 T antigen. This cell line was useful for the propagation of poliovirus and adeno-associated virus carrying amber mutations in specific genes (6, 34). However, the general use of this approach to other cell types has been limited due to the need for a temperature-sensitive T-antigen background. Other attempts to regulate suppressor tRNA gene expression have used the E. coli lac repressor to block the expression of a suppressor tRNA gene linked on the 5' side to a lac operator sequence (39, 41). Similarly, the tetracycline repressor-operator system has been used to regulate the expression of a Dictyostelium discoideum amber suppressor tRNA gene in D. discoideum and in the yeast Saccharomyces cerevisiae (9, 10).

The above approaches for isolation of mammalian cell lines carrying inducible suppressor tRNA genes rely on regulation of expression of the suppressor tRNA gene which, in eukaryotes, is transcribed by RNA polymerase III. We are working on an alternate approach, which relies on regulation of function of the suppressor tRNA rather than its expression (13). We have shown recently that an E. coli glutamine-inserting amber suppressor tRNA gene is expressed in COS-1 and CV-1 cells but that the tRNA is inactive as a suppressor because it is not aminoacylated by the aminoacyl-tRNA synthetases in these cells to a detectable extent. Coexpression of the E. coli glutaminyl-tRNA synthetase (GlnRS) gene results in aminoacylation of the suppressor tRNA and its functioning as an amber suppressor. This result opened up the possibility of regulated suppression of amber mutations in mammalian cells by regulating expression of E. coli GlnRS. In this paper, we report on tetracycline-dependent regulation of the E. coli GlnRS gene by using a system developed by Gossen and Bujard for the regulation of RNA polymerase II transcribed genes in mammalian and in higher eukaryotic cells (17). We show (i) that the expression of GlnRS in HeLa and in COS-1 cells can be regulated by tetracycline and (ii) that the tetracycline regulation of GlnRS can be further used to regulate the aminoacylation of the suppressor tRNA and, thereby, its function as an amber suppressor.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Plasmids. pSVBpUC-sup2, carrying the E. coli glutamine-inserting suppressor tRNA gene, is the same plasmid as pSVBpUC-hsup2A9Delta CCA described previously (13). pSVGT3-Seram, carrying a human serine amber suppressor tRNA gene, and pRSVCATam27, carrying an amber mutation at codon 27 of the chloramphenicol acetyltransferase (CAT) gene, have been described previously (4). pRSVCATam27 does not contain the ori region of SV40, and the CATam27 gene is transcribed by using the Rous sarcoma virus long terminal repeat enhancer/promoter. pc3PUR-CATam27 carries the CATam27 gene transcribed by using the human cytomegalovirus (CMV) enhancer/promoter (3). It is derived from pcDNA3-CATam27 in which the neomycin resistance gene has been replaced by the puromycin resistance gene. pc3PUR-CATam27 contains the ori region of SV40 and was constructed as follows. First, the HindIII-BanI fragment of pRSVCATam27 containing the CATam27 coding region was blunt ended at the BanI site and cloned into the HindIII-EcoRV site of pcDNA3 (Invitrogen) to yield pcDNA3-CATam27. Second, the neomycin phosphotransferase gene in pcDNA3-CATam27 was replaced by a puromycin acetyltransferase gene to produce pc3PUR-CATam27, by cloning the AvrII-Bsp120I fragment of pPUR (Clontech) into the AvrII-Bst1107 site of pcDNA3-CATam27. Although pc3PUR-CATam27 and pcDNA3-CATam27 differ only in the region coding for antibiotic resistance, pc3PUR-CATam27 was used instead of pcDNA3-CATam27 as the reporter for in vivo suppression assays since pc3PUR-CATam27 showed much higher suppression activity than pcDNA3-CATam27 (unpublished data).

Vectors for the tetracycline-controlled system are pUHD10-3 and pUHD15-1, kindly provided by H. Bujard (17). pUHD10-3 carries a minimal promoter derived from the human CMV immediate-early promoter fused downstream of seven tandem tetracycline operator (tetO) sequences. pUHD15-1 carries a hybrid tetracycline-controlled transactivator (tTA) gene made by combining the gene coding for the tetracycline repressor with the gene coding for the C-terminal 127 amino acids of VP16 from herpes simplex virus, known to be essential for the transcription of the immediate-early viral genes. pUtetO-CATwt carrying the CAT gene downstream of the tetO was constructed by inserting the smaller fragment of the blunt-ended HindIII-BanI digest of pRSVCATwt (4) into the blunt-ended EcoRI digest of pUHD10-3. The orientation of the gene with respect to the tetO region was determined by restriction analysis. A nuclear localization signal sequence (PKRPRP) of adenovirus E1A (15) was fused to the N-terminal region of the tTA protein by PCR to yield pU-CMV-tTAnls. pUHD15-1 DNA was used as a template, and sequences of primers were GCGAATTCACCATGGATCCTAAGAGACCTAGGCCTTCTAGATTAGATAAAAGTA (5' primer) and GGGGCCGTCGACAGTC (3' primer). The 5' primer was complementary to the 5' end of the coding region of the tTA gene and contained a sequence coding for the nuclear localization signal and Kozak's consensus initiation codon context, ACCATGG (26). The 3' primer was complementary to the region containing the SalI site of the gene. An EcoRI-SalI fragment of the PCR product was used to replace the EcoRI-SalI region of pUHD15-1 coding for tTA, resulting in pU-CMV-tTAnls.

