This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheriyath, V.
Right arrow Articles by Roy, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheriyath, V.
Right arrow Articles by Roy, A. L.

 Previous Article  |  Next Article 

Mol Cell Biol, August 1998, p. 4444-4454, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

TFII-I Regulates Vbeta Promoter Activity through an Initiator Element

Venugopalan Cheriyath, Carl D. Novina, and Ananda L. Roy*

Department of Pathology and Program in Immunology, Tufts University School of Medicine, Boston, Massachusetts 02111

Received 25 February 1998/Returned for modification 4 May 1998/Accepted 8 May 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In our effort to understand the transcriptional regulation of naturally occurring TATA-less but initiator (Inr)-containing genes, we have employed the murine T-cell receptor Vbeta 5.2 promoter as a model. Here we show by transient-transfection assays that the Inr binding transcription factor TFII-I is required for efficient expression of the Vbeta promoter in vivo. Mutations in the Inr element that reduced binding of TFII-I also abolished the Vbeta promoter activity by ectopic TFII-I. We further biochemically identified a protease-resistant N-terminal DNA binding fragment of TFII-I, p70. When ectopically expressed, recombinant p70 bound to the Vbeta Inr element with a specificity similar to that of wild-type TFII-I. More importantly, p70, which lacks independent activation functions, behaved as a dominant negative mutant that inhibited Inr-specific function of wild-type TFII-I. However, the activation functions of p70 were restored when fused to the heterologous activation domain of the yeast activator protein GAL4. Taken together, these data suggest that TFII-I functions in vivo require an intact Inr element and that the Inr-specific transcriptional functions of TFII-I are solely dictated by its N-terminal DNA binding domain and do not require its own C-terminal activation domain.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Transcription initiation in metazoan genes is directed by the core promoter elements that comprise the TATA box and/or the pyrimidine-rich initiator (Inr) element (36). The heterogeneity in core promoter elements might allow alternate initiation pathways in response to specific regulatory factors in various cellular responses. Thus, it has been shown that specific TATA elements (10, 14, 40, 48) or specific Inr elements (9, 12, 17) are important for certain responses, and substitution of one element for another may in fact result in deregulation and loss of developmental or cell-type specificity (reviewed in reference 31).

The TATA-directed basal (activator-independent) transcription (6, 33) begins with TATA recognition by the TATA-binding protein component of transcription factor TFIID. This step is sufficient to nucleate the assembly of additional general transcription factors and RNA polymerase II into a functional complex (5, 36). However, the corresponding pathways for Inr-directed basal transcription appears to be more complex and less well understood (13, 36). The Inr-mediated basal transcription requires several factors, including TBP-associated factors (TAFs), that are not required for TATA-directed basal transcription (30, 36). Some of these factors were also shown to be required for Inr function in conjunction with TATA elements (24, 30) and in conjunction with known or inferred distal regulatory elements (29, 42); however, the latter studies could not distinguish general TAF requirements for activator functions as observed for TATA-containing promoters (36, 47).

Three distinct models have been proposed for Inr recognition in the absence of a TATA box. One model proposes direct recognition of the Inr by a TAF component and an adjacent downstream promoter element when present (3, 4, 46), followed by stable TFIID binding and subsequent preinitiation complex assembly. However, at least in mammalian promoters, the TAFs do not appear to show any sequence specific interactions at the Inr element (24, 36). Moreover, unlike initial expectations TAFII150 is clearly not involved in direct Inr recognition (25). A second model proposes that recognition of the Inr by independent Inr binding proteins, followed by secondary interactions with TFIID or associated factors, nucleates assembly of the general transcription factors at the core promoter. Consistent with the latter model, several factors have been shown to bind at an Inr element or sites adjacent to it (43). Yet a third model proposes recognition of Inr by RNA polymerase II in the absence of both TAFs and independent Inr binding proteins (49). These observations could reflect diversity in core promoter Inr elements and corresponding interactions, especially in light of the loose consensus sequence for such elements (21, 36). Given such a diverse set of results, it is clear that identification and characterization of the protein factors directly involved in Inr function not only in vitro but also in vivo are required to clarify the issue.

Our current studies are directed toward resolving this problem, with emphasis on Inr function in vivo in the absence of TATA elements. In our effort to understand the transcriptional regulation of the TATA-less, Inr-containing (TATA- Inr+) genes in general, we have employed the murine Vbeta 5.2 promoter as a model (1). In earlier studies we identified a multifunctional transcription factor, TFII-I, that binds at and functions through pyrimidine-rich Inr elements (22, 37, 38) and was critically required for the transcription of the Vbeta promoter in vitro (29, 32). Consistent with its multifunctional potential, recent cDNA cloning and functional expression of recombinant TFII-I demonstrated that TFII-I functions as a basal factor through the Inr element in a TATA- and Inr-containing promoter (39) and as an activator through upstream promoter elements in the absence of a functional Inr (15, 26, 39). These observations suggest that TFII-I is a novel factor that is capable of mediating communication between the regulatory and basal components in a eukaryotic gene (15, 26, 39). More surprisingly, TFII-I has also been cloned as a factor (BAP-135) that is tyrosine phosphorylated and interacts with the B-cell-specific Bruton's tyrosine kinase (50) and as a functional gene that is deleted in William's syndrome (34). In this study we demonstrate that in in vivo (transient-transfection) assays ectopically expressed wild-type TFII-I markedly activates the Vbeta promoter in an Inr-dependent fashion. Furthermore, we have biochemically identified and ectopically expressed a DNA binding fragment of TFII-I (p70) that exhibits specific Inr binding properties in vitro but lacks the Inr-dependent transcriptional activation in transient-transfection assays. As expected, given these properties, the p70 mutant behaves in a dominant negative fashion when coexpressed with the wild-type TFII-I. However, the Inr-specific activation functions of p70 can be restored when the activation domain of GAL4 is fused to it. Together, these data clearly demonstrate that TFII-I functions through the Inr element and address for the first time the transcriptional functions of an Inr binding protein on a naturally TATA- Inr+ promoter in vivo.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell culture. COS7 cells were grown in Dulbecco's modified Eagle medium (DMEM; Cellgro) containing 10% fetal bovine serum (FBS; Sigma), 50 U of penicillin per ml, and 50 µg of streptomycin (GIBCO BRL) per ml at 37°C under 5% CO2.

Plasmids and antibody. (i) TFII-I derivatives. The eukaryotic expression vector pEBGII-I (pEBG containing TFII-I cDNA) is derived from pEBG (44), in which the human EF-1alpha promoter drives the expression of protein fused to glutathione S-transferase (GST). To construct pEBGII-I, the open reading frame for TFII-I plus the hexa-histidine tag was isolated from pET11d-II-I (39) by NcoI and ClaI digestion. A BamHI linker was ligated to the NcoI end, and the whole fragment was inserted in frame between the BamHI and ClaI site of pEBG. GST-p70 was made by introducing a stop codon after amino acid (aa) 735 by PCR-based mutagenesis. The region between aa 606 and aa 735 was PCR amplified from pEBGII-I by using 5' GTTGTTAAAAAACCTGAACTAG 3' and 5' GTAAATCGATCTAACCCTCAGGTA 3' as primers. The amplified fragment was gel isolated and restricted with SpeI and ClaI. The digested product was then ligated into pEBGII-I. The bacterial p70 expression construct pET11d-p70 was made as follows. The region between aa 606 and aa 735 was PCR amplified from pET11d-II-I by using 5' GTTGTTAAAAAACCTGAACTAG 3' and 5' AATCCTAGGTATCGATACTAACC 3' as primers. The PCR product was gel purified, digested with SpeI and AvrII and then ligated to pET11d-II-I. To generate the expression plasmid p70-GAL4ADII, the activation domain II (aa 768 to 881) of GAL4 was PCR amplified from pMA242 (28) by using the primers 5' GGACCTGAGGGTTTTAATCAAAGTGGGAAT 3' and 5' ATATGCGGCCGCTATTACTCTTTTTTTGG 3'. The PCR-amplified cDNA was gel purified and digested with AocI and NotI and then ligated with GST-p70 at aa 735. The plasmid containing the C-terminal 280 aa of TFII-I (aa 677 to 957) fused to GAL4 DNA binding domain (aa 1 to 147) was generated as follows. The C280 TFII-I was PCR amplified by using the primers 5' GGGGATCCGTGTGCCATTCCGA 3' and 5' GGGATCTAGAGCTACCACGTGG 3'. The PCR-amplified product was gel purified, digested with BamHI and XbaI, and then ligated in frame with GAL4 DNA binding domain in pSG424 plasmid (a gift from Brent Cochran).

(ii) Vbeta reporters. The plasmid containing the Vbeta FL-Luc was made by PCR amplification of the region between -473 and 9 of the Vbeta 5.2 promoter by using 5' GGGATAAGATCTCCAGGTGGCGCTGTGGAC 3' and 5' GGGTAAGCTTCGGCTCCTCCTTTCTC 3' as primers from PGL2Vbeta 5.2-Luc (a gift from Michael Meisterernst). The PCR-amplified product was gel purified, digested with HindIII and BglII, and then ligated with PGL3-Basic (Promega Corp.). The truncated Vbeta promoter, Vbeta Delta 61-Luc, with an intact decamer element (Deca) (2), was constructed by PCR amplifying the specified regions (-61 to 9) from Vbeta FL-Luc. The PCR primers used were 5' GGGAGATCTAGAACCTGACAT 3' and 5' GGGAGGCTTGAGAAAGTGAGAGT 3'. The initiator mutant containing plasmids Vbeta FLMut-Luc and for Vbeta Delta 61Mut-Luc was generated by PCR-directed mutagenesis. For Vbeta FLMut-Luc 5' GGGATAAGATCTCCAGGTGGCGCTGTGGAC 3' and 5' AGGCTTGAGCCCCTGAGCGTCGG 3' were used as primers, and for Vbeta Delta 61Mut-Luc 5' GGGAGATCTAGAACCTGACAT 3' and 5' AGGCTTGAGCCCCTGAGCGTCGG 3' were used as primers. The amplified PCR fragments were gel purified, digested with HindIII and BglII, and ligated with PGL3-Basic. All clones were confirmed by sequencing.

The anti-TFII-I antibody used in this study was as described previously (29, 32).

(iii) Eukaryotic expression and purification of TFII-I. For eukaryotic expression of TFII-I, COS7 cells were transfected with pEBGII-I. Transfections were carried out by the Lipofectamine method according to the manufacturer's protocol (GIBCO BRL). For transfection, 10 µg of expression plasmid (pEBGII-I) was used per 100-mm-diameter plate. At 36 h posttransfection, cells were harvested, washed twice in phosphate-buffered saline (PBS), and lysed by sonication in 2 ml of ice-cold BC500 buffer (20 mM Tris-HCl [pH 7.9], 500 mM KCl, 20% glycerol) containing 0.1% Nonidet P-40 and protease inhibitors (1 mM phenylmethylsulfonyl fluoride; 1% aprotinin, leupeptin, and antipain; and soybean trypsin inhibitor at 1 µg/ml). The lysate was clarified by centrifugation for 30 min at 12,000 rpm at 4°C. The GST-hexahistidine tag TFII-I protein was purified by loading the lysate on a 1-ml Ni2+-agarose (Invitrogen) column at 4°C. The column was washed sequentially with 5 column volumes of BC500 (without protease inhibitors and Nonidet P-40) containing 20 and 80 mM imidazole, respectively. Finally, the tagged fusion protein was eluted with 3 column volumes of BC500 containing 200 mM imidazole. The TFII-I-containing peak fractions were pooled, dialyzed against buffer B (20 mM Tris-HCl [pH 7.9], 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 10% glycerol) with 100 mM KCl (B100), and loaded onto a Hitrap SP column (Pharmacia). The Hitrap column was washed sequentially with 5 column volumes of B100 and B200 (buffer B with 200 mM KCl) and eluted with 3 column volumes of B500 (buffer B with 500 mM KCl).

Purification of bacterially overexpressed p70. p70 was overexpressed in the bacterial strain BL21(DE3) pLysS (Stratagene) and purified over Ni2+ as described previously (39).

EMSA. The electrophoretic mobility shift assays (EMSAs) shown in Fig. 1, 3, and 5 were performed with an Inr probe (-28 to 12) derived from the Vbeta promoter (29). The probes in Fig. 2 were derived as follows. A 109-bp DNA fragment (-100 to 9) containing wild-type Inr or the Inr mutant was isolated from Vbeta Delta 100Luc or Vbeta Delta 100Mut-Luc by digesting the plasmid with HindIII and BglII. The fragment was gel purified and labeled with [alpha -32P]dATP (3,000 Ci/mmol), [alpha -32P]dTTP (3,000 Ci/mmol), and Klenow fragment. The EMSA and electrophoresis were done as described previously (29, 32).

Western blot analysis. Either purified TFII-I or extracts were subjected to sodium dodecyl sulfate (SDS)-7.5% polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose by the semidry blotting method in a buffer containing 0.192 M glycine, 0.025 M Tris base, and 20% methanol. The blot was blocked in Tris-buffered saline (10 mM Tris [pH 8.0], 150 mM NaCl) with 6% nonfat dry milk (Carnation). The primary (anti-TFII-I, 1:2,500 dilution) and secondary (1:1,500 dilution) anti-rabbit horseradish peroxidase-linked antibodies were incubated in Tris-buffered saline containing 0.05% Tween 20.

In vitro transcription. The nuclear extract was prepared as described previously (8) and was either mock depleted with preimmune serum or immunodepleted with anti-TFII-I antibody (29). Native (20 ng) or recombinant (60 ng) TFII-I was added as indicated. Processing of the transcription reactions was as described previously (29).

Transient-transfection and luciferase assay. One day before transfection, COS cells at 80 to 90% confluency (in 60-mm plates) were trypsinized for 15 min with 2 ml of trypsin, and the volume was increased to 10 ml with DMEM containing 10% FBS. A 200-µl cell suspension was seeded into each well of a six-well plate. Transfection was done with Lipofectamine as suggested by the manufacturer (GIBCO BRL) with the following modifications. In an Eppendorf tube, various reporter plasmids with or without different TFII-I expression constructs and 1 µg of renilla luciferase plasmid (pRL-TK; Promega Corp) were mixed. The total amount of DNA in each experiment was equalized with empty vector pEBB (44). The final volumes were adjusted to 100 µl with Optimem. In a separate Eppendorf tube, 15 µl of Lipofectamine was mixed with 85 µl of Optimem. The plasmid-containing medium was mixed with the Lipofectamine-containing medium and then incubated at room temperature for 45 min to allow the formation of DNA-lipid complex, during which the cells were washed twice with PBS. At the end of the incubation period, the DNA-lipid complex was diluted with 800 µl of Optimem, and the mixture was added to the cells and incubated overnight in a CO2 incubator at 37°C. After 12 to 14 h, 2 ml of DMEM containing 22.5% FBS was added to each of the cells and incubated an additional 8 h. The cells were then treated with fresh medium containing 15% serum. At 36 h posttransfection, the cells were washed twice in PBS and then lysed, and the luciferase activities were determined. Luciferase activities in the transfected cells were determined according to the manufacturer's protocol (Dual luciferase assay; Promega Corp). Cells were lysed in 500 µl of passive lysis buffer and centrifuged at 14,000 rpm (4°C) for 2 min, and the supernatant was collected. A 10-µl portion of the supernatant was mixed with 50 µl of luciferase assay reagent II for 10 s, and the luciferase activity was determined. Then, to normalize the transfection efficiency, 50 µl of stop-and-glow buffer was added, and the renilla luciferase activity was determined.

Protease treatment and N-terminal sequencing of TFII-I. Approximately equal amounts of highly purified native and recombinant TFII-I (40 to 60 ng) were digested with 1 CLU of thrombin or V8 protease (7.5 ng) by incubation at room temperature for the indicated time. At the end of the incubation, the digestion was stopped by adding the SDS loading buffer, and the digested product was analyzed on a 7.5% SDS gel and immunoblotted with an anti-TFII-I antibody or silver stained according to the manufacturer's directions (Pharmacia Biotech). For N-terminal sequencing the digested product was transferred onto polyvinylidene difluoride membrane and stained with Coomassie blue. The 70- and 43-kDa bands were cut out and subjected to N-terminal microsequencing at the Tufts University sequencing facility.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Ectopic expression of a transcriptionally competent TFII-I in mammalian cells. To demonstrate the DNA binding and transcriptional activity of recombinant TFII-I, it was ectopically expressed in and purified from COS cells. For this purpose, we constructed a cDNA encoding a 146-kDa GST-TFII-I fusion protein that is readily distinguished from the endogenous 120 kDa TFII-I. In addition to the GST moiety, p146 also contained the hexa-histidine tag, thus allowing rapid purification. Figures 1A and B show, respectively, the expression and purification of GST-TFII-I (p146), which was monitored both by silver staining (Fig. 1A) and by Western blot analysis with an anti-TFII-I antibody (Fig. 1B). A purified p146 preparation bound to the Vbeta Inr probe, resulting in a lower mobility shift than the native TFII-I (Fig. 1C). Most importantly, the Inr element binding specificity of the recombinant protein was similar to that of the native protein, as evidenced by the competition assay (Fig. 1C), and the DNA-protein complex was abrogated by anti-TFII-I antibody (data not shown). Finally, we tested the transcriptional properties of p146 in a TFII-I immunodepleted nuclear extract. p146 was fully capable of restoring Vbeta transcription in this extract and thus demonstrated functional properties similar to those of native TFII-I (Fig. 1D) (29). Furthermore, Vbeta transcription reconstituted with p146 was inhibited by preincubation of p146 with an oligonucleotide containing the wild-type Vbeta Inr sequence, which specifically binds p146 but not by preincubation with an oligonucleotide containing a mutant Inr sequence (data not shown), suggesting that the Inr binding capabilities of TFII-I were required for its transcription function in vitro. Thus, these results demonstrate that the eukaryotically expressed recombinant TFII-I behaves in a fashion similar to the native protein both in DNA binding and in in vitro transcription assays.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1.   Eukaryotically expressed recombinant TFII-I has DNA binding and transcriptional properties similar to native TFII-I. Silver stain (A) and Western blot (B) analyses with the anti-TFII-I antibody comparing the relative mobility and purity of the native, purified TFII-I (lane 1) to those of the recombinant protein (p146) at all stages of purification (lanes 2 to 5). Mock lysate was derived from COS cell extracts after transfection with the vector alone. Positions of GST-TFII-I (p146) and native TFII-I (p120) are indicated. (C) EMSA with Vbeta Inr to demonstrate that the GST-TFII-I has a binding specificity similar to that of purified TFII-I. While GST cannot bind the Vbeta Inr element (lane 2), purified TFII-I and the recombinant TFII-I (GST-TFII-I) can bind to the Vbeta Inr element (lanes 3 and 4). The binding of p146 can be competed with a 15-fold excess of wild type (WT) but not with a mutant (Mut) Vbeta Inr containing oligonucleotide (lanes 5 and 6). (D) Vbeta transcription is observed in the mock-treated Jurkat nuclear extract (lane 1) but not in an anti-TFII-I antibody-treated Jurkat nuclear extract (alpha -TFII-I; lane 2); it can, however, be reconstituted by adding back either GST-TFII-I (lane 3) or native TFII-I (lane 4).

Functional interactions of TFII-I with the Vbeta Inr element in COS cells. To ascertain the minimum promoter region that is required to mediate transcriptional response of ectopically expressed TFII-I (146 kDa) and to discriminate between its upstream-sequence-dependent and -independent (basal) functions, we initially generated two Vbeta promoter templates each fused to the luciferase gene. The first contained the full-length Vbeta promoter (-476 to 9, Vbeta FL), and the second contained only 61 nucleotides from the start site (-61 to 9, Vbeta Delta 61). Furthermore, sequences located 3' of the Inr were removed in both cases to minimize confusion due to TFII-I interactions with downstream promoter elements (3, 4). To show Inr-specific transcription functions of TFII-I in vivo at the Vbeta promoter, the Inr elements in the Vbeta FL and Vbeta Delta 61 minimal promoters were also mutated. The specific mutations introduced within the consensus Inr sequence were known to disrupt the basal Inr function (21). The schematic representation of these reporters is shown in Fig. 2A.


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2.   Initiator-dependent transcriptional activation of the Vbeta promoter by TFII-I. (A) The architecture of full-length Vbeta (Vbeta FL-Luc) and truncated Vbeta luciferase (Vbeta Delta 61-Luc) promoter constructs with wild type (WT) or mutant (Mut) initiator sequences are shown on the left. The binding sites for various transcription factors are indicated. Deca denotes the conserved decamer sequence that is present in all Vbeta promoters (1). COS7 cells were transiently transfected with 1 µg of either the wild-type (lanes 3 and 4) or the mutant (lanes 5 and 6) Vbeta FL-Luc plasmids in the presence (lanes 4 and 6) or in the absence (lanes 3 and 5) of 350 ng of TFII-I expression plasmid pEBGII-I. For the Vbeta Delta 61-Luc wild-type (lanes 7 and 8) or mutant (lanes 9 and 10) plasmids, 75 ng was used for cotransfection in the presence (lanes 8 and 10) or absence (lanes 7 and 9) of 350 ng of pEBGII-I. Lanes 1 and 2 represent the cotransfection of control plasmids (PGL3-Basic) with or without pEBGII-I. To equalize the total amount of DNA, 350 ng of empty vector (pEBB) was added in lanes with TFII-I. The experiments represent five (for lanes 1 to 6) and three (for lanes 7 to 10) independent transfection assays. The fold activation was calculated by normalizing the basal promoter activity of either the full-length or the truncated promoter to 1. The absolute values were twofold lower for the Vbeta Delta 61-Luc promoter than the Vbeta FL-Luc promoter. (B) EMSA showing that Vbeta initiator mutation reduces the binding of TFII-I. Equal counts (approximately 60,000 cpm) of Vbeta wild-type (WT) (lanes 1 to 3) and Vbeta mutant (Mut) (lanes 4 and 5) probes were used per reaction. Lanes 2, 3, and 5 contained TFII-I. Lane 3 also contained affinity-purified anti-TFII-I antibody. (C) Western blot showing the expression of recombinant TFII-I (p146) in transient-transfection experiments. COS cell lysates (5 µg) from Vbeta FL-Luc only (lane 2) or Vbeta FL-Luc+pEBGII-I (lane 3) transfections were subjected to Western blot analysis with an anti-TFII-I antibody. Native TFII-I (p120) was used as a positive control (lane 1).

For all transient-transfection studies, we employed COS7 cells since these cells exhibited very low endogenous levels of TFII-I (e.g., see Fig. 2C). GST-TFII-I (146 kDa) was used as the wild-type TFII-I for all transfection experiments. Cotransfection of TFII-I with the full-length Vbeta reporter resulted in a significant stimulation of the promoter activity (ca. fivefold) compared to the basal Vbeta promoter activity (Fig. 2A, lane 3 versus lane 4). While cotransfection of TFII-I with Vbeta FL resulted in fivefold induction, cotransfection of TFII-I with the Inr mutated promoter resulted in no significant stimulation over the basal levels (Fig. 2A, lane 5 versus lane 6). The Inr mutation resulted in a 40% reduction in basal promoter activity in the absence of ectopic TFII-I, suggesting that the Inr mutation does not render the promoter completely inactive (Fig. 2A, compare lanes 3 and 5). Cotransfection of TFII-I with the Vbeta Delta 61 minimal promoter containing either a wild-type or a mutated Inr was also performed. Significant levels of TFII-I-dependent activation (nearly fourfold, compare lanes 7 and 8) was observed with the promoter containing an intact Inr, strongly suggesting that TFII-I functions do not require upstream regulatory elements. More importantly, mutations in the Inr element in the Vbeta Delta 61 reporter construct resulted in a complete abrogation of TFII-I-dependent activation (Fig. 2A, compare lanes 9 and 10).

In order to demonstrate that mutations in the Vbeta Inr element that affect transactivation functions of TFII-I also reduce or abolish its binding, EMSAs were performed with the wild-type and Inr mutant promoters (Fig. 2B). For this experiment, we used a probe that was derived from the Vbeta promoter and that contained sequences from -100 to 9. While a highly purified preparation of TFII-I bound to an intact Inr element (Fig. 2B, lane 2), the binding of TFII-I to the mutant Inr probe is nearly abrogated (about fivefold less as revealed by densitometric measurements) (Fig. 2B, lane 5). That the shifted complex contains authentic TFII-I was also verified by using an affinity-purified anti-TFII-I antibody that abolished TFII-I binding (lane 3). These data suggested that, despite the presence of multiple upstream elements in the probe, TFII-I binds exclusively and specifically to the Vbeta Inr element and that the same Inr mutations that drastically reduces binding of TFII-I also drastically reduces TFII-I-dependent activation of the promoter in transient-transfection assays. Finally, to demonstrate that TFII-I (p146) is expressed ectopically under the transfection conditions, Western blotting was performed with an anti-TFII-I antibody (Fig. 2C, lane 3). When compared to a purified native TFII-I preparation (lane 1), even though the levels of expression of endogenous TFII-I (120 kDa) in COS cells were below detectable levels (lane 2), p146 was efficiently expressed under our transfection conditions (lane 3). These data indicate that although the basal promoter activity (in the absence of ectopic TFII-I) was twofold lower with Vbeta Delta 61 compared to the Vbeta FL promoter, ectopic-TFII-I-dependent activation of the Vbeta promoter does not depend on the presence of either upstream activating sequences or downstream promoter elements, suggesting that TFII-I functions through the core Vbeta promoter (-61 to 9) in vivo. Furthermore, because TFII-I-dependent transcriptional activation of the Vbeta promoter is directly correlated to the specific binding of TFII-I to its Inr element, the transcriptional activity of ectopically expressed TFII-I at the Vbeta promoter requires an intact Inr element, strongly suggesting that TFII-I functions directly through the Inr.

