Previous Article | Next Article 
Mol Cell Biol, August 1998, p. 4418-4425, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Tetracycline-Regulated Suppression of Amber Codons
in Mammalian Cells
Ho-Jin
Park and
Uttam L.
RajBhandary*
Department of Biology, Massachusetts
Institute of Technology, Cambridge, Massachusetts 02139
Received 13 March 1998/Returned for modification 30 April
1998/Accepted 11 May 1998
 |
ABSTRACT |
As an approach to inducible suppression of nonsense mutations in
mammalian cells, we described recently an amber suppression system in
mammalian cells dependent on coexpression of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) along with the E. coli glutamine-inserting amber suppressor tRNA. Here, we report
on tetracycline-regulated expression of the E. coli GlnRS
gene and, thereby, tetracycline-regulated suppression of amber codons
in mammalian HeLa and COS-1 cells. The E. coli GlnRS coding
sequence attached to a minimal mammalian cell promoter was placed
downstream of seven tandem tetracycline operator sequences.
Cotransfection of HeLa cell lines expressing a tetracycline
transactivator protein, carrying a tetracycline repressor domain linked
to part of a herpesvirus VP16 activation domain, with the E. coli GlnRS gene and the E. coli glutamine-inserting
amber suppressor tRNA gene resulted in suppression of the amber codon
in a reporter chloramphenicol acetyltransferase gene. The tetracycline
transactivator-mediated expression of E. coli GlnRS was
essentially completely blocked in HeLa or COS-1 cells grown in the
presence of tetracycline. Concomitantly, both aminoacylation of the
suppressor tRNA and suppression of the amber codon were reduced
significantly in the presence of tetracycline.
 |
INTRODUCTION |
As in the case of Escherichia
coli, the availability of mammalian cell lines carrying nonsense
suppressor tRNA genes will greatly facilitate the genetic analysis of
animal cells and animal viruses. The suppressor tRNAs are also likely
to be useful for a variety of other purposes. For example, suppressor
tRNAs have been used for diphtheria toxin-mediated ablation of
photoreceptor cells in studies of cell-cell interactions during the
neuronal development of the optic system in Drosophila
melanogaster (27). Toxin-mediated cell ablation
dependent on suppressor tRNA has also been suggested as a possibility
for cancer therapy (32). In addition, the finding that
nonsense mutations in genes are often responsible for a variety of
human genetic diseases has led to suggestions of the use of suppressor
tRNAs as a tool in gene therapy (2, 40). Interestingly, the
direct injection of plasmid DNA carrying an ochre suppressor tRNA gene
partially suppresses the effect of an ochre nonsense mutation in the
dystrophin gene in mice (23, 30).
Classical genetic selections have not yielded any mammalian cell lines
carrying nonsense suppressor tRNA genes. Suppressor tRNAs have,
however, been generated by in vitro mutagenesis of tRNA genes and shown
to be functional in mammalian cells and in Drosophila
(4, 5, 28, 29). Cell lines carrying suppressor tRNA genes
have been made; however, constitutive expression of suppressor tRNA
genes is detrimental to mammalian cells and to Drosophila
(11, 22, 29).
To overcome the problem of toxicity of constitutive expression of
suppressor tRNAs in mammalian cells, we are investigating approaches
for the generation of inducible suppressors in mammalian cells.
Previously, we reported on the generation of BSC-40 monkey kidney cell
lines carrying an inducible human serine amber suppressor tRNA gene
(34). The induction relied on temperature-dependent amplification of the suppressor tRNA gene, linked to a simian virus 40 (SV40) origin of DNA replication (ori), in a cell line carrying a temperature-sensitive SV40 T antigen. This cell line was
useful for the propagation of poliovirus and adeno-associated virus
carrying amber mutations in specific genes (6, 34). However,
the general use of this approach to other cell types has been limited
due to the need for a temperature-sensitive T-antigen background. Other
attempts to regulate suppressor tRNA gene expression have used the
E. coli lac repressor to block the expression of a
suppressor tRNA gene linked on the 5' side to a lac operator sequence (39, 41). Similarly, the tetracycline
repressor-operator system has been used to regulate the expression of a
Dictyostelium discoideum amber suppressor tRNA gene in
D. discoideum and in the yeast Saccharomyces
cerevisiae (9, 10).
The above approaches for isolation of mammalian cell lines carrying
inducible suppressor tRNA genes rely on regulation of expression of the
suppressor tRNA gene which, in eukaryotes, is transcribed by RNA
polymerase III. We are working on an alternate approach, which relies
on regulation of function of the suppressor tRNA rather than its
expression (13). We have shown recently that an E. coli glutamine-inserting amber suppressor tRNA gene is expressed
in COS-1 and CV-1 cells but that the tRNA is inactive as a suppressor
because it is not aminoacylated by the aminoacyl-tRNA synthetases in
these cells to a detectable extent. Coexpression of the E. coli glutaminyl-tRNA synthetase (GlnRS) gene results in
aminoacylation of the suppressor tRNA and its functioning as an amber
suppressor. This result opened up the possibility of regulated
suppression of amber mutations in mammalian cells by regulating
expression of E. coli GlnRS. In this paper, we report on
tetracycline-dependent regulation of the E. coli GlnRS
gene by using a system developed by Gossen and Bujard for the
regulation of RNA polymerase II transcribed genes in mammalian and in
higher eukaryotic cells (17). We show (i) that the
expression of GlnRS in HeLa and in COS-1 cells can be regulated by
tetracycline and (ii) that the tetracycline regulation of GlnRS can be
further used to regulate the aminoacylation of the suppressor tRNA and, thereby, its function as an amber suppressor.
 |
MATERIALS AND METHODS |
Plasmids.
pSVBpUC-sup2, carrying the E. coli
glutamine-inserting suppressor tRNA gene, is the same plasmid as
pSVBpUC-hsup2A9
CCA described previously (13).
pSVGT3-Seram, carrying a human serine amber suppressor tRNA gene, and
pRSVCATam27, carrying an amber mutation at codon 27 of the
chloramphenicol acetyltransferase (CAT) gene, have been described
previously (4). pRSVCATam27 does not contain the
ori region of SV40, and the CATam27 gene is
transcribed by using the Rous sarcoma virus long terminal repeat
enhancer/promoter. pc3PUR-CATam27 carries the
CATam27 gene transcribed by using the human cytomegalovirus
(CMV) enhancer/promoter (3). It is derived from
pcDNA3-CATam27 in which the neomycin resistance gene has been replaced by the puromycin resistance gene.
pc3PUR-CATam27 contains the ori region of SV40
and was constructed as follows. First, the
HindIII-BanI fragment of
pRSVCATam27 containing the CATam27 coding region
was blunt ended at the BanI site and cloned into the
HindIII-EcoRV site of pcDNA3 (Invitrogen) to
yield pcDNA3-CATam27. Second, the neomycin
phosphotransferase gene in pcDNA3-CATam27 was replaced by a
puromycin acetyltransferase gene to produce pc3PUR-CATam27,
by cloning the AvrII-Bsp120I fragment of pPUR (Clontech) into the AvrII-Bst1107 site of
pcDNA3-CATam27. Although pc3PUR-CATam27 and
pcDNA3-CATam27 differ only in the region coding for
antibiotic resistance, pc3PUR-CATam27 was used instead of pcDNA3-CATam27 as the reporter for in vivo suppression
assays since pc3PUR-CATam27 showed much higher suppression
activity than pcDNA3-CATam27 (unpublished data).