For purposes of immunodetection, the C terminus of E. coli GlnRS was tagged with six histidine residues by using PCR. The template DNA used was pCDGlnRS (13). The primers used for PCR (5' primer, AGGGATCCACGATAAGTG; 3' primer, ACTGGATCCCTTTCGCCCAGTATC) were complementary to the ends of the coding region of the E. coli GlnRS gene. The PCR product was digested with BamHI, and the fragment was ligated to the larger fragment of the BamHI-BglII digest of pQE16 (Qiagen), to yield pQE16-GlnRS. A smaller fragment of the EcoRI-NheI digest of pQE16-GlnRS was ligated with a larger fragment of the EcoRI-XbaI digest of either pUHD10-3 (17) or pcDNA3, to yield pUtetO-16GlnRS or pc-16GlnRS, respectively. The transcription of the histidine-tagged E. coli GlnRS gene is controlled by tTA in pUtetO-16GlnRS and is constitutive from the CMV enhancer/promoter in pc-16GlnRS. pCMV-beta gal, containing an E. coli beta -galactosidase gene transcribed by using the CMV promoter (Clontech), was used as a control vector.

Transfection of cells. HeLa-tetOff cells (Clontech), which express constitutively tTA, were maintained at 37°C with 5% CO2 in Dulbecco's modified Eagle's medium (DMEM) containing 10% calf serum, 100 U of penicillin G sodium, 100 µg of streptomycin sulfate per ml, and 200 µg of G418 (GIBCO BRL) per ml. COS-1 cells were maintained under the same conditions as HeLa-tetOff cells except that no G418 was included in the medium.

Electroporation for transfection of HeLa-tetOff cells was performed by using Electroporator II and 0.4-cm-width cuvettes from Invitrogen. Ten micrograms of plasmid DNA was used for 0.4 ml of cells (4 × 106 cells/ml) in each electroporation.

LipofectAMINE (GIBCO BRL) or SuperFect (Qiagen) was used for liposome-mediated transfection of HeLa-tetOff cells according to the manufacturer's protocols, with slight modifications. A total of 2 µg of plasmid DNA was used for transfection of cells, at about 80% confluence, in each well of a six-well plate. Cells were treated with liposome-DNA complex in medium containing 10% Nu-serum and 0.2 µg of tetracycline per ml for 3 h. Cells were harvested 24 to 30 h after transfection.

The DEAE-dextran-chloroquine-dimethyl sulfoxide (DMSO) method was used for HeLa and COS-1 transfection according to the protocol of Kluxen and Lubbert (25), with some modifications. Briefly, cells at about 80% confluence in six-well plates were washed twice with DMEM. One milliliter of DMEM containing 10% Nu-serum (Becton Dickinson Labware, Bedford, Mass.), 0.4 mg of DEAE dextran per ml, 100 µM chloroquine (Sigma), 0.2 µg of tetracycline per ml, and plasmid DNA was added as indicated in the figure legends, and the cells were incubated in 5% CO2 at 37°C for 4 h. Afterwards, the cells were washed once with DMEM and then incubated in 10% DMSO in Ca2+- and Mg2+-free phosphate-buffered saline for 2 min at room temperature. The cells were washed twice with DMEM and incubated in 3 ml of complete medium for 40 to 50 h. When 60-mm-diameter dishes were used for transfection, the procedure described above was scaled up.

Assays for CAT in cell extracts. The CAT assay was modified from the protocols of Shaw (33) and Gorman et al. (16) as follows. The cell pellet was resuspended in 50 to 100 µl of 0.25 M Tris-HCl (pH 7.8). Cells were lysed by rapid freezing and thawing three times. Cell extracts containing various amounts of protein in 30 µl of 0.25 M Tris-HCl (pH 7.8) were heat treated at 65°C for 15 min to prevent enzymatic breakdown of the acetyl coenzyme A (acetyl-CoA) substrate (33). To the supernatant, 14 µl of double-distilled H2O, 4 µl of 8 mM acetyl-CoA, and 2 µl of [14C]chloramphenicol (0.8 mmol/ml, 50 mCi/ml) were added (final concentration; 33 µM [14C]chloramphenicol, 0.64 mM acetyl-CoA, 0.15 M Tris-HCl [pH 7.8]). The reaction mixture was incubated at 37°C for 1 h, and acetyl-chloramphenicol was separated from chloramphenicol by thin-layer chromatography following extraction into ethyl acetate. One unit of the CAT activity is defined as nanomoles of chloramphenicol acetylated by 10 µg of protein per hour by using the CAT values where the enzyme activities were within a linear range.

Northern analysis for determination of aminoacylation of tRNA in vivo. Total RNA was isolated under acidic conditions (7) using TRI Reagent (Molecular Research Center, Inc., Cincinnati, Ohio). The separation of suppressor tRNA from the corresponding aminoacyl-tRNA was achieved by acid-urea gel electrophoresis on 6.5% polyacrylamide gels (19, 42). The suppressor tRNA was detected by Northern hybridization using a 5'-32P-labeled (38) oligonucleotide probe (GCCGGAATTAGAATCCGG) complementary to nucleotides 27 to 44 of the sup2 tRNA.

