Previous Article | Next Article 
Mol Cell Biol, August 1998, p. 4577-4588, Vol. 18, No. 8
Department of Cell and Molecular Biology,
Life Sciences Division, Berkeley National Laboratory, University of
California, Berkeley, California 94720,1 and
Geraldine Brush Cancer Research Institute, California
Pacific Medical Center, San Francisco, California
941152
Received 20 October 1997/Returned for modification 16 December
1997/Accepted 21 May 1998
Mammary epithelial cells undergo changes in growth, invasion, and
differentiation throughout much of adulthood, and most
strikingly during pregnancy, lactation, and involution. Although the
pathways of milk protein expression are being elucidated,
little is known, at a molecular level, about control of mammary
epithelial cell phenotypes during normal tissue morphogenesis and
evolution of aggressive breast cancer. We developed a murine mammary
epithelial cell line, SCp2, that arrests growth and functionally
differentiates in response to a basement membrane and lactogenic
hormones. In these cells, expression of Id-1, an inhibitor of basic
helix-loop-helix transcription factors, declines prior to
differentiation, and constitutive Id-1 expression blocks
differentiation. Here, we show that SCp2 cells that constitutively
express Id-1 slowly invade the basement membrane but remain anchorage
dependent for growth and do not form tumors in nude mice. Cells
expressing Id-1 secreted a ~120-kDa gelatinase. From
inhibitor studies, this gelatinase appeared to be a
metalloproteinase, and it was the only metalloproteinase detectable in conditioned medium from these cells. A nontoxic inhibitor diminished the activity of this metalloproteinase in vitro
and repressed the invasive phenotype of Id-1-expressing cells in
culture. The implications of these findings for normal mammary-gland
development and human breast cancer were investigated. A gelatinase of
~120 kDa was expressed by the mammary gland during involution, a time
when Id-1 expression is high and there is extensive tissue remodeling.
Moreover, high levels of Id-1 expression and the activity of a
~120-kDa gelatinase correlated with a less-differentiated and
more-aggressive phenotype in human breast cancer cells. We suggest that
Id-1 controls invasion by normal and neoplastic mammary epithelial
cells, primarily through induction of a ~120-kDa gelatinase. This
Id-1-regulated invasive phenotype could contribute to involution of the
mammary gland and possibly to the development of invasive breast
cancer.
The epithelial cells of the mammary
gland undergo coordinate changes in growth, differentiation, and
invasion of the surrounding ECM during embryonic development and
puberty, and throughout much of adulthood during each menstrual
cycle. Particularly striking changes occur during pregnancy,
lactation, and involution. The molecular mechanisms that control
the growth and functional differentiation of mammary epithelial cells
are slowly being elucidated, but far less is known about the transient
invasive behavior of normal breast epithelial cells.
Normal breast epithelial cells proliferate and invade the surrounding
ECM during the fetal and postnatal development of the gland, and then
more vigorously at puberty as the branches of the mammary epithelial
tree are formed. After puberty, there are minor waves of mammary
epithelial-cell proliferation during each estrous cycle (16,
46). The most striking activity of mammary epithelial-cell
proliferation and invasion occurs during pregnancy, as the gland
expands in preparation for lactation (45). The proliferation
and invasion of breast epithelial cells cease during late pregnancy,
whereupon the cells functionally differentiate Invasion of the ECM by normal epithelial cells must be tightly
regulated and self-limiting. This control is clearly important for the
mammary gland to develop and function normally. Control over normal
invasive properties is also important in order to prevent neoplastic
cells from invading the surrounding ECM. Most cancers develop from
epithelial cells, and a hallmark of malignancy is invasion of the ECM
by neoplastic epithelial cells (38). In many experimental
models of tumorigenesis, an invasive phenotype develops subsequent to
neoplasia and often entails expression of ECM-degrading enzymes
commonly expressed by mesenchymal or stromal cells. These enzymes
include the MMPs stromelysin and the 72- and 92-kDa collagenases
(19, 48). It is not clear whether tumor cells express these
MMPs because they are normally expressed when epithelial cells
transiently invade the ECM during normal tissue morphogenesis or
because they frequently acquire mesenchymal characteristics upon
transformation. It was recently shown by in situ hybridization that
these MMPs are expressed by stromal fibroblasts during certain stages
of ductal and alveolar mammary morphogenesis as well as during
involution (29, 49).
In order to study normal and abnormal mammary epithelial-cell
phenotypes, we developed a murine mammary epithelial-cell line, SCp2,
whose growth and differentiation can be controlled in culture (8). SCp2 cells are an immortal line that originated from a heterogeneous cell population derived from a midpregnancy mouse mammary
gland (7, 37). SCp2 cells grow well in serum on tissue culture plastic, where they express keratins and exhibit other epithelial characteristics. When serum is removed and they are given
lactogenic hormones (insulin, prolactin, and hydrocortisone) and
basement membrane components, SCp2 cells first arrest growth, then
aggregate and form alveolar structures, and finally express high levels
of several milk proteins (8, 36).
We have shown that the differentiation of SCp2 cells requires a sharp
decline in the expression of the HLH protein Id-1 (9). Id
genes encode a small family of proteins that prevent bHLH
transcription factors from binding DNA (4). bHLH
transcription factors comprise a large family of
sequence-specific DNA binding proteins that activate the
transcription of cell- and tissue-specific genes. bHLH proteins act as
obligate dimers: they dimerize through the HLH domains and bind DNA
through the composite basic domain. Id proteins contain HLH
domains and therefore dimerize with bHLH proteins. However,
because Id proteins lack basic domains, Id-bHLH heterodimers cannot
bind DNA. Thus, Id proteins negatively regulate bHLH transcription
factors. The bHLH superfamily contains both ubiquitous and
lineage-specific transcription factors that direct many developmental
and differentiation processes (20). Two of the four known Id
proteins (Id-1 and Id-3) are nearly ubiquitously expressed, whereas
the other two Id proteins (Id-2 and Id-4) have a more restricted
pattern of expression (35). Thus, lineage-specific differentiation is determined by tissue-specific bHLH genes,
which, in turn, are posttranslationally regulated by a small
number of Id genes. Whether and how bHLH proteins participate in the
differentiation of breast epithelial cells is not yet known.
Id-1 was the first Id protein to be identified (4). Since
its initial discovery in myoblasts, it has been shown to be expressed by a variety of cell types and to inhibit the differentiation of
myoblasts (18), several hematopoietic cell types (23,
26, 40), trophoblasts (6), and mammary epithelial
cells (9). Id-1 was also found to be serum inducible in
fibroblasts, where its expression is essential for progression into the
S phase of the cell cycle (14). In contrast to the closely
related Id-2 protein, Id-1 does not physically associate with the
retinoblastoma tumor suppressor protein pRb (15, 17) but can
functionally interact with a pRb-regulated pathway for entry into S
phase (15).
Id-1 expression declines rapidly when SCp2 cells are induced to
differentiate. As long as the cells remain in contact with a basement
membrane and lactogenic hormones, Id-1 remains repressed and the cells
do not proliferate, but they express milk proteins. By contrast, SCp2
cells that constitutively express Id-1 fail to differentiate, as judged
by the expression of milk proteins, but nonetheless transiently arrest
growth and form loose alveolar structures. After several days, cells
that constitutively express Id-1 dissociate from each other and
subsequently resume growth (9).
Here, we show that Id-1 expression confers upon SCp2 cells the ability
to migrate and invade the basement membrane. However, cells that
constitutively express Id-1 neither grow in soft agar nor form tumors
in nude mice. Id-1 expression correlates strongly with expression of an
apparently novel gelatinase of approximately 120 kDa, an MMP, which is
also expressed during involution. The activity of this MMP was critical
for the Id-1-regulated invasive phenotype. We also show that Id-1
expression correlates with the degree of differentiation and
invasiveness of human breast cancer cells. The least-differentiated and
most highly invasive cells express constitutively high levels of Id-1
and also secrete a 120-kDa gelatinase. Our results suggest that Id-1 is
a regulator of the invasive phenotype of normal and neoplastic mammary
epithelial cells and that it acts, at least in part, by controlling
expression of a 120-kDa gelatinase. The invasive phenotype conferred by
Id-1 is not a consequence of tumorigenic transformation, although it may be appropriated in a subset of aggressive breast cancers. Our data
provide new insights into the control of breast epithelial-cell invasion and suggest that one or more bHLH transcription factors may
repress the invasive phenotype in normal as well as neoplastic breast
epithelial cells.
Abbreviations.
AEBSF, 4-(2-aminoethyl)-benzenesulfonyl
fluoride; bHLH, basic helix-loop-helix; BSA, bovine serum albumin;
DAPI, 4',6'-diamidino-2-phenylindole; DMEM, Dulbecco's modified
Eagle's medium; DMSO, dimethyl sulfoxide; EHS, Englebreth Holm Swarm
tumor; ECM, extracellular matrix; F12, Ham's F-12 medium; FBS, fetal
bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HLH,
helix-loop-helix; MMP, matrix metalloproteinase; PBS,
phosphate-buffered saline; PMSF, phenylmethylsulfonyl fluoride; RT-PCR,
reverse transcription-PCR.
Cell culture.
SCp2 cells were grown in a 1:1 mixture of DMEM
and F12 (DMEM-F12) containing 5% heat-inactivated FBS, insulin (5 µg/ml), and gentamicin (50 µg/ml) (growth medium) at 37°C in a
humidified 5% CO2 atmosphere, as previously described
(8). To induce differentiation, cells were plated at 5 × 104/cm2 atop basement membrane components in
DMEM-F12 lacking serum but containing lactogenic hormones (insulin, 5 µg/ml; hydrocortisone, 1 µg/ml; prolactin, 3 µg/ml)
(9). Unless otherwise indicated, cells were cultured for 5 days before analysis. Basement membrane ECM either was purified from
EHS tumors by the method of Taub et al. (42) or was supplied
as Matrigel from Collaborative Research.
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Novel Pathway for Mammary Epithelial Cell
Invasion Induced by the Helix-Loop-Helix Protein Id-1
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
that is, they express
and secrete milk proteins (44). The epithelial cells remain
proliferatively quiescent and functionally differentiated throughout
lactation. At the end of lactation, the mammary gland undergoes
involution, during which time there is an early and transient
reactivation of epithelial-cell proliferation, followed by extensive
ECM degradation and epithelial-cell death by apoptosis. The extensive
remodeling of the mammary gland that occurs during involution entails
the stepwise activation of several MMPs by the stromal and epithelial
cells of the gland (29, 41). The involuting gland eventually
returns to its prepregnancy structure.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
DNA synthesis and autoradiography.
Cells plated on
coverslips were labeled with [3H]methylthymidine (10 µCi/ml; 60 to 70 Ci/mmol) for 24 h, washed twice with PBS, then
fixed for 5 min with a 1:1 (vol/vol) mixture of acetone and methanol at
20°C. Where indicated, cell nuclei were stained for 2 min with DAPI
diluted 1:10,000 in PBS. The coverslips were air dried, coated with
Kodak NTB2 emulsion (1:2 dilution), and exposed for 16 to 24 h.
The coverslips were developed with D-19, fixed with Kodak Rapid-Fix,
and viewed by phase-contrast microscopy.
Boyden chamber invasion assays. Invasion assays were performed in modified Boyden chambers with 8-µm-pore-size filter inserts for 24-well plates (Collaborative Research). Filters were coated with 10 to 12 µl of ice-cold basement membrane ECM at 8 to 12 mg of protein/ml. Cells (0.5 × 105 to 1 × 105) were added to the upper chamber in 200 µl of DMEM-F12. The lower chamber was filled with 300 µl of NIH 3T3 cell-conditioned medium. Where indicated, GM6001 was added at 0.2 mM to both chambers immediately after cell plating. After a 16- to 20-h incubation, the cells were fixed with 2.5% glutaraldehyde in PBS and stained with 0.5% toluidine blue in 2% Na2CO3. Cells that remained in the basement membrane or attached to the upper side of the filter were removed with paper towels. Cells on the lower side of the filter were examined by light microscopy and counted.
Anchorage-dependent growth assays. Liquefied 2% agarose was mixed with an equal volume of 2× DMEM-F12 growth medium lacking serum and supplemented with insulin (10 µg/ml) and gentamicin (100 µg/ml) (2× medium). One milliliter of the mixture was layered onto 35-mm-diameter dishes to create a 1% agarose base. Liquefied 0.6% agarose was mixed with an equal volume of 2× medium, and 10 ml of this solution was mixed with 1 ml of growth medium containing 105 cells to yield 104 cells/ml in 0.27% agarose; 1 ml of this cell suspension was layered on top of the 1% agarose base, and 1 ml of DMEM-F12 containing 5% FBS was added. The cells were incubated for 14 days, after which representative fields were photographed under phase-contrast microscopy.
Tumorigenicity assays. Cells were injected subcutaneously into nude mice at 4 × 106 cells per site, two sites per animal, and two animals for each cell type (TCL1, SCg6, SCp2, SCp2-antisense Id-1, and SCp2-Id-1). Animals injected with TCL1 and SCg6 cells developed easily detectable tumors (at least 1 cm3) within 3 weeks and were sacrificed after 4 weeks. The remaining animals remained tumor negative for a minimum of 5 months.
Immunofluorescence.
Cells cultured on coverslips were washed
with PBS, fixed for 5 min with acetone-methanol (1:1, vol/vol) at
20°C, permeabilized for 5 min with 1% Triton X-100 in PBS, and
washed with PBS. A rabbit polyclonal antiserum raised against bovine
keratins (Dako, Carpinteria, Calif.) was diluted 1:10 in 0.2% BSA in
PBS and applied for 60 min at 37°C, followed by three washes in PBS.
The coverslips were then incubated with biotin-conjugated anti-rabbit
antibody (1:100 dilution; Amersham Corp.) for 30 min at 37°C and were
washed three times in PBS. Finally, the coverslips were incubated with fluorescein isothiocyanate-conjugated streptavidin (1:100 dilution; Amersham Corp.) for 30 min at 37°C and were washed in PBS. Cell nuclei were stained with DAPI, as described above, and the coverslips were mounted in glycerol-gelatin (Sigma) for viewing by
epifluorescence.
RNA isolation and analysis.
Total cellular RNA was isolated
and purified as described by Chomczynski and Sacchi (5). The
RNA (10 µg) was size fractionated by electrophoresis through
formaldehyde-agarose gels and transferred to a nylon membrane (Hybond N
from Amersham Corp.). The membrane was hybridized to
32P-labeled probes prepared by random oligonucleotide
priming, washed, and exposed to XAR-5 film for autoradiography as
described by Maniatis et al. (31). The 
-casein probe was
the 540-bp mouse cDNA (from J. Rosen, Baylor College of Medicine,
Houston, Tex.), and the Id-1 probe was either the murine Id-1 cDNA
(4) or the human Id-1 cDNA (14).
RT-PCR and Southern analysis. Transcripts for murine gelatinases A (72-kDa MMP) and B (92-kDa MMP) were detected by RT-PCR. cDNA was synthesized from total RNA by using SuperscriptII Reverse TranscriptaseII (Gibco-BRL), and 100 ng was used for PCR. The 5' and 3' PCR primers were TTGAGAAGGATGGCAAGTATGG and ACACCTTGCCATCGTTGC for gelatinase A, GGCGTGTCTGGAGATTCGA and AGGGTCCACCTTGGTCACC for gelatinase B, and ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA for GAPDH. PCR was performed in 20 mM Tris-HCl (pH 8.8)-2 mM MgSO4-10 mM KCl-10 mM (NH4)2SO4-0.1% Triton X-100-100 µg of BSA/ml-0.125 mM deoxynucleoside triphosphates-0.8 µM each PCR primer-0.05 U of Pfu DNA polymerase/µl by using 35 cycles for amplification of gelatinase cDNAs and 25 cycles for amplification of GAPDH cDNA. The cycle conditions were 1 min of denaturation at 94°C, 1 min of annealing at 58°C, and 30 s of extension at 72°C. For Southern analysis, one-fifth of the PCR reaction product was separated on a 2.1% agarose gel, transferred to a nylon membrane (Hybond N+), and hybridized with cDNA inserts labeled with 32P by random priming. cDNAs encoding murine gelatinase A or B (33, 34) were a gift from Z. Werb, University of California, San Francisco, and the GAPDH cDNA was obtained from Clontech (Palo Alto, Calif.). Hybridization was carried out in 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5× Denhardt's solution, 0.5% sodium dodecyl sulfate, and 50% formamide at 42°C overnight. The membranes were washed at a final stringency of 0.2× SSC and 0.1% sodium dodecyl sulfate at 68°C and were exposed to XAR-5 film for autoradiography.