Vectors for the tetracycline-controlled system are pUHD10-3 and
pUHD15-1, kindly provided by H. Bujard (17). pUHD10-3
carries a minimal promoter derived from the human CMV immediate-early promoter fused downstream of seven tandem tetracycline operator (tetO) sequences. pUHD15-1 carries a hybrid
tetracycline-controlled transactivator (tTA) gene made by combining the
gene coding for the tetracycline repressor with the gene coding for the
C-terminal 127 amino acids of VP16 from herpes simplex virus, known to
be essential for the transcription of the immediate-early viral genes. pUtetO-CATwt carrying the CAT gene downstream of the tetO
was constructed by inserting the smaller fragment of the blunt-ended HindIII-BanI digest of pRSVCATwt
(4) into the blunt-ended EcoRI digest of
pUHD10-3. The orientation of the gene with respect to the
tetO region was determined by restriction analysis. A
nuclear localization signal sequence (PKRPRP) of adenovirus E1A
(15) was fused to the N-terminal region of the tTA protein
by PCR to yield pU-CMV-tTAnls. pUHD15-1 DNA was used as a
template, and sequences of primers were
GCGAATTCACCATGGATCCTAAGAGACCTAGGCCTTCTAGATTAGATAAAAGTA (5' primer) and GGGGCCGTCGACAGTC (3' primer). The
5' primer was complementary to the 5' end of the coding region of the
tTA gene and contained a sequence coding for the nuclear localization
signal and Kozak's consensus initiation codon context, ACCATGG
(26). The 3' primer was complementary to the region
containing the SalI site of the gene. An
EcoRI-SalI fragment of the PCR product was used
to replace the EcoRI-SalI region of pUHD15-1
coding for tTA, resulting in pU-CMV-tTAnls.
For purposes of immunodetection, the C terminus of
E. coli
GlnRS was tagged with six histidine residues by using PCR. The
template
DNA used was pCDGlnRS (
13). The primers used for PCR
(5'
primer, AGGGATCCACGATAAGTG; 3' primer,
ACTGGATCCCTTTCGCCCAGTATC)
were complementary to the ends of
the coding region of the
E. coli GlnRS gene. The PCR product
was digested with
BamHI, and
the fragment was ligated to the
larger fragment of the
BamHI-
BglII
digest of
pQE16 (Qiagen), to yield pQE16-GlnRS. A smaller fragment
of the
EcoRI-
NheI digest of pQE16-GlnRS was ligated with
a larger
fragment of the
EcoRI-
XbaI digest of
either pUHD10-3 (
17) or
pcDNA3, to yield pUtetO-16GlnRS or
pc-16GlnRS, respectively. The
transcription of the histidine-tagged
E. coli GlnRS gene is controlled
by tTA in pUtetO-16GlnRS
and is constitutive from the CMV enhancer/promoter
in pc-16GlnRS.
pCMV-

gal, containing an
E. coli 
-galactosidase
gene
transcribed by using the CMV promoter (Clontech), was used
as a control
vector.
Transfection of cells.
HeLa-tetOff cells (Clontech), which
express constitutively tTA, were maintained at 37°C with 5%
CO2 in Dulbecco's modified Eagle's medium (DMEM)
containing 10% calf serum, 100 U of penicillin G sodium, 100 µg of
streptomycin sulfate per ml, and 200 µg of G418 (GIBCO BRL) per ml.
COS-1 cells were maintained under the same conditions as HeLa-tetOff
cells except that no G418 was included in the medium.
Electroporation for transfection of HeLa-tetOff cells was performed by
using Electroporator II and 0.4-cm-width cuvettes from
Invitrogen. Ten
micrograms of plasmid DNA was used for 0.4 ml
of cells (4 × 10
6 cells/ml) in each electroporation.
LipofectAMINE (GIBCO BRL) or SuperFect (Qiagen) was used for
liposome-mediated transfection of HeLa-tetOff cells according
to the
manufacturer's protocols, with slight modifications. A
total of 2 µg
of plasmid DNA was used for transfection of cells,
at about 80%
confluence, in each well of a six-well plate. Cells
were treated with
liposome-DNA complex in medium containing 10%
Nu-serum and 0.2 µg of
tetracycline per ml for 3 h. Cells were
harvested 24 to 30 h
after transfection.
The DEAE-dextran-chloroquine-dimethyl sulfoxide (DMSO) method was used
for HeLa and COS-1 transfection according to the protocol
of Kluxen and
Lubbert (
25), with some modifications. Briefly,
cells at
about 80% confluence in six-well plates were washed twice
with DMEM.
One milliliter of DMEM containing 10% Nu-serum (Becton
Dickinson
Labware, Bedford, Mass.), 0.4 mg of DEAE dextran per
ml, 100 µM
chloroquine (Sigma), 0.2 µg of tetracycline per ml,
and plasmid DNA
was added as indicated in the figure legends,
and the cells were
incubated in 5% CO
2 at 37°C for 4 h. Afterwards,
the cells were washed once with DMEM and then incubated in 10%
DMSO in
Ca
2+- and Mg
2+-free phosphate-buffered saline
for 2 min at room temperature.
The cells were washed twice with DMEM
and incubated in 3 ml of
complete medium for 40 to 50 h. When
60-mm-diameter dishes were
used for transfection, the procedure
described above was scaled
up.
Assays for CAT in cell extracts.
The CAT assay was modified
from the protocols of Shaw (33) and Gorman et al.