Immunoblot analysis. Cell extracts were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the protein bands were blotted onto a polyvinylidene difluoride membrane (Amersham). The histidine-tagged E. coli GlnRS was detected by using a monoclonal antibody against the polyhistidine epitope (Qiagen).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Strategy for tetracycline regulation of genes in mammalian cells. The strategy for tetracycline regulation of genes in mammalian cells (17) involves (i) a target gene, which is linked to a promoter with minimal activity, and (ii) a tTA consisting of a tetracycline repressor fused to the C-terminal 127 amino acids of the herpesvirus VP16 activation domain (Fig. 1A). The tTA protein binds to the tetO DNA elements in the target gene, placed approximately 50 nucleotides upstream of the transcriptional start site, through the tetracycline repressor domain and activates transcription of the otherwise silent gene (in this case the E. coli GlnRS gene) through the VP16 activation domain. Using cells stably transfected with the tTA gene and a luciferase target gene, Gossen and Bujard (17) have demonstrated a 104- to 105-fold regulation of expression of luciferase by tetracycline.


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1.   Strategy for tetracycline-regulated suppression of the amber codon in mammalian cells. (A) Tetracycline-regulated expression of E. coli GlnRS in mammalian cells. The GlnRS gene is attached to a minimal human CMV promoter (Pmin) and seven tandem E. coli tetO DNA sequences. tTA is a hybrid protein which consists of the E. coli tetracycline repressor (tetR) sequences and the herpes simplex virus VP16 transcription activation domain (17). The tTA protein binds to the tetO sequences in the GlnRS gene and activates transcription of the otherwise silent gene through the VP16 activation domain in the absence of tetracycline but not in its presence. (B) GlnRS-dependent suppression of the amber codon in the CATam27 reporter gene. Mammalian cells transfected with the E. coli glutamine amber suppressor tRNA gene express the tRNA. However, the tRNA is not aminoacylated to any detectable extent and is therefore inactive as an amber suppressor (13). Expression of E. coli GlnRS results in aminoacylation of the suppressor tRNA and, thereby, suppression of the amber codon in the CATam27 reporter gene to yield a functional CAT protein. Tetracycline-dependent regulation of GlnRS synthesis, therefore, leads to tetracycline-dependent regulation of suppression.

Tetracycline-regulated expression of E. coli glutaminyl-tRNA synthetase in a HeLa-tetOff cell line expressing tTA. As a first step toward studying the feasibility of regulation of E. coli GlnRS in mammalian cells, we adopted a similar strategy using a HeLa-tetOff cell line constitutively expressing tTA, except that the E. coli GlnRS gene was introduced by transient transfection instead of stable transfection. To monitor the expression of the E. coli GlnRS, the enzyme was tagged with six histidines at the carboxyl terminus. A monoclonal antibody against this epitope was used for immunoblot analysis to visualize expression of the E. coli GlnRS. The GlnRS gene was subcloned into pUHD10-3, which carries seven tetO sequences, to yield pUtetO-16GlnRS. For constitutive expression, the GlnRS gene was subcloned into pcDNA3, which contains a CMV promoter, to yield pc-16GlnRS.

The HeLa-tetOff cell line was transiently transfected with either pUtetO-16GlnRS or pc-16GlnRS. Figure 2 shows an immunoblot analysis of extracts made from cells transfected in the absence or in the presence of tetracycline. The results show tetracycline-dependent regulation of E. coli GlnRS synthesis. There is a strong band corresponding to GlnRS in cells grown in the absence of tetracycline (Fig. 2A, lanes 1, 3, and 5), whereas this band is absent or much weaker in cells grown in the presence of tetracycline (lanes 2, 4, and 6). The tetracycline regulation is seen in cells transfected by all three methods, electroporation (lanes 1 and 2), the DEAE-dextran method (lanes 3 and 4), and liposome-mediated transfection (lanes 5 and 6). The tetracycline regulation is also specific in that it is seen in cells transfected with pUtetO-16GlnRS (Fig. 2A) but not in cells transfected with pc-16GlnRS (Fig. 2B).


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2.   Immunoblot analysis for expression of the E. coli glutaminyl-tRNA synthetase in HeLa-tetOff cells. Histidine-tagged E. coli GlnRS was expressed by using two different vectors, pUtetO-16GlnRS carrying tetO (A) or pc-16GlnRS carrying a CMV promoter (B), and three different transfection methods: electroporation (lanes 1 and 2), the DEAE-dextran-chloroquine-DMSO method (lanes 3 and 4), and the liposome-mediated method using LipofectAMINE (GIBCO BRL) (lanes 5 and 6). Where indicated, cells were incubated in medium containing tetracycline (1 µg/ml). Ten-microgram aliquots of crude cell extracts were separated by electrophoresis on sodium dodecyl sulfate-12% polyacrylamide gels and analyzed by immunoblotting using an antibody to the histidine tag (Clontech). The blot was visualized by the enhanced chemiluminescence method (Amersham).