Isolation of the DNA binding fragment of TFII-I by limit proteolysis. Limited proteolysis is a classical biochemical method to identify structural domains within a large multidomain protein (11, 20, 23). To identify the DNA binding fragment of TFII-I, we employed limited proteolysis in order to separate the protease-resistant versus protease-sensitive domains and to select the potential DNA binding domain of TFII-I. Thrombin digestion of native, purified TFII-I was performed for various times, and the proteolyzed products were analyzed by DNA binding assays (Fig. 3). Thrombin treatment of native TFII-I prior to the DNA binding reaction resulted in a shifted complex with higher mobility compared to the untreated-gel-shifted complex in a time-dependent fashion (Fig. 3A). This complex was stable and protease resistant even after 1 h of thrombin treatment (data not shown). Moreover, when thrombin treatment was carried out subsequent to the DNA binding reaction, the DNA-bound TFII-I gave the same pattern as did the unbound TFII-I (Fig. 3B), suggesting that DNA binding does not induce any significant conformational changes.


View larger version (56K):
[in this window]
[in a new window]
 
FIG. 3.   Protease-resistant DNA binding fragment of TFII-I. (A) EMSA demonstrating that the thrombin-resistant fragment of TFII-I exhibits DNA binding activity. Purified TFII-I (lane 1) was treated with 1 CLU of thrombin at room temperature for 0 to 40 min (lanes 2 to 5). At the end of the digestion the reaction mixture was incubated with an oligonucleotide containing the wild-type Vbeta Inr at 30°C for 20 min. (B) DNA binding by TFII-I does not induce conformation changes. Purified TFII-I was incubated with the Vbeta Inr containing oligonucleotide at 30°C for 20 min and digested with 1 CLU of thrombin at room temperature either for 0 (lane 2) or 30 (lane 3) min.

We also tested the proteolyzed products by SDS-PAGE and visualized them either by Western blotting or silver staining (Fig. 4A and B). Thrombin cleavage of either the recombinant 146-kDa (Fig. 4A, lane 1) or the native 120-kDa (lane 5) TFII-I yielded a protease-resistant band that migrated with a relative molecular mass of about 70 kDa (henceforth referred to as p70) and immunoreactive to the anti-TFII-I antibody. A band migrating at about 100 kDa was also apparent at earlier time points of digestion (lanes 2, 3, and 6) but which disappeared at later time points (lanes 4, 7, and 8). In order to test whether protease-resistant fragments could be generated by treatment with another protease, V8 protease was employed to cleave TFII-I (Fig. 4B). Limiting digestion of either the native 120-kDa (lane 1) or the recombinant 146-kDa (lane 4) TFII-I with V8 yielded a protease-resistant fragment with an apparent molecular mass of about 102 kDa that was also recognized by the anti-TFII-I antibody and was competent in DNA binding (data not shown). Because the anti-TFII-I antibody was raised against a synthetic peptide corresponding to aa 301 to 320 in TFII-I (38), we projected that the C-terminal fragments may not be visualized by the antibody. A homogeneous preparation of TFII-I (Fig. 4C, lane 1) was subjected to thrombin digestion for 20 min, and the derived products were then visualized by silver staining (Fig. 4C, lane 2). In addition to the 100- and 70-kDa bands that were also seen by Western blot analysis, a 43-kDa band was visualized (lane 2). Identical patterns were also observed with both bacterially expressed and eukaryotically expressed recombinant TFII-I (data not shown). It is likely that the 43-kDa band was derived from the C-terminal end of TFII-I and thus was not recognized by the antibody.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4.   Protease treatment cleaves TFII-I into two fragments. (A) Western blot analysis with anti-TFII-I antibody showing the formation of a 70-kDa fragment (p70) by treating either GST-TFII-I (lanes 1 to 4) or native TFII-I (lanes 5 to 8) with 1 CLU of thrombin for 30 min at room temperature. The formation of 100- and 70-kDa products are indicated. (B) Western blot analysis with anti-TFII-I antibody to show the formation of a protease-resistant 102-kDa polypeptide (arrow) by treating either native TFII-I (lanes 1 to 3) or GST-TFII-I (lanes 4 to 6) with V8 protease at room temperature for 0 to 30 min. (C) Silver staining of native homogeneous TFII-I before (lane 1) and after (lane 2) thrombin digestion for 20 min. The 100-, 70-, and 43-kDa fragments are indicated. (D) Diagram of TFII-I. The positions of the direct repeats (R1 to R6) are indicated. The arrow indicates the major thrombin cleavage site at aa 677 between repeats 4 and 5 (based on N-terminal sequencing).

To confirm the identities of these products, the 70- and 43-kDa bands resulting from thrombin digestion of both the native and the recombinant preparations of TFII-I were subjected to N-terminal sequencing. Sequencing revealed that the p70 fragment derived from the recombinant protein contained an additional 3 aa (GSH) at its N terminus derived from the hexa-histidine tag. These results suggested that regardless of the source of TFII-I and whether a tag is present or absent at the N terminus, the p70 fragment is folded in a compact configuration that is still resistant to protease. The p43 fragment from both sources gave identical sequence information that indicated the thrombin cleavage site to be at aa 677 from the N terminus and in between repeats 4 and 5 (Fig. 4D). Thus, despite the presence of 56 potential thrombin cleavage sites within the TFII-I sequence, only one major site in between repeats 4 and 5 appears to be being used that separates the protein essentially into two fragments: an N-terminal fragment containing 677 aa and repeats 1 through 4 (p70) and a C-terminal fragment containing 280 aa and repeats 5 and 6 (p43). p70 seems to retain the DNA binding domain, since it is being recognized by the antibody both in Western blot (Fig. 4A) and EMSA analyses (data not shown). The summary of N-terminal sequencing results is shown in Fig. 4D.

Generation of recombinant p70 in bacteria. To directly demonstrate that p70 indeed contains the DNA binding domain of TFII-I, a cDNA encoding aa 1 to 735 was subcloned into a bacterial expression vector that adds a hexa-histidine tag to the N terminus of the protein. Although the p70 generated by proteolysis contained 677 aa, for the sake of cloning convenience our recombinant p70 construct contained 58 extra aa at the C-terminal end. The expressed protein was purified from crude bacterial lysate by binding to an Ni2+-agarose column. The purified recombinant p70 protein (Fig. 5A, lane 1) was subjected to Western blot analysis and compared to a native 120-kDa TFII-I (lane 2). To demonstrate that recombinant p70 contained the DNA binding domain, it was compared by EMSA to the native TFII-I before and after thrombin cleavage (Fig. 5B). The mobility of the p70 fragment (lane 3) generated from thrombin cleavage of the native TFII-I (lane 2) was similar to the mobility of the recombinant p70 (lane 4). Furthermore, the p70 gel-shifted complex was completely abrogated in the presence of an affinity-purified anti-TFII-I antibody (Fig. 5C, compare lanes 3 and 4) and is specific since it could be competed strongly by an oligonucleotide containing the wild-type Vbeta Inr sequence (lane 5) but very weakly by an oligonucleotide that contains the mutated Vbeta Inr element (lane 6). We concluded that p70 contains the DNA binding domain of TFII-I and is sufficient to impart Inr specificity and that the C-terminal portion of TFII-I is dispensable for its DNA binding activity.


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 5.   Expression and DNA binding specificity of recombinant p70. (A) Western blot analysis with anti-TFII-I antibody of a native purified TFII-I (lane 1) and the bacterially expressed recombinant p70 (lane 2). (B) EMSA demonstrates that the native TFII-I (lane 2), when treated with thrombin, generated a complex (lane 3) that has mobility comparable to the mobility of the complex derived from the recombinant p70 (lane 4). (C) EMSA demonstrates that purified TFII-I (lane 2) and recombinant p70 (lane 3) can bind to the Vbeta Inr element comparably. Anti-TFII-I antibody blocked the binding of recombinant p70 (lane 4), and the binding of recombinant p70 can be competed with a 15-fold molar excess of wild type (lane 5), but not with a mutant Inr-containing oligonucleotide (lane 6).

p70 lacks independent activation potential and inhibits wild-type TFII-I function. To determine the transcription functions of recombinant p70, we employed the transient-transfection assay in COS7 cells. For ectopic expression of p70, we used a construct that would produce a GST-p70 (96 kDa) fusion protein (Fig. 6A). Whereas the wild-type TFII-I stimulated the Vbeta FL promoter by about fourfold (Fig. 6B, compare lanes 3 and 4), p70 alone did not activate this promoter (compare lanes 3 and 5). Cotransfection of both TFII-I and p70 resulted in a complete abrogation of the Vbeta transcriptional activation (compare lanes 4 and 6). These results suggested that p70 lacks the transcription activation potential and that the C-terminal 280 aa might constitute or contain an activation domain. In order to test this hypothesis, we fused a heterologous activation domain of the yeast activator protein GAL4 (activation domain II, aa 768 to 881 [29, 45]) to p70 (p70-GAL4ADII [Fig. 6A]). As seen in Fig. 6C, while p70 failed to stimulate the Vbeta promoter on its own (compare lanes 3 and 5), the p70-GAL4ADII fusion protein stimulated the Vbeta promoter nearly as much as had the wild-type TFII-I (compare lanes 4 and 6), suggesting that p70 indeed lacked an activation domain. As expected, unlike p70 p70-GAL4ADII did not inhibit the wild-type TFII-I function when coexpressed (data not shown). Furthermore, the transcriptional activation by p70-GAL4ADII required an intact Inr element (Fig. 6D) since significant activation was only observed with a wild-type Vbeta promoter (compare lanes 3 and 4) but not with an Inr mutant Vbeta promoter (compare lanes 5 and 6). Finally, to demonstrate that the various TFII-I expression constructs do express the respective proteins in comparable amounts in vivo under our transfection conditions, a Western blot was performed with the lysates expressing the empty vector (lane 1), the Vbeta promoter alone (lane 2), or the Vbeta promoter with GST-TFII-I (lane 3), GST-p70 (lane 4), GST-TFII-I+GST-p70 (lane 5), or p70-GAL4ADII (lane 6) and probed with an anti-TFII-I antibody (Fig. 6E). The various TFII-I derivatives are expressed at comparable levels under our assay conditions either individually (lanes 3, 4, and 6) or in combination (lane 5). Taken together, these results suggest that (i) TFII-I is composed of essentially two domains, the N-terminal portion containing a compact, protease-resistant DNA binding domain (p70) and the C-terminal portion required for transcriptional activation functions; (ii) p70, independently, does not activate the Vbeta promoter in transient-transfection assays and behaves as a dominant negative when coexpressed with the wild-type TFII-I; and (iii) when fused with a heterologous activation domain of yeast activator GAL4, p70 shows an Inr-specific transcription function comparable to that of the wild-type TFII-I. Therefore, the Inr-dependent function of TFII-I is solely dictated by its DNA binding specificity.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6.   p70 lacks independent transactivation function and behaves as a dominant negative in transient-transfection assays. (A) Diagrams showing p70 and p70 fused to the GAL4 activation domain II (p70-GALADII). (B) COS7 cells were transiently transfected with either 1 µg of PGL3-Basic as a control (lanes 1 and 2) or 1 µg of Vbeta FL-Luc promoter (lanes 3 to 6) in the presence of 350 ng of pEBGII-I (lanes 2 and 4), 500 ng of p70 (lane 5), or both (lane 6). (C) The transactivation potentials of p70 can be rescued by fusion of a heterologous GAL4 activation domain to p70. Lanes 1 to 5 are the same as in panel B. Lane 6 contains 250 ng of the p70-GAL4ADII expression plasmid. The activation by p70-GAL4ADII is comparable to that of wild-type TFII-I (lane 4). (D) p70-GAL4ADII activates Vbeta promoter in an initiator-specific manner. COS7 cells were transiently transfected with 1 µg of either wild-type (lanes 3 and 4) or mutant (lanes 5 and 6) Vbeta FL-Luc promoter in the presence (lanes 4 and 6) or absence (lanes 3 and 5) of 250 ng of p70-GAL4ADII. Lanes 1 and 2 represent the cotransfection of PGL3-Basic with or without p70-GAL4ADII. The total amounts of DNA in experiments as indicated in panels B, C, and D were equalized by the addition of empty vector (pEBB), and the results represent an average of three independent experiments. The fold activation was calculated by normalizing the Vbeta FL-Luc promoter activity to 1. (E) Western blot analysis of lysates from transfection assays to show the comparable expression of various TFII-I derivatives in our transient-transfection assays. Equal amounts of lysate (5 µg of total protein) transfected with PGL3-Basic (lane 1), Vbeta FL-Luc alone (lane 2), or Vbeta FL-Luc plus GST-TFII-I (lane 3), GST-p70 (lane 4), GST-TFII-I+GST-p70 (lane 5), or p70-GAL4ADII (lane 6) were Western blotted with anti-TFII-I antibody.

As a final control, to demonstrate that the different TFII-I derivatives mediate their transcriptional effects specifically through an Inr element under our assay conditions, we employed a promoter that lacked an Inr element but contained a TATA box (pFR-Luc; Fig. 7). In addition, the pFR-Luc promoter also contained five GAL4 sites upstream and thus served as a control to test the specificity of the p70-GAL4ADII fusion protein. While the GAL4 DNA binding domain fused to its own activation domain stimulated the promoter very robustly (lane 2), wild-type TFII-I (lane 3), p70 (lane 4), and p70-GAL4ADII (lane 5) did not show any stimulation of the pFR-Luc promoter that lacked a detectable TFII-I binding site. In addition, we also tested whether the C-terminal 280 aa (p43) of TFII-I, when fused to the GAL4 DNA binding domain (aa 1 to 147), could activate this promoter. However, GAL4DBD-C280 failed to activate the promoter (lane 6) despite the presence of five GAL4 binding sites. We concluded that TFII-I function requires specific promoters containing its binding sites (in this case an Inr element) and that the C-terminal 280 aa of TFII-I do not appear to possess any independent transcriptional activation function under these conditions.


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 7.   TFII-I derivatives do not function through a TATA-containing but Inr-lacking promoter. COS7 cells were transiently transfected with 200 ng of pFR-Luc alone (lane 1) or cotransfected with 350 ng of plasmids expressing GAL4DBD-GAL4ADII (GAL4; lane 2), TFII-I (lane 3), p70 (lane 4), p70-GAL4ADII (lane 5), or GAL4DBD (aa 1 to 147) fused to the C-terminal 280 amino acids of TFII-I (GAL4DBD-C280; lane 6). The total amounts of transfected DNA in all lanes were equalized by the addition of empty vector (pEBB). The results represent three independent transfection assays. The fold activation was relative to the pFR-Luc activity that was taken as 1.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Since the discovery of the initiator as an autonomous core promoter element (41), the mechanism of action of this element has remained unclear and controversial. This reflects in part both the low efficiency of Inr function, relative to strong TATA elements, and the lack of a completely defined in vitro system for Inr function. It is clear, however, that basal Inr-directed transcription requires some factors not required for basal TATA-directed transcription in vitro and that a subset of these factors is required for Inr function in the context of a TATA- and Inr-containing promoter (36). The demonstration of several Inr or Inr-region interacting factors in vitro has further complicated the issue and leaves open the possibility of diverse Inr-mediated transcription initiation pathways (43, 49). To resolve these problems, systematic functional assays, in addition to the in vitro assays, must be undertaken to address the physiological significance of Inr-dependent interactions. Toward this end, we have undertaken an in vivo analysis of TFII-I, an Inr-binding protein, and show here an essential role for ectopic TFII-I in transcription of the naturally TATA- Inr+ Vbeta 5.2 promoter (1, 2).

The in vivo functions of ectopic TFII-I were first shown by us with the potent TATA- and Inr-containing AdML model promoter (39). However, for natural promoters the biochemical interactions and cofactor requirement for Inr function in the presence of a TATA box might be different than in its absence, further suggesting the importance of the promoter context on Inr function (36). Hence, clear demonstration of TFII-I function via an Inr element in a natural TATA- Inr+ promoter was necessary. The Vbeta promoter not only allowed us to directly address the role of TFII-I in the context of a TATA-less promoter, but it also allowed us to preserve the natural promoter context which could be critical for appropriate expression of several TATA- Inr+ genes (9, 12, 31). As shown by complementary functional assays with nuclear extracts, which were expected to contain all of the factors necessary for Inr function, TFII-I is required for transcription of the Vbeta promoter. This was demonstrated by the ability of an antibody directed against the cDNA-encoded protein to selectively inhibit transcription of the Vbeta promoter and by the ability of a recombinant TFII-I, expressed in and purified from mammalian cells, to restore the Vbeta transcription in immunodepleted nuclear extracts.

Together with the in vitro data, here we show that ectopically expressed TFII-I markedly stimulates the expression of the Vbeta promoter in in vivo (transient-transfection) assays. Given the fact that promoter truncation only affects the expression of the Vbeta promoter by twofold, the expression of the promoter, even in the presence of TFII-I, reflects largely basal-level (activator-independent) transcription. The Vbeta promoter contains an upstream E-box motif (consensus: CAGGTG). However, in functional assays, this E-box element does not appear to contribute significantly toward TFII-I-dependent transcriptional activation. Because this consensus differs from that of the adenovirus major-late-promoter E box (consensus: CACGTG) through which TFII-I functions (39), it is possible that TFII-I activates transcription only through specific E boxes. Although the Vbeta promoter also contains sequences for inducible and tissue-type restricted activators (e.g., NFkappa B and Pu.1), these factors are largely absent from COS cells. Thus, it is not too surprising that deletion of upstream sequences in COS cells does not result in a significant reduction in promoter activity. However, Vbeta belongs to a complex family of core promoters (16) that could potentially have activator elements immediately adjacent to the Inr element. In the latter scenario, even the Delta 61 "core" promoter might contain unidentified activator sequences. Added to this complexity is the fact that the absolute levels of expression of the Vbeta promoter constructs in transient assays are rather low; thus, our attempts to analyze the transcripts by RNA assays have been largely unsuccessful (data not shown). However, it is clear that the Vbeta promoter requires TFII-I for efficient expression both in vitro and in vivo, regardless of whether the readout reflects activator-dependent or -independent transcription.