(16) as follows. The cell pellet was resuspended in 50 to
100 µl of 0.25 M Tris-HCl (pH 7.8). Cells were lysed by rapid
freezing and thawing three times. Cell extracts containing various
amounts of protein in 30 µl of 0.25 M Tris-HCl (pH 7.8) were heat
treated at 65°C for 15 min to prevent enzymatic breakdown of the
acetyl coenzyme A (acetyl-CoA) substrate (33). To the supernatant, 14 µl of double-distilled H2O, 4 µl of 8 mM acetyl-CoA, and 2 µl of [14C]chloramphenicol (0.8 mmol/ml, 50 mCi/ml) were added (final concentration; 33 µM
[14C]chloramphenicol, 0.64 mM acetyl-CoA, 0.15 M Tris-HCl
[pH 7.8]). The reaction mixture was incubated at 37°C for 1 h,
and acetyl-chloramphenicol was separated from chloramphenicol by
thin-layer chromatography following extraction into ethyl acetate. One
unit of the CAT activity is defined as nanomoles of chloramphenicol
acetylated by 10 µg of protein per hour by using the CAT values where
the enzyme activities were within a linear range.
Northern analysis for determination of aminoacylation of tRNA in
vivo.
Total RNA was isolated under acidic conditions
(7) using TRI Reagent (Molecular Research Center, Inc.,
Cincinnati, Ohio). The separation of suppressor tRNA from the
corresponding aminoacyl-tRNA was achieved by acid-urea gel
electrophoresis on 6.5% polyacrylamide gels (19, 42). The
suppressor tRNA was detected by Northern hybridization using a
5'-32P-labeled (38) oligonucleotide probe
(GCCGGAATTAGAATCCGG) complementary to nucleotides 27 to 44 of the sup2 tRNA.
Immunoblot analysis.
Cell extracts were subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis, and the protein
bands were blotted onto a polyvinylidene difluoride membrane
(Amersham). The histidine-tagged E. coli GlnRS was detected
by using a monoclonal antibody against the polyhistidine epitope
(Qiagen).
 |
RESULTS |
Strategy for tetracycline regulation of genes in mammalian
cells.
The strategy for tetracycline regulation of genes in
mammalian cells (17) involves (i) a target gene, which is
linked to a promoter with minimal activity, and (ii) a tTA consisting
of a tetracycline repressor fused to the C-terminal 127 amino acids of
the herpesvirus VP16 activation domain (Fig.
1A). The tTA protein binds to the
tetO DNA elements in the target gene, placed approximately 50 nucleotides upstream of the transcriptional start site, through the
tetracycline repressor domain and activates transcription of the
otherwise silent gene (in this case the E. coli GlnRS gene) through the VP16 activation domain. Using cells stably transfected with
the tTA gene and a luciferase target gene, Gossen and Bujard (17) have demonstrated a 104- to
105-fold regulation of expression of luciferase by
tetracycline.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Strategy for tetracycline-regulated suppression of the
amber codon in mammalian cells. (A) Tetracycline-regulated expression
of E. coli GlnRS in mammalian cells. The GlnRS gene is
attached to a minimal human CMV promoter (Pmin) and seven
tandem E. coli tetO DNA sequences. tTA is a hybrid protein
which consists of the E. coli tetracycline repressor (tetR)
sequences and the herpes simplex virus VP16 transcription activation
domain (17). The tTA protein binds to the tetO
sequences in the GlnRS gene and activates transcription of the
otherwise silent gene through the VP16 activation domain in the absence
of tetracycline but not in its presence. (B) GlnRS-dependent
suppression of the amber codon in the CATam27 reporter gene.
Mammalian cells transfected with the E. coli glutamine amber
suppressor tRNA gene express the tRNA. However, the tRNA is not
aminoacylated to any detectable extent and is therefore inactive as an
amber suppressor (13). Expression of E. coli
GlnRS results in aminoacylation of the suppressor tRNA and, thereby,
suppression of the amber codon in the CATam27 reporter gene
to yield a functional CAT protein. Tetracycline-dependent regulation of
GlnRS synthesis, therefore, leads to tetracycline-dependent regulation
of suppression.
|
|
Tetracycline-regulated expression of E. coli
glutaminyl-tRNA synthetase in a HeLa-tetOff cell line expressing
tTA.
As a first step toward studying the feasibility of regulation
of E. coli GlnRS in mammalian cells, we adopted a similar
strategy using a HeLa-tetOff cell line constitutively expressing tTA,
except that the E. coli GlnRS gene was introduced by
transient transfection instead of stable transfection. To monitor the
expression of the E. coli GlnRS, the enzyme was tagged with
six histidines at the carboxyl terminus. A monoclonal antibody against
this epitope was used for immunoblot analysis to visualize expression
of the E. coli GlnRS. The GlnRS gene was subcloned into
pUHD10-3, which carries seven tetO sequences, to yield
pUtetO-16GlnRS. For constitutive expression, the GlnRS gene was
subcloned into pcDNA3, which contains a CMV promoter, to yield
pc-16GlnRS.
The HeLa-tetOff cell line was transiently transfected with either
pUtetO-16GlnRS or pc-16GlnRS. Figure
2
shows an immunoblot
analysis of extracts made from cells transfected in
the absence
or in the presence of tetracycline. The results show
tetracycline-dependent
regulation of
E. coli GlnRS
synthesis. There is a strong band
corresponding to GlnRS in cells grown
in the absence of tetracycline
(Fig.
2A, lanes 1, 3, and 5), whereas
this band is absent or much
weaker in cells grown in the presence of
tetracycline (lanes 2,
4, and 6). The tetracycline regulation is seen
in cells transfected
by all three methods, electroporation (lanes 1 and
2), the DEAE-dextran
method (lanes 3 and 4), and liposome-mediated
transfection (lanes
5 and 6). The tetracycline regulation is also
specific in that
it is seen in cells transfected with pUtetO-16GlnRS
(Fig.
2A)
but not in cells transfected with pc-16GlnRS (Fig.
2B).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot analysis for expression of the E. coli glutaminyl-tRNA synthetase in HeLa-tetOff cells.
Histidine-tagged E. coli GlnRS was expressed by using two
different vectors, pUtetO-16GlnRS carrying tetO (A) or
pc-16GlnRS carrying a CMV promoter (B), and three different
transfection methods: electroporation (lanes 1 and 2), the
DEAE-dextran-chloroquine-DMSO method (lanes 3 and 4), and the
liposome-mediated method using LipofectAMINE (GIBCO BRL) (lanes 5 and
6). Where indicated, cells were incubated in medium containing
tetracycline (1 µg/ml). Ten-microgram aliquots of crude cell extracts
were separated by electrophoresis on sodium dodecyl sulfate-12%
polyacrylamide gels and analyzed by immunoblotting using an antibody to
the histidine tag (Clontech). The blot was visualized by the enhanced
chemiluminescence method (Amersham).
|
|
Tetracycline-regulated amber suppression in a HeLa-tetOff cell
line.
The function of the E. coli glutamine-inserting
suppressor tRNA (sup2) as an amber suppressor in mammalian
cells was previously shown to be dependent on the coexpression of the
E. coli GlnRS (13). Having demonstrated the
tetracycline-regulated expression of E. coli GlnRS, we
examined whether amber suppression by the E. coli glutamine
suppressor tRNA could be regulated by regulating the expression of the
E. coli GlnRS (Fig. 1B). HeLa-tetOff cells were
cotransfected with pSVBpUC-sup2 carrying the E. coli
suppressor tRNA, pUtetO-16GlnRS, and pc3PUR-CATam27 carrying
an amber mutation in the CAT gene as a reporter (4). The
amount of pUtetO-16GlnRS DNA used for transfection was varied in
different experiments. All transfections were carried out in duplicate.
CAT assays were performed with cell extracts to measure the levels of
suppression of the amber codon in the CATam27mRNA. The
results, shown in Fig. 3 and quantitated
in Table 1, provide clear evidence for
tetracycline regulation of amber suppression in the HeLa cell line. As
described previously (13), suppression of the amber codon in
the CATam27mRNA, measured by CAT activity in extracts, was
detected only in cells transfected with both the E. coli
suppressor tRNA and the E. coli GlnRS genes (Fig. 3; compare
lanes 1 to 16 with lanes 17 to 20). In cells cotransfected with
pUtetO-16GlnRS (lanes 1 to 12), the suppression of the amber mutation
was much reduced when tetracycline was added to the medium (compare
lanes 3 and 4 to 1 and 2, 7 and 8 to 5 and 6, 11 and 12 to 9 and 10).
The regulation of suppression by tetracycline was 15- to 78-fold,
depending on the amount of pUtetO-16GlnRS vector used for transfection
(Table 1). When the amount of pUtetO-16GlnRS vector used for
transfection was reduced, tetracycline regulation of suppression was
higher (78-fold), whereas when the amount of pUtetO-16GlnRS vector used
for transfection was increased, the extent of suppression was higher
but the fold regulation by tetracycline was lower. This is due to
increases in the background CAT activity with increases in the amount
of the GlnRS vector used for transfection. The effect of tetracycline on amber suppression is specific to cells expressing GlnRS from the
pUtetO-16GlnRS vector, since tetracycline did not affect significantly the suppression in cells expressing the E. coli GlnRS
constitutively (Fig. 3, lanes 13 to 16; Table 1) or when a human
serine-inserting amber suppressor tRNA was used in the transfection
(Table 1). The CAT values are, if anything, even slightly higher in
these cases in the presence of tetracycline than in its absence. Higher suppression levels in the presence of the human serine amber suppressor tRNA gene than in the presence of the E. coli glutamine
suppressor tRNA gene have been described before (13).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
In vivo assay for amber suppression in HeLa-tetOff
cells, using a tetracycline-regulated E. coli GlnRS gene.
HeLa-tetOff cells in six-well plates were cotransfected in duplicate
with three vectors, 1 µg of pc3PUR-CATam27, 1 µg of
pSVBpUC-sup2, and various amounts of pUtetO-16GlnRS (lanes 1 to 12),
pc-16GlnRS (lanes 13 to 16), or pCMV- gal (lanes 17 to 20) as
indicated. Liposome-mediated transfection was used. Where indicated,
cells were incubated in the presence of 1 µg of tetracycline (Tc) per
ml for the course of the transfection (24 to 30 h). The CAT
activities from individual transfections using 7.5 µg of crude
protein extracts are shown.
|
|
A difference in efficiency of tetracycline regulation depending on the
amounts of the vector carrying a
tetO-controlled target
gene
used in transfection was also observed when the wild-type
CAT gene was
expressed in the same cell line by using pUtetO-CATwt
(Table
2). When a smaller amount of pUtetO-CATwt
was used for
transfection, the regulation by tetracycline was more than
1,018-fold;
when a greater amount of pUtetO-CATwt was used, the fold
regulation
was down to 327.
Tetracycline regulation of aminoacylation of the E. coli suppressor tRNA by the E. coli glutaminyl-tRNA
synthetase.
To establish that the regulation of function of the
E. coli suppressor tRNA by tetracycline is responsible for
the observed regulated suppression of the amber codon in the
CATam27 mRNA, the effect of tetracycline on the in vivo
aminoacylation level of the suppressor tRNA was monitored. Figure
4 shows a Northern blot analysis of total
RNA isolated from transfected cells after separation of aminoacyl-tRNA
from tRNA by acid-urea gel electrophoresis. In cells transfected with
pUtetO-16GlnRS, aminoacylation of the suppressor tRNA was significantly
reduced when tetracycline was present in media (Fig. 4; compare lanes 3 and 4). As expected, this effect of tetracycline depends on the vector
used for expression of the E. coli GlnRS. In cells
transfected with plasmid pc-16GlnRS which are constitutively expressing
the E. coli GlnRS gene, there is no effect of tetracycline
(compare lanes 1 and 2). As described before, aminoacylation of the
E. coli suppressor tRNA requires cotransfection of cells
with an E. coli GlnRS-carrying vector. There is no
aminoacylation of the tRNA when cells are cotransfected with
pCMV-
gal (lane 5). These results show that the
tetracycline-regulated suppression of the amber codon in the
CATam27 mRNA is due to its regulation of synthesis of the
E. coli GlnRS, which is needed for aminoacylation of the
E. coli suppressor tRNA.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Regulation of in vivo aminoacylation of the
sup2 tRNA by tetracycline. HeLa-tetOff cells were
cotransfected with pSVBpUC-sup2 carrying the E. coli suppressor tRNA gene and pc-16GlnRS (lanes 1 and 2),
pUtetO-16GlnRS (lanes 3 and 4), or pCMV- gal (lane 5).
Liposome-mediated transfection was used. Where indicated, cells were
incubated in medium containing tetracycline (Tc) during the course
of transfection (24 to 30 h); 0.2 A260 unit
of total RNA isolated from transfected cells under acidic conditions
(pH 4.5) was separated by acid-urea gel electrophoresis and analyzed by
Northern hybridization using a 32P-labeled oligonucleotide
complementary to nucleotides 27 to 44 of the E. coli
glutamine suppressor tRNA. The sample in lane 6 was the same as that in
lane 1 except that it was treated with 0.2 M Tris-HCl (pH 9.5) at
37°C for 30 min.
|
|
Tetracycline-regulated suppression can be achieved in other cell
types by use of tTA carrying a nuclear localization signal.
We
examined whether the tetracycline-regulated suppression system could
also be demonstrated in other cell lines such as COS-1. Unlike
HeLa-tetOff cells, COS-1 cells do not contain the tTA; therefore, the
gene for the tTA was introduced by transient transfection along with
the other genes. While this system seemed to function for
tetracycline-regulated suppression in this cell line, the levels of
suppression, as measured by CAT activity in extracts, were very low,
making it difficult to measure the fold regulation of suppression by
tetracycline (data not shown). To increase the transactivator-dependent
suppression activity, a nuclear localization signal sequence (PKRPRP)
was added close to the amino terminus of the tTA protein. It was hoped
that this would lead to a higher concentration of the tTA in the
nucleus and thereby to increased transcription of the GlnRS gene. Table
3 shows that the insertion of the nuclear
localization signal sequence in the transactivator (tTAnls)
improved the transactivation activity by a factor of more than 12 compared to that of the prototype transactivator (tTA) when a wild-type
CAT gene was expressed under control of tetO
(pUtetO-CATwt). This modified transactivator (pU-CMV-tTAnls) was
used for the tetracycline-regulated suppression of amber codons in COS-1 cells.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Comparison of the modified (tTAnls) and unmodified (tTA)
transactivator for activation of CAT expression in
COS-1 cellsa
|
|
COS-1 cells were cotransfected with four different plasmids, each
carrying the gene for either the suppressor tRNA, the GlnRS,
the
tTAnls, or the CAT
am27 reporter gene. The results of CAT
assays
(Table
4) show clearly that amber
suppression is regulated by
tetracycline in COS-1 cells. Also, the
tetracycline regulation
is specific to cells which are expressing GlnRS
from the pUtetO-16GlnRS
vector and not from the pc-16GlnRS vector.
However, the high background
of CAT activity (7 ± 0.5, compared to <1 in mock-transfected cells)
in cells not carrying
the suppressor tRNA gene or the GlnRS gene
suggests that
the amber mutation in CAT
am27 is leaky in COS-1
cells. This
leakiness reduces the fold regulation by tetracycline
from 15 to 78 in
HeLa cells to 5 to 17 in COS-1 cells. The pc3
DNA vector contains the
ori region of SV40 and is known to be
replicated in COS-1
cells. Therefore, the leakiness of the amber
mutation is most likely
due to the high copy number of the vector
carrying
CAT
am27 (pc3PUR-CATam27) in COS-1 cells, resulting in
very
high levels of the CAT
am27 mRNA. The leakiness of
expression
of the CAT
am27 gene was much reduced when
the nonreplicating vector
pRSVCAT
am27, which does
not contain the SV40
ori region (
7),
was used
instead of pc3PUR-CAT
am27 in transfection of COS-1
cells
(Table
5). The CAT activity
of <1 in extracts of cells transfected
with the suppressor tRNA gene
but without the
E. coli GlnRS gene
is essentially the
same as the background CAT activity in mock-transfected
cells.
The results in Table
5 also show that amber suppression in COS-1 cells
by using pRSVCAT
am27 as the reporter is regulated
by
tetracycline in a dose-dependent manner. Maximal regulation
is achieved
at a tetracycline concentration of 1 µg/ml in the
medium,
increasing the tetracycline concentration to 5 µg/ml does
not have
any further effect. Immunoblot analysis of the cell extracts
from the
same transfection showed that the expression of the
E. coli
GlnRS was also regulated in a similar manner (Fig.
5, lanes
3 to 6). Assay of the in vivo
aminoacylation level of transfected
cells showed also that the
aminoacylation level decreased when
the concentration of
tetracycline in media was increased (data
not shown).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
Regulated expression of the E. coli GlnRS in
COS-1 cells by tetracycline. COS-1 cells were cotransfected by the
DEAE-dextran method with four vectors as described in Table 5 and
incubated in media containing various amounts of tetracycline (Tc).
Ten-microgram aliquots of crude cell extracts from each transfection
were used for immunoblot analysis. A monoclonal antibody to the
histidine tag was used to detect the E. coli GlnRS. The
blots were visualized by the enhanced chemiluminescence method.
|
|
 |
DISCUSSION |
As a first step in generating mammalian cell lines carrying
inducible suppressors of nonsense codons, we have shown that amber suppression in HeLa and COS-1 cells can be regulated by tetracycline. The suppressor tRNA used for this purpose was the E. coli
glutamine-inserting amber suppressor tRNA. Because this tRNA is not
aminoacylated by the mammalian aminoacyl-tRNA synthetases, amber
suppression is dependent on coexpression of the E. coli
GlnRS. Tetracycline regulation of amber suppression was achieved by
regulating the expression of E. coli GlnRS, using a system
developed by Gossen and Bujard (17). We have shown that
tetracycline regulation of GlnRS results in regulation of
aminoacylation of the suppressor tRNA and thereby regulation of amber
suppression. The tetracycline regulation is specific to cells
expressing GlnRS from the tetracycline promoter; there is no such
regulation in cells expressing GlnRS from the constitutive CMV
promoter. The tetracycline regulation is also dependent on the levels
of tetracycline in the medium.
The tetracycline regulation of amber suppression is 15- to 78-fold in
the HeLa cells and 5- to 17-fold in COS-1 cells. This level of
regulation is similar to that seen in other transient-transfection systems (1, 21, 43, 45) or in D. discoideum
(10), where tetracycline is used to regulate expression of
the suppressor tRNA rather than its function. The 15- to 78-fold
regulation of amber suppression by tetracycline in HeLa cells is,
however, substantially less than that in a stable HeLa cell line
expressing the same tTA constitutively (17) or in animals
using different transactivation systems induced by mifepristone (RU486)
or ecdysone (31, 43, 44). This is at least partly due to the
fact that we are using transient transfection of cells, whereas the
other cases involve cell lines or animals in which the gene for the
transactivator protein and the target gene for regulation are both
stably integrated into the chromosomal DNA. Induction levels in
transiently transfected cells are known to be substantially lower than
in stable cell lines or in animals. For example, transient transfection
of Vero cell lines expressing tTA resulted in only 64- to 94-fold
regulation by tetracycline (1). Also, with the
RU486-regulated system, transient transfection of HepG2 cells yielded
34- to 47-fold regulation by RU486, whereas in animals it was
>33,000-fold (43, 44). Our results with the tetracycline
regulation of amber suppression are, therefore, considered encouraging
enough to proceed with isolation of cell lines in which both tTA and
the GlnRS genes are stably integrated.