Tetracycline-regulated amber suppression in a HeLa-tetOff cell line. The function of the E. coli glutamine-inserting suppressor tRNA (sup2) as an amber suppressor in mammalian cells was previously shown to be dependent on the coexpression of the E. coli GlnRS (13). Having demonstrated the tetracycline-regulated expression of E. coli GlnRS, we examined whether amber suppression by the E. coli glutamine suppressor tRNA could be regulated by regulating the expression of the E. coli GlnRS (Fig. 1B). HeLa-tetOff cells were cotransfected with pSVBpUC-sup2 carrying the E. coli suppressor tRNA, pUtetO-16GlnRS, and pc3PUR-CATam27 carrying an amber mutation in the CAT gene as a reporter (4). The amount of pUtetO-16GlnRS DNA used for transfection was varied in different experiments. All transfections were carried out in duplicate. CAT assays were performed with cell extracts to measure the levels of suppression of the amber codon in the CATam27mRNA. The results, shown in Fig. 3 and quantitated in Table 1, provide clear evidence for tetracycline regulation of amber suppression in the HeLa cell line. As described previously (13), suppression of the amber codon in the CATam27mRNA, measured by CAT activity in extracts, was detected only in cells transfected with both the E. coli suppressor tRNA and the E. coli GlnRS genes (Fig. 3; compare lanes 1 to 16 with lanes 17 to 20). In cells cotransfected with pUtetO-16GlnRS (lanes 1 to 12), the suppression of the amber mutation was much reduced when tetracycline was added to the medium (compare lanes 3 and 4 to 1 and 2, 7 and 8 to 5 and 6, 11 and 12 to 9 and 10). The regulation of suppression by tetracycline was 15- to 78-fold, depending on the amount of pUtetO-16GlnRS vector used for transfection (Table 1). When the amount of pUtetO-16GlnRS vector used for transfection was reduced, tetracycline regulation of suppression was higher (78-fold), whereas when the amount of pUtetO-16GlnRS vector used for transfection was increased, the extent of suppression was higher but the fold regulation by tetracycline was lower. This is due to increases in the background CAT activity with increases in the amount of the GlnRS vector used for transfection. The effect of tetracycline on amber suppression is specific to cells expressing GlnRS from the pUtetO-16GlnRS vector, since tetracycline did not affect significantly the suppression in cells expressing the E. coli GlnRS constitutively (Fig. 3, lanes 13 to 16; Table 1) or when a human serine-inserting amber suppressor tRNA was used in the transfection (Table 1). The CAT values are, if anything, even slightly higher in these cases in the presence of tetracycline than in its absence. Higher suppression levels in the presence of the human serine amber suppressor tRNA gene than in the presence of the E. coli glutamine suppressor tRNA gene have been described before (13).


View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3.   In vivo assay for amber suppression in HeLa-tetOff cells, using a tetracycline-regulated E. coli GlnRS gene. HeLa-tetOff cells in six-well plates were cotransfected in duplicate with three vectors, 1 µg of pc3PUR-CATam27, 1 µg of pSVBpUC-sup2, and various amounts of pUtetO-16GlnRS (lanes 1 to 12), pc-16GlnRS (lanes 13 to 16), or pCMV-beta gal (lanes 17 to 20) as indicated. Liposome-mediated transfection was used. Where indicated, cells were incubated in the presence of 1 µg of tetracycline (Tc) per ml for the course of the transfection (24 to 30 h). The CAT activities from individual transfections using 7.5 µg of crude protein extracts are shown.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Tetracycline-regulated suppression of the CATam27 in the HeLa-tetOff cell linea

A difference in efficiency of tetracycline regulation depending on the amounts of the vector carrying a tetO-controlled target gene used in transfection was also observed when the wild-type CAT gene was expressed in the same cell line by using pUtetO-CATwt (Table 2). When a smaller amount of pUtetO-CATwt was used for transfection, the regulation by tetracycline was more than 1,018-fold; when a greater amount of pUtetO-CATwt was used, the fold regulation was down to 327. 

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Tetracycline-regulated expression of the wild-type CAT gene in the HeLa-tetOff cell line

Tetracycline regulation of aminoacylation of the E. coli suppressor tRNA by the E. coli glutaminyl-tRNA synthetase. To establish that the regulation of function of the E. coli suppressor tRNA by tetracycline is responsible for the observed regulated suppression of the amber codon in the CATam27 mRNA, the effect of tetracycline on the in vivo aminoacylation level of the suppressor tRNA was monitored. Figure 4 shows a Northern blot analysis of total RNA isolated from transfected cells after separation of aminoacyl-tRNA from tRNA by acid-urea gel electrophoresis. In cells transfected with pUtetO-16GlnRS, aminoacylation of the suppressor tRNA was significantly reduced when tetracycline was present in media (Fig. 4; compare lanes 3 and 4). As expected, this effect of tetracycline depends on the vector used for expression of the E. coli GlnRS. In cells transfected with plasmid pc-16GlnRS which are constitutively expressing the E. coli GlnRS gene, there is no effect of tetracycline (compare lanes 1 and 2). As described before, aminoacylation of the E. coli suppressor tRNA requires cotransfection of cells with an E. coli GlnRS-carrying vector. There is no aminoacylation of the tRNA when cells are cotransfected with pCMV-beta gal (lane 5). These results show that the tetracycline-regulated suppression of the amber codon in the CATam27 mRNA is due to its regulation of synthesis of the E. coli GlnRS, which is needed for aminoacylation of the E. coli suppressor tRNA.


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 4.   Regulation of in vivo aminoacylation of the sup2 tRNA by tetracycline. HeLa-tetOff cells were cotransfected with pSVBpUC-sup2 carrying the E. coli suppressor tRNA gene and pc-16GlnRS (lanes 1 and 2), pUtetO-16GlnRS (lanes 3 and 4), or pCMV-beta gal (lane 5). Liposome-mediated transfection was used. Where indicated, cells were incubated in medium containing tetracycline (Tc) during the course of transfection (24 to 30 h); 0.2 A260 unit of total RNA isolated from transfected cells under acidic conditions (pH 4.5) was separated by acid-urea gel electrophoresis and analyzed by Northern hybridization using a 32P-labeled oligonucleotide complementary to nucleotides 27 to 44 of the E. coli glutamine suppressor tRNA. The sample in lane 6 was the same as that in lane 1 except that it was treated with 0.2 M Tris-HCl (pH 9.5) at 37°C for 30 min.