Zymography.
Proliferating cells (106 in
100-mm-diameter dishes) were shifted to serum-free medium for 2 to 3 days, after which they were given 10 ml of fresh serum-free medium.
Forty-eight hours later, the conditioned medium was collected and
concentrated 10- to 15-fold by using 10-kDa-cutoff filters (Millipore,
Bedford, Mass.). The concentrated medium was analyzed on casein and
gelatin substrate gels, as described by Fisher and Werb (10)
and Talhouk et al. (41). Briefly, gels consisted of 8 to
10% polyacrylamide and 3 mg of 
-casein or gelatin (Sigma)/ml.
Concentrated conditioned medium was mixed with nonreducing Laemmli
sample buffer and incubated at 37°C for 15 min. After
electrophoresis, the gels were incubated for 1 h in 2.5% Triton
X-100 at room temperature, followed by 24 to 48 h in substrate
buffer (100 mM Tris-HCl [pH 7.4]-15 mM CaCl2) in the
absence or presence of GM6001 (0.2 mM in DMSO; supplied by Glycomed
Corporation and obtained from Z. Werb [12]), EDTA (10 mM), ortho-phenanthroline (1 mM in DMSO; Sigma), PMSF (5 mM), or AEBSF (0.5 mM; Calbiochem). Where appropriate, control gels were incubated with buffer containing solvent only. The gels were stained with Coomassie blue for 30 min and were destained with 30%
methanol-10% acetic acid. Caseinase and gelatinase activities were
visible as clear bands, indicative of proteolysis of the substrate
protein.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Id-1 induces an invasive, migratory phenotype in mammary epithelial
cells.
SCp2 mammary epithelial cells grow as a monolayer in 5%
serum. When given lactogenic hormones and basement membrane ECM in serum-free medium, they arrest growth, form three-dimensional alveolar
structures, and express the milk protein -casein (8). Alveoli formed by SCp2 cells are stable, maintaining their structure and -casein expression for more than 2 weeks. Under these
conditions, Id-1 is not expressed. By contrast, SCp2 cells that
constitutively express Id-1 form poorly compacted alveoli that become
increasingly disorganized; after 6 to 8 days, cells at the periphery
detach from the structure and synthesize DNA (9).
|
|
Constitutive Id-1 expression is not sufficient for anchorage-independent growth or tumorigenicity. In many model systems of malignant transformation, unregulated expression of normal or activated proto-oncogenes drives cell proliferation, and invasiveness often develops subsequent to, or concomitant with, tumorigenicity. Although Id-1 did not appear in this regard to act like a typical oncogene, we nonetheless asked whether constitutive Id-1 expression transformed SCp2 cells, using the criteria of anchorage-independent growth and tumorigenicity in nude mice.
We first tested the ability of the cells to grow in an anchorage-independent manner. As expected, control cells and cells transfected with Id-1 in the antisense orientation failed to grow in soft agar (Fig. 3A and C). Similarly, SCp2-Id-1 cells failed to form colonies in soft agar, remaining as single cells for at least 14 days (Fig. 3B). It is interesting that, in soft agar, SCp2-Id-1 cells appeared twice as large as control cells; the reason for this size increase is not known. Malignant TCL1 cells (isolated from a murine mammary tumor [28]), used as a positive control, formed large colonies after 14 days in soft agar (Fig. 3D). We conclude that constitutive expression of Id-1 does not induce anchorage-independent growth in SCp2 mammary epithelial cells.
|
|
Isolation and characterization of cloned SCp2-Id-1 cells.
The
experiments described thus far used a pooled population of SCp2-Id-1
cells, which is heterogeneous with respect to Id-1 expression. To
eliminate this heterogeneity and better define the role of Id-1 in
inducing an invasive phenotype, we isolated single-cell-derived
SCp2-Id-1 clones that expressed the Id-1 transgene to varying levels.
The clones were assessed for cytokeratin filaments (a general
characteristic of epithelial cells), morphology in monolayer culture,
and ability to form alveolar structures in response to basement
membrane ECM. In addition, RNA was isolated 5 days after the cells were
exposed to basement membrane and hormones and was analyzed for Id-1 and
-casein mRNA. The Id-1 transgene mRNA was distinguishable from the
endogenous Id-1 mRNA by its slightly larger size; the
endogenous transcript was barely detectable under these conditions
(9).
-casein mRNA (Fig. 4a, lane 1) and form
stable alveolar structures (data not shown), like untransfected SCp2
cells. These cells were therefore used as negative controls.
|
-casein mRNA than SCp2-Id-1A cells (Fig. 4a, lanes 2 and 3), but
they expressed cytokeratin filaments and formed alveolar structures
(data not shown).
Finally, SCp2-Id-1D and SCp2-Id-1E cells expressed high levels of the
Id-1 transgene and undetectable levels of -casein (Fig. 4a,
lanes 4 and 5). In monolayer culture, SCp2-Id-1E cells were less
cuboidal and grew as more-dispersed entities than SCp2-Id-1A cells
(Fig. 4b, panels C and D). Their failure to express -casein was not
due to a loss of epithelial characteristics. SCp2-Id-1E cells, which
expressed the highest levels of Id-1, as well as SCp2-Id-1D cells
(data not shown), expressed cytokeratin filaments (Fig. 4b, panel D).
However, SCp2-Id-1D and SCp2-Id-1E cells, like the pooled SCp2-Id-1
cells, formed only loose alveolar structures, from which they
eventually detached and invaded the ECM (see Fig. 7) (data not shown).
These results confirm in cloned populations that mammary epithelial
cells constitutively expressing Id-1 do not undergo a complete
epithelial-to-mesenchymal transition; they retain some epithelial-cell characteristics (such as keratin expression) but fail to functionally differentiate and to maintain three-dimensional organization on the ECM. SCp2-Id-1A and SCp2-Id-1E cells, which express undetectable and high levels of the Id-1 transgene,
respectively, were used for further studies.
A potentially novel metalloproteinase is secreted by Id-1-expressing cells. The ability of SCp2-Id-1 cells to invade the ECM suggested that Id-1 might induce expression of ECM-degrading proteases. The major classes of proteases that degrade ECM are serine, cysteine, and aspartyl proteases, and metalloproteinases (10). The Zn2+-containing, Ca2+-stabilized MMPs are of particular interest because they are implicated in the remodeling of the mammary gland during involution (29, 41) and the initial steps of tumor-cell invasion (25). Of the major MMPs, interstitial collagenase (56 kDa) and gelatinases A (72 kDa) and B (92 kDa) are detectable on gelatin substrate gels, whereas stromelysins (57 kDa for stromelysin-1) and matrilysin (30 kDa) are detectable on casein substrate gels (reviewed by Fisher and Werb [10]; see also reference 22).
We examined the secretion of proteases by SCp2-Id-1A and SCp2-Id-1E cells, using conditioned medium and gelatin or casein substrate gel zymography. Cells were incubated in serum-free medium for 3 days prior to collection of conditioned medium for zymography. Under these conditions, the endogenous Id-1 gene is not expressed (9), and SCp2-Id-1A and SCp2-Id-1E express undetectable and high levels of the Id-1 transgene, respectively. Gelatin substrate gels showed that SCp2-Id-1A and SCp2-Id-1E cells differed only in the secretion of a high-molecular-mass (approximately 120-kDa) gelatinase. The 120-kDa gelatinase was abundantly expressed by serum-deprived SCp2-Id-1E cells (Fig. 5A, lane 2) as well as SCp2-Id-1D cells (data not shown). Secretion of this 120-kDa gelatinase was not due to clonal variation. Conditioned medium from the uncloned SCp2-Id-1 pooled population also showed a gelatinase of ~120 kDa (Fig. 5C, lane 2). This gelatinase was undetectable in serum-deprived SCp2-Id-1A (Fig. 5A, lane 1) and control SCp2 (Fig. 5C, lane 1) cells. Thus, secretion of a 120-kDa gelatinase correlated with Id-1 expression.
|
|
The Id-1-related MMP is essential for the invasive phenotype of SCp2 cells. Because the 120-kDa MMP appears to be the only proteinase whose secretion correlates with Id-1 expression, and constitutive Id-1 expression renders cells invasive, we explored the possibility that this MMP is critical for the invasive phenotype of mammary epithelial cells.
