Previous Article | Next Article 
Mol Cell Biol, August 1998, p. 4761-4771, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
RhoE Regulates Actin Cytoskeleton Organization
and Cell Migration
Rosa M.
Guasch,1 2
Peter
Scambler,3
Gareth E.
Jones,2 and
Anne J.
Ridley1 4 *
The Ludwig Institute for Cancer Research,
London W1P 8BT,1
Muscle and Motility
Research Centre, The Randall Institute, King's College London,
London, WC2B 5RL,2
Institute of Child
Health, London, WC1N 1EH,3 and
Department of Biochemistry and Molecular Biology,
University College London, London WC1E 6BT,4
United Kingdom
Received 29 December 1997/Returned for modification 5 February
1998/Accepted 3 May 1998
 |
ABSTRACT |
The actin cytoskeleton is regulated by Rho family proteins: in
fibroblasts, Rho mediates the formation of actin stress fibers, whereas
Rac regulates lamellipodium formation and Cdc42 controls filopodium
formation. We have cloned the mouse RhoE gene, whose product is a member of the Rho family that shares (except in one amino
acid) the conserved effector domain of RhoA, RhoB, and RhoC. RhoE is
able to bind GTP but does not detectably bind GDP and has low intrinsic
GTPase activity compared with Rac. The role of RhoE in regulating actin
organization was investigated by microinjection in Bac1.2F5 macrophages
and MDCK cells. In macrophages, RhoE induced actin reorganization,
leading to the formation of extensions resembling filopodia and
pseudopodia. In MDCK cells, RhoE induced the complete disappearance of
stress fibers, together with cell spreading. However, RhoE did not
detectably affect the actin bundles that run parallel to the outer
membranes of cells at the periphery of colonies, which are known to be
dependent on RhoA. In addition, RhoE induced an increase in the speed
of migration of hepatocyte growth factor/scatter factor-stimulated MDCK
cells, in contrast to the previously reported inhibition produced by
activated RhoA. The subcellular localization of RhoE at the lateral
membranes of MDCK cells suggests a role in cell-cell adhesion, as has
been shown for RhoA. These results suggest that RhoE may act to inhibit signalling downstream of RhoA, altering some RhoA-regulated responses, such as stress fiber formation, but not affecting others, such as
peripheral actin bundle formation.
 |
INTRODUCTION |
Rho family proteins consist of 11 mammalian members, in addition to many homologs in other species, and
form a subgroup of the Ras GTPases (40). Over the past few
years, members of the Rho family have been implicated in many different
cellular events, including actin organization, cell adhesion, membrane
trafficking, and transcriptional regulation (52). Like all
members of the Ras superfamily, they function as molecular switches,
cycling between an active GTP-bound form and an inactive GDP-bound form (recently reviewed in reference 52). This property
is determined by five primary sequence motifs that are highly conserved
evolutionarily among members of the Ras superfamily (6). The
activity of Rho GTPases is determined by the ratio of their GTP-bound
and GDP-bound states and is regulated by the opposing effects of
guanine nucleotide exchange factors, which enhance the exchange of
bound GDP for bound GTP, and the GTPase-activating proteins (GAPs),
which increase the intrinsic rate of hydrolysis of bound GTP. In
addition, guanine nucleotide dissociation inhibitors can inhibit both
the exchange of nucleotides and the hydrolysis of bound GTP
(4).
Rho, Rac, and Cdc42 are three members of the Rho family known to be
involved in regulating the organization of the actin cytoskeleton. In
Swiss 3T3 fibroblasts, Rho regulates the formation of actin stress
fibers, whereas Rac regulates lamellipodium formation and Cdc42
regulates filopodium formation (23, 35, 42, 43). In
addition, these three proteins can act in a hierarchical cascade, where
Cdc42 activates Rac, which in turn activates Rho (35, 43).
Many extracellular stimuli induce actin reorganization via Rho family
proteins. Lysophosphatidic acid induces the formation of actin stress
fibers in quiescent Swiss 3T3 fibroblasts, a response that is dependent
on Rho (42). Growth factors such as insulin, platelet-derived growth factor, and bombesin stimulate the
polymerization of actin to form lamellipodia and membrane ruffles
(43). Bradykinin induces Cdc42-mediated filopodium formation
and the subsequent formation of lamellipodia (23). Rho is
also required for the formation of focal adhesions, where stress fibers
are connected to the extracellular matrix via clustered transmembrane
integrins, whereas Rac and Cdc42 regulate the formation of smaller
focal complexes, which are similar to focal adhesions in composition but are associated with lamellipodia and filopodia (35).