It is also clear from our analysis that an intact Inr element is required for TFII-I functions, since either mutations in the Inr (Vbeta ) or the lack of an Inr element (but the presence of a TATA box, pFR-Luc) resulted in a lack of transcriptional activation by any derivatives of TFII-I. That TFII-I binding to the Vbeta Inr element is tightly correlated with transcriptional functions in vivo is also consistent with the notion that TFII-I binds and functions directly through the Vbeta Inr element. Although both our in vitro and especially our in vivo data are most consistent with direct involvement of TFII-I via the Inr element, in the absence of altered specificity mutants of TFII-I we cannot at present unambiguously demonstrate that TFII-I directly functions through the Inr element in vivo. Furthermore, it remains a formal possibility that the lack of TFII-I responsiveness of the Inr mutant promoters might be due to the fact that these mutations render the promoters completely inactive, especially in the absence of an RNA assay that could detect them. However, we do not favor this notion because the transcriptional levels from the mutant promoters, although 40% lower than those of the wild-type promoters, are still readily measurable.

Creation and use of a dominant negative mutant of an activator protein are a powerful approach to assigning a direct and unambiguous functional role in vivo. For a DNA binding transcription factor this could occur if the DNA binding domain is left intact but the activation domain is deleted or mutated (18, 19). Thus, as a first step to achieving this, we biochemically identified and isolated the DNA binding domain of TFII-I, reasoning that if this fragment or domain retained specific DNA binding ability but lacked the activation function then it might behave as a dominant negative mutant of wild-type TFII-I in vivo. The p70 mutant of TFII-I demonstrated Inr binding specificity in vitro but lacked any detectable transcription functions in transient reporter assays. As expected given these properties, p70 behaved as a dominant negative mutant of wild-type TFII-I when both proteins are coexpressed. Furthermore, ectopically expressed p70 also inhibited the basal Vbeta promoter, suggesting that it competes for the low levels of endogenous TFII-I. Despite the fact that this inhibition is only 30 to 40%, it is comparable to that obtained with Inr mutation. However, the exact mechanisms of the dominant negative function of p70 are not yet clear. Although the binding of p70 to the Inr is only marginally better than the wild-type TFII-I, p70 in functional assays totally inhibits the wild-type TFII-I function. Thus, a simple model of competition for promoter occupancy might not explain such dramatic effects and might involve titration of cofactors or heterodimerization between the wild-type and the mutant proteins, especially in vivo. Regardless of the exact mechanism of inhibition, it is clear that p70 lacks an activation domain because fusion of the GAL4 activation domain to p70 rescued its transcriptional potentials. Thus, by inference, the C-terminal 280 aa of TFII-I must contain or be part of an activation domain. Surprisingly, this activation domain is not required for Inr-specific transcription since the GAL4 activation domain imparts Inr function and suggests that the Inr specificity is largely dictated by the DNA binding domain of TFII-I. On the other hand, when the C-terminal 280 aa was fused to the DNA binding domain of GAL4 (aa 1 to 147), it failed to impart any detectable transcriptional responses from a promoter that contained five GAL4 binding sites upstream of a TATA box. In the same assay, the GAL4 activation domain, fused to its own DNA binding domain, stimulated the promoter significantly. Because this promoter contained a TATA box but lacked an Inr element, it is possible that the activation function of the C-terminal 280 aa may only be detectable in the presence of an Inr as has been shown for other activation domains (7, 27). However, it is also possible that this C-terminal domain of TFII-I is necessary but not sufficient for activation function and that it requires other portions of TFII-I for appropriate transcriptional responses.

What is the mechanism by which TFII-I stimulates Inr-dependent transcription either in the presence of a TATA box (39) or in its absence (this study)? Because TFII-I appears to have two distinct and separable domains, could it act as a more conventional activator protein even when bound to the Inr element? Moreover, the activation domain of GAL4 can function in an Inr-specific fashion when fused to the DNA binding domain of TFII-I. The GAL4 activation domain is known to target components within the basal machinery, most notably the TATA-binding protein and TFIIB, and it might help recruit the transcriptional machinery (reviewed in reference 35). It is likely that the C-terminal domain of TFII-I interacts with the same components of the basal machinery, although this domain may not, independently, direct significant transcription. However, we do not favor the notion that TFII-I behaves as a conventional "activator" protein. Rather, we favor a model in which TFII-I possesses one C-terminal activation domain and two separable DNA binding domains embedded within the N-terminal domain: one specific for activator function and the other specific for basal function. Either of these DNA binding domains might function independently with the C-terminal activation domain and, depending on the usage of these DNA binding domains, TFII-I can behave either as an activator or as a basal factor. Further structure-function analysis of TFII-I and identification of its targets within the basal machinery will reveal the critical determinants and will reveal the mechanisms of action of this intriguing transcription factor.

    ACKNOWLEDGMENTS

N-terminal microsequencing and DNA sequencing were performed at Tufts University protein sequencing facility. We are grateful to Jeff Parvin, Brent Cochran, and Michael Meisterernst for plasmids and reagents. We are particularly thankful to Ranjan Sen for support and critically reading the manuscript. Finally, we thank Bob Roeder for helpful suggestions.