We first tested the abilities of SCp2-Id-1A and SCp2-Id-1E cells to invade basement membrane ECM in a Boyden chamber invasion assay (Fig. 7). SCp2-Id-1A cells, like untransfected SCp2 cells (Fig. 2), were not invasive, or only minimally invasive, in this assay (Fig. 7). Under the assay conditions, the endogenous Id-1 gene is not expressed and SCp2-Id-1A cells express undetectable levels of the Id-1 transgene. By contrast, SCp2-Id-1E cells, like uncloned SCp2-Id-1 cells (Fig. 2), were demonstrably invasive under the same conditions, consistent with the high levels of the Id-1 transgene expressed by these cells.
|
Id-1 and the 120-kDa gelatinase are expressed during mammary gland involution. In studying proteases during mouse mammary-gland development, Talhouk et al. (41) described a gelatinase having a molecular size greater than 110 kDa that was not expressed during lactation (Fig. 8, top panel, lane 1) but was expressed during the early stages of involution (days 1 and 2 [lanes 2 and 3], declining by day 3 [lane 4]). The identity or function of this gelatinase was not determined or discussed. To explore the possibility that this gelatin-degrading proteinase may be the 120-kDa MMP expressed by Id-1-expressing cells, we isolated RNA from lactating and involuting mouse mammary glands and measured Id-1 expression by Northern analysis (Fig. 8, lower panels). Id-1 mRNA was undetectable in the lactating gland (lane 1) but was highly expressed early in involution (day 1 and 2 [lanes 2 and 3]); Id-1 expression began to decline by the 3rd day of involution (lane 4). Thus, the correlation between the expression of Id-1 and a 120-kDa gelatinase observed in mammary epithelial-cell cultures is also seen in the intact mammary gland during involution.
|
Id-1 and 120-kDa gelatinase expression in invasive human breast cancer cells. Our finding that ectopic Id-1 expression induced a 120-kDa gelatinase and an invasive phenotype in mouse mammary epithelial cells suggested that Id-1 and its associated gelatinase could, at least in some instances, contribute to human breast cancer progression. To begin to explore this possibility, we examined human breast cancer cell lines exhibiting varying degrees of invasiveness in culture and in vivo.
We examined four differentiated, essentially noninvasive breast cancer cell lines, T47D, MCF-7, ZR75-1, and SKBR-3 (43), and five poorly differentiated and invasive cell lines, Hs578T, BT-549, MDA-MB-231, MDA-MB-436, and MDA-MB-435 (27, 30, 43, 50) (Fig. 9). These cell lines have been evaluated for invasiveness in culture, by using the Boyden chamber assay (2), and in vivo, by using metastatic tumor formation in nude mice (43). By both assays (under serum-free and/or estrogen-free conditions), T47D, MCF-7, ZR75-1, and SKBR-3 cells were noninvasive. By contrast, Hs578T, BT-549, and particularly MDA-MB-231, MDA-MB-436, and MDA-MB-435 cells were highly invasive by both assays. We confirmed the reported invasive potentials of these cells, using the Boyden chamber assay (data not shown). When cells were cultured in serum-free medium for 2 days, Id-1 mRNA was undetectable in the noninvasive T47D, MCF-7, ZR75-1, and SKBR-3 cells (Fig. 9, lanes 1, 2, 6, and 7) but was easily detectable in the highly invasive MDA-MB-231, MDA-MB-436, and MDA-MB-435 cells (Fig. 9, lanes 5, 8, and 9). Of the other invasive cells, Hs578T expressed low levels of Id-1 mRNA (Fig. 9, lane 3), whereas Id-1 mRNA was undetectable in BT-549 (Fig. 9, lane 4). Thus, the invasive potential of the human breast cancer cell lines MDA-MB-231, MDA-MB-436, MDA-MB-435, and, to a lesser extent, Hs578T could, at least in part, derive from unregulated expression of Id-1 and its associated 120-kDa gelatinase.
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
The mammary gland is one of the few organs that undergo striking morphological and functional changes during adult life, particularly during pregnancy, lactation, and involution. In both humans and mice, fetal, virgin adult, and pregnant mammary glands undergo extensive temporal and spatial remodeling, which entails invasion, migration, and relocation of cells to generate the ductal and alveolar structures of the gland. Once lactation is terminated, there is additional and extensive tissue remodeling as the gland returns to its resting state. In recent years, progress has been made in elucidating the mechanisms that regulate mammary gland-specific gene expression and the transformation of mammary epithelial cells to malignancy (3, 39). However, much less is known about the mechanisms, particularly the transcriptional mechanisms, that regulate the development and remodeling of the normal mammary gland.
SCp2 cells as a model for normal mammary epithelial cells. SCp2 is an immortal murine cell line that nonetheless expresses many characteristics of epithelial cells in the pregnant and lactating mammary gland. SCp2 cells proliferate in monolayer culture in response to serum growth factors but arrest growth, form alveolar structures, and express milk proteins in response to lactogenic hormones and basement membrane components. Arrested growth is necessary, but not sufficient, for differentiation. The differentiation of SCp2 cells in culture is remarkably similar to the differentiation of mammary epithelial cells in vivo (8). Here, we extend this similarity to expression of a 120-kDa MMP that appears to be controlled by Id-1, a negative regulator of bHLH transcription factors (4).
Id-1 as a negative regulator of mammary epithelial-cell
differentiation.
During proliferation, but not during
arrested growth or differentiation, SCp2 cells express Id-1. The
expression of Id-1 and that of the milk protein -casein are
inversely correlated in cultured SCp2 cells (9), as well as
in the mammary gland in virgin, pregnant, and lactating mice
(9a). Indeed, Id-1 is a negative regulator of the
functional differentiation of SCp2 cells. When constitutively
expressed, Id-1 prevents the strong cell-cell contacts typical of
differentiated cells and blocks milk protein expression.
Although the precise mechanism by which Id-1 inhibits differentiation
is not known, it is clear that it does not act by preventing the growth
arrest induced by hormones and ECM (9).
An Id-1-regulated gelatinase expressed by mammary epithelial cells. Id-1 expression, whether originating from the endogenous gene or a transgene, correlated strongly with the expression of a 120-kDa gelatinase having the characteristics of an MMP. This protease appeared to be the only metalloproteinase expressed by SCp2 mammary epithelial cells. The well-characterized MMPs stromelysin and gelatinases A and B (72- and 92-kDa type IV collagenases) were not expressed by SCp2 cells. By contrast, gelatinases A and B were expressed by SCg6, a stroma-like cell line derived from the same culture from which SCp2 cells were cloned (8). SCg6 cells also express stromelysin-1 (28). These findings suggest that the expression of stromelysin and gelatinases A and B during involution of the mammary gland may derive from the nonepithelial cells in the tissue (29).
The epithelial cells of the mammary gland, on the other hand, may express the 120-kDa MMP. Talhouk et al. (41) described a gelatinase with an apparent molecular size exceeding 110 kDa that was expressed during the early stages of involution. We found that Id-1 mRNA was not expressed during lactation, when the 120-kDa gelatinase is undetectable, but was expressed early in involution (days 1 and 2). We suggest that this gelatinase may be the 120-kDa MMP identified in Id-1-expressing SCp2 cells. Thus, there is a correlation between Id-1 expression and secretion of a 120-kDa gelatinase in vivo, as well as in cultured cells.The Id-1-regulated gelatinase is critical for epithelial-cell invasiveness. SCp2 cells arrest growth when in contact with basement membrane ECM. Under these conditions, Id-1 is not expressed, the cells maintain strong contacts, and they do not invade the surrounding ECM (9). Constitutive Id-1 expression did not prevent the growth arrest but conferred an invasive phenotype on the cells. Only after Id-1-expressing SCp2 cells had invaded the ECM did they resume proliferation. Thus, Id-1 appeared to be a regulator of the invasive phenotype rather than a stimulator of cell proliferation per se. This invasive phenotype, in turn, appeared to depend primarily on the 120-kDa gelatinase (MMP). This MMP was the only detectable target of GM6001, a nontoxic MMP inhibitor (12), and GM6001 effectively inhibited the invasive phenotype of Id-1-expressing cells. Thus, Id-1 and its related 120-kDa MMP were key regulators of the invasive phenotype of SCp2 cells. During involution, the Id-1-associated MMP may participate in remodeling the gland in vivo. We suggest that Id-1 and its related MMP may be key regulators of the transient invasive phenotype acquired by the epithelial cells during certain stages of normal mammary-gland development and remodeling.