Many targets of Rho family GTPases have been characterized recently,
although the molecular mechanism underlying their ability to regulate
actin organization appears complex and still remains unclear. However,
the characterization of proteins that bind Rho in a GTP-dependent
manner has provided major insights into Rho-mediated signalling. The
serine/threonine kinase ROK
/Rho kinase and its close relative
p160ROCK/ROK
play a role in the formation of stress fibers and focal
adhesions (20, 26, 27, 33). A model in which Rho kinase
induces the interaction of myosin with actin filaments by stimulating
the phosphorylation of the myosin light chain (MLC) has been proposed
(12). Rho kinase leads to a decrease in MLC phosphatase
activity (22) and, more recently, it has been shown that Rho
kinase stoichiometrically phosphorylates MLC at the same site that is
phosphorylated by MLC kinase (3). This model may underlie
the involvement of Rho in regulating cytokinesis, motility, and smooth
muscle contraction (52). It has also been suggested that the
effect of Rho on MLC leads to stress fiber formation, generating
tension that then induces the aggregation of integrins. This process in
turn stimulates the formation of focal adhesions and tyrosine
phosphorylation of focal adhesion proteins (9).
However, other studies have suggested that stress fiber assembly and
focal adhesion formation can be regulated independently; for example,
Rho and Rho kinase can induce some formation of focal adhesions under
conditions in which actin stress fibers are disrupted (11,
35).
Actin reorganization is mediated by Rho family proteins, but the
specific response regulated by each protein is highly cell type
dependent. In MDCK epithelial cells, lamellipodium formation requires
Rac, but Rac is not sufficient by itself to induce lamellipodia when
microinjected into the cells (41). Instead, Rac actually enhances the formation of intercellular junctions (50). In
neuronal cells, which do not have stress fibers, several factors induce cell rounding and neurite retraction in a Rho-dependent manner (21, 38). In an epidermoid carcinoma cell line, Rac and Rho each regulate a distinct type of ruffling response (34).
Because of these differences, we have extensively characterized the
roles of Rho family proteins in MDCK epithelial cells and Bac1.2F5
macrophages (2, 41), two cell types with very different
phenotypes. MDCK cells have stress fibers associated with
integrin-containing adhesion complexes (14, 41). Hepatocyte growth factor/scatter factor (HGF/SF) stimulates the motility of
epithelial cells, inducing centrifugal spreading of cell colonies, disrupting junctions between cells and, consequently, producing cell
scattering. Simultaneously, changes in the actin cytoskeleton, including an overall decrease in the amount of stress fibers, the
disappearance of peripheral actin bundles at the edges of colonies, and
an increase in lamellipodium extension and membrane ruffling, are
observed. These changes involve Ras, Rac, and Rho proteins
(41). Bac1.2F5 macrophages do not have stress fibers or the
associated focal adhesions found in other cultured cells. They are
dependent on colony-stimulating factor 1 (CSF-1) for both proliferation
and viability, even in the presence of fetal calf serum (5).
Bac1 cells become rounded in the absence of CSF-1, and on readdition,
the cells rapidly spread, producing filopodia, membrane ruffles, and
lamellipodia (2, 5). Rac and Cdc42 are activated in parallel
by CSF-1, inducing the formation of lamellipodia and ruffles and of
filopodia, respectively, and Rac subsequently activates Rho to
stimulate the formation of actin cables within the cell body. CSF-1
also induces the redistribution of focal complexes, and this process is
controlled by Cdc42 acting upstream of Rac (2).
Although Rho family proteins have been implicated in many different
cell events, the molecular mechanisms underlying these responses have
not been fully elucidated, and the identification of additional
proteins that interact with them will help to unravel these signalling
pathways. We have cloned the mouse RhoE gene and studied the
biochemical and biological properties of its product. RhoE is able to
bind and hydrolyze GTP, although the rate of hydrolysis is much slower
than that of other Rho family proteins. Distinct types of actin
reorganization were observed when this protein was microinjected into
MDCK epithelial cells and Bac1.2F5 macrophages. Specifically, a
complete disappearance of stress fibers was observed in MDCK cells,
while actin-rich extensions resembling filopodia and pseudopodia were
revealed in Bac1.2F5 macrophages. In addition, RhoE was able to
increase the speed of migration of HGF/SF-stimulated MDCK cells.
 |
MATERIALS AND METHODS |
Screening protocol and cDNA cloning.
A Rho-related clone was
identified as a PCR product in experiments aimed at cloning human cDNAs
from monochromosomal hybrids. Southern analysis demonstrated that the
clone was of murine origin and was an example of mispriming. The clone
was used to screen an 8.5-day-postcoitum (dpc) whole-mouse-embryo cDNA
library. Four tertiary positive clones (r13, r15, r16, and r20) were
obtained after a screen of 5 × 105 plaques.