Another reason for the reduced fold regulation of amber suppression by
tetracycline in the HeLa-tetOff cell line could be due to the
background activity of the GlnRS minimal promoter, giving rise to a
basal level of GlnRS expression not involving tTA. This is also
indicated by the fact that the fold regulation of expression of the
wild-type CAT gene, which has a different sequence in the region
following the tetO sequences, is substantially higher
(>1,028 [Table 2]) than that of amber suppression dependent on GlnRS
function. Alternatively, it is possible that the effect of the basal
levels of GlnRS that are produced from the minimal promoter is
amplified because each GlnRS molecule can participate in aminoacylation
of many suppressor tRNA molecules.
The background activity of the GlnRS minimal promoter is clearly seen
in COS-1 cells, where a band corresponding to GlnRS is visible in
immunoblots of cell extracts in the absence of any tTA (Fig. 5, lane
2). Interestingly, the tetracycline regulation of amber suppression in
COS-1 cells is lower (5- to 17-fold) than that in HeLa cells (15- to
78-fold). This result is analogous to the finding that a tTA-regulated
minimal promoter gave high basal levels of transcription of the target
gene in Vero, BHK, and HEK293 cell lines but not in HeLa or GH3 (clonal
cells derived from rat pituitary cells) cell lines (1, 21,
45). However, in contrast to our results, indicating 5- to
17-fold regulation of amber suppression by tetracycline in COS-1 cells,
in BHK cells the background activity of the promoter was so high that
there was essentially no tetracycline regulation of the target gene (1).
The tetracycline regulation of amber suppression in mammalian cells
opens up the possibility of further improvements in this system or use
of other, more recently developed systems such that amber suppression
in mammalian cells and eventually in animals may be achieved in an
inducible, tissue-specific or developmentally regulated manner
(24, 37). These improvements include an autoregulatory system for synthesis of tTA (12, 20, 35) and a mutant tTA (rtTA), which depends on tetracycline activation rather than repression for binding of the transactivator to the tetO DNA (8,
18, 24). Suppression in the latter case will be induced by
addition of tetracycline rather than by removal of tetracycline. Also, derivatives of tetracycline which yield even greater induction levels
with rtTA or which bind so tightly to the repressor that regulation
requires a 100-fold-lower concentration of the tetracycline derivative
have been identified (8, 24). Thus, it might be possible to
obtain even higher fold regulation of amber suppression by tetracycline
with the incorporation of these features. Other possibilities include a
more recently developed transactivator protein, which contains the
yeast GAL4 DNA binding domain and is activated by RU486 (43,
44), and an ecdysone-inducible transactivation system
(31). The RU486-inducible system has been shown to be
very effective in regulated expression of genes in transgenic
mice, in which the transactivator is expressed only in the liver by
linking it to the liver-specific transerythrin promoter.
Finally, in addition to the generation of cell lines useful for the
identification and propagation of nonsense mutations in animal cells
and viruses, the regulated amber suppression described here could prove
useful for a variety of other purposes, e.g., in the regulation of
genes for extremely toxic proteins such as the diphtheria toxin.
Although several tissue-specific and developmentally regulated
promoters have been described for higher eukaryotic cells, Kunes and
Steller (27) observed that Drosophila
transformants carrying the gene for diphtheria toxin linked to a
photoreceptor cell-specific promoter were not viable even though the
visual system in Drosophila is not essential for viability.
This finding suggests that the photoreceptor cell-specific promoter
could be leaky in some other cells, thereby leading to expression of
the diphtheria toxin in cells or tissues essential for viability. The
combination of a diphtheria toxin gene carrying an amber mutation along
with a Drosophila amber suppressor tRNA gene was necessary to obtain viable transformants that could be used to study the effect
of ablation of photoreceptor cells on the neuronal development of the
visual system. A system that allowed amber suppression to be switched
on and off in a time-dependent manner would be an important addition in
studies of cell ablation and in any use of suppressor tRNAs in gene
therapy (36). Another possible application would be to
provide additional levels of regulation to a preexisting transactivation system for the switching of gene expression, for example, tighter regulation of one activation system by another (37). Thus, the tTA gene could be used to regulate the
function of an amber suppressor necessary for the expression of another transactivator, which has an amber mutation in the gene. In much the
same way as a combined transcriptional and translational regulation of
a gene can lead to much tighter regulation than by transcription or
translation alone, this could lead to much tighter regulation for
turning on gene expression in different systems. It is hoped that
further studies including improvements in the regulation system used
for amber suppression will make this a realistic goal for the future.
 |
ACKNOWLEDGMENTS |
We thank Herman Bujard for plasmids pUHD10-3 and the
pUHD15-1, Phil Sharp and Leslie Leinwand for comments and suggestions on the manuscript, and Harold Drabkin for suggestions and
encouragement. We also thank Annmarie McInnis for her usual patience,
care, and cheerfulness in the preparation of the manuscript.
This work was supported by grants GM46942 and GM17151 from the National
Institutes of Health and by a postdoctoral fellowship from the Human
Frontier Science Program (to Ho-Jin Park).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rm. 68-671A,
MIT, 77 Massachusetts Ave., Cambridge, MA 02139. Phone: (617) 253-4702. Fax: (617) 252-1556. E-mail: bhandary{at}wccf.mit.edu.
 |
REFERENCES |
| 1.
|
Ackland-Berglund, C. E., and D. A. Leib.
1995.
Efficacy of tetracycline-controlled gene expression is influenced by cell type.
BioTechniques
18:196-200[Medline].
|
| 2.
|
Atkinson, J., and R. Martin.
1994.
Mutations to nonsense codons in human genetic disease: implications for gene therapy by nonsense suppressor tRNAs.
Nucleic Acids Res.
22:1327-1334[Abstract/Free Full Text].
|
| 3.
|
Boshart, M.,
F. Weber,
G. Jahn,
K. Dorsch-Hasler,
B. Fleckenstein, and W. Schaffner.
1985.
A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus.
Cell
41:521-530[Medline].
|
| 4.
|
Capone, J. P.,
J. M. Sedivy,
P. A. Sharp, and U. L. RajBhandary.
1986.
Introduction of UAG, UAA, and UGA nonsense mutations at a specific site in the Escherichia coli chloramphenicol acetyltransferase gene: use in measurement of amber, ochre, and opal suppression in mammalian cells.
Mol. Cell. Biol.