This work was funded by grants from the American Cancer Society (RPG-98-104-01-TBE) to A.L.R.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Pathology and Program in Immunology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111. Phone: (617) 636-6715. Fax: (617) 636-8590. E-mail: aroy{at}opal.tufts.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Anderson, S. J., H. S. Chou, and D. Y. Loh. 1988. A conserved sequence in the T-cell receptor beta -chain promoter region. Proc. Natl. Acad. Sci. USA 85:3551-3554[Abstract/Free Full Text].
2. Anderson, S. J., S. Miyake, and D. Y. Loh. 1989. Transcription from a murine T-cell receptor Vbeta promoter depends on a conserved decamer motif similar to the cyclic AMP response element. Mol. Cell. Biol. 9:4835-4845[Abstract/Free Full Text].
3. Burke, T. W., and J. T. Kadonaga. 1996. Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters. Genes Dev. 10:711-724[Abstract/Free Full Text].
4. Burke, T. W., and J. T. Kadonaga. 1997. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes Dev. 11:3020-3031[Abstract/Free Full Text].
5. Burley, S. K., and R. G. Roeder. 1996. Biochemistry and structural biology of transcription factor IID (TFIID). Annu. Rev. Biochem. 65:769-799[Medline].
6. Conaway, R. C., and J. W. Conaway. 1993. General initiation factors for RNA polymerase II. Annu. Rev. Biochem. 62:161-190[Medline].
7. Das, G., C. S. Hinkley, and W. Herr. 1995. Basal promoter elements as a selective determinant of transcriptional activator function. Nature 374:657-660[Medline].
8. Dignam, J. D., P. Martin, B. Shastry, and R. G. Roeder. 1983. Eukaryotic gene transcription with purified components. Methods Enzymol. 101:583-598.
9. Eichbaum, Q. G., R. Iyer, D. P. Raveh, C. Mathieu, and A. B. Ezekowitz. 1994. Restriction of interferon gamma  responsiveness and basal expression of the myeloid human Fcgamma R1b gene is mediated by a functional Pu.1 site and a transcriptional initiator (Inr) consensus. J. Exp. Med. 179:1985-1986[Abstract/Free Full Text].
10. Fong, T. C., and B. M. Emerson. 1992. The erythroid-specific protein cGATA-1 mediates distal enhancer activity through a specialized beta -globin TATA box. Genes Dev. 6:521-532[Abstract/Free Full Text].
11. Frankel, A. D., and P. S. Kim. 1991. Modular structure of transcription factors: implications for gene regulation. Cell 65:717-719[Medline].
12. Garraway, I. R., K. Semple, and S. T. Smale. 1996. Transcription of the lymphocyte-specific terminal deoxynucleotidyltransferase gene requires a specific core promoter structure. Proc. Natl. Acad. Sci. USA 93:4336-4341[Abstract/Free Full Text].
13. Gill, G. 1994. Transcriptional initiation: taking the initiative. Curr. Biol. 4:374-376[Medline].
14. Grayson, J., R. S. Williams, Y. T. Yu, and R. Bassel-Duby. 1995. Synergistic interactions between heterologous upstream activation elements and specific TATA sequences in a muscle-specific promoter. Mol. Cell. Biol. 15:1870-1878[Abstract].
15. Grueneberg, D. A., R. W. Henry, A. Brauer, C. D. Novina, V. Cheriyath, A. L. Roy, and M. Gilman. 1997. A multifunctional DNA-binding protein that promotes the formation of serum response factor/homeodomain complexes: identity to TFII-I. Genes Dev. 11:2482-2493[Abstract/Free Full Text].
16. Halle, J.-P., P. Haus-Seuffert, C. Woltering, G. Stelzer, and M. Meisterernst. 1997. A conserved tissue-specific structure at a human T-cell receptor beta -chain core promoter. Mol. Cell. Biol. 17:4220-4229[Abstract].
17. Hansen, S. K., and R. Tjian. 1995. TAFs and TFIIA mediate differential utilization of the tandem Adh promoters. Cell 82:565-575[Medline].
18. Herskowitz, I. 1987. Functional inactivation of genes by dominant negative mutations. Nature 329:219-222[Medline].
19. Hope, I. A., and K. Struhl. 1986. Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46:885-894[Medline].
20. Hubbard, S. J., F. Eisenmonger, and J. M. Thornton. 1994. Modeling studies of the change in conformation required for cleavage of limited proteolysis sites. Protein Sci. 3:757-768[Medline].
21. Javahery, R., A. Khachi, K. Lo, B. Zenzie-Gregory, and S. T. Smale. 1994. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol. Cell. Biol. 14:116-127[Abstract/Free Full Text].
22. Johansson, E., E. Skogman, and L. Thelander. 1995. The TATA-less promoter of mouse ribonucleotide reductase R1 gene contains a TFII-I binding initiator element essential for cell cycle-regulated transcription. J. Biol. Chem. 270:30162-30167[Abstract/Free Full Text].
23. Jonsen, M. D., J. M. Petersen, Q.-P. Xu, and B. J. Graves. 1996. Characterization of the cooperative function of inhibitory sequences in Ets-1. Mol. Cell. Biol. 16:2065-2073[Abstract].
24. Kaufmann, J., C. P. Verrijzer, J. Shao, and S. T. Smale. 1996. CIF, an essential cofactor for TFIID-dependent initiator function. Genes Dev. 10:873-886[Abstract/Free Full Text].
25. Kaufmann, J., K. Ahrens, R. Koop, S. T. Smale, and R. Muller. 1998. CIF150, a human cofactor for transcription factor IID-dependent initiator function. Mol. Cell. Biol. 18:233-239[Abstract/Free Full Text].
26. Kim, D.-W., V. Cheriyath, A. L. Roy, and B. H. Cochran. 1998. TFII-I enhances activation of the c-fos promoter through interactions with upstream elements. Mol. Cell. Biol. 18:3310-3320[Abstract/Free Full Text].
27. Luo, X., and M. Sawadogo. 1996. Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains. Mol. Cell. Biol. 16:1367-1375[Abstract].
28. Ma, J., and M. Ptashne. 1987. Deletion analysis of GAL4 defines two transcriptional activating segments. Cell 48:847-853[Medline].
29. Manzano-Winkler, B., C. D. Novina, and A. L. Roy. 1996. TFII-I is required for transcription of the naturally TATA-less but initiator-containing Vbeta promoter. J. Biol. Chem. 271:12076-12081[Abstract/Free Full Text].
30. Martinez, E., C. M. Chiang, H. Ge, and R. G. Roeder. 1994. TAFs in TFIID function through the initiator to direct basal transcription from a TATA-less class II promoter. EMBO J. 13:3115-3126[Medline].
31. Novina, C. D., and A. L. Roy. 1996. Core promoter mediated transcription. Trends Genet. 12:351-355[Medline].
32. Novina, C. D., V. Cheriyath, M. C. Denis, and A. L. Roy. 1997. Methods for studying the biochemical properties of an Inr element binding protein: TFII-I. Methods 12:254-263[Medline].
33. Orphanides, G., T. Lagrange, and D. Reinberg. 1996. The general transcription factors of RNA polymerase II. Genes Dev. 10:2657-2683[Free Full Text].
34. Perez-Jurado, L. A., Y.-K. Wang, R. Peoples, A. Coloma, J. Cruces, and U. Francke. 1998. A duplicated gene in the breakpoint regions of the 7q11.23 Williams-Beuren syndrome deletion encodes the initiator binding protein TFII-I and BAP-135, a phosphorylation target of Btk. Hum. Mol. Genet. 7:325-334[Abstract/Free Full Text].
35. Ptashne, M., and A. Gann. 1997. Transcriptional activation by recruitment. Nature 386:569-577[Medline].
36. Roeder, R. G. 1996. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem. 21:327-335[Medline].
37. Roy, A. L., M. Meisterernst, P. Pognonec, and R. G. Roeder. 1991. Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature 354:245-248[Medline].
38. Roy, A. L., S. Malik, M. Meisterernst, and R. G. Roeder. 1993. An alternative pathway for transcription initiation involving TFII-I. Nature 365:355-359[Medline].
39. Roy, A. L., H. Du, P. D. Gregor, C. D. Novina, E. Martinez, and R. G. Roeder. 1997. Cloning of an Inr- and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO J. 16:7091-7104[Medline].
40. Simon, M. C., T. M. Fisch, B. J. Benecke, J. R. Nevins, and N. Heintz. 1988. Definition of multiple, functionally distinct TATA elements, one of which is a target in the hsp70 promoter for E1A regulation. Cell 52:723-729[Medline].
41. Smale, S. T., and D. Baltimore. 1989. The "initiator" as a transcription control element. Cell 57:103-113[Medline].
42. Smale, S. T., M. C. Schmidt, A. J. Berk, and D. Baltimore. 1990. Transcriptional activation by Sp1 as directed through TATA or initiator: specific requirements for mammalian transcription factor IID. Proc. Natl. Acad. Sci. USA 87:4509-4513[Abstract/Free Full Text].
43. Smale, S. T. 1997. Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351:73-88[Medline].
44. Tanaka, M., R. Gupta, and B. J. Mayer. 1995. Differential inhibition of signaling pathways by dominant-negative SH2/SH3 adapter proteins. Mol. Cell. Biol. 15:6829-6837[Abstract].
45. Triezenberg, S. J. 1995. Structure and function of transcriptional activation domains. Curr. Opin. Genet. Dev. 5:190-195[Medline].
46. Verrijzer, C. P., J. L. Chen, K. Yokomori, and R. Tjian. 1995. Binding of TAFs to core elements directs promoter selectivity by RNA polymerase II. Cell 81:1115-1125[Medline].
47. Verrijzer, C. P., and R. Tjian. 1996. TAFs mediate transcriptional activation and promoter selectivity. Trends Biochem. 21:338-342[Medline].
48. Wefald, F. C., B. H. Devlin, and R. S. Williams. 1990. Functional heterogeneity of mammalian TATA-box sequences revealed by interaction with a cell-specific enhancer. Nature 344:260-262[Medline].
49. Weis, L., and D. Reinberg. 1997. Accurate positioning of RNA polymerase II on a natural TATA-less promoter is independent of TATA-binding-protein-associated factors and initiator-binding proteins. Mol. Cell. Biol. 17:2973-2984[Abstract].
50. Yang, W., and S. Desiderio. 1997. BAP-135, a target for Bruton's tyrosine kinase in response to B cell receptor engagement. Proc. Natl. Acad. Sci. USA 94:604-609[Abstract/Free Full Text].