Subcloning into pBluescript and sequencing showed that these clones
encoded an incomplete open reading frame (ORF) related to RhoA. To
obtain a cDNA encoding the full-length protein, the r13 clone was
32P labelled by random priming (multiprime DNA labelling
system; Amersham) and used as a hybridization probe to screen a 10-dpc mouse embryo cDNA library under high-stringency screening conditions. Of 2 × 106 plaques screened, 17 positive clones were
isolated in the primary screening. Two clones were selected on the
basis of their strong hybridization to a probe from the 5' region of
r13, subcloned into pBluescript, and sequenced by dye terminator cycle
sequencing with AmpliTaq DNA polymerase (Perkin-Elmer).
Expression and purification of the recombinant protein.
Mouse RhoE cDNA generated by PCR was fused to the carboxy-terminal end
of the glutathione S-transferase (GST) gene by cloning into
the BamHI/EcoRI sites of the pGEX-2T vector
(47). The following primers were used:
5'CGGGATCCGATCCTAATCAG3' and
5'CGGAATTCTCACATCACAGTACAG3'. RhoE was purified by binding
to glutathione beads (Pharmacia Biotech) and cleaved with thrombin to
remove GST as previously described (43) but with
modification. RhoE was purified from protease-deficient Escherichia coli BL21, as protein degradation was observed
in strain JM101. In BL21, protein expression was induced by 1 h of incubation with isopropyl-
-D-galactopyranoside (IPTG) at
24°C. Under these conditions, RhoE migrated at an approximate size of 29 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, whereas with JM101, the size was about 25 kDa. The correct size of the
purified protein was confirmed by laser desorption mass spectrometry.
For expression in mammalian cells, RhoE cDNA was tagged at the 5' end
by PCR with a DNA sequence encoding the epitope from Myc recognized by
the 9E10 antibody and subcloned into the eukaryotic expression vector
pEXV-3 (43). The primers used were 5 ' CGGAAT TCCACCATGGAGCAGAAGC TGATC TCCGAGGAGGACC TGGATCCTAATCAGC3' and 5'CGGAATTCTCACATCACAGTACAG3'. All sequences were
checked by dye terminator cycle sequencing with AmpliTaq DNA
polymerase.
Guanine nucleotide-binding assay.
The active protein
concentration was determined by a guanine nucleotide nitrocellulose
filter-binding assay (46). Different amounts of RhoE (2 to
25 µg) were incubated in a total volume of 40 µl of assay buffer
(50 mM Tris-HCl [pH 7.5], 1 mM dithiothreitol [DTT]) containing 5 mM EDTA and 0.2 µl of [3H]GTP (1 mCi/ml, 8 Ci/mmol;
Amersham) or [3H]GDP (1 mCi/ml, 13 Ci/mmol; Amersham) for
30 min at 37°C. Samples were diluted with 1 ml of ice-cold wash
buffer containing 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, and
50 mM NaCl and filtered through prewetted nitrocellulose filters.
Before the filters dried, they were washed with 10 ml of cold wash
buffer. Radioactivity bound to RhoE was determined by scintillation
counting. The active protein concentration was calculated as previously
described (46), except that if 1 mol of RhoE binds 1 mol of
[3H]GTP, then 1 µg of RhoE should yield approximately
3 × 105 dpm. The total protein concentration was
estimated with a protein assay kit (Bio-Rad).
GTPase assay.
RhoE (150 ng) was preloaded with
[
-32P]GTP (6,000 Ci/mmol, 10 mCi/ml; DuPont NEN) in 20 µl of 20 mM Tris-HCl (pH 7.5)-25 mM NaCl-0.1 mM DTT-0.5 mg of
bovine serum albumin (BSA) per ml-4 mM EDTA for 30 min at 37°C.
MgCl2 was added at a final concentration of 20 mM on ice.
Eighteen nanograms of the preloaded protein was diluted into 20 mM
Tris-HCl (pH 7.5)-0.1 mM DTT-1 mg of BSA per ml-1 mM GTP to give a
final volume of 30 µl. Aliquots (5 µl) were removed after
incubation for 0, 5, 10, 15, and 30 min and for 1 h at 37°C and
diluted with an ice-cold buffer (50 mM Tris-HCl [pH 7.5], 50 mM NaCl,
5 mM MgCl2). Radioactivity bound to RhoE was measured by
scintillation counting.
Cell culture and microinjection.
MDCK cells were incubated
at 37°C (10% CO2) in Dulbecco's modified Eagle's
medium (DMEM) containing 10% bovine fetal calf serum (FCS). For
microinjection, cells were seeded at 5 × 103 per well
(15-mm diameter) on glass coverslips (13 mm) marked with a cross to
facilitate the localization of injected cells. After 3 days, cells were
transferred to DMEM containing 5% FCS. For analysis of actin
organization, approximately 50% of the cells in a colony were
microinjected. RhoE was injected at 40 to 50 µg/ml (determined by
[3H]GTP binding), and V14RhoA (constitutively active RhoA
[amino acid 14 altered from Gly to Val] [42]) was
injected at 200 µg/ml (determined by [3H]GDP binding).
To identify injected cells, rat immunoglobulin G (IgG) or rabbit IgG
(Pierce) at 0.5 mg/ml was microinjected together with the recombinant
protein. Proteins were diluted in 50 mM Tris-Cl (pH 7.5)-100 mM
NaCl-5 mM MgCl2. The pEXV-3 expression plasmid carrying
Myc-tagged RhoE cDNA was injected at 0.3 mg/ml in
phosphate-buffered saline (PBS; Gibco BRL).
A subclone of the cloned mouse macrophage line Bac1.2F5 (32)
was grown at 37°C (10% CO2) in T25 tissue culture flasks
(Falcon). Except as stated otherwise, all media and supplements used
with macrophages were supplied by ICN Flow. Cells were maintained in DMEM supplemented with 10% heat-inactivated FCS (Biopharm UK), 1.32 nM
CSF-1 (Chiron Corp.), 2 mM L-glutamine, 0.15 mM
L-asparagine, 15 nM
-mercaptoethanol, 77.5 U of
streptomycin per ml, and 25 U of penicillin per ml. Cells were
subcultured twice weekly by dissociation with 0.04% EDTA in PBS and
resuspended in growth medium at 2 × 105 cells/ml. For
microinjection, 5 × 104 cells per well were plated in
wells containing 13-mm glass coverslips and microinjected 48 h
after seeding.
The R4.2 cell line is a clone derived from the HB4a mammary luminal
epithelial cell line (36) by transfection with oncogenic H-Ras cDNA; it was a gift from Robert Harris and Thomas Eichholtz (GlaxoWellcome, Stevenage, United Kingdom). R4.2 cells were grown at
37°C (5% CO2) in RPMI 1640 with L-glutamine,
10% FCS, and insulin (5 µg/ml). Cells were seeded at 104
per well on glass coverslips and microinjected 2 days later.
Immunofluorescence.
For immunofluorescence analysis, cells
were washed briefly in PBS containing 0.9 mM CaCl2 and 0.7 mM MgCl2 and then fixed for 20 min in 3.7% formaldehyde in
PBS at room temperature. Cells were permeabilized with 0.2% Triton
X-100 in PBS for 5 min. Actin filaments were localized by incubating
cells for 45 min with 0.1 µg of tetramethyl rhodamine isothiocyanate
(TRITC)-labelled phalloidin (Sigma Chemical Co.) per ml as previously
described (42). Cells containing rat IgG or rabbit IgG
(microinjection marker) were localized with fluorescein isothiocyanate
(FITC)-conjugated goat anti-rat IgG (1:400; Sigma) or FITC-conjugated
goat anti-rabbit IgG (1:200; Southern Biotechnology Associates, Inc.).
For localization of cells expressing the tagged RhoE cDNA, fixed cells
were blocked for 1 h in PBS containing 10% FCS, 5% milk powder,
0.5% BSA, and 0.1% Triton X-100. They were then incubated with an
anti-Myc mouse monoclonal antibody, 9E10 (1:400; Santa Cruz
Biotechnology), in 1% BSA, followed by incubation with FITC-conjugated
goat anti-mouse IgG (1:400; Jackson ImmunoResearch) in 1% BSA together
with TRITC-conjugated phalloidin.
Confocal laser scanning microscopy.
Images of cells were
visualized with an MRC 500 confocal visualization system (Bio-Rad) or
with an LSM 310 apparatus (Zeiss, Welwyn Garden City, United Kingdom)
mounted over an infinity-corrected Axioplan microscope by using a ×10
eyepiece and a ×63 NA 1.4 oil immersion objective (Zeiss). The MRC 500 was configured and used as described previously (15). Image
files were collected with the LSM 310 as a matrix of 1,024 by 1,024 pixels describing the average of eight frames scanned at 0.062 Hz,
where FITC and TRITC were excited at 488 nm and 543 nm and visualized
with bandpass filters of 540 ± 25 and 608 ± 32 nm,
respectively, where the levels of interchannel cross talk were
insignificant. Three-dimensional data sets were obtained with the MRC
500 by collecting a series of single views as the stage was moved 0.37 µm along the z axis between each view.
Time-lapse videomicroscopy.
MDCK colonies chosen for each
experiment contained 15 to 20 cells, and every cell in each colony was
microinjected. Some of the colonies were microinjected with RhoE, and
others were microinjected with a control protein, usually rabbit IgG.
For experiments studying the motility of MDCK cells, recombinant human
HGF/SF (R&D Systems) was added after microinjection at a final
concentration of 5 ng/ml. Cells were filmed on a Zeiss ICM 405 microscope linked to a Panasonic F15 camera and a Hamamatsu image
processor with a Sony U-matic time-lapse video recorder.
 |
RESULTS |
Isolation and analysis of a mouse cDNA that codes for a Rho-related
protein.
Partial cDNAs encoding part of a novel Rho family protein
were originally isolated in a screen for novel human cDNAs (see Materials and Methods). A cDNA encoding the full-length ORF was subsequently isolated from a 10-dpc mouse embryo library. The identified ORF extends over 690 bp and encodes a protein of 229 amino
acids.
Alignment of this sequence to other members of the Rho family
demonstrated that the nucleotide sequence is 92% identical to
human
RhoE cDNA and 100% identical at the amino acid level to
the
RhoE protein recently described by Foster et al. (
16).
Phylogenetic
analysis of the mouse RhoE protein showed that it is more
homologous
to the Rho subfamily than to the Rac and Cdc42 subfamilies
(Fig.
1). This finding
is also corroborated by the fact that its effector
domain (amino acids
32 to 42) is more closely related to RhoA,
RhoB, and RhoC than to Rac
or Cdc42. It is most closely related
to human Rho6, Rho7, and Rho8,
proteins whose sequences have not
yet been published but are available
in the EMBL database.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Phylogenetic analysis of Rho family proteins,
including percentages of homology between mouse RhoE (asterisk) and the
other proteins. Mouse RhoE cDNA was identified by screening
of a 10-dpc mouse embryo library. It shares the five conserved
GTP-binding domains that are found in all other Ras-related proteins
and are known to be important for their function. It exhibits very
strong sequence similarity to Rho6, Rho7, and Rho8. Sequences were
aligned with the Geneworks program by use of the Clustal algorithm and
a PAM250 table.
|
|
The predicted size of mouse RhoE is approximately 25.6 kDa, as
determined from its sequence. The RhoE gene is expressed as
a 3.3-kb
mRNA detected in different rodent cell lines, including
Rat-2, NIH 3T3,
and Swiss 3T3 fibroblasts and Bac1.2F5 macrophages
(data not shown).
Biochemical characterization of the mouse RhoE protein.
Since
the activity of Rho-related GTPases is regulated by their ability to
bind and exchange guanine nucleotides and to hydrolyze GTP, we tested
whether RhoE behaved in a manner similar to that of other Rho family
members. RhoE was expressed as a GST fusion protein in E. coli, the GST was removed with thrombin, and the purity of the
cleaved RhoE was confirmed by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and Coomassie blue staining. The correct size was
confirmed by laser desorption mass spectrometry. A
nucleotide-binding assay where [3H]GTP was incubated
with RhoE showed that this protein is capable of binding GTP (Fig.
2A) and demonstrated a linear
relationship between GTP bound and increasing concentrations of RhoE.
In addition, the amount of GTP bound to a constant concentration of
RhoE increased as the GTP concentration was increased, reaching a
maximum value at 6 µM GTP (data not shown). In contrast to
[3H]GTP, RhoE (25 µg/ml) did not detectably bind
[3H]GDP after 10 min of incubation (Fig. 2B) or when
different RhoE concentrations, [3H]GDP concentrations,
and incubation times were tested (data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
RhoE binds and hydrolyzes GTP, but the intrinsic GTPase
activity is low compared to that of other Rho proteins. (A) GTP-binding
assay. Recombinant RhoE was expressed as a GST fusion protein in a
protease-deficient strain (BL21), bound to glutathione-agarose beads,
and cleaved with thrombin. RhoE at the indicated concentrations was
incubated at 37°C with [3H]GTP for 30 min, and
radioactivity bound to the protein was determined by a filter-binding
assay. (B) Comparison of GTP and GDP binding. A nucleotide-binding
assay with [3H]GDP showed background levels of
radioactivity when GDP was incubated with RhoE at 25 µg/ml. (C)
Intrinsic GTPase activity of thrombin-cleaved RhoE and Rac. Each
protein was preloaded with [ -32P]GTP, incubated at
37°C in the presence of excess unlabeled GTP for the indicated times,
and subjected to a filter-binding assay. The amount of radioactivity
remaining bound to each protein was determined by scintillation
counting. RhoEm, mouse RhoE.
|
|
The intrinsic GTPase activity of RhoE was also studied, showing that
under conditions where Rac hydrolyzes 95% of
[

-
32P]GTP, RhoE hydrolyzed approximately 31% (Fig.
2C). The curve
is biphasic, with a higher initial rate of GTP
hydrolysis during
the first 10 min followed by much lower GTPase
activity. RhoE
thus exhibits GTPase activity, but the hydrolysis rate
is very
low compared to that of other Rho family proteins. The
uncleaved
GST-RhoE fusion protein also hydrolyzed GTP (data not shown).
To confirm that the reduction in radioactive nucleotide remaining
on
RhoE was in fact due to the hydrolysis of the phosphate group
itself
and not to spontaneous exchange, we performed the same
hydrolysis assay
with [
3H]GTP (more than 95% of the radioactivity is
associated with the
guanine moiety). No decrease in
[
3H]GTP binding to RhoE was detected during a 30-min
incubation
(data not shown), ruling out the possibility that the GTP
molecule
was released rather than hydrolyzed.
RhoE induces stress fiber disassembly in MDCK cells.
Rho
family proteins are known to be involved in regulating actin
organization, although the precise response varies between cell types
(52). We therefore investigated responses to RhoE in two
different cell types, MDCK epithelial cells and Bac1.2F5 macrophages,
for which we have previously characterized responses to other Rho
family proteins (2, 41). Our initial aim was to determine
whether RhoE had any effect on cytoskeletal reorganization, which plays
a crucial role in many cellular processes, including motility,
cytokinesis, and phagocytosis.
MDCK is an epithelial cell line that proliferates as discrete colonies
and becomes motile in response to HGF/SF (
48). It
is
believed that changes in actin polymerization and depolymerization
are
involved in driving cell motility (
13). Purified RhoE was
microinjected into unstimulated colonies containing 40 to 50 cells
(3 days after plating), and its effect on the actin cytoskeleton
was
investigated by confocal microscopy. Unstimulated MDCK cells
have actin
stress fibers localized close to the basal membrane.
RhoE induced the
total disappearance of stress fibers when microinjected
into both cells
at the periphery of (Fig.
3A and B) and
cells
within (Fig.
3C and D) colonies. Many of the injected cells had
aggregates of actin filaments within the cytoplasm. These changes
in
the actin cytoskeleton induced by RhoE were rapid and were
observed by
10 min after microinjection, at concentrations of
active RhoE protein
of >15 µg/ml. The effect of RhoE diminished
with time, and at
10 h after RhoE microinjection, most injected
cells had fine actin
filaments, mainly at the cell periphery,
and actin aggregates were not
present (data not shown). These
results suggested that by 10 h the
cells were reverting to their
original actin cytoskeleton phenotype.
RhoE also induce a dramatic
decrease in the number of focal adhesions,
as determined by staining
for vinculin (data not shown). Since RhoE
affects stress fibers,
which are known to be induced by RhoA
(
42), we wondered whether
RhoE could inhibit the response to
RhoA. Microinjection of both
V14RhoA (50 µg/ml) and RhoE (25 µg/ml)
together led to an increase
in the amount of stress fibers similar to
that observed with V14RhoA
alone (data not shown), suggesting that RhoA
is able to overcome
the RhoE effect in MDCK cells.

View larger version (119K):
[in this window]
[in a new window]
|
FIG. 3.
RhoE induces the disappearance of stress fibers in MDCK
cells. Confocal micrographs of cells injected with recombinant RhoE at
25 µg/ml and rat IgG (0.5 mg/ml) (A, B, C, and D) or rat IgG alone at
0.5 mg/ml (E and F) (as a marker to identify injected cells) are shown.
Actin filaments were localized (B, D, and F) by staining with
TRITC-labelled phalloidin 30 min after RhoE injection at both the
periphery (B) and within a cell colony (D) or after injection with IgG
alone (F). Microinjected cells were detected with FITC-labelled goat
anti-rat IgG (A, C, and E). Arrow in panel B, RhoE-injected cell with a
lamellipodium. The scale bar represents 42 µm (A and B) or 25 µm
(C, D, E, and F).
|
|
MDCK cells also exhibit bundles of actin fibers running parallel to the
outer membranes of many cells at the basal edges of
colonies.
Approximately 15% of outer cells do not have these bundles
of actin
fibers and instead extend lamellipodia from the smooth
outer edges of
colonies (
41). These peripheral actin bundles,
as well as
stress fibers, disassemble in cells injected with C3
transferase, which
inhibits Rho (
41). In contrast, RhoE did
not detectably
alter these structures when microinjected into
cells at the periphery
of colonies, even up to 10 h after microinjection
(shown at 30 min
in Fig.
3A and B). Even at the highest concentration
of RhoE attainable
when purified from
E. coli (65 µg of active
protein per
ml), no effect on peripheral actin bundles was observed
(data not
shown). RhoE also did not obviously affect lamellipodium
formation
(Fig.
3A and B). To confirm that the observed changes
in actin
organization were not due to the microinjection protocol
itself, we
microinjected IgG into MDCK cells. Stress fibers, as
well as actin
bundles at the periphery of colonies, were retained
in these control
injected cells (Fig.
3E and F).
To verify that the cytoskeletal reorganization was indeed due to the
RhoE protein itself, we microinjected a eukaryotic expression
vector
containing myc epitope-tagged
RhoE cDNA into the nuclei
of
MDCK cells. Four to six hours after injection, stress fiber
loss was
observed together with aggregates of actin filaments
(Fig.
4B). These experiments also allowed the
subcellular localization
of RhoE to be analyzed. As revealed by
immunofluorescence with
an anti-myc epitope antibody, RhoE was
localized throughout the
cytoplasm but was also strongly associated
with the plasma membrane
(Fig.
4A). In addition, it colocalized with
the aggregates of
actin filaments which were induced by RhoE expression
(Fig.
4B).
A series of
z sections through the cells obtained
by confocal
microscopy showed that these aggregates were present on the
basal
surfaces of cells (Fig.
4C), suggesting a link with stress fiber
disruption, and were not present on the apical surfaces (Fig.
4D). RhoE
was associated with the plasma membrane on the lateral
membrane between
cells, mainly between the middle of the cells
and the apical surface,
as well as on the apical membrane in structures
that resembled
microvilli (Fig.
4D). Indeed, analysis of a series
of
z
sections showed that these structures had a distribution
and an
appearance similar to those of microvilli, as revealed
in cells stained
for actin filaments (data not shown).

View larger version (162K):
[in this window]
[in a new window]
|
FIG. 4.
Immunolocalization of RhoE in MDCK cells. A eukaryotic
expression vector, pEXV3, containing myc epitope-tagged RhoE
cDNA was microinjected into the nuclei of MDCK cells. Cells were
analyzed by immunofluorescence to detect myc epitope-tagged RhoE
with anti-myc epitope antibody 9E10 followed by incubation with
FITC-conjugated goat anti-mouse IgG (A, C, and D) RhoE and
TRITC-labelled phalloidin (B) to detect actin filaments. (A and B)
Confocal images show that RhoE was localized mainly at the level of the
plasma membrane as well as in some structures (arrows) inside the
cytoplasm (A) that colocalized with aggregates of actin filaments (B).
(C and D) Images show RhoE localization in basal (C) and near-apical
(D) optical sections of the left-hand cell in panel A. The scale bar
represents 25 µm (A and B) or 15 µm (C and D).
|
|
Actin reorganization in Bac1.2F5 macrophages induced by RhoE.
Bac1.2F5 macrophages are a hemopoietic cell line whose actin
cytoskeletal organization is different from that of epithelial cells.
They do not possess stress fibers or the focal adhesions found in many
other cultured cell types. Instead, they exhibit an actin cytoskeleton
organized as very fine actin cables within the cytoplasm, regulated by
RhoA and thought to be the counterpart of the stress fibers in other
cell types (2). They depend on CSF-1 for both viability and
proliferation. Bac1.2F5 cells became rounded in the absence of CSF-1
(Fig. 5B), and on readdition they spread,
adopting the typical phenotype of growing cells (Fig. 5A). To
investigate if RhoE had any effect on the actin cytoskeleton, RhoE
protein was microinjected into these cells. After 10 min, this protein
rapidly induced a reorganization in actin distribution, leading to a
striking difference in cell morphology. Cells extended long actin-rich
extensions resembling filopodia and pseudopodia (Fig. 5C and D).
Time-lapse videomicroscopy confirmed that these structures were
actively extended from cells following the microinjection of RhoE (data
not shown). A more detailed study revealed that these structures
appeared in two slightly different phenotypes, some with broad,
web-like actin-containing structures linking filopodium-like structures
(Fig. 5C) and others with smaller pseudopodia among longer and more
numerous filopodium-like structures (Fig. 5D). These different
formations may reflect both the intrinsic morphological heterogeneity
of these macrophages and the different patterns of actin organization
that they exhibit, as was previously postulated with monocytes
(1). Microinjection of a control protein (IgG) did not
induce any change in Bac1.2F5 morphology, confirming that the responses
to RhoE were not due to microinjection itself (Fig. 5E and F).

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 5.
Actin reorganization induced by RhoE in Bac1.2F5
macrophages. Confocal micrographs show growing (A) and CSF-1-starved
(B) cells, cells injected with recombinant RhoE protein at 25 µg/ml
(C and D), cells injected with rat IgG at 0.5 mg/ml as a control (E and
F), and cells injected with expression vector pEXV3-myc-RhoE at 0.3 mg/ml (G and H). Bac1.2F5 cells were stained with TRITC-labelled
phalloidin to reveal actin filaments (A, B, C, D, E, and G), with
FITC-labeled goat anti-rabbit IgG (F) to detect microinjected cells, or
with anti-myc epitope antibody 9E10 followed by FITC-labeled goat
anti-mouse IgG (H). (H) A three-dimensional reconstruction shows the
subcellular localization of RhoE 4 h after DNA microinjection. A
maximum-intensity projection through a 768- by 512- by 25-voxel data
set was generated with the intermediate axis (512 voxels) tilted 15°.
Arrows indicate injected cells. The scale bar represents 20 µm (A, C,
E, F, and G), 28 µm (B), 17 µm (D), or 14 µm (H).
|
|
Similar morphological changes were obtained when the expression vector
carrying myc epitope-tagged
RhoE cDNA was microinjected
into
the nuclei of Bac1.2F5 macrophages and the expressed RhoE
protein was
detected with antibody 9E10 against the myc epitope
(Fig.
5G). The
cellular distribution of RhoE was also revealed
by these
immunofluorescence studies. RhoE was expressed throughout
the cytoplasm
but strongly localized at the dorsal plane of Bac1.2F5
macrophages,
specifically at the level of the ruffles, as revealed
by
three-dimensional reconstruction of a series of
z sections
obtained by confocal microscopy (Fig.
5H).
Stimulation of cell migration speed by RhoE.
MDCK cells become
motile in the presence of HGF/SF, and this response involves initial
centrifugal spreading of cells followed by detachment of cells from
each other (scattering) (48). It has been reported that
HGF/SF induces actin cytoskeletal reorganization, including a decrease
in the amount of stress fibers and the extension of lamellipodia, both
of which are likely to be important for the migration response
(13, 14, 41). It has also been shown that the microinjection
of V14RhoA induces stress fiber formation and inhibits HGF/SF-induced
motility (41). Since RhoE alters actin organization in MDCK
cells, it is possible that this protein has an effect on motility.
The effect of RhoE on the responses to HGF/SF was investigated by
monitoring cell motility by time-lapse videomicroscopy.
At RhoE
concentrations of 25 µg/ml, MDCK cells were able to spread
and
scatter. During the first 4 to 6 h after the addition of HGF/SF,
the surface area of each epithelial cell and therefore of each
colony
increases, with the subsequent scattering response involving
the
breaking of contact among cells. To study cell locomotion
specifically
associated with scattering and not spreading, cells
were tracked from 5 to 15 h after the addition of HGF/SF. Figure
6 shows that the migration speed of MDCK
cells was significantly
increased by 30% with RhoE injection, as
revealed by a statistical
Student
t test (
P 
0.001), compared to the speed of control cells
injected with rabbit
IgG.

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 6.
Enhancement of cell migration speed by RhoE. Cell
migration was monitored by tracking injected cells from 5 to 15 h
after the injection of RhoE. All cells monitored were microinjected
with either RhoE (25 µg/ml) or rabbit IgG (1 mg/ml) as a control
protein. HGF/SF (5 ng/ml) was added to MDCK cells 15 min after
microinjection, and cells were monitored by time-lapse videomicroscopy.
Ten cells were randomly selected, and the positions of their nuclei
were tracked every hour. For MDCK cells, five cells at the outer edge
and five cells within a colony were tracked. When a cell divided, both
progeny were monitored and the mean of the distances that they moved
was calculated. The final mean distance migrated was calculated from
the average distance moved by each of the 10 cells per hour. The error
bars represent the standard deviations of the means (four or five
independent experiments for MDCK cells and two for R4.2 cells). The
difference in migration rates between RhoE-injected cells and control
cells was statistically significant (P 0.001 for
MDCK and P 0.04 for R4.2).
|
|
To confirm that the effect of RhoE on MDCK cell migration was not