6:3059-3067[Abstract/Free Full Text].
|
| 5.
|
Capone, J. P.,
P. A. Sharp, and U. L. RajBhandary.
1985.
Amber, ochre, opal suppressor tRNA genes derived from a human serine tRNA gene.
EMBO J.
4:213-221[Medline].
|
| 6.
|
Chejanovsky, N., and B. J. Carter.
1989.
Replication of a human parvovirus nonsense mutant in mammalian cells containing an inducible amber suppressor.
Virology
117:239-247.
|
| 7.
|
Chomczynski, P., and N. Sacchi.
1987.
Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 8.
|
Chrast-Balz, J., and R. Hooft van Huijsduijnen.
1996.
Bi-directional gene switching with the tetracycline repressor and a novel tetracycline antagonist.
Nucleic Acids Res.
24:2900-2904[Abstract/Free Full Text].
|
| 9.
|
Dingermann, T.,
U. Frank-Stoll,
H. Werner,
A. Wissmann,
W. Hillen,
M. Jacquet, and R. Marschalek.
1992.
RNA polymerase III catalyzed transcription can be regulated in Saccharomyces cerevisiae by the bacterial tetracycline repressor-operator system.
EMBO J.
11:1487-1492[Medline].
|
| 10.
|
Dingermann, T.,
H. Werner,
A. Schutz,
I. Zundorf,
K. Nerke,
D. Knecht, and R. Marschalek.
1992.
Establishment of a system for conditional gene expression using an inducible tRNA suppressor gene.
Mol. Cell. Biol.
12:4038-4045[Abstract/Free Full Text].
|
| 11.
|
Doerig, R. E.,
B. Suter,
M. Gray, and E. Kubli.
1988.
Identification of an amber nonsense mutation in the rosy516 gene by germline transformation of an amber suppressor aminoacyl-tRNA gene.
EMBO J.
7:2579-2584[Medline].
|
| 12.
|
Dotan, I.,
I. Kopatz,
T. Naiman,
B. Perelman,
N. Dafni, and D. Canaani.
1995.
Establishment of an autocatalytic conditional mammalian system for expression of stringently regulated genes.
Nucleic Acids Res.
23:307-309[Free Full Text].
|
| 13.
|
Drabkin, H. J.,
H.-J. Park, and U. L. RajBhandary.
1996.
Amber suppression in mammalian cells dependent upon expression of an Escherichia coli aminoacyl-tRNA synthetase gene.
Mol. Cell. Biol.
16:907-913[Abstract].
|
| 14.
|
Efrat, S.,
D. Fusco-DeMane,
H. Lemberg,
O. A. Emran, and X. Wang.
1995.
Conditional transformation of a pancreatic -cell line derived from transgenic mice expressing a tetracycline-regulated oncogene.
Proc. Natl. Acad. Sci. USA
92:3576-3580[Abstract/Free Full Text].
|
| 15.
|
Fieck, A.,
D. L. Wyborski, and J. M. Short.
1992.
Modifications of the E. coli Lac repressor for expression in eukaryotic cells: effects of nuclear signal sequences on protein activity and nuclear accumulation.
Nucleic Acids Res.
20:1785-1791[Abstract/Free Full Text].
|
| 16.
|
Gorman, C. M.,
L. F. Moffat, and B. H. Howard.
1982.
Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells.
Mol. Cell. Biol.
2:1044-1051[Abstract/Free Full Text].
|
| 17.
|
Gossen, M., and H. Bujard.
1992.
Tight control of gene expression in mammalian cells by tetracycline-responsive promoters.
Proc. Natl. Acad. Sci. USA
89:5547-5551[Abstract/Free Full Text].
|
| 18.
|
Gossen, M.,
S. Freundlieb,
G. Bender,
G. Muller,
W. Hillen, and H. Bujard.
1995.
Transcriptional activation by tetracyclines in mammalian cells.
Science
268:1766-1769[Abstract/Free Full Text].
|
| 19.
|
Ho, Y.-S., and Y. W. Kan.
1987.
In vivo aminoacylation of human and Xenopus suppressor tRNAs constructed by site-specific mutagenesis.
Proc. Natl. Acad. Sci. USA
84:2185-2188[Abstract/Free Full Text].
|
| 20.
|
Hoffman, A.,
G. P. Nolan, and H. M. Blau.
1995.
Rapid retroviral delivery of tetracycline-inducible genes in a single autoregulatory cassette.
Proc. Natl. Acad. Sci. USA
93:5185-5190[Abstract/Free Full Text].
|
| 21.
|
Howe, J. R.,
B. V. Skyrabin,
S. M. Belcher,
C. A. Zerrilo, and C. Schamuss.
1995.
The responsiveness of a tetracycline-sensitive expression system differs in different cell lines.
J. Biol. Chem.
270:14168-14174[Abstract/Free Full Text].
|
| 22.
|
Hudziak, R. M.,
F. A. Laski,
U. L. RajBhandary,
P. A. Sharp, and M. R. Capecchi.
1982.
Establishment of mammalian cell lines containing multiple nonsense mutations and functional suppressor tRNA genes.
Cell
31:137-146[Medline].
|
| 23.
|
Kass-Eisler, A.,
K. Li, and L. A. Leinwand.
1995.
Prospects for gene therapy with direct injection of polynucleotides.
Ann. N. Y. Acad. Sci.
772:232-240[Medline].
|
| 24.
|
Kistner, A.,
M. Gossen,
F. Zimmermann,
J. Jerecic,
C. Ullmer,
H. Lubbert, and H. Bujard.
1996.
Doxycycline-mediated quantitative and tissue-specific control of gene expression in transgenic mice.
Proc. Natl. Acad. Sci. USA
93:10933-10938[Abstract/Free Full Text].
|
| 25.
|
Kluxen, F.-W., and H. Lubbert.
1993.
Maximal expression of recombinant cDNAs in COS cells for use in expression cloning.
Anal. Biochem.
208:352-356[Medline].
|
| 26.
|
Kozak, M.
1994.
Determinants of translational fidelity and efficiency in vertebrate mRNAs.
Biochimie
76:815-821[Medline].
|
| 27.
|
Kunes, S., and H. Steller.
1991.
Ablation of Drosophila photoreceptor cells by conditional expression of a toxin gene.
Genes Dev.
5:970-983[Abstract/Free Full Text].
|
| 28.
|
Laski, F. A.,
R. Belagaje,
U. L. RajBhandary, and P. A. Sharp.
1982.
An amber suppressor tRNA gene derived by site-specific mutagenesis.