Id-1 and the 120-kDa gelatinase in tumor cell invasion. The invasive phenotype induced by Id-1 was not the result of malignant transformation. Id-1-expressing SCp2 cells did not grow in an anchorage-independent manner and did not form detectable tumors in nude mice. Thus, Id-1 differs from oncogenes such as v-Ha-ras, which converts mouse mammary epithelial cells into invasive but also tumorigenic cells (13). Furthermore, Id-1 did not induce an invasive phenotype by converting cells to a stromal or mesenchymal phenotype. Id-1-expressing SCp2 cells maintained their epithelial characteristics, such as keratin expression, and did not express stromal MMPs. Thus, the action of Id-1 differs from that of genes of the ets family. c-Ets, a transcription factor expressed by stromal fibroblasts, promotes epithelial tumor cell invasion (48) by inducing stromal MMPs such as stromelysin-1. E1AF, a new member of the ets family, induces an invasive and migratory phenotype in human MCF-7 breast cancer cells (19), presumably by inducing gelatinase B as well as stromelysin-1.
Although the Id-1-induced invasive phenotype was not a consequence of malignant transformation, our results with human breast cancer cells suggest that constitutive Id-1 expression, and its associated 120-kDa gelatinase, may play a role in the invasive phenotype of at least some aggressive human breast tumors. We hypothesize that Id-1 and the 120-kDa gelatinase may constitute a thus far unrecognized pathway for tumor cell invasion. A very recent report (32) suggests that the Id-1-120-kDa gelatinase pathway we describe here may be of substantial clinical importance. In that report, a gelatinase of approximately the same size as the one described here was detected in urine from metastatic breast cancer patients but not in urine specimens from patients with other types of cancer. The authors acknowledge that the identity of this gelatinase is as yet unknown but suggest that it might serve as a predictor of metastatic breast cancer. By contrast, the 72- and 92-kDa gelatinases detected in urine were suggested to serve as predictors of organ-confined cancers. These suggestions are consistent with our results showing that the 72- and/or 92-kDa gelatinase is expressed by differentiated and noninvasive human breast cancer cells, whereas the 120-kDa gelatinase is expressed only in invasive breast cancer cells. In conclusion, we propose that Id-1 regulates the invasive phenotype of breast epithelial cells, in part through the activity of a 120-kDa gelatinase, during normal mammary-gland development and remodeling. Although this phenotype is not necessarily linked to tumorigenesis, it may well be reactivated during progression toward malignancy in some breast cancers, for example, during the transition from an in situ to an invasive carcinoma. We do not yet know whether Id-1 induces the 120-kDa gelatinase by directly inactivating a bHLH repressor of the gene or whether it acts indirectly by altering the expression of other genes. We are currently attempting to clone the 120-kDa gelatinase in order to answer these questions.| |
ACKNOWLEDGMENTS |
|---|
We thank Y. Jen (Memorial Sloan-Kettering Cancer Center, New
York, N.Y.) for the murine Id-1 cDNA, J. Rosen for the -casein cDNA,
and Z. Werb for the gelatinase-A and -B cDNAs and the GM6001. We also
thank S. Liang, A. Lochter, R. Lupu, and Z. Werb for assistance with some of the experiments and for helpful discussions.
P.-Y.D. and C.Q.L. contributed equally to this work.
This work was supported by grants from the U.S. Department of Energy (contract DE-AC03-76SF00098) to M.J.B. and J.C. and by a New Investigator Award from the University of California Breast Cancer Research Program (1KB0274) to P.-Y.D.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Geraldine Brush Cancer Research Institute, Stern Building, 2330 Clay St., San Francisco, CA 94115. Phone: (415) 561-1760. Fax: (415) 561-1390. E-mail: pdesprez{at}cooper.cpmc.org.
Present address: INSERM Unite 433, Faculte de Medecine Laennec,
69372 Lyon, France.
Present address: Searle Research and Development, Monsanto
Company, Immunology Department-AA4G, North Chesterfield, MO 63198.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Abbas Abidi, S. M., E. W. Howard, J. J. Dmytryk, and J. T. Pento. 1997. Differential influence of antiestrogens on the in vitro release of gelatinases (type IV collagenases) by invasive and non-invasive breast cancer cells. Clin. Exp. Metastasis 15:432-439[Medline]. |
| 2. |
Albini, A.,
Y. Iwamoto,
H. K. Kleinman,
G. R. Martin,
S. A. Aaronson,
J. M. Kozlowski, and R. N. McEwan.
1987.
A rapid in vitro assay for quantitating the invasive potential of tumor cells.
Cancer Res.
47:3239-3245 |
| 3. | Band, V. 1995. Preneoplastic transformation of human mammary epithelial cells. Semin. Cancer Biol. 6:185-192[Medline]. |
| 4. | Benezra, R., R. L. Davis, D. Lockshon, D. L. Turner, and H. Weintraub. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49-59[Medline]. |
| 5. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline]. |
| 6. | Cross, J. C., M. L. Flannery, M. A. Blanar, E. Steingrimsson, N. A. Jenkins, N. G. Copeland, W. J. Rutter, and Z. Werb. 1995. Hxt encodes a basic helix-loop-helix transcription factor that regulates trophoblast cell development. Development 121:2513-2523[Abstract]. |
| 7. |
Danielson, K. G.,
C. J. Oborn,
E. M. Durban,
J. S. Buetel, and D. Medina.
1984.
Epithelial mouse mammary cell line exhibiting normal morphogenesis in vivo and functional differentiation in vitro.
Proc. Natl. Acad. Sci. USA
81:3756-3760 |
| 8. | Desprez, P. Y., C. Roskelley, J. Campisi, and M. J. Bissell. 1993. Isolation of functional cell lines from a mouse mammary epithelial cell strain: the importance of basement membrane and cell-cell interaction. Mol. Cell. Differ. 1:99-110. |
| 9. | Desprez, P. Y., E. Hara, M. J. Bissell, and J. Campisi. 1995. Suppression of mammary epithelial cell differentiation by the helix-loop-helix protein Id-1. Mol. Cell. Biol. 15:3398-3404[Abstract]. |
| 9a. | Desprez, P. Y., C. Sympson, J. Campisi, and M. J. Bissell. Unpublished data. |
| 10. | Fisher, S. J., and Z. Werb. 1995. The catabolism of extracellular matrix components, p. 261-287. In M. A. Haralson, and J. R. Hassell (ed.), Extracellular matrix: a practical approach. IRL Press Ltd., Oxford, United Kingdom. |
| 11. | Gilles, C., M. Polette, M. Seiki, P. Birembaut, and E. W. Thompson. 1997. Implication of collagen type I-induced membrane type 1-matrix metalloproteinase expression and matrix metalloproteinase-2 activation in the metastatic progression of breast carcinoma. Lab. Investig. 76:651-660[Medline]. |
| 12. | Grobelny, D., L. Poncz, and R. E. Galardy. 1992. Inhibition of human skin fibroblast collagenase, thermolysin, and Pseudomonas aeruginosa elastase by peptide hydroxamic acids. Biochemistry 31:7152-7154[Medline]. |
| 13. |
Gunzburg, W. H.,
B. Salmons,
A. Schlaeffli,
S. Moritz-Legrand,
W. Jones,
N. H. Sarkar, and R. Ullrich.
1988.
Expression of the oncogenes mil and ras abolishes the in vivo differentiation of mammary epithelial cells.
Carcinogenesis
9:1849-1856 |
| 14. |
Hara, E.,
T. Yamaguchi,
H. Nojima,
T. Ide,
J. Campisi,
H. Okayama, and K. Oda.
1994.
Id-related genes encoding HLH proteins are required for G1 progression and are repressed in senescent human fibroblasts.
J. Biol. Chem.
269:2139-2145 |
| 15. | Hara, E., J. A. Uzman, G. P. Dimri, J. O. Nehlin, A. Testori, and J. Campisi. 1996. The helix-loop-helix Id-1 and a retinoblastoma protein binding mutant of SV40 T antigen synergize to reactivate DNA synthesis in senescent human fibroblasts. Dev. Genet. 18:161-172[Medline]. |
| 16. |
Haslam, S. Z.
1989.
The ontogeny of mouse mammary gland responsiveness to ovarian steroid hormones.
Endocrinology
125:2766-2772 |
| 17. |
Iavarone, A.,
P. Garg,
A. Lasorella,
J. Hsu, and M. A. Israel.
1994.
The helix-loop-helix protein Id-2 enhances cell proliferation and binds to the retinoblastoma protein.
Genes Dev.
8:1270-1284 |
| 18. |
Jen, Y.,
H. Weintraub, and R. Benezra.
1992.
Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins.
Genes Dev.
6:1466-1479 |
| 19. | Kaya, M., K. Yoshida, F. Higashino, T. Mitaka, S. Ishii, and K. Fujinaga. 1996. A single ets-related transcription factor, E1AF, confers invasive phenotype on human cancer cells. Oncogene 12:221-227[Medline]. |
| 20. | Kingston, R. E. 1989. Transcription control and differentiation: the HLH family, c-myc and C/EBP. Curr. Opin. Cell Biol. 1:1081-1087[Medline]. |
| 21. |
Kjeldsen, L.,
A. H. Johnsen,
H. Sengelov, and N. Borregaard.
1993.
Isolation and primary structure of NGAL, a novel protein associated with human neutrophil gelatinase.
J. Biol. Chem.
268:10425-10432 |
| 22. | Kleiner, D. E., and W. G. Stetler-Stevenson. 1994. Quantitative zymography: detection of picogram quantities of gelatinases. Anal. Biochem. 218:325-329[Medline]. |
| 23. |
Kreider, B. L.,
R. Benezra,
G. Rovera, and T. Kadesch.
1992.
Inhibition of myeloid differentiation by the helix-loop-helix protein Id.
Science
255:1700-1702 |
| 24. |
Lee, J. E.,
S. M. Hollenberg,
L. Snider,
D. L. Turner,
N. Lipnick, and H. Weintraub.
1995.
Conversion of Xenopus ectoderm into neurons by neuroD, a basic helix-loop-helix protein.
Science
268:836-844 |
| 25. | Liotta, L. A., P. S. Steeg, and W. G. Stetler-Stevenson. 1991. Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation. Cell 64:327-336[Medline]. |
| 26. |
Lister, J.,
W. C. Forrester, and M. H. Baron.
1995.
Inhibition of an erythroid differentiation switch by the helix-loop-helix protein Id1.
J. Biol. Chem.
270:17939-17946 |
| 27. | Liu, Z., M. G. Brattain, and H. Appert. 1997. Differential display of reticulocalbin in the highly invasive cell line, MDA-MB-435, versus the poorly invasive cell line, MCF-7. Biochem. Biophys. Res. Commun. 231:283-289[Medline]. |
| 28. |
Lochter, A.,
A. Srebrow,
C. J. Sympson,
N. Terracio,
Z. Werb, and M. J. Bissell.
1997.
Misregulation of stromelysin-1 expression in mouse mammary tumor cells accompanies acquisition of stromelysin-1-dependent invasive properties.
J. Biol. Chem.
272:5007-5015 |
| 29. | Lund, L. R., J. Romer, N. Thomasset, H. Solberg, C. Pyke, M. J. Bissell, K. Dano, and Z. Werb. 1996. Two distinct phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways. Development 122:181-193[Abstract]. |
| 30. | Maemura, M., S. K. Akiyama, V. L. Woods, Jr., and R. B. Dickson. 1995. Expression and ligand binding of alpha 2 beta 1 integrin on breast carcinoma cells. Clin. Exp. Metastasis 13:223-235[Medline]. |
| 31. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 32. |
Moses, M. A.,
D. Wiederschain,
K. R. Loughlin,
D. Zurakowski,
C. C. Lamb, and M. R. Freeman.
1998.
Increased incidence of matrix metalloproteinases in urine of cancer patients.
Cancer Res.
58:1395-1399 |
| 33. |
Reponen, P.,
C. Sahlberg,
P. Huhtala,
T. Hurskainen,
I. Thesleff, and K. Tryggvason.
1992.
Molecular cloning of murine 72-kDa type IV collagenase and its expression during mouse development.
J. Biol. Chem.
267:7856-7862 |
| 34. |
Reponen, P.,
C. Sahlberg,
C. Munaut,
I. Thesleff, and K. Tryggvason.
1994.
High expression of 92-kD type IV collagenase (gelatinase B) in the osteoclast lineage during mouse development.
J. Cell Biol.
124:1091-1102 |
| 35. |
Riechmann, V.,
I. van Cruchten, and F. Sablitzky.
1994.
The expression pattern of Id4, a novel dominant negative helix-loop-helix protein, is distinct from Id1, Id2 and Id3.
Nucleic Acids Res.
22:749-755 |
| 36. |
Roskelley, C. D.,
P. Y. Desprez, and M. J. Bissell.
1994.
Extracellular matrix-dependent tissue-specific gene expression in mammary epithelial cells requires both physical and biochemical signal transduction.
Proc. Natl. Acad. Sci. USA
91:12378-12382 |
| 37. |
Schmidhauser, C.,
M. J. Bissell,
C. A. Myers, and G. F. Casperson.
1990.
Extracellular matrix and hormones transcriptionally regulate bovine beta-casein 5' sequences in stably transfected mouse mammary cells.
Proc. Natl. Acad. Sci. USA
87:9118-9122 |
| 37a. | Shalaby, R., and G. Colbern (California Pacific Medical Center). Personal communication. |
| 38. | Stetler-Stevenson, W. G. 1990. Type IV collagenases in tumor invasion and metastasis. Cancer Metastasis Rev. 9:289-303[Medline]. |
| 39. |
Streuli, C. H.,
C. Schmidhauser,
N. Bailey,
P. Yurchenco,
A. P. Skubitz,
C. Roskelley, and M. J. Bissell.
1995.
Laminin mediates tissue-specific gene expression in mammary epithelia.
J. Cell Biol.
129:591-603 |
| 40. | Sun, X. H. 1994. Constitutive expression of the Id1 gene impairs mouse B cell development. Cell 79:893-900[Medline]. |
| 41. | Talhouk, R. S., J. R. Chin, E. N. Unemori, Z. Werb, and M. J. Bissell. 1991. Proteinases of the mammary gland: developmental regulation in vivo and vectorial secretion in culture. Development 112:439-449[Abstract]. |
| 42. |
Taub, M.,
Y. Wang,
T. M. Szczesny, and H. K. Kleinman.
1990.
Epidermal growth factor or transforming growth factor is required for kidney tubulogenesis in Matrigel cultures in serum free medium.
Proc. Natl. Acad. Sci. USA
87:4002-4006 |
| 43. | Thompson, E. W., S. Paik, N. Brunner, C. L. Sommers, G. Zugmaier, R. Clarke, T. B. Shima, J. Torri, S. Donahue, M. E. Lippman, G. R. Martin, and R. B. Dickson. 1992. Association of increased basement membrane invasiveness with absence of estrogen receptor and expression of vimentin in human breast cancer cell lines. J. Cell. Physiol. 150:534-544[Medline]. |
| 44. | Traurig, H. H. 1967. Cell proliferation in the mammary gland during late pregnancy and lactation. Anat. Rec. 157:489-504. |
| 45. | Traurig, H. H. 1967. A radioautographic study of cell proliferation in the mammary gland of the pregnant mouse. Anat. Rec. 159:239-248[Medline]. |
| 46. |
Wang, S.,
L. J. Counterman, and S. Z. Haslam.
1990.
Progesterone action in normal mouse mammary gland.
Endocrinology
127:2183-2189 |
| 47. |
Weintraub, H.,
R. Davis,
S. J. Tapscott,
M. Thayer,
R. Krause,
R. Benezra,
T. K. Blackwell,
D. Turner,
R. Rupp,
S. Hollenberg, et al.
1991.
The myoD gene family: nodal point during specification of the muscle cell lineage.
Science
251:761-766 |
| 48. |
Wernert, N.,
F. Gilles,
V. Fafeur,
F. Bouali,
M. B. Raes,
C. Pyke,
T. Dupressoir,
G. Seitz,
B. Vandenbunder, and D. Stehelin.
1994.
Stromal expression of c-Ets1 transcription factor correlates with tumor invasion.
Cancer Res.
54:5683-5688 |
| 49. | Witty, J. P., J. H. Wright, and L. M. Matrisian. 1995. Matrix metalloproteinases are expressed during ductal and alveolar mammary morphogenesis, and misregulation of stromelysin-1 in transgenic mice induces unscheduled alveolar development. Mol. Biol. Cell 6:1287-1303[Abstract]. |
| 50. | Zhang, R. D., I. J. Fidler, and J. E. Price. 1991. Relative malignant potential of human breast carcinoma cell lines established from pleural effusions and a brain metastasis. Invasion Metastasis 11:204-215[Medline]. |
Mol Cell Biol, August 1998, p. 4577-4588, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Huang, T.-H., Wu, F., Loeb, G. B., Hsu, R., Heidersbach, A., Brincat, A., Horiuchi, D., Lebbink, R. J., Mo, Y.-Y., Goga, A., McManus, M. T.
(2009). Up-regulation of miR-21 by HER2/neu Signaling Promotes Cell Invasion. J. Biol. Chem.
284: 18515-18524
[Abstract] [Full Text] -
Ushio, K., Hashimoto, T., Kitamura, N., Tanaka, T.
(2009). Id1 Is Down-Regulated by Hepatocyte Growth Factor via ERK-Dependent and ERK-Independent Signaling Pathways, Leading to Increased Expression of p16INK4a in Hepatoma Cells. Mol Cancer Res
7: 1179-1188
[Abstract] [Full Text] -
Torabian, S. Z., de Semir, D., Nosrati, M., Bagheri, S., Dar, A. A., Fong, S., Liu, Y., Federman, S., Simko, J., Haqq, C., Debs, R. J., Kashani-Sabet, M.
(2009). Ribozyme-Mediated Targeting of I{kappa}B{gamma} Inhibits Melanoma Invasion and Metastasis. Am. J. Pathol.
174: 1009-1016
[Abstract] [Full Text] -
Subbaramaiah, K., Benezra, R., Hudis, C., Dannenberg, A. J.
(2008). Cyclooxygenase-2-derived Prostaglandin E2 Stimulates Id-1 Transcription. J. Biol. Chem.
283: 33955-33968
[Abstract] [Full Text] -
Caldon, C. E., Swarbrick, A., Lee, C. S.L., Sutherland, R. L., Musgrove, E. A.
(2008). The Helix-Loop-Helix Protein Id1 Requires Cyclin D1 to Promote the Proliferation of Mammary Epithelial Cell Acini. Cancer Res.
68: 3026-3036
[Abstract] [Full Text] -
Kamalian, L., Gosney, J. R., Forootan, S. S., Foster, C. S., Bao, Z. Z., Beesley, C., Ke, Y.
(2008). Increased Expression of Id Family Proteins in Small Cell Lung Cancer and its Prognostic Significance. Clin. Cancer Res.
14: 2318-2325
[Abstract] [Full Text] -
Gautschi, O., Tepper, C. G., Purnell, P. R., Izumiya, Y., Evans, C. P., Green, T. P., Desprez, P. Y., Lara, P. N., Gandara, D. R., Mack, P. C., Kung, H.-J.
(2008). Regulation of Id1 Expression by Src: Implications for Targeting of the Bone Morphogenetic Protein Pathway in Cancer. Cancer Res.
68: 2250-2258
[Abstract] [Full Text] -
Gupta, G. P., Perk, J., Acharyya, S., de Candia, P., Mittal, V., Todorova-Manova, K., Gerald, W. L., Brogi, E., Benezra, R., Massague, J.
(2007). ID genes mediate tumor reinitiation during breast cancer lung metastasis. Proc. Natl. Acad. Sci. USA
104: 19506-19511
[Abstract] [Full Text] -
Yoshimura, T, Sumida, T, Liu, S, Onishi, A, Shintani, S, Desprez, P-Y, Hamakawa, H
(2007). Growth inhibition of human salivary gland tumor cells by introduction of progesterone (Pg) receptor and Pg treatment. Endocr Relat Cancer
14: 1107-1116
[Abstract] [Full Text] -
Zhang, X., Ling, M.-T., Wang, Q., Lau, C.-K., Leung, S. C. L., Lee, T. K., Cheung, A. L. M., Wong, Y.-C., Wang, X.
(2007). Identification of a Novel Inhibitor of Differentiation-1 (ID-1) Binding Partner, Caveolin-1, and Its Role in Epithelial-Mesenchymal Transition and Resistance to Apoptosis in Prostate Cancer Cells. J. Biol. Chem.
282: 33284-33294
[Abstract] [Full Text] -
McAllister, S. D., Christian, R. T., Horowitz, M. P., Garcia, A., Desprez, P.-Y.
(2007). Cannabidiol as a novel inhibitor of Id-1 gene expression in aggressive breast cancer cells. Molecular Cancer Therapeutics
6: 2921-2927
[Abstract] [Full Text] -
Perk, J., Gil-Bazo, I., Chin, Y., de Candia, P., Chen, J. J.S., Zhao, Y., Chao, S., Cheong, W., Ke, Y., Al-Ahmadie, H., Gerald, W. L., Brogi, E., Benezra, R.
(2006). Reassessment of Id1 Protein Expression in Human Mammary, Prostate, and Bladder Cancers Using a Monospecific Rabbit Monoclonal Anti-Id1 Antibody.. Cancer Res.
66: 10870-10877
[Abstract] [Full Text] -
Wu, G., Guo, Z., Chatterjee, A., Huang, X., Rubin, E., Wu, F., Mambo, E., Chang, X., Osada, M., Sook Kim, M., Moon, C., Califano, J. A., Ratovitski, E. A., Gollin, S. M., Sukumar, S., Sidransky, D., Trink, B.
(2006). Overexpression of Glycosylphosphatidylinositol (GPI) Transamidase Subunits Phosphatidylinositol Glycan Class T and/or GPI Anchor Attachment 1 Induces Tumorigenesis and Contributes to Invasion in Human Breast Cancer.. Cancer Res.
66: 9829-9836
[Abstract] [Full Text] -
Jankiewicz, M., Groner, B., Desrivieres, S.
(2006). Mammalian Target of Rapamycin Regulates the Growth of Mammary Epithelial Cells through the Inhibitor of Deoxyribonucleic Acid Binding Id1 and Their Functional Differentiation through Id2. Mol. Endocrinol.
20: 2369-2381
[Abstract] [Full Text] -
Zhao, Y., Johansson, C., Tran, T., Bettencourt, R., Itahana, Y., Desprez, P.-Y., Konieczny, S. F.
(2006). Identification of a Basic Helix-Loop-Helix Transcription Factor Expressed in Mammary Gland Alveolar Cells and Required for Maintenance of the Differentiated State. Mol. Endocrinol.
20: 2187-2198
[Abstract] [Full Text] -
Nieborowska-Skorska, M., Hoser, G., Rink, L., Malecki, M., Kossev, P., Wasik, M. A., Skorski, T.
(2006). Id1 transcription inhibitor-matrix metalloproteinase 9 axis enhances invasiveness of the breakpoint cluster region/abelson tyrosine kinase-transformed leukemia cells.. Cancer Res.
66: 4108-4116
[Abstract] [Full Text] -
Parrinello, S., Coppe, J.-P., Krtolica, A., Campisi, J.
(2005). Stromal-epithelial interactions in aging and cancer: senescent fibroblasts alter epithelial cell differentiation. J. Cell Sci.
118: 485-496
[Abstract] [Full Text] -
Sumida, T., Itahana, Y., Hamakawa, H., Desprez, P.-Y.
(2004). Reduction of Human Metastatic Breast Cancer Cell Aggressiveness on Introduction of Either Form A or B of the Progesterone Receptor and Then Treatment with Progestins. Cancer Res.
64: 7886-7892
[Abstract] [Full Text] -
Lofstedt, T., Jogi, A., Sigvardsson, M., Gradin, K., Poellinger, L., Pahlman, S., Axelson, H.