Mol Cell Biol, August 1998, p. 4444-4454, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Tapia-Paez, I., Tammimies, K., Massinen, S., Roy, A. L., Kere, J. (2008). The complex of TFII-I, PARP1, and SFPQ proteins regulates the DYX1C1 gene implicated in neuronal migration and dyslexia. FASEB J. 22: 3001-3009 [Abstract] [Full Text]  
  • Crusselle-Davis, V. J., Vieira, K. F., Zhou, Z., Anantharaman, A., Bungert, J. (2006). Antagonistic Regulation of {beta}-Globin Gene Expression by Helix-Loop-Helix Proteins USF and TFII-I.. Mol. Cell. Biol. 26: 6832-6843 [Abstract] [Full Text]  
  • Rajaiya, J., Nixon, J. C., Ayers, N., Desgranges, Z. P., Roy, A. L., Webb, C. F. (2006). Induction of Immunoglobulin Heavy-Chain Transcription through the Transcription Factor Bright Requires TFII-I. Mol. Cell. Biol. 26: 4758-4768 [Abstract] [Full Text]  
  • Ogura, Y., Azuma, M., Tsuboi, Y., Kabe, Y., Yamaguchi, Y., Wada, T., Watanabe, H., Handa, H. (2006). TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor {alpha}. GENES CELLS 11: 373-381 [Abstract] [Full Text]  
  • Desgranges, Z. P., Ahn, J., Lazebnik, M. B., Ashworth, T., Lee, C., Pestell, R. C., Rosenberg, N., Prives, C., Roy, A. L. (2005). Inhibition of TFII-I-Dependent Cell Cycle Regulation by p53. Mol. Cell. Biol. 25: 10940-10952 [Abstract] [Full Text]  
  • Ku, M., Sokol, S. Y., Wu, J., Tussie-Luna, M. I., Roy, A. L., Hata, A. (2005). Positive and Negative Regulation of the Transforming Growth Factor {beta}/Activin Target Gene goosecoid by the TFII-I Family of Transcription Factors. Mol. Cell. Biol. 25: 7144-7157 [Abstract] [Full Text]  
  • Youn, H., Koo, Y., Ji, I., Ji, T. H. (2005). An Upstream Initiator-Like Element Suppresses Transcription of the Rat Luteinizing Hormone Receptor Gene. Mol. Endocrinol. 19: 1318-1328 [Abstract] [Full Text]  
  • Hong, M., Lin, M.-y., Huang, J.-m., Baumeister, P., Hakre, S., Roy, A. L., Lee, A. S. (2005). Transcriptional Regulation of the Grp78 Promoter by Endoplasmic Reticulum Stress: ROLE OF TFII-I AND ITS TYROSINE PHOSPHORYLATION. J. Biol. Chem. 280: 16821-16828 [Abstract] [Full Text]  
  • Chen, J., Malcolm, T., Estable, M. C., Roeder, R. G., Sadowski, I. (2005). TFII-I Regulates Induction of Chromosomally Integrated Human Immunodeficiency Virus Type 1 Long Terminal Repeat in Cooperation with USF. J. Virol. 79: 4396-4406 [Abstract] [Full Text]  
  • Rajaiya, J., Hatfield, M., Nixon, J. C., Rawlings, D. J., Webb, C. F. (2005). Bruton's Tyrosine Kinase Regulates Immunoglobulin Promoter Activation in Association with the Transcription Factor Bright. Mol. Cell. Biol. 25: 2073-2084 [Abstract] [Full Text]  
  • Sacristan, C., Tussie-Luna, M. I., Logan, S. M., Roy, A. L. (2004). Mechanism of Bruton's Tyrosine Kinase-mediated Recruitment and Regulation of TFII-I. J. Biol. Chem. 279: 7147-7158 [Abstract] [Full Text]  
  • McLeod, A., Smart, C. D., Fry, W. E. (2004). Core Promoter Structure in the Oomycete Phytophthora infestans. Eukaryot Cell 3: 91-99 [Abstract] [Full Text]  
  • Gregory, P. A., Gardner-Stephen, D. A., Lewinsky, R. H., Duncliffe, K. N., Mackenzie, P. I. (2003). Cloning and Characterization of the Human UDP-glucuronosyltransferase 1A8, 1A9, and 1A10 Gene Promoters: DIFFERENTIAL REGULATION THROUGH AN INITIATOR-LIKE REGION. J. Biol. Chem. 278: 36107-36114 [Abstract] [Full Text]  
  • Chen, W. G., West, A. E., Tao, X., Corfas, G., Szentirmay, M. N., Sawadogo, M., Vinson, C., Greenberg, M. E. (2003). Upstream Stimulatory Factors Are Mediators of Ca2+-Responsive Transcription in Neurons. J. Neurosci. 23: 2572-2581 [Abstract] [Full Text]  
  • Wen, Y.-D., Cress, W. D., Roy, A. L., Seto, E. (2003). Histone Deacetylase 3 Binds to and Regulates the Multifunctional Transcription Factor TFII-I. J. Biol. Chem. 278: 1841-1847 [Abstract] [Full Text]  
  • Vallejo, A. N., Bryl, E., Klarskov, K., Naylor, S., Weyand, C. M., Goronzy, J. J. (2002). Molecular Basis for the Loss of CD28 Expression in Senescent T Cells. J. Biol. Chem. 277: 46940-46949 [Abstract] [Full Text]  
  • Ji, H.-b., Gupta, A., Okamoto, S., Blum, M. D., Tan, L., Goldring, M. B., Lacy, E., Roy, A. L., Terhorst, C. (2002). T Cell-specific Expression of the Murine CD3delta Promoter. J. Biol. Chem. 277: 47898-47906 [Abstract] [Full Text]  
  • Butler, J. E.F., Kadonaga, J. T. (2002). The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16: 2583-2592 [Full Text]  
  • Casteel, D. E., Zhuang, S., Gudi, T., Tang, J., Vuica, M., Desiderio, S., Pilz, R. B. (2002). cGMP-dependent Protein Kinase Ibeta Physically and Functionally Interacts with the Transcriptional Regulator TFII-I. J. Biol. Chem. 277: 32003-32014 [Abstract] [Full Text]  
  • Cheriyath, V., Desgranges, Z. P., Roy, A. L. (2002). c-Src-dependent Transcriptional Activation of TFII-I. J. Biol. Chem. 277: 22798-22805 [Abstract] [Full Text]  
  • Tussie-Luna, M. I., Bayarsaihan, D., Ruddle, F. H., Roy, A. L. (2001). Repression of TFII-I-dependent transcription by nuclear exclusion. Proc. Natl. Acad. Sci. USA 98: 7789-7794 [Abstract] [Full Text]  
  • Parker, R., Phan, T., Baumeister, P., Roy, B., Cheriyath, V., Roy, A. L., Lee, A. S. (2001). Identification of TFII-I as the Endoplasmic Reticulum Stress Response Element Binding Factor ERSF: Its Autoregulation by Stress and Interaction with ATF6. Mol. Cell. Biol. 21: 3220-3233 [Abstract] [Full Text]  
  • Webb, C. F., Yamashita, Y., Ayers, N., Evetts, S., Paulin, Y., Conley, M. E., Smith, E. A. (2000). The Transcription Factor Bright Associates with Bruton's Tyrosine Kinase, the Defective Protein in Immunodeficiency Disease. J. Immunol. 165: 6956-6965 [Abstract] [Full Text]  
  • Morikawa, N., Clarke, T. R., Novina, C. D., Watanabe, K., Haqq, C., Weiss, M., Roy, A. L., Donahoe, P. K. (2000). Human Mullerian-Inhibiting Substance Promoter Contains a Functional TFII-I-Binding Initiator. Biol. Reprod. 63: 1075-1083 [Abstract] [Full Text]  
  • Mobley, C. M., Sealy, L. (2000). The Rous Sarcoma Virus Long Terminal Repeat Promoter Is Regulated by TFII-I. J. Virol. 74: 6511-6519 [Abstract] [Full Text]  
  • Kim, D.-W., Cochran, B. H. (2000). Extracellular Signal-Regulated Kinase Binds to TFII-I and Regulates Its Activation of the c-fos Promoter. Mol. Cell. Biol. 20: 1140-1148 [Abstract] [Full Text]  
  • Novina, C. D., Kumar, S., Bajpai, U., Cheriyath, V., Zhang, K., Pillai, S., Wortis, H. H., Roy, A. L. (1999). Regulation of Nuclear Localization and Transcriptional Activity of TFII-I by Bruton's Tyrosine Kinase. Mol. Cell. Biol. 19: 5014-5024 [Abstract] [Full Text]  
  • Zahedi, K., Bissler, J. J., Prada, A. E., Prada, J. A., Davis, A. E. III (1999). The Promoter of the C1 Inhibitor Gene Contains a Polypurine{middle dot}Polypyrimidine Segment that Enhances Transcriptional Activity. J. Immunol. 162: 7249-7255 [Abstract] [Full Text]  
  • Wu, Y., Patterson, C. (1999). The Human KDR/flk-1 Gene Contains a Functional Initiator Element That Is Bound and Transactivated by TFII-I. J. Biol. Chem. 274: 3207-3214 [Abstract] [Full Text]  
  • WEBB, C., ZONG, R.-T., LIN, D., WANG, Z., KAPLAN, M., PAULIN, Y., SMITH, E., PROBST, L., BRYANT, J., GOLDSTEIN, A., SCHEUERMANN, R., TUCKER, P. (1999). Differential Regulation of Immunoglobulin Gene Transcription via Nuclear Matrix-associated Regions. Cold Spring Harb Symp Quant Biol 64: 109-118 [Abstract]  
  • Novina, C. D., Cheriyath, V., Roy, A. L. (1998). Regulation of TFII-I Activity by Phosphorylation. J. Biol. Chem. 273: 33443-33448 [Abstract] [Full Text]  
  • Cheriyath, V., Roy, A. L. (2000). Alternatively Spliced Isoforms of TFII-I. COMPLEX FORMATION, NUCLEAR TRANSLOCATION, AND DIFFERENTIAL GENE REGULATION. J. Biol. Chem. 275: 26300-26308 [Abstract] [Full Text]  
  • Vallejo, A. N., Weyand, C. M., Goronzy, J. J. (2001). Functional Disruption of the CD28 Gene Transcriptional Initiator in Senescent T Cells. J. Biol. Chem. 276: 2565-2570 [Abstract] [Full Text]  
  • Cheriyath, V., Roy, A. L. (2001). Structure-Function Analysis of TFII-I. ROLES OF THE N-TERMINAL END, BASIC REGION, AND I-REPEATS. J. Biol. Chem. 276: 8377-8383 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheriyath, V.
Right arrow Articles by Roy, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheriyath, V.
Right arrow Articles by Roy, A. L.