Proc. Natl. Acad. Sci. USA
79:5813-5817[Abstract/Free Full Text].
|
| 29.
|
Laski, F. A.,
S. Ganguly,
P. A. Sharp,
U. L. RajBhandary, and G. M. Rubin.
1989.
Construction, stable transformation, and function of an amber suppressor tRNA gene in Drosophila melanogaster.
Proc. Natl. Acad. Sci. USA
86:6696-6698[Abstract/Free Full Text].
|
| 30.
|
Li, K.,
J. Zhang,
M. Buvoli,
X. D. Yan,
L. Leinwand, and H. He.
1997.
Ochre suppressor transfer RNA restored dystrophin expression in mdx mice.
Life Sci.
61:205-209[Medline].
|
| 31.
|
No, D.,
T.-S. Yao, and R. M. Evans.
1996.
Ecdysone-inducible gene expression in mammalian cells and transgenic mice.
Proc. Natl. Acad. Sci. USA
93:3346-3351[Abstract/Free Full Text].
|
| 32.
|
Robinson, D. F., and I. H. Maxwell.
1995.
Suppression of single and double nonsense mutations introduced into the diphtheria toxin A-chain gene: a potential binary system for toxin gene therapy.
Hum. Gene Ther.
6:137-143[Medline].
|
| 33.
|
Shaw, W. V.
1975.
Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria.
Methods Enzymol.
43:737-755[Medline].
|
| 34.
|
Sedivy, J. M.,
J. P. Capone,
U. L. RajBhandary, and P. A. Sharp.
1987.
An inducible mammalian amber suppressor: propagation of a poliovirus mutant.
Cell
50:379-389[Medline].
|
| 35.
|
Shockett, P.,
M. Difillippantonio,
N. Hellman, and D. G. Schatz.
1995.
A modified tetracycline-regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice.
Proc. Natl. Acad. Sci. USA
92:6522-6526[Abstract/Free Full Text].
|
| 36.
|
Shockett, P., and D. G. Schatz.
1996.
Diverse strategies for tetracycline-regulated inducible gene expression.
Proc. Natl. Acad. Sci. USA
93:5173-5176[Abstract/Free Full Text].
|
| 37.
|
Shockett, P., and D. G. Schatz.
1997.
Switching on gene expression.
Nat. Biotechnol.
15:219-221[Medline].
|
| 38.
|
Silberklang, M.,
A. M. Gillum, and U. L. RajBhandary.
1979.
Use of in vitro 32P-labeling in the sequence analysis of nonradioactive tRNAs.
Methods Enzymol.
59:58-109[Medline].
|
| 39.
|
Syroid, D. E.,
R. I. Tapping, and J. P. Capone.
1992.
Regulated expression of a mammalian nonsense suppressor tRNA gene in vivo and in vitro using the lac operator/repressor system.
Mol. Cell. Biol.
12:4271-4278[Abstract/Free Full Text].
|
| 40.
|
Temple, G. F.,
A. M. Dozy,
K. L. Roy, and Y. W. Kan.
1982.
Construction of a functional human suppressor tRNA gene: an approach to gene therapy for -thalassaemia.
Nature (London)
296:537-540[Medline].
|
| 41.
|
Ulmasov, B.,
J. Capone, and W. Folk.
1997.
Regulated expression of plant tRNA genes by the prokaryotic tet and lac repressors.
Plant Mol. Biol.
35:417-424[Medline].
|
| 42.
|
Varshney, U.,
C.-P. Lee, and U. L. RajBhandary.
1991.
Direct analysis of aminoacylation levels of tRNAs in vivo.
J. Biol. Chem.
266:24712-24718[Abstract/Free Full Text].
|
| 43.
|
Wang, Y.,
F. J. DeMayo,
S. Y. Tsai, and B. W. O'Malley.
1997.
Ligand-inducible and liver-specific target gene expression in transgenic mice.
Nat. Biotechnol.
15:239-243[Medline].
|
| 44.
|
Wang, Y.,
B. W. O'Malley, Jr.,
S. Y. Tsai, and B. W. O'Malley.
1994.
A regulatory system for use in gene transfer.
Proc. Natl. Acad. Sci. USA
91:8180-8184[Abstract/Free Full Text].
|
| 45.
|
Yin, D. X.,
L. Zhu, and R. T. Schimke.
1996.
Tetracycline-controlled gene expression system achieves high-level and quantitative control of gene expression.
Anal. Biochem.
235:195-201[Medline].
|
Mol Cell Biol, August 1998, p. 4418-4425, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kohrer, C., Sullivan, E. L., RajBhandary, U. L.
(2004). Complete set of orthogonal 21st aminoacyl-tRNA synthetase-amber, ochre and opal suppressor tRNA pairs: concomitant suppression of three different termination codons in an mRNA in mammalian cells. Nucleic Acids Res
32: 6200-6211
[Abstract]
[Full Text]
-
Sakamoto, K., Hayashi, A., Sakamoto, A., Kiga, D., Nakayama, H., Soma, A., Kobayashi, T., Kitabatake, M., Takio, K., Saito, K., Shirouzu, M., Hirao, I., Yokoyama, S.
(2002). Site-specific incorporation of an unnatural amino acid into proteins in mammalian cells. Nucleic Acids Res
30: 4692-4699
[Abstract]
[Full Text]
-
Silverman, J. A., Harbury, P. B.
(2002). Rapid Mapping of Protein Structure, Interactions, and Ligand Binding by Misincorporation Proton-Alkyl Exchange. J. Biol. Chem.
277: 30968-30975
[Abstract]
[Full Text]
-
Kowal, A. K., Köhrer, C., RajBhandary, U. L.
(2001). Twenty-first aminoacyl-tRNA synthetase-suppressor tRNA pairs for possible use in site-specific incorporation of amino acid analogues into proteins in eukaryotes and in eubacteria. Proc. Natl. Acad. Sci. USA
10.1073/pnas.031488298v1
[Abstract]
[Full Text]
-
Buvoli, M., Buvoli, A., Leinwand, L. A.
(2000). Suppression of Nonsense Mutations in Cell Culture and Mice by Multimerized Suppressor tRNA Genes. Mol. Cell. Biol.
20: 3116-3124
[Abstract]
[Full Text]
-
Kowal, A. K., Kohrer, C., RajBhandary, U. L.
(2001). From the Cover: Twenty-first aminoacyl-tRNA synthetase-suppressor tRNA pairs for possible use in site-specific incorporation of amino acid analogues into proteins in eukaryotes and in eubacteria. Proc. Natl. Acad. Sci. USA
98: 2268-2273
[Abstract]
[Full Text]