(2004). Induction of ID2 Expression by Hypoxia-inducible Factor-1: A ROLE IN DEDIFFERENTIATION OF HYPOXIC NEUROBLASTOMA CELLS. J. Biol. Chem.
279: 39223-39231
[Abstract] [Full Text] -
Zhang, K.-X., Ward, K. R., Schrader, J. W.
(2004). Multiple Aspects of the Phenotype of Mammary Epithelial Cells Transformed by Expression of Activated M-Ras Depend on an Autocrine Mechanism Mediated by Hepatocyte Growth Factor/Scatter Factor. Mol Cancer Res
2: 242-255
[Abstract] [Full Text] -
Coppe, J.-P., Itahana, Y., Moore, D. H., Bennington, J. L., Desprez, P.-Y.
(2004). Id-1 and Id-2 Proteins as Molecular Markers for Human Prostate Cancer Progression. Clin. Cancer Res.
10: 2044-2051
[Abstract] [Full Text] -
Shan, L., Yu, M., Qiu, C., Snyderwine, E. G.
(2003). Id4 Regulates Mammary Epithelial Cell Growth and Differentiation and Is Overexpressed in Rat Mammary Gland Carcinomas. Am. J. Pathol.
163: 2495-2502
[Abstract] [Full Text] -
Zhang, H., Rosdahl, I.
(2003). Ultraviolet A and B differently induce intracellular protein expression in human skin melanocytes--a speculation of separate pathways in initiation of melanoma. Carcinogenesis
24: 1929-1934
[Abstract] [Full Text] -
Fong, S., Itahana, Y., Sumida, T., Singh, J., Coppe, J.-P., Liu, Y., Richards, P. C., Bennington, J. L., Lee, N. M., Debs, R. J., Desprez, P.-Y.
(2003). Id-1 as a molecular target in therapy for breast cancer cell invasion and metastasis. Proc. Natl. Acad. Sci. USA
100: 13543-13548
[Abstract] [Full Text] -
Itahana, Y., Singh, J., Sumida, T., Coppe, J.-P., Parrinello, S., Bennington, J. L., Desprez, P.-Y.
(2003). Role of Id-2 in the Maintenance of a Differentiated and Noninvasive Phenotype in Breast Cancer Cells. Cancer Res.
63: 7098-7105
[Abstract] [Full Text] -
Shepherd, T. G., Nachtigal, M. W.
(2003). Identification of a Putative Autocrine Bone Morphogenetic Protein-Signaling Pathway in Human Ovarian Surface Epithelium and Ovarian Cancer Cells. Endocrinology
144: 3306-3314
[Abstract] [Full Text] -
Kashani-Sabet, M., Liu, Y., Fong, S., Desprez, P.-Y., Liu, S., Tu, G., Nosrati, M., Handumrongkul, C., Liggitt, D., Thor, A. D., Debs, R. J.
(2002). Identification of gene function and functional pathways by systemic plasmid-based ribozyme targeting in adult mice. Proc. Natl. Acad. Sci. USA
99: 3878-3883
[Abstract] [Full Text] -
Navarro, M., Valentinis, B., Belletti, B., Romano, G., Reiss, K., Baserga, R.
(2001). Regulation of Id2 Gene Expression by the Type 1 IGF Receptor and the Insulin Receptor Substrate-1. Endocrinology
142: 5149-5157
[Abstract] [Full Text] -
Wilson, J. W., Deed, R. W., Inoue, T., Balzi, M., Becciolini, A., Faraoni, P., Potten, C. S., Norton, J. D.
(2001). Expression of Id Helix-Loop-Helix Proteins in Colorectal Adenocarcinoma Correlates with p53 Expression and Mitotic Index. Cancer Res.
61: 8803-8810
[Abstract] [Full Text] -
Parrinello, S., Lin, C. Q., Murata, K., Itahana, Y., Singh, J., Krtolica, A., Campisi, J., Desprez, P.-Y.
(2001). Id-1, ITF-2, and Id-2 Comprise a Network of Helix-Loop-Helix Proteins That Regulate Mammary Epithelial Cell Proliferation, Differentiation, and Apoptosis. J. Biol. Chem.
276: 39213-39219
[Abstract] [Full Text] -
Krtolica, A., Parrinello, S., Lockett, S., Desprez, P.-Y., Campisi, J.
(2001). Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging. Proc. Natl. Acad. Sci. USA
10.1073/pnas.211053698v1
[Abstract] [Full Text] -
Prisco, M., Peruzzi, F., Belletti, B., Baserga, R.
(2001). Regulation of Id Gene Expression by Type I Insulin-Like Growth Factor: Roles of STAT3 and the Tyrosine 950 Residue of the Receptor. Mol. Cell. Biol.
21: 5447-5458
[Abstract] [Full Text] -
Ouyang, X.S., Wang, X., Lee, D.T.W., Tsao, S.W., Wong, Y.C.
(2001). Up-regulation of TRPM-2, MMP-7 and ID-1 during sex hormone-induced prostate carcinogenesis in the Noble rat. Carcinogenesis
22: 965-973
[Abstract] [Full Text] -
Beger, C., Pierce, L. N., Kruger, M., Marcusson, E. G., Robbins, J. M., Welcsh, P., Welch, P. J., Welte, K., King, M.-C., Barber, J. R., Wong-Staal, F.
(2001). Identification of Id4 as a regulator of BRCA1 expression by using a ribozyme-library-based inverse genomics approach. Proc. Natl. Acad. Sci. USA
98: 130-135
[Abstract] [Full Text] -
Resto, V. A., Caballero, O. L., Buta, M. R., Westra, W. H., Wu, L., Westendorf, J. M., Jen, J., Hieter, P., Sidransky, D.
(2000). A Putative Oncogenic Role for MPP11 in Head and Neck Squamous Cell Cancer. Cancer Res.
60: 5529-5535
[Abstract] [Full Text] -
Béliveau, A., Bérubé, M., Rousseau, A., Pelletier, G., Guérin, S. L.
(2000). Expression of Integrin {alpha}5{beta}1 and MMPs Associated with Epithelioid Morphology and Malignancy of Uveal Melanoma. IOVS
41: 2363-2372
[Abstract] [Full Text] -
Lin, C. Q., Singh, J., Murata, K., Itahana, Y., Parrinello, S., Liang, S. H., Gillett, C. E., Campisi, J., Desprez, P.-Y.
(2000). A Role for Id-1 in the Aggressive Phenotype and Steroid Hormone Response of Human Breast Cancer Cells. Cancer Res.
60: 1332-1340
[Abstract] [Full Text] -
Norton, J.
(2000). ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J. Cell Sci.
113: 3897-3905
[Abstract] -
Maruyama, H., Kleeff, J., Wildi, S., Friess, H., Buchler, M. W., Israel, M. A., Korc, M.
(1999). Id-1 and Id-2 Are Overexpressed in Pancreatic Cancer and in Dysplastic Lesions in Chronic Pancreatitis. Am. J. Pathol.
155: 815-822
[Abstract] [Full Text] -
Singh, J., Itahana, Y., Parrinello, S., Murata, K., Desprez, P.-Y.
(2001). Molecular Cloning and Characterization of a Zinc Finger Protein Involved in Id-1-stimulated Mammary Epithelial Cell Growth. J. Biol. Chem.
276: 11852-11858
[Abstract] [Full Text] -
Belletti, B., Prisco, M., Morrione, A., Valentinis, B., Navarro, M., Baserga, R.
(2001). Regulation of Id2 Gene Expression by the Insulin-like Growth Factor I Receptor Requires Signaling by Phosphatidylinositol 3-Kinase. J. Biol. Chem.
276: 13867-13874
[Abstract] [Full Text] -
Woo, P. L., Cercek, A., Desprez, P.-Y., Firestone, G. L.
(2000). Involvement of the Helix-Loop-Helix Protein Id-1 in the Glucocorticoid Regulation of Tight Junctions in Mammary Epithelial Cells. J. Biol. Chem.
275: 28649-28658
[Abstract] [Full Text] -
Krtolica, A., Parrinello, S., Lockett, S., Desprez, P.-Y., Campisi, J.
(2001). Senescent fibroblasts promote epithelial cell growth and tumorigenesis: A link between cancer and aging. Proc. Natl. Acad. Sci. USA
98: 12072-12077
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»