Tetracycline-regulated suppression can be achieved in other cell types by use of tTA carrying a nuclear localization signal. We examined whether the tetracycline-regulated suppression system could also be demonstrated in other cell lines such as COS-1. Unlike HeLa-tetOff cells, COS-1 cells do not contain the tTA; therefore, the gene for the tTA was introduced by transient transfection along with the other genes. While this system seemed to function for tetracycline-regulated suppression in this cell line, the levels of suppression, as measured by CAT activity in extracts, were very low, making it difficult to measure the fold regulation of suppression by tetracycline (data not shown). To increase the transactivator-dependent suppression activity, a nuclear localization signal sequence (PKRPRP) was added close to the amino terminus of the tTA protein. It was hoped that this would lead to a higher concentration of the tTA in the nucleus and thereby to increased transcription of the GlnRS gene. Table 3 shows that the insertion of the nuclear localization signal sequence in the transactivator (tTAnls) improved the transactivation activity by a factor of more than 12 compared to that of the prototype transactivator (tTA) when a wild-type CAT gene was expressed under control of tetO (pUtetO-CATwt). This modified transactivator (pU-CMV-tTAnls) was used for the tetracycline-regulated suppression of amber codons in COS-1 cells.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Comparison of the modified (tTAnls) and unmodified (tTA) transactivator for activation of CAT expression in COS-1 cellsa

COS-1 cells were cotransfected with four different plasmids, each carrying the gene for either the suppressor tRNA, the GlnRS, the tTAnls, or the CATam27 reporter gene. The results of CAT assays (Table 4) show clearly that amber suppression is regulated by tetracycline in COS-1 cells. Also, the tetracycline regulation is specific to cells which are expressing GlnRS from the pUtetO-16GlnRS vector and not from the pc-16GlnRS vector. However, the high background of CAT activity (7 ± 0.5, compared to <1 in mock-transfected cells) in cells not carrying the suppressor tRNA gene or the GlnRS gene suggests that the amber mutation in CATam27 is leaky in COS-1 cells. This leakiness reduces the fold regulation by tetracycline from 15 to 78 in HeLa cells to 5 to 17 in COS-1 cells. The pc3 DNA vector contains the ori region of SV40 and is known to be replicated in COS-1 cells. Therefore, the leakiness of the amber mutation is most likely due to the high copy number of the vector carrying CATam27 (pc3PUR-CATam27) in COS-1 cells, resulting in very high levels of the CATam27 mRNA. The leakiness of expression of the CATam27 gene was much reduced when the nonreplicating vector pRSVCATam27, which does not contain the SV40 ori region (7), was used instead of pc3PUR-CATam27 in transfection of COS-1 cells (Table 5). The CAT activity of <1 in extracts of cells transfected with the suppressor tRNA gene but without the E. coli GlnRS gene is essentially the same as the background CAT activity in mock-transfected cells.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Tetracycline-regulated suppression of the CATam27 in COS-1 cellsa

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Quantitative regulation of in vivo suppression in COS-1 cells by tetracycline

The results in Table 5 also show that amber suppression in COS-1 cells by using pRSVCATam27 as the reporter is regulated by tetracycline in a dose-dependent manner. Maximal regulation is achieved at a tetracycline concentration of 1 µg/ml in the medium, increasing the tetracycline concentration to 5 µg/ml does not have any further effect. Immunoblot analysis of the cell extracts from the same transfection showed that the expression of the E. coli GlnRS was also regulated in a similar manner (Fig. 5, lanes 3 to 6). Assay of the in vivo aminoacylation level of transfected cells showed also that the aminoacylation level decreased when the concentration of tetracycline in media was increased (data not shown).


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 5.   Regulated expression of the E. coli GlnRS in COS-1 cells by tetracycline. COS-1 cells were cotransfected by the DEAE-dextran method with four vectors as described in Table 5 and incubated in media containing various amounts of tetracycline (Tc). Ten-microgram aliquots of crude cell extracts from each transfection were used for immunoblot analysis. A monoclonal antibody to the histidine tag was used to detect the E. coli GlnRS. The blots were visualized by the enhanced chemiluminescence method.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

As a first step in generating mammalian cell lines carrying inducible suppressors of nonsense codons, we have shown that amber suppression in HeLa and COS-1 cells can be regulated by tetracycline. The suppressor tRNA used for this purpose was the E. coli glutamine-inserting amber suppressor tRNA. Because this tRNA is not aminoacylated by the mammalian aminoacyl-tRNA synthetases, amber suppression is dependent on coexpression of the E. coli GlnRS. Tetracycline regulation of amber suppression was achieved by regulating the expression of E. coli GlnRS, using a system developed by Gossen and Bujard (17). We have shown that tetracycline regulation of GlnRS results in regulation of aminoacylation of the suppressor tRNA and thereby regulation of amber suppression. The tetracycline regulation is specific to cells expressing GlnRS from the tetracycline promoter; there is no such regulation in cells expressing GlnRS from the constitutive CMV promoter. The tetracycline regulation is also dependent on the levels of tetracycline in the medium.

The tetracycline regulation of amber suppression is 15- to 78-fold in the HeLa cells and 5- to 17-fold in COS-1 cells. This level of regulation is similar to that seen in other transient-transfection systems (1, 21, 43, 45) or in D. discoideum (10), where tetracycline is used to regulate expression of the suppressor tRNA rather than its function. The 15- to 78-fold regulation of amber suppression by tetracycline in HeLa cells is, however, substantially less than that in a stable HeLa cell line expressing the same tTA constitutively (17) or in animals using different transactivation systems induced by mifepristone (RU486) or ecdysone (31, 43, 44). This is at least partly due to the fact that we are using transient transfection of cells, whereas the other cases involve cell lines or animals in which the gene for the transactivator protein and the target gene for regulation are both stably integrated into the chromosomal DNA. Induction levels in transiently transfected cells are known to be substantially lower than in stable cell lines or in animals. For example, transient transfection of Vero cell lines expressing tTA resulted in only 64- to 94-fold regulation by tetracycline (1). Also, with the RU486-regulated system, transient transfection of HepG2 cells yielded 34- to 47-fold regulation by RU486, whereas in animals it was >33,000-fold (43, 44). Our results with the tetracycline regulation of amber suppression are, therefore, considered encouraging enough to proceed with isolation of cell lines in which both tTA and the GlnRS genes are stably integrated.

Another reason for the reduced fold regulation of amber suppression by tetracycline in the HeLa-tetOff cell line could be due to the background activity of the GlnRS minimal promoter, giving rise to a basal level of GlnRS expression not involving tTA. This is also indicated by the fact that the fold regulation of expression of the wild-type CAT gene, which has a different sequence in the region following the tetO sequences, is substantially higher (>1,028 [Table 2]) than that of amber suppression dependent on GlnRS function. Alternatively, it is possible that the effect of the basal levels of GlnRS that are produced from the minimal promoter is amplified because each GlnRS molecule can participate in aminoacylation of many suppressor tRNA molecules.

The background activity of the GlnRS minimal promoter is clearly seen in COS-1 cells, where a band corresponding to GlnRS is visible in immunoblots of cell extracts in the absence of any tTA (Fig. 5, lane 2). Interestingly, the tetracycline regulation of amber suppression in COS-1 cells is lower (5- to 17-fold) than that in HeLa cells (15- to 78-fold). This result is analogous to the finding that a tTA-regulated minimal promoter gave high basal levels of transcription of the target gene in Vero, BHK, and HEK293 cell lines but not in HeLa or GH3 (clonal cells derived from rat pituitary cells) cell lines (1, 21, 45). However, in contrast to our results, indicating 5- to 17-fold regulation of amber suppression by tetracycline in COS-1 cells, in BHK cells the background activity of the promoter was so high that there was essentially no tetracycline regulation of the target gene (1).

The tetracycline regulation of amber suppression in mammalian cells opens up the possibility of further improvements in this system or use of other, more recently developed systems such that amber suppression in mammalian cells and eventually in animals may be achieved in an inducible, tissue-specific or developmentally regulated manner (24, 37). These improvements include an autoregulatory system for synthesis of tTA (12, 20, 35) and a mutant tTA (rtTA), which depends on tetracycline activation rather than repression for binding of the transactivator to the tetO DNA (8, 18, 24). Suppression in the latter case will be induced by addition of tetracycline rather than by removal of tetracycline. Also, derivatives of tetracycline which yield even greater induction levels with rtTA or which bind so tightly to the repressor that regulation requires a 100-fold-lower concentration of the tetracycline derivative have been identified (8, 24). Thus, it might be possible to obtain even higher fold regulation of amber suppression by tetracycline with the incorporation of these features. Other possibilities include a more recently developed transactivator protein, which contains the yeast GAL4 DNA binding domain and is activated by RU486 (43, 44), and an ecdysone-inducible transactivation system (31). The RU486-inducible system has been shown to be very effective in regulated expression of genes in transgenic mice, in which the transactivator is expressed only in the liver by linking it to the liver-specific transerythrin promoter.

Finally, in addition to the generation of cell lines useful for the identification and propagation of nonsense mutations in animal cells and viruses, the regulated amber suppression described here could prove useful for a variety of other purposes, e.g., in the regulation of genes for extremely toxic proteins such as the diphtheria toxin. Although several tissue-specific and developmentally regulated promoters have been described for higher eukaryotic cells, Kunes and Steller (27) observed that Drosophila transformants carrying the gene for diphtheria toxin linked to a photoreceptor cell-specific promoter were not viable even though the visual system in Drosophila is not essential for viability. This finding suggests that the photoreceptor cell-specific promoter could be leaky in some other cells, thereby leading to expression of the diphtheria toxin in cells or tissues essential for viability. The combination of a diphtheria toxin gene carrying an amber mutation along with a Drosophila amber suppressor tRNA gene was necessary to obtain viable transformants that could be used to study the effect of ablation of photoreceptor cells on the neuronal development of the visual system. A system that allowed amber suppression to be switched on and off in a time-dependent manner would be an important addition in studies of cell ablation and in any use of suppressor tRNAs in gene therapy (36). Another possible application would be to provide additional levels of regulation to a preexisting transactivation system for the switching of gene expression, for example, tighter regulation of one activation system by another (37). Thus, the tTA gene could be used to regulate the function of an amber suppressor necessary for the expression of another transactivator, which has an amber mutation in the gene. In much the same way as a combined transcriptional and translational regulation of a gene can lead to much tighter regulation than by transcription or translation alone, this could lead to much tighter regulation for turning on gene expression in different systems. It is hoped that further studies including improvements in the regulation system used for amber suppression will make this a realistic goal for the future.

    ACKNOWLEDGMENTS

We thank Herman Bujard for plasmids pUHD10-3 and the pUHD15-1, Phil Sharp and Leslie Leinwand for comments and suggestions on the manuscript, and Harold Drabkin for suggestions and encouragement. We also thank Annmarie McInnis for her usual patience, care, and cheerfulness in the preparation of the manuscript.

This work was supported by grants GM46942 and GM17151 from the National Institutes of Health and by a postdoctoral fellowship from the Human Frontier Science Program (to Ho-Jin Park).

    FOOTNOTES

* Corresponding author. Mailing address: Rm. 68-671A, MIT, 77 Massachusetts Ave., Cambridge, MA 02139. Phone: (617) 253-4702. Fax: (617) 252-1556. E-mail: bhandary{at}wccf.mit.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Ackland-Berglund, C. E., and D. A. Leib. 1995. Efficacy of tetracycline-controlled gene expression is influenced by cell type. BioTechniques 18:196-200[Medline].
2. Atkinson, J., and R. Martin. 1994. Mutations to nonsense codons in human genetic disease: implications for gene therapy by nonsense suppressor tRNAs. Nucleic Acids Res. 22:1327-1334[Abstract/Free Full Text].
3. Boshart, M., F. Weber, G. Jahn, K. Dorsch-Hasler, B. Fleckenstein, and W. Schaffner. 1985. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41:521-530[Medline].
4. Capone, J. P., J. M. Sedivy, P. A. Sharp, and U. L. RajBhandary. 1986. Introduction of UAG, UAA, and UGA nonsense mutations at a specific site in the Escherichia coli chloramphenicol acetyltransferase gene: use in measurement of amber, ochre, and opal suppression in mammalian cells. Mol. Cell. Biol. 6:3059-3067[Abstract/Free Full Text].
5. Capone, J. P., P. A. Sharp, and U. L. RajBhandary. 1985. Amber, ochre, opal suppressor tRNA genes derived from a human serine tRNA gene. EMBO J. 4:213-221[Medline].
6. Chejanovsky, N., and B. J. Carter. 1989. Replication of a human parvovirus nonsense mutant in mammalian cells containing an inducible amber suppressor. Virology 117:239-247.
7. Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline].
8. Chrast-Balz, J., and R. Hooft van Huijsduijnen. 1996. Bi-directional gene switching with the tetracycline repressor and a novel tetracycline antagonist. Nucleic Acids Res. 24:2900-2904[Abstract/Free Full Text].
9. Dingermann, T., U. Frank-Stoll, H. Werner, A. Wissmann, W. Hillen, M. Jacquet, and R. Marschalek. 1992. RNA polymerase III catalyzed transcription can be regulated in Saccharomyces cerevisiae by the bacterial tetracycline repressor-operator system. EMBO J. 11:1487-1492[Medline].
10. Dingermann, T., H. Werner, A. Schutz, I. Zundorf, K. Nerke, D. Knecht, and R. Marschalek. 1992. Establishment of a system for conditional gene expression using an inducible tRNA suppressor gene. Mol. Cell. Biol. 12:4038-4045[Abstract/Free Full Text].
11. Doerig, R. E., B. Suter, M. Gray, and E. Kubli. 1988. Identification of an amber nonsense mutation in the rosy516 gene by germline transformation of an amber suppressor aminoacyl-tRNA gene. EMBO J. 7:2579-2584[Medline].
12. Dotan, I., I. Kopatz, T. Naiman, B. Perelman, N. Dafni, and D. Canaani. 1995. Establishment of an autocatalytic conditional mammalian system for expression of stringently regulated genes. Nucleic Acids Res. 23:307-309[Free Full Text].
13. Drabkin, H. J., H.-J. Park, and U. L. RajBhandary. 1996. Amber suppression in mammalian cells dependent upon expression of an Escherichia coli aminoacyl-tRNA synthetase gene. Mol. Cell. Biol. 16:907-913[Abstract].
14. Efrat, S., D. Fusco-DeMane, H. Lemberg, O. A. Emran, and X. Wang. 1995. Conditional transformation of a pancreatic beta -cell line derived from transgenic mice expressing a tetracycline-regulated oncogene. Proc. Natl. Acad. Sci. USA 92:3576-3580[Abstract/Free Full Text].
15. Fieck, A., D. L. Wyborski, and J. M. Short. 1992. Modifications of the E. coli Lac repressor for expression in eukaryotic cells: effects of nuclear signal sequences on protein activity and nuclear accumulation. Nucleic Acids Res. 20:1785-1791[Abstract/Free Full Text].
16. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051[Abstract/Free Full Text].
17. Gossen, M., and H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551[Abstract/Free Full Text].
18. Gossen, M., S. Freundlieb, G. Bender, G. Muller, W. Hillen, and H. Bujard. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766-1769[Abstract/Free Full Text].
19. Ho, Y.-S., and Y. W. Kan. 1987. In vivo aminoacylation of human and Xenopus suppressor tRNAs constructed by site-specific mutagenesis. Proc. Natl. Acad. Sci. USA 84:2185-2188[Abstract/Free Full Text].
20. Hoffman, A., G. P. Nolan, and H. M. Blau. 1995. Rapid retroviral delivery of tetracycline-inducible genes in a single autoregulatory cassette. Proc. Natl. Acad. Sci. USA 93:5185-5190[Abstract/Free Full Text].
21. Howe, J. R., B. V. Skyrabin, S. M. Belcher, C. A. Zerrilo, and C. Schamuss. 1995. The responsiveness of a tetracycline-sensitive expression system differs in different cell lines. J. Biol. Chem. 270:14168-14174[Abstract/Free Full Text].
22. Hudziak, R. M., F. A. Laski, U. L. RajBhandary, P. A. Sharp, and M. R. Capecchi. 1982. Establishment of mammalian cell lines containing multiple nonsense mutations and functional suppressor tRNA genes. Cell 31:137-146[Medline].
23. Kass-Eisler, A., K. Li, and L. A. Leinwand. 1995. Prospects for gene therapy with direct injection of polynucleotides. Ann. N. Y. Acad. Sci. 772:232-240[Medline].
24. Kistner, A., M. Gossen, F. Zimmermann, J. Jerecic, C. Ullmer, H. Lubbert, and H. Bujard. 1996. Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc. Natl. Acad. Sci. USA 93:10933-10938[Abstract/Free Full Text].
25. Kluxen, F.-W., and H. Lubbert. 1993. Maximal expression of recombinant cDNAs in COS cells for use in expression cloning. Anal. Biochem. 208:352-356[Medline].
26. Kozak, M. 1994. Determinants of translational fidelity and efficiency in vertebrate mRNAs. Biochimie 76:815-821[Medline].
27. Kunes, S., and H. Steller. 1991. Ablation of Drosophila photoreceptor cells by conditional expression of a toxin gene. Genes Dev. 5:970-983[Abstract/Free Full Text].
28. Laski, F. A., R. Belagaje, U. L. RajBhandary, and P. A. Sharp. 1982. An amber suppressor tRNA gene derived by site-specific mutagenesis. Proc. Natl. Acad. Sci. USA 79:5813-5817[Abstract/Free Full Text].
29. Laski, F. A., S. Ganguly, P. A. Sharp, U. L. RajBhandary, and G. M. Rubin. 1989. Construction, stable transformation, and function of an amber suppressor tRNA gene in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 86:6696-6698[Abstract/Free Full Text].
30. Li, K., J. Zhang, M. Buvoli, X. D. Yan, L. Leinwand, and H. He. 1997. Ochre suppressor transfer RNA restored dystrophin expression in mdx mice. Life Sci. 61:205-209[Medline].
31. No, D., T.-S. Yao, and R. M. Evans. 1996. Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proc. Natl. Acad. Sci. USA 93:3346-3351[Abstract/Free Full Text].
32. Robinson, D. F., and I. H. Maxwell. 1995. Suppression of single and double nonsense mutations introduced into the diphtheria toxin A-chain gene: a potential binary system for toxin gene therapy. Hum. Gene Ther. 6:137-143[Medline].
33. Shaw, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 43:737-755[Medline].
34. Sedivy, J. M., J. P. Capone, U. L. RajBhandary, and P. A. Sharp. 1987. An inducible mammalian amber suppressor: propagation of a poliovirus mutant. Cell 50:379-389[Medline].
35. Shockett, P., M. Difillippantonio, N. Hellman, and D. G. Schatz. 1995. A modified tetracycline-regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc. Natl. Acad. Sci. USA 92:6522-6526[Abstract/Free Full Text].
36. Shockett, P., and D. G. Schatz. 1996. Diverse strategies for tetracycline-regulated inducible gene expression. Proc. Natl. Acad. Sci. USA 93:5173-5176[Abstract/Free Full Text].
37. Shockett, P., and D. G. Schatz. 1997. Switching on gene expression. Nat. Biotechnol. 15:219-221[Medline].
38. Silberklang, M., A. M. Gillum, and U. L. RajBhandary. 1979. Use of in vitro 32P-labeling in the sequence analysis of nonradioactive tRNAs. Methods Enzymol. 59:58-109[Medline].
39. Syroid, D. E., R. I. Tapping, and J. P. Capone. 1992. Regulated expression of a mammalian nonsense suppressor tRNA gene in vivo and in vitro using the lac operator/repressor system. Mol. Cell. Biol. 12:4271-4278[Abstract/Free Full Text].
40. Temple, G. F., A. M. Dozy, K. L. Roy, and Y. W. Kan. 1982. Construction of a functional human suppressor tRNA gene: an approach to gene therapy for beta -thalassaemia. Nature (London) 296:537-540[Medline].
41. Ulmasov, B., J. Capone, and W. Folk. 1997. Regulated expression of plant tRNA genes by the prokaryotic tet and lac repressors. Plant Mol. Biol. 35:417-424[Medline].
42. Varshney, U., C.-P. Lee, and U. L. RajBhandary. 1991. Direct analysis of aminoacylation levels of tRNAs in vivo. J. Biol. Chem. 266:24712-24718[Abstract/Free Full Text].
43. Wang, Y., F. J. DeMayo, S. Y. Tsai, and B. W. O'Malley. 1997. Ligand-inducible and liver-specific target gene expression in transgenic mice. Nat. Biotechnol. 15:239-243[Medline].
44. Wang, Y., B. W. O'Malley, Jr., S. Y. Tsai, and B. W. O'Malley. 1994. A regulatory system for use in gene transfer. Proc. Natl. Acad. Sci. USA 91:8180-8184[Abstract/Free Full Text].
45. Yin, D. X., L. Zhu, and R. T. Schimke. 1996. Tetracycline-controlled gene expression system achieves high-level and quantitative control of gene expression. Anal. Biochem. 235:195-201[Medline].


Mol Cell Biol, August 1998, p. 4418-4425, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, H.-J.
Right arrow Articles by RajBhandary, U. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, H.-J.
Right arrow Articles by RajBhandary, U. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals