Previous Article | Next Article 
Mol Cell Biol, August 1998, p. 4589-4596, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Murine Adseverin (D5), a Novel Member of the Gelsolin Family,
and Murine Adseverin Are Induced by Interleukin-9 in
T-Helper Lymphocytes
Johan
Robbens,1
Jamila
Louahed,2
Kathleen
De
Pestel,1
Inge
Van
Colen,1
Christophe
Ampe,1
Joel
Vandekerckhove,1 * and
Jean-Christophe
Renauld2
V. I. B., Flanders Interuniversity
Institute for Biotechnology and Department of Biochemistry, Faculty of
Medicine, Universiteit Gent, B-9000 Gent,1 and
Ludwig Institute for Cancer Research, Brussels Branch, and
Experimental Medicine Unit, University of Louvain-in-Brussels B-1200
Brussels,2 Belgium
Received 6 November 1997/Returned for modification 30 January
1998/Accepted 12 May 1998
 |
ABSTRACT |
We identified a number of upregulated genes by differential
screening of interleukin-9-stimulated T-helper lymphocytes.
Interestingly, two of these messengers encode proteins that are similar
to proteins of the gelsolin family. The first displays a typical
structure of six homologous domains and shows a high level of identity
(90%) with bovine adseverin (or scinderin) and may therefore be
considered the murine adseverin homolog. The second encodes a protein
with only five segments. Sequence comparison shows that most of the fifth segment and a short amino-terminal part of the sixth segment (amino acids 528 to 628 of adseverin) are missing, and thus, this form
may represent an alternatively spliced product derived from the same
gene. The corresponding protein is called mouse adseverin (D5). We
expressed both proteins in Escherichia coli and show that
mouse adseverin displays the typical characteristics of all members of
the gelsolin family with respect to actin binding (capping, severing,
and nucleation) and its regulation by Ca2+. In contrast,
mouse adseverin (D5) fails to nucleate actin polymerization, although
like mouse adseverin and gelsolin, it severs and caps actin filaments
in a Ca2+-dependent manner. Adseverin is present in all of
the tissues and most of the cell lines tested, although at low
concentrations. Mouse adseverin (D5) was found only in blood cells and
in cell lines derived from T-helper lymphocytes and mast cells, where it is weakly expressed. In a gel filtration experiment, we demonstrated that mouse adseverin forms a 1:2 complex with G actin which is stable
only in the presence of Ca2+, while no stable complex was
observed for mouse adseverin (D5).
 |
INTRODUCTION |
Gelsolins form a highly conserved
family of multifunctional actin binding proteins. Most of the
properties of these proteins were derived from in vitro and in vivo
studies on plasma and macrophage gelsolin. Gelsolin is characterized by
a typical organization of six homologous domains, each containing
approximately 125 amino acids residues (19, 40). Two G-actin
binding domains and a single F-actin binding site have been assigned to
segments S1, S4 to S6, and S2 and S3, respectively (20, 41,
45). The amino-terminal half of gelsolin (S1 to S3) is important
for severing and capping, while the carboxy-terminal part (S4 to S6) is
necessary for efficient nucleation (41). The interactions
with actin are regulated by Ca2+ and phosphatidylinositol
4,5-bisphosphate (15, 16). This led to the concept that the
cytoplasmic form of gelsolin is an important regulator of subcortical
actin cytoskeleton organization, connecting the phosphoinositide status
with actin polymerization, and that it is a key player in signal
transduction (9, 12, 18).
Gelsolin has been implicated in a number of pathologies. For instance,
familiar Finnish-type amyloidosis results from a single point mutation
at position 654 of gelsolin, where Asp replaces Asn (29).
Human cell carcinomas of the bladder have been correlated with deletion
of the gelsolin gene. Consequently, tumor suppression was obtained by
gelsolin transfection (36). In similar experiments, the
tumorigenicity of ras-transformed cells was suppressed by genetic transfection with gelsolin-His321, a mutant with a Pro-to-His substitution at position 321 (27). Transgenic gelsolin null mice show normal embryonic development and longevity. However, the
observed phenotypes emphasize the importance of gelsolin for rapid
motile processes in cell types involved in stress response such as
homostasis, inflammation, and wound healing (42). Members of
the gelsolin family are also found in invertebrates, e.g., Physarum polycephalum (2),
Dictyostelium sp. (43), Homerus americanus (23), and Lumbricus terrestris
(11). Here, the predominant forms consist of only three
segments, but they appear to share all of the actin binding properties
of vertebrate gelsolin, including severing, capping, and nucleation
(2, 3, 10, 38).
Interleukin-9 (IL-9) is a pleiotropic cytokine produced by activated
T-helper type 2 lymphocytes and was originally identified by its
ability to stimulate the proliferation of murine T-cell clones and mast
cell lines (14, 39). More recently, in an attempt to better
characterize the activity of IL-9 on mouse T-helper lymphocytes, we
identified four genes whose expression is induced by IL-9, but not by
IL-2 or IL-3, in cytokine-dependent T-cell clones and mast cells
(22). Three of these genes correspond to granzymes A and B
and the
chain of the high-affinity receptor for immunoglobulin E
(IgE) (Fc
Rl
). The fourth gene encodes a previously unknown murine
protein.
In this report, we present the sequence and functional characterization
of this IL-9-induced protein, comparison of whose sequence suggests
that it is the murine homolog of adseverin or scinderin. We found that
mouse adseverin displays most of the typical gelsolin properties. It is
able to form a stable 1:2 complex with G actin, but unlike that
formed by gelsolin, the complex completely dissociates upon
Ca2+ chelation. In addition, we isolated another
IL-9-upregulated protein which we call mouse adseverin (D5). It is a
novel gelsolin family member with only five segments, lacking most of
the fifth domain and part of the sixth segment. It has lost its ability to nucleate actin polymerization and to form a stable complex with G
actin; however, it still displays Ca2+-dependent capping
and severing activities.
 |
MATERIALS AND METHODS |
Cell culture.
TS2 and TS3 are factor-dependent T-helper cell
clones derived from clones TUC5.37 and TUC7.33, respectively, by
culturing cells in the absence of antigen in medium supplemented with
IL-9 and IL-3 (22, 39). Cultures were maintained in
Dulbecco's modified Eagle medium supplemented with 10% fetal calf
serum, 50 µM 2-mercaptoethanol, 0.55 mM L-arginine, 0.24 mM L-asparagine, and 1.25 mM L-glutamine.
Cell lines were kindly provided as follows: T-helper clone ST2K9
(33) by E. Schmitt (Johannes Gutenberg-Universität,
Mainz, Federal Republic of Germany); IL-9-dependent mast cell lines
L138 and MC-9 by L. Hültner (Forschungszentrum für
Umwelt und Gesundheit GmbH, Munich, Federal Republic of Germany) and C. Petit-Frère (Institut Henri Beaufour, Les Ullys, France),
respectively; macrophage cell line PU5.8 by L. Franssen (Innogenetics,
Gent, Belgium); and the EL4 lymphoma cell line by H. R. MacDonald
(Ludwig Institute for Cancer Research, Lausanne, Switzerland).
Mouse bone marrow-derived mast cells were obtained by culturing bone
marrow from BALB/c mice for 2 to 4 weeks in enriched medium (RPMI 1640 medium containing 0.1 mM nonessential amino acids, 2 mM
L-glutamine, 100 µg/ml penicillin, 100-µg/ml
streptomycin, 10-µg/ml gentamicin, 50 µM 2-mercaptoethanol, and
20% fetal calf serum supplemented with either 1-ng/ml IL-3 [Biogen,
Geneva, Switzerland] alone or in combination with IL-9 [5 ng/ml]).
Fluorescence-activated cell sorter analysis of these cells showed
homogeneous staining by biotinylated IgE and no staining with
anti-Mac1, anti-Mac2, anti-Mac3, and Thy1 antibodies.
Construction and screening of a cDNA library.
The
differential hybridization approach used for isolation of IL-9-induced
genes has been described previously (22). Briefly, TS2 cells
are washed and deprived of growth factor for 14 h before stimulation with IL-9 for 24 h. A cDNA library was constructed in
a BstXI- and NotI-digested plasmid derived from
pSVK3 (Pharmacia, Uppsala, Sweden). Aliquots from the cDNA library
containing about 1,000 individual colonies were plated onto
nitrocellulose membranes (Schleicher & Schuell, Inc.). Triplicates of
each membrane were prepared, and two of them were treated as previously
described (4) to allow hybridization with either a negative
or a positive probe consisting of a single-stranded,
32P-labelled cDNA probe prepared from poly(A) RNA isolated
from TS2 cells stimulated with IL-2 (negative probe) or IL-9 (positive probe). Colonies exhibiting differential hybridization to the positive
and negative probes were selected for further analysis by Northern blot
hybridization.
Preparation of mRNA and Northern analysis.
Total cellular
mRNA prepared by the guanidinium-CsCl method (4) was
fractionated by electrophoresis in a 1.3% agarose gel containing 2.2 M
formaldehyde and transferred to Hybond nylon. cDNA inserts were
labelled with the Multiprime DNA labelling kit from Amersham. The
filters were hybridized at 60°C in a solution of 10% (wt/vol)
dextran sulfate; 1 M NaCl, 1% sodium dodecyl sulfate (SDS), and
200-µg/ml denatured salmon sperm. After autoradiography, blots were
reprobed with a
-actin-specific probe to check the amount of RNA.
DNA sequencing and analysis.
Sequencing was performed by the
dideoxy sequencing technique, using the T7 sequencing kit (Pharmacia)
on CsCl-purified plasmid DNA with primers flanking the cloning sites.
Further sequence analysis was performed on clones resulting from
exonuclease III digestion using the Erase-a-Base kit (Promega).
Characterization of the 5' end of mouse adseverin cDNA sequences was
done by using the 5' Amplifinder Race kit (Clontech). Searches of the
GenBank and EMBL databases were performed with the FASTA program.
Identity matrices were calculated with pileup and distances in the GCG Wisconsin package.
Preparation of RNA from organs of C3H/HeJ mice.
Several
organs were dissected from male and female C3/HeJ mice and
immediately frozen in liquid nitrogen. Organs were homogenized in a
mortar with 6 M guanidinium isothiocyanate with sea sand as previously
described (4, 21). After centrifugation of the debris, the
RNA was pelleted by ultracentrifugation (SW-28 rotor, 113,000 × g) and solubilized in 200 µl of
diethylpyrocarbonate-treated water.
RT-PCR.
Samples (1 µg) of RNA were taken from the
different tissues, and first-strand cDNA was prepared by the use
of Moloney leukemia murine virus reverse transcriptase (RT;
SuperscriptII; Gibco Bethesda Research Laboratories [BRL]) and
oligo(dT)12-18 as a primer. Half of the final volume (10 µl) was used
for PCR. The sequences of the primers
(5'tacatcacggagaaagtggctcagataaagcag3' and
5'ctcgtgcccttgcttgatgatgacaat3') correspond to sequences 1185 and 2171, respectively, in adseverin. In adseverin (D5), they correspond to
sequences 1185 and 1871, respectively. The amplified fragments were
analyzed on a 1% agarose gel. They had sizes of 986 and 686 bp,
respectively. The amplified fragments were blotted onto nitrocellulose,
and Southern blotting was performed as described by Ausubel et al.
(4). The probe was derived from the SstI fragment
of mouse adseverin that was isolated and randomly primed in accordance
with the manufacturer's (Boehringer Mannheim) instructions. The probes
for the dynamitin control experiment were dyn01
(5'gtagaactgttgcaagccaaagtga3') and dyn02 (5'ctttcccagcctcttcatccgag3')
and were designed for the expressed sequence tag of dynamitin,
vi64g01.r1.
Selective amplification of adseverin (D5).
A 0.5-µg sample
of IL-9-stimulated TS2 cell RNA was taken, and first-strand cDNA was
prepared as described above. Half of the final volume (10 µl) was
used for PCR. The backward primers corresponding to the flanking region
of the spliced-out fragment in adseverin (D5) had the following
sequences: D3, 5'aatctc3'; D5, 5'tcaatctcca3';
D7, 5'cttcaatctccaca3'; D10,
5'cttcttcaatctccacaatt3'; D15,
5'cggaacttcttcaatctccacaattctggt3'; D20,
5'tctcccggaacttcttcaatctccacaattctggtgatag3'; d5/25,
5'gtgaactctcccggaacttcttcaatctcca3'; d10/20,
5'tctcccggaacttcttcaatctccacaatt3'. pDpcr
(5'cccacagg agaggaagactgccatgaagacagctgaggag3') was
used as the forward primer. The control backward primers were
Dcontr1 (5'gcatcaacgtcaacctccacaattctggtg3') and Dcontr2
(5'cccggaacttcttcaataatgaatcttccag3'), which correspond to
the sequence of adseverin. PCRs were performed with Taq DNA
polymerase in accordance with the manufacturer's (Gibco BRL)
instructions, although the number of reaction cycles was
restricted to 15. The amplified fragments were analyzed on a 1.5%
agarose gel.
Cloning and expression of mouse adseverin and adseverin (D5) in
E. coli.
Plasmid p9016 was digested with
NcoI/SstI and SstI/NsiI,
and the adseverin-encoding fragments were ligated into
NcoI/PstI-opened vector pSE380 (1),
resulting in plasmid pSEGLP.
The
Eco0109/
BsmI fragment of plasmid p9034,
encoding mouse adseverin (D5), was exchanged with the
Eco0109/
BsmI fragment of
plasmid pSEGLP,
resulting in plasmid pSEGLP (D5).
E. coli MC1061
[F
ara
139

(
ara-leu)
7697
lacX74 galU galK
hsdR2(r
K
m
K+)
mcrB1 rpsL Str
+] was used as the transformation
host.
Purification of recombinant mouse adseverin and adseverin (D5)
from E. coli.
A single colony of E. coli MC1061
harboring plasmid pSEGLP or pSEGLP(D5) was picked from a freshly
transformed plate. A preculture was grown overnight and diluted 50 times in 1.8 liters of Luria-Bertani medium containing the antibiotic
triacillin (Gibco-BRL) at a concentration of 100 µg/ml. Upon a cell
density of 2.5 × 108/ml,
isopropyl-
-D-thiogalactopyranoside was added to a final concentration of 1 mM, after which the bacteria were grown for another
4 h. Cells were collected by centrifugation and resuspended in 40 ml of buffer A (25 mM Tris-HCl [pH 7.5], 0.5 mM CaCl2, 50 mM NaCl) plus 1 mM phenylmethylsulfonyl fluoride (PMSF) or a protease inhibitor mixture (300-µg/ml leupeptin, 100-µg/ml pepstatin, 100 mM
benzamidine, 50-µg/ml antipain) in the case of mouse adseverin (D5).
The cells were opened by being passed twice through a French press
(Aminco, Danvers, Mass.). Mouse adseverin was purified after removal of
cell debris by centrifugation; the proteins in the supernatant were
precipitated with 40% (wt/vol) ammonium sulfate. The protein pellet
was solubilized in 40 ml of buffer A-1 mM PMSF and dialyzed against 1 liter of the same buffer (with three changes). Dialyzed proteins were
loaded on a DEAE column that had previously been equilibrated with
buffer A. The flowthrough of the column, containing adseverin, was
dialyzed against buffer B (25 mM Tris-HCl [pH 8.5], 50 mM NaCl, 1 mM
EGTA) plus 1 mM PMSF and loaded onto a second DEAE column that had been
equilibrated with this buffer. Here, too, adseverin was found in the
flowthrough, and the corresponding fraction was passed on to a Mono Q
column (HR5/5; Pharmacia) that had previously been equilibrated with
buffer B and was eluted with a gradient of NaCl. Adseverin eluted at
around 190 mM NaCl and was more than 95% pure. During purification,
activity was tested with the falling-ball assay (24).
E. coli bacteria containing pSEGLP(D5) were grown and lysed
as described above, except that the bacteria were passed four
times
through a French press. Mouse adseverin (D5) was purified
from
inclusion bodies. These were washed twice in each of the
following
solutions: buffer C (25 mM Tris-HCl [pH 6.5], 1 mM EGTA,
25 mM
NaCl), buffer C plus 0.475 M NaCl, buffer C plus 0.975 M
NaCl, buffer
C, buffer C plus 0.5 M urea, and buffer C. The washed
inclusion bodies,
enriched for adseverin (D5), were solubilized
in buffer C containing 10 mM dithiothreitol, protease inhibitor
(see above), and 8 M urea. After
overnight dialysis against buffer
C with 6 M urea, the proteins were
loaded onto a DEAE column (2.5
by 10 cm) that had previously been
equilibrated with the same
buffer. The flowthrough of the column, which
contained adseverin
(D5), was dialyzed against the same buffer at pH
8.0 and loaded
onto a gel filtration column (Superdex 200; Pharmacia).
This procedure
yielded a protein more than 95% pure, as estimated by
SDS-polyacrylamide
gel electrophoresis (PAGE). The purified protein was
renatured
by stepwise dialysis against 4, 2, and 0 M urea (in buffer
C),
yielding soluble and biologically active mouse adseverin (D5).
Amino-terminal amino acid sequence determination.
Bacterially expressed proteins were separated by SDS-PAGE, and blotted
onto Problot membranes as described by Bauw et al. (5). The
appropriate band was cut out, and the amino-terminal amino acid
sequence was determined by Edman degradation on an A470 gas-phase
sequenator equipped with a 120A on-line phenylthiohydantoin amino acid
analyzer (Applied Biosystems, Foster City, Calif.) in accordance with
the instructions of the manufacturer.
Actin preparation.
Actin was prepared from cow muscle as
described by Spudich and Watt (34). Actin was kept in G
buffer (2 mM Tris-HCl [pH 7.6], 0.2 mM ATP, 0.5 mM 2-mercaptoethanol,
0.2 mM CaCl2). Labelling of actin with
N-pyrenyliodoacetamide was performed as described by Brenner
and Korn (6).
Nucleating, severing, and capping activities of mouse adseverin
and adseverin (D5).
All fluorescence measurements with
pyrene-labeled actin were performed at room temperature with an SFM25
fluorimeter (Kontron Instruments, Zurich, Switzerland). The excitation
and emission wavelengths were 365 and 388 nm, respectively. Human
plasma gelsolin was purified as described by Bryan (7) and
used as a control. Assays were performed as follows. For the nucleation
assay, 6 µM actin (10% pyrene labelled) was preincubated with
mouse adseverin, mouse adseverin (D5), or human gelsolin at a 1:1,000
molar ratio at room temperature for 10 min. The total volume was
adjusted to 675 µl with G buffer. Polymerization was initiated by
addition of 75 µl 10-fold-concentrated F buffer (final
concentrations, 100 mM KCl and 2 mM MgCl2), and the
increase in fluorescence was measured. Assays were performed in the
presence of Ca2+ or EGTA at a concentration of 0.2 or 2 mM,
respectively.
For the severing assay, 8 µM actin (25% pyrene labelled) in 675 µl
of G buffer was allowed to polymerize by addition of 75
µl of
10-fold-concentrated F buffer. After 15 min, human gelsolin
was added
at a molar ratio of 1:300 (final concentration, 26 nM)
and the mixture
was kept on ice overnight in order to equilibrate.
Subsequently, these
precapped filaments were diluted 20 times
in 750 µl of G buffer with
Ca
2+ or EGTA in the absence or presence (5 nM final
concentration)
of adseverin or adseverin (D5), and the fluorescence was
measured.
For the capping assay, F actin (final concentration, 1.2 µM) nuclei
were prepared as follows. A 40 µM actin stock (150 µl)
was mixed
with 4.5 ml of G buffer. A 0.5-ml sample of
10-fold-concentrated
F buffer was added to initiate polymerization, and
the mixture
was kept on ice overnight. A 262-µl volume of these
nuclei was
mixed with 52.5 µl of actin (25% pyrene labelled) to a
final concentration
of 3 µM. Polymerization was initiated by
adding 35 µl of 10-fold-concentrated
F buffer in the absence or
presence (3 nM final concentration)
of adseverin or adseverin (D5), and
the fluorescence was measured.
Mouse adseverin and adseverin (D5) complex formation with G
actin.
A 182-µl volume of mouse adseverin (concentration, 0.5 mg/ml) or 1 ml of mouse adseverin (D5) (concentration, 0.1 mg/ml) was mixed with 78 µl of G actin (concentration, 1.28 mg/ml) in a
collodion bag (Sartorius AG) and dialyzed overnight against a buffer
containing 2 mM Tris, 10 mM CaCl2, 50 mM NaCl, 0.2 mM
dithiothreitol, and 0.2 mM ATP. The mixture was loaded onto a Superdex
200 gel filtration column (Pharmacia) equilibrated and run with the
same buffer, and the fractions were analyzed by SDS-PAGE. To determine
the role of Ca2+ in complex formation, we performed
the same experiment but with a buffer containing 2 mM Tris, 30 mM EGTA,
50 mM NaCl, 0.2 mM DTT, and 0.2 mM ATP.
 |
RESULTS |
IL-9 upregulates the expression of a member of the gelsolin family
in T cells.
Based on specific or upregulated expression in
IL-9-stimulated T cells, we previously identified and isolated four
genes. Three of them corresponded to granzyme A, granzyme B, and the
chain of the high-affinity receptor for IgE (Fc
RI
)
(22). The sequence of the fourth IL-9-induced gene did not
show a perfect match to any of the DNA sequences in the GenBank and
EMBL databases but, interestingly, displayed similarity to gelsolin and
adseverin. Initially, we identified two independent cDNA clones by
differential screening methods (clones 9016 and 9034). We used these
clones for further screening of the same library and isolated seven
cDNAs independently; the 5' part was obtained by rapid
amplification of 5' cDNA ends. Four of these clones contained the same
2,144-nucleotide open reading frame, encoding a protein of 715 amino
acid residues (calculated mass, 80,293 Da) (Fig.
1). Comparison of the complete sequence
with the information stored in the SwissProt database showed high
degrees of identity with bovine adseverin (90%) and bovine scinderin
(88%), both members of the gelsolin family. These proteins are known
to be important regulators of the subcortical microfilament network
(31, 32). We propose that these clones encode murine
adseverin, although we cannot exclude the possibility that we
identified a novel variant of adseverin. Identity scores with
adseverin, scinderin, and other members of the gelsolin family are
shown in Table 1.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Amino acid sequence of mouse adseverin (GenBank
accession no. U04354). The sequence missing in mouse adseverin (D5)
(GenBank accession no. Y13971) corresponds to amino acids 528 to 628 and is underlined. Superscripts indicate the different domains in
accordance with the plasma gelsolin crystal structure (8).
|
|
Like several members of the gelsolin family, mouse adseverin displays
the characteristic repeat of the six homologous domains
(
19), each containing the three conserved sequence motifs
initially
defined by Ampe and Vandekerckhove (
2) in fragmin
and by Way
and Weeds (
40) in porcine gelsolin. The two
putative polyphosphoinositide
binding sites described for gelsolin
(
46) and villin (
17)
are also present in the
corresponding regions of mouse adseverin
albeit that the second one is
less conserved (Fig.
2).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the sequences of the PIP2 binding sites of
different actin binding proteins (17, 45, 46). PIP2 binding
sites are underlined.
|
|
Interestingly, in three of the seven independently isolated cDNA clones
we observed the same internal deletion of 300 nucleotides
in the coding
region. This deleted segment corresponds to most
of the fifth domain
and a short amino-terminal part of the sixth
segment of mouse adseverin
(amino acids 528 to 628 of adseverin)
(Fig.
1). The corresponding
protein is hereafter referred to as
mouse adseverin (D5). It
contains 615 amino acids and has a molecular
weight of 69,150. Given
the fact that three of the seven clones,
each unique isolates, encode
this variant, it is unlikely that
we observed a cloning artifact, but
rather, we believe that the
shorter mRNA results from an alternative
splicing event and represents
the first naturally occurring
five-segmented member of the gelsolin
family (see also the Discussion).
Mouse adseverin is expressed in various cell lines and tissues but
at low levels; mouse adseverin (D5) is present only in blood
cells.
We first measured mouse adseverin RNA transcript expression
in various IL-9-responsive cell lines by Northern blot analysis (Fig.
3A) and found that in T-cell clones (TS2
and TS3) and mast cell lines (L138 and MC9) adseverin was significantly
upregulated by IL-9. We observed the same effect with freshly derived
mast cells in the presence of IL-3 and IL-9 but not with mast cells in
the presence of IL-3 alone. In contrast, we observed no expression of
mouse adseverin in the PU5.8 murine macrophage cell line or in the EL4
lymphoma cell line, even after IL-9 stimulation. Macrophages are a good
source from which to purify cytoplasmic gelsolin (44, 45);
thus, there is no cross-hybridization between the cytoplasmic gelsolin
mRNA and the mouse adseverin probe. Closer inspection of the Northern
blots of the T cells (TS2) and mast cells (L138 and MC9) reveals a
fainter signal of a band with a smaller size, which may represent mouse
adseverin (D5) mRNA (Fig. 3A). By using different primers with
sequences corresponding to the regions flanking the spliced-out
fragment and applying short PCR conditions, we were able to selectively
amplify adseverin (D5) cDNA from IL-9-induced TS2 cells in an RT-PCR
experiment (Fig. 3B).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
(A) The IL-9-responsive cell lines indicated were
cultured in the presence of saturating concentrations of the indicated
cytokines for at least 3 days. After electrophoresis of 10 µg of
total RNA and transfer to nitrocellulose, the filter was hybridized
with a specific 32P-labelled mouse adseverin cDNA probe.
Hybridization with a -actin probe was used as a control to compare
the amounts of RNA in the lanes. (B) Selective amplification of
adseverin (D5) cDNA. RT-PCR of total RNA of IL-9-induced TS2 cells.
pDpcr was used as the forward primer. The sequences of the different
primers are described in Materials and Methods. Lanes: 1, primer D3; 2, primer D5; 3, primer D7; 4, primer D10; 5, primer D15; 6, primer D20;
7, primer d5/25; 8, primer d10/20; 9, primer Dcontr1; 10, primer
Dcontr2.
|
|
We also prepared RNAs from several organs or tissues from male and
female mice but failed to detect any positive signal for
either
adseverin or adseverin (D5) in a Northern blot (data not
shown). With
the more sensitive RT-PCR technique, we were able
to amplify a 986-bp
adseverin fragment in liver, kidney, spleen,
intestine, and muscle
samples (Fig.
4A). Via Southern blotting
of the same amplified PCR fragments, we detected a signal in all
of the
tissues examined (Fig.
4C). The absence of a signal in
conventional
Northern blots and the positive results obtained
by RT-PCR indicate
that the adseverin message is only present
at low levels in the tissues
analyzed. In the case of the adseverin
(D5) variant, we detected only a
faint band of the amplified fragment
in blood cells by Southern
blotting (Fig.
4B), which is in accordance
with the fact that we picked
up both forms from a T-lymphocyte
library. All other tissues were
negative (Fig.
4C). This further
supports the notion that the message
encoding mouse adseverin
(D5) is indeed present in vivo.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 4.
(A) RT-PCR of RNAs prepared from different organs and
tissues. The methods and linkers used are described in Materials and
Methods. (A) Upper lanes: 1, blood; 2, heart; 3, liver; 4, lung; 5, kidney; 6, pancreas; 7, intestine; 8, thymus. Lower lanes: 9, muscle;
10, spleen; 11, brain; 12, testis; 13, ovary; 14, skin; 15, uterus; 16, pancreas; 17, negative control (linkers). (B) Southern blot of
RT-PCR fragment of RNA from blood cells. (C) Southern blot of RT-PCR
fragments of different tissues. Lanes: 1, heart; 2, lung; 3, pancreas;
4, thymus; 5, brain; 6, ovary; 7, skin; 8, uterus; 9, pancreas; 10, liver; 11, kidney; 12, intestine; 13, muscle; 14, spleen. The
arrow indicates the amplified adseverin band.
|
|
A control RT-PCR experiment was performed with primers against a
dynamitin expressed sequence tag. Dynamitin is a low-abundance
household protein. We were able to amplify a band of 423 bp in
all
tissues (Fig.
5).

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Agarose (2.5%) gel of RT-PCR fragments of different
tissues. Lanes: 1, blood; 2, heart; 3, liver; 4, lung; 5, kidney; 6, pancreas; 7, intestine; 8, thymus; 9, muscle; 10, spleen; 11, brain;
12, testis; 13, ovary; 14, skin; 15, uterus; 16, pancreas.
|
|
Expression and purification of recombinant mouse adseverin and
adseverin (D5) in E. coli.
Upon expression of adseverin in
E. coli about half of the recombinant protein is in the
insoluble fraction. In addition, this fraction contained another
induced protein with a mass of about 49,000 Dal resulting from internal
initiation at amino acid 307, as determined by amino-terminal amino
acid sequencing of electroblotted protein. For adseverin (D5), a larger
amount of the protein was present in the insoluble fraction, as was a
similar initiation form.
We tried to purify adseverin by the procedure described for gelsolin by
Bryan (
7), in which extracts are successively passed
over a
DEAE column in the presence or absence of Ca
2+. Under these
conditions, gelsolin is not retained by the first
column but is by the
second. In contrast, adseverin is present
in the flowthrough of a DEAE
column regardless of whether Ca
2+ is present or not.
Nevertheless, these purification steps proved
very efficient because
most of the contaminating proteins were
removed. Mouse adseverin was
further purified on a Mono Q column.
Since recombinant mouse adseverin (D5) was deposited mainly in
inclusion bodies, we used these as starting material. We solubilized
them in 8 M urea and purified the protein under denaturating conditions
by using ion-exchange chromatography and gel filtration. After
purification in the presence of urea, we renatured adseverin (D5)
in a
stepwise fashion, yielding soluble and active protein (Fig.
6).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 6.
SDS-PAGE of purified proteins. Lanes: 1, molecular size
markers; 2, adseverin; 3, adseverin (D5). kd, kilodaltons.
|
|
Characterization of the actin binding properties of mouse adseverin
and adseverin (D5); the latter does not nucleate actin polymerization
in vitro.
Initially, we assayed the different proteins in a
falling-ball experiment indicating that they are all active
(24) (Table 2). In addition,
we examined the effects of both proteins on actin polymerization by
using pyrenyl-labelled actin (Fig. 7). In
all experiments, we employed human plasma gelsolin as a reference. We
first investigated the ability of adseverin and adseverin (D5) to cap
actin filaments. We prepared F-actin nuclei with a final concentration
of 1.2 µM. These nuclei were added to 1.8 µM pyrenyl-actin (25%
labelled) in the presence of the different actin binding proteins at 3 nM under polymerization conditions. Filament capping results in slower
polymerization and a slower increase in the associated fluorescence,
which is what we observed for both mouse adseverin and adseverin (D5),
but only in the presence of Ca2+ (Fig. 7A).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Characterization of the different actin binding
properties of mouse adseverin and adseverin (D5) in the presence of
Ca2+. Assays were done as described in Materials and
Methods. Symbols: , adseverin; , gelsolin; , adseverin (D5)
, negative control (contains only actin). Rel., relative.
|
|
For the severing assay, we used actin filaments precapped with
gelsolin. After reaching equilibrium, the samples were diluted
below
the critical monomer concentration of the pointed end in
low-salt
buffer containing either adseverin or adseverin (D5)
in the presence or
absence of Ca
2+. Severing results in the generation of new
pointed ends which
will depolymerize under the conditions used while no
polymerization
or depolymerization will take place at the capped plus
end. We
only observed a faster decrease in fluorescence, indicative of
depolymerization, in samples containing adseverin or adseverin
(D5) and
Ca
2+, and the latter protein seems to sever slightly more
efficiently
(Fig.
7B).
It is known that gelsolin nucleates actin polymerization. This results
in the reduction of the lag phase for actin polymerization
typically
observed in vitro. Likewise, we assayed the nucleating
capacities of
adseverin and adseverin (D5) and observed little
difference between the
actin-nucleating activities of gelsolin
and adseverin. Interestingly,
adseverin (D5) was completely inactive
with respect to the in vitro
induction of actin polymerization
(Fig.
7C).
Characterization of the complexes of mouse adseverin and adseverin
(D5) formed with G actin.
We determined the complexes formed by
adseverin and adseverin (D5) with G actin via gel filtration. In the
case of adseverin, after mixing the protein with G actin, we detected a
protein peak of 170 kDa corresponding to the 1:2 adseverin-actin
complex. After addition of EGTA, we detected only two protein peaks,
one of approximately 80 kDa and another of approximately 45 kDa,
containing adseverin and actin, respectively. This indicates that
complete dissociation of the complex occurred and no 1:1 EGTA-resistant
complex was found, which is in contrast with most members of the
gelsolin family. In the case of adseverin (D5), we did not detect a
stable complex with G actin in a gel filtration experiment, regardless of the presence or absence of Ca2+.
 |
DISCUSSION |
In a search for proteins that are induced by IL-9 treatment of
murine T-helper cells, we identified two members of the gelsolin family: mouse adseverin and adseverin (D5). Mouse adseverin is characterized by a typical six-domain organization and is likely to be
the murine homolog of bovine adseverin (also called scinderin), given
its high level of identity with this protein. Although the expression
level of mouse adseverin is significantly upregulated in T-helper
cells, hence its detection, it is expressed at a low level but
constitutively in other cells. We demonstrated its presence in all of
the tissues and most of the cells examined, but expression levels may
be very low since only a more sensitive technique indicated that mRNA
was present. Previously, bovine adseverin had only been purified from
adrenal and exocytotic cells (31). It was also immunologically detected in pituitary, brain, and kidney tissues after
partial enrichment (25, 28, 37), again pointing at the low
abundance of the protein. It is important to mention here that mouse
adseverin is strongly upregulated in mast cells, which contain many
granules and are known to be exocytotically active. Adseverin has been
suggested to be involved in secretory processes (28, 31).
Mouse adseverin (D5) appears to be a completely novel member of the
gelsolin family. It lacks most of the fifth domain and a small part of
the sixth segment and is the first such member of this family known.
Previously, only members with six or three segments had been isolated.
We detected adseverin (D5) in blood cells only, which suggests very
narrow tissue specificity. This fact, combined with its low expression
level, may explain why the five-segmented form had previously escaped
detection, unless the 74-kDa protein called bovine adseverin in some
early reports corresponds to adseverin (D5). Indeed, the predicted
molecular mass of mouse adseverin (D5) (69,150 Da) is in reasonable
agreement with this (25, 32). In a report published after
cloning of the gene, a molecular mass of 80 kDa was assigned (closer to
the 80,293 Da of mouse adseverin) (28). However, nucleating
activity was observed in those studies.
The fact that the nucleotide sequences of the cDNA clones, with the
exception of the spliced-out part, are exactly the same suggests that
adseverin and adseverin (D5) are encoded by a single gene and likely
result from an alternative splicing event. Given the different tissue
expression patterns of the two forms, splicing does not occur
haphazardly and therefore must be regulated, possibly as a response to
IL-9 activation.
From our biochemical characterization of adseverin and adseverin (D5),
it is clear that both, like gelsolin, show Ca2+-dependent
actin binding activity. The curves we obtained for adseverin in
capping, severing, and nucleation experiments resemble those we
obtained for (plasma) gelsolin, suggesting that they modulate actin
dynamics similarly. In contrast, adseverin (D5) seems to have slightly
increased capping and severing activity and is completely deficient in
nucleation of actin polymerization. The carboxy-terminal half of
gelsolin is known to be important for Ca2+ regulation of
the amino-terminal half (20), and the lack of the fifth
domain apparently does not influence Ca2+ regulation of
severing and capping. Therefore, the inability of adseverin (D5) to
nucleate actin polymerization is probably not due to disturbed
Ca2+ regulation. It is generally believed that for
efficient nucleation, two actin monomers need to be brought into close
proximity to each other in the correct orientation (13). The
fragment containing domains S1 to S3 caps and severs F actin but does
not nucleate actin polymerization, indicating that domains S4 to S6 are
essential for nucleation (41). Since mouse adseverin (D5) is
not able to nucleate actin polymerization, it is clear that intact S5
is required for nucleation. This is in agreement with a recent study showing that the S5 and S6 domains of scinderin are required for this
activity (26). However, this contrasts with a mutagenesis study of gelsolin suggesting that an actin binding site is present in
S4 (30). Other scenarios may be possible. One possibility is
that the fifth segment is a functionally necessary spacer between the
actin binding site in S4 and the Ca2+ binding site in S6
(30, 41). Alternatively, the fifth domain can enhance or
determine the binding activity of the neighboring fourth G-actin
binding segment. A similar phenomenon, although not so extreme, has
been observed for the third domain of gelsolin with respect to severing
and capping (35). This domain, although not strictly
required for severing, is necessary for the strong capping of S1 to S3.
The observation that adseverin, but not adseverin (D5), formed a stable
complex with G actin in a gel filtration experiment is in accordance
with the observed effects of both proteins on nucleation. The facts
that a 2:1 G-actin-adseverin complex was completely dissociated upon
chelation of Ca2+ and no EGTA-resistant 1:1 complex was
observed prove its extreme Ca2+ sensitivity and regulation.
We showed that PU5.8 macrophage (the primary source of
cytoplasmic gelsolin [45]) express no mouse adseverin
as judged by Northern blotting. This may be indicative of a
regulatory mechanism in which the expression of mouse adseverin and
that of gelsolin are complementary. In this respect, it is of interest
that gelsolin knockout mice are relatively healthy, showing normal
embryonic development and longevity (42). It is clear from
these experiments that gelsolin is not important for embryogenesis.
However, taking into account our in vitro actin binding data and given
the ubiquitous presence of adseverin in tissues, the latter could take
over the role of gelsolin. Comparison of the adseverin mRNA levels in
gelsolin knockout mice and wild-type mice and/or the construction of
adseverin knockout and adseverin-gelsolin double-knockout mice would be informative. Besides the potentially complementary role, one can wonder
about the significance of the fact that adseverin, adseverin (D5),
and gelsolin are all present in the same cell. From our results, it is
clear that adseverin and adseverin (D5) can be regulated at the
transcriptional level by cytokines (here, IL-9). In this respect, we
should point out that IL-9 is both a factor of activation and an
inducer of differentiation, suggesting that the level of adseverin and
adseverin (D5) is increased during differentiation and/or an immune
response.
 |
ACKNOWLEDGMENTS |
We are grateful to Caroline-Aurore Seghers for help with
fluorescence experiments.
J.C.R. is a Research Associate and J.L. is a Scientific Associate
(Televie) with the Fonds National de la Recherche Scientifique, Belgium. C.A. is a Research Associate of the Flanders Fund for Scientific Research (FWO). This work was supported in part by the
Flanders Action for Biotechnology (VLAB-COT), the Action
Levenslijn 7.0040.94, GOA 91/96-3 to J.V., and in part by the Belgian
Federal Service for Scientific, Technical and Cultural Affairs and the Operation Televie.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: V. I. B., Flanders Interuniversity Institute for Biotechnology and Department
of Biochemistry, Faculty of Medicine, Universiteit Gent, K. L. Ledeganckstraat 35, B-9000 Gent, Belgium. Phone: 32-9-2645289. Fax:
32-9-2645337. E-mail: Johan.Robbens{at}rug.ac.be.
 |
REFERENCES |
| 1.
|
Amann, E.,
J. Brosius, and M. Ptashne.
1983.
Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in Escherichia coli.
Gene
25:167-178[Medline].
|
| 2.
|
Ampe, C., and J. Vandekerckhove.
1987.
The F-actin capping proteins of Physarum polycephalum: cap42(a) is very similar, if not identical, to fragmin and is structurally and functionally very homologous to gelsolin; cap42(b) is Physarum actin.
EMBO J.
6:4149-4157[Medline].
|
| 3.
|
Andre, E.,
F. Lottspeich,
M. Schleicher, and A. Noegel.
1988.
Severin, gelsolin, and villin share a homologous sequence in regions presumed to contain F-actin severing domains.
J. Biol. Chem.
263:722-727[Abstract/Free Full Text].
|
| 4.
|
Ausubel, F.,
R. Brent,
R. Kingston,
D. Moore,
J. Seidman,
J. Smith, and K. Struhl.
1993.
Current protocols in molecular biology 1993.
Greene and Wiley-Interscience, New York, N.Y.
|
| 5.
|
Bauw, G.,
M. De Loose,
D. Inzé,
M. Van Montagu, and J. Vandekerckhove.
1987.
Alterations in the phenotype of plant cells studied by NH2-terminal amino-acid-sequence analysis of proteins electroblotted from two-dimensional gel-separated total extracts.
Proc. Natl. Acad. Sci. USA
84:4806-4810[Abstract/Free Full Text].
|
| 6.
|
Brenner, S. L., and E. D. Korn.
1983.
On the mechanism of actin monomer-polymer subunit exchange at steady state.
J. Biol. Chem.
258:5013-5020[Abstract/Free Full Text].
|
| 7.
|
Bryan, J.
1988.
Gelsolin has three actin-binding sites.
J. Cell Biol.
106:1553-1562[Abstract/Free Full Text].
|
| 8.
|
Burtnick, L. D.,
E. D. Koepf,
J. Grimes,
E. Y. Jones,
D. I. Stuart,
P. J. McLaughin, and R. C. Robinson.
1997.
The crystal structure of plasma gelsolin; implication for actin severing, capping and nucleation.
Cell
90:661-670[Medline].
|
| 9.
|
Dieffenbach, C. W.,
D. N. SenGupta,
D. Krause,
D. Sawzak, and R. H. Silverman.
1989.
Cloning of murine gelsolin and its regulation during differentiation of embryonal carcinoma cells.
J. Biol. Chem.
264:13281-13288[Abstract/Free Full Text].
|
| 10.
|
Gettemans, J.,
Y. De Ville,
E. Waelkens, and J. Vandekerckhove.
1995.
The actin-binding properties of the Physarum actin-fragmin complex. Regulation by calcium, phospholipids, and phosphorylation.
J. Biol. Chem.
270:2644-2651[Abstract/Free Full Text].
|
| 11.
|
Giebing, T.,
H. Hinssen, and J. D'Haese.
1994.
The complete sequence of a 40-kDa actin-modulating protein from the earthworm Lumbricus terrestris.
Eur. J. Biochem.
225:773-779[Medline].
|
| 12.
|
Gips, S. J.,
D. E. Kandzari, and P. J. Goldschmidt-Clermont.
1994.
Growth factor receptors, phospholipases, phospholipid kinases and actin reorganization.
Semin. Cell Biol.
5:201-208[Medline].
|
| 13.
|
Hesterkamp, T.,
A. G. Weeds, and H. G. Mannherz.
1993.
The actin monomers in the ternary gelsolin: 2 actin complexes are in an antiparallel orientation.
Eur. J. Biochem.
218:507-513[Medline].
|
| 14.
|
Hültner, L.,
C. Druez,
J. Moeller,
E. Schmitt,
C. Uyttenhove,
E. Rüde,
P. Dörmer, and J. Van Snick.
1990.
Mast cell growth-enhancing activity (MEA) is structurally related and functionally identical to the novel mouse T cell growth factor P40/TCGFIII (interleukin 9).
Eur. J. Immunol.
20:1413-1416[Medline].
|
| 15.
|
Janmey, P. A.
1994.
Phosphoinositides and calcium as regulators of cellular actin assembly and disassembly.
Annu. Rev. Physiol.
56:169-191[Medline].
|
| 16.
|
Janmey, P. A., and T. P. Stossel.
1987.
Modulation of gelsolin function by phosphatidylinositol 4,5-bisphosphate.
Nature
325:362-364[Medline].
|
| 17.
|
Janmey, P. A.,
J. Lamb,
P. G. Allen, and P. T. Matsudaira.
1992.
Phosphoinositide-binding peptides derived from the sequences of gelsolin and villin.
J. Biol. Chem.
267:11818-11823[Abstract/Free Full Text].
|
| 18.
|
Kraus-Friedman, N.
1994.
Signal transduction and calcium: a suggested role for the cytoskeleton in inositol 1,4,5-triphosphate action.
Cell Motil. Cytoskelet.
28:279-284[Medline].
|
| 19.
|
Kwiatkowski, D. J.,
T. P. Stossel,
S. H. Orkin,
J. E. Mole,
H. R. Colten, and H. L. Yin.
1986.
Plasma and cytoplasmic gelsolins are encoded by a single gene and contain a duplicated actin-binding domain.
Nature
227:455-458.
|
| 20.
|
Kwiatkowski, D. J.,
P. A. Janmey, and H. L. Yin.
1989.
Identification of critical functional and regulatory domains in gelsolin.
J. Cell Biol.
108:1717-1726[Abstract/Free Full Text].
|
| 21.
|
Liou, G. I., and S. Matragon.
1992.
A simple method to homogenize multiple tissue samples in small sizes without cross contamination.
BioTechniques
13:719[Medline].
|
| 22.
|
Louahed, Y.,
N. Kermouni,
J. Van Snick, and J. C. Renauld.
1995.
IL-9 induces expression of granzymes and high-affinity IgE receptor in murine T helper clones.
J. Immunol.
154:5061-5070[Abstract].
|
| 23.
|
Lück, A.,
J. D'Haese, and H. Hinssen.
1995.
A gelsolin-related protein from lobster muscle: cloning, sequence analysis and expression.
Biochem. J.
305:767-775.
|
| 24.
|
MacLean-Fletcher, S., and T. Pollard.
1980.
Viscometric analysis of the gelation of Acanthamoeba extracts and purification of two gelation factors.
J. Cell Biol.
85:414-428[Abstract/Free Full Text].
|
| 25.
|
Maekawa, S., and H. Sakai.
1990.
Inhibition of actin regulatory activity of the 74-kDa protein from bovine adrenal medulla (adseverin) by some phospholipids.
J. Biol. Chem.
265:10940-10942[Abstract/Free Full Text].
|
| 26.
|
Marcu, M. G.,
L. Zhang,
A. Elzagallaai, and J. M. Trifaro.
1998.
Localization by segmental deletion analysis and functional characterization of a third actin-binding site in domain 5 of scinderin.
J. Biol. Chem.
273:3661-3668[Abstract/Free Full Text].
|
| 27.
|
Müllauer, L.,
H. Fujita,
A. Ishizaki, and N. Kuzumaki.
1993.
Tumor-suppressive function of mutated gelsolin in ras-transformed cells.
Oncogene
8:2531-2536[Medline].
|
| 28.
|
Nakamura, S.,
T. Sakurai, and Y. Nonomura.
1994.
Differential expression of bovine adseverin in adrenal gland revealed by in situ hybridization. Cloning of a cDNA for adseverin.
J. Biol. Chem.
269:5890-5896[Abstract/Free Full Text].
|
| 29.
|
Paunio, T.,
H. Kangas,
N. Kalkkinen,
M. Haltia,
J. Palo, and L. Peltonen.
1994.
Toward understanding the pathogenic mechanisms in gelsolin-related amyloidosis: in vitro expression reveals an abnormal gelsolin fragment.
Hum. Mol. Genet.
12:2223-2229.
|
| 30.
|
Pope, B.,
S. Maclver, and A. Weeds.
1995.
Localization of the calcium-sensitive actin monomer binding site in gelsolin to segment 4 and identification of calcium binding sites.
Biochemistry
34:1583-1588[Medline].
|
| 31.
|
Rodriguez Del Castillo, A.,
S. Lemaire,
L. Tchakarov,
M. Jeyapragrasan,
J. P. Doucet,
M. L. Vitale, and J. M. Trifaro.
1990.
Chromaffin cell scinderin, a novel calcium-dependent actin filament-severing protein.
EMBO J.
9:43-52[Medline].
|
| 32.
|
Sakurai, T.,
H. Kurokawa, and Y. Nonomura.
1991.
Comparison between the gelsolin and adseverin domain structure.
J. Biol. Chem.
166:15979-15983.
|
| 33.
|
Schmitt, E.,
R. van Brandwijk,
J. Van Snick,
B. Siebold, and E. Rüde.
1989.
TCGF III/P40 is produced by naive murine CD4+ T cells but is not a general T cell growth factor.
Eur. J. Immunol.
19:2167-2170[Medline].
|
| 34.
|
Spudich, J. A., and S. Watt.
1971.
The regulation of rabbit skeletal muscle contraction.
J. Biol. Chem.
246:4866-4871[Abstract/Free Full Text].
|
| 35.
|
Sun, H. Q.,
D. C. Wooten,
P. A. Janmey, and H. L. Yin.
1994.
The actin side-binding domain of gelsolin also caps actin filaments. Implications for actin filament severing.
J. Biol. Chem.
269:9473-9479[Abstract/Free Full Text].
|
| 36.
|
Tanaka, M.,
L. Mullauer,
Y. Ogiso,
H. Fujita,
S. Moriya,
K. Furuuchi,
T. Harabayashi,
N. Shinohara,
T. Koyanagi, and N. Kuzumaki.
1995.
Gelsolin: a candidate for suppressor of human bladder cancer.
Cancer Res.
55:3228-3232[Abstract/Free Full Text].
|
| 37.
|
Tchakarov, L.,
M. L. Vitale,
M. Jeyapragrasan,
A. Rodriguez Del Castillo, and J. M. Trifaro.
1990.
Expression of scinderin, an actin filament-severing protein, in different tissues.
FEBS Lett.
268:209-212[Medline].
|
| 38.
|
T'Jampens, D.,
K. Meerschaert,
B. Constantin,
J. Bailey,
L. J. Cook,
V. De Corte,
H. De Mol,
M. Goethals,
J. Van Damme,
J. Vanderkerckhove, and J. Gettemans.
1997.
Molecular cloning, over-expression, developmental regulation and immunolocalization of fragmin P, a gelsolin-related actin-binding protein from Physarum polycephalum plasmodia.
J. Cell Sci.
110:1215-1226[Abstract].
|
| 39.
|
Uyttenhove, C.,
J. Simpson, and J. Van Snick.
1988.
Functional and structural characterization of P40, a mouse glycoprotein with T-cell growth factor activity.
Proc. Natl. Acad. Sci. USA
85:6934-6938[Abstract/Free Full Text].
|
| 40.
|
Way, M., and A. G. Weeds.
1988.
Nucleotide sequence of pig plasma gelsolin. Comparison of protein sequence with human gelsolin and other actin-severing proteins shows strong homologies and evidence for large internal repeats.
J. Mol. Biol.
203:1127-1133[Medline].
|
| 41.
|
Way, M.,
J. Gooch,
B. Pope, and A. G. Weeds.
1989.
Expression of human plasma gelsolin in Escherichia coli and dissection of actin binding sites by segmental deletion mutagenesis.
J. Cell Biol.
109:593-605[Abstract/Free Full Text].
|
| 42.
|
Witke, W.,
A. H. Sharpe,
J. H. Hartwig,
T. Aruma,
T. Stossel, and D. I. Kwiatkowski.
1995.
Hemostatic, inflammatory, and fibroblast responses are blunted in mice lacking gelsolin.
Nature
81:41-51.
|
| 43.
|
Yamamoto, K.,
J. D. Pardee,
J. Reidler,
L. Stryer, and J. A. Spudich.
1982.
Mechanism of interaction of Dictyostelium severin with actin filaments.
J. Cell Biol.
95:711-719[Abstract/Free Full Text].
|
| 44.
|
Yin, H. L., and T. P. Stossel.
1979.
Control of cytoplasmic actin gel-sol transformation by gelsolin, a calcium-dependent regulatory protein.
Nature
281:583-586[Medline].
|
| 45.
|
Yin, H. L., and T. P. Stossel.
1980.
Purification and structural properties of gelsolin, a Ca2+-activated regulatory protein of macrophages.
J. Biol. Chem.
255:9490-9493[Abstract/Free Full Text].
|
| 46.
|
Yu, F. X.,
H. Q. Sun,
P. A. Janmey, and H. Yin.
1992.
Identification of a polyphosphoinositide-binding sequence in an actin monomer-binding domain of gelsolin.
J. Biol. Chem.
267:14616-14621[Abstract/Free Full Text].
|
Mol Cell Biol, August 1998, p. 4589-4596, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jia, S., Omelchenko, M., Garland, D., Vasiliou, V., Kanungo, J., Spencer, M., Wolf, Y., Koonin, E., Piatigorsky, J.
(2007). Duplicated gelsolin family genes in zebrafish: a novel scinderin-like gene (scinla) encodes the major corneal crystallin. FASEB J.
21: 3318-3328
[Abstract]
[Full Text]
-
Ehre, C., Rossi, A. H., Abdullah, L. H., De Pestel, K., Hill, S., Olsen, J. C., Davis, C. W.
(2005). Barrier role of actin filaments in regulated mucin secretion from airway goblet cells. Am. J. Physiol. Cell Physiol.
288: C46-C56
[Abstract]
[Full Text]
-
Svensson, C., Lundberg, K.
(2001). Immune-Specific Up-Regulation of Adseverin Gene Expression by 2,3,7,8-Tetrachlorodibenzo-p-dioxin. Mol. Pharmacol.
60: 135-142
[Abstract]
[Full Text]
-
Dumoutier, L., Louahed, J., Renauld, J.-C.
(2000). Cloning and Characterization of IL-10-Related T Cell-Derived Inducible Factor (IL-TIF), a Novel Cytokine Structurally Related to IL-10 and Inducible by IL-9. J. Immunol.
164: 1814-1819
[Abstract]
[Full Text]
-
Friederich, E., Vancompernolle, K., Louvard, D., Vandekerckhove, J.
(1999). Villin Function in the Organization of the Actin Cytoskeleton. CORRELATION OF IN VIVO EFFECTS TO ITS BIOCHEMICAL ACTIVITIES IN VITRO. J. Biol. Chem.
274: 26751-26760
[Abstract]
[Full Text]
-
Stocker, S., Hiery, M., Marriott, G.
(1999). Phototactic Migration of Dictyostelium Cells Is Linked to a New Type of Gelsolin-related Protein. Mol. Biol. Cell
10: 161-178
[Abstract]
[Full Text]
-
Xu, Y.-S., Kantorow, M., Davis, J., Piatigorsky, J.
(2000). Evidence for Gelsolin as a Corneal Crystallin in Zebrafish. J. Biol. Chem.
275: 24645-24652
[Abstract]
[Full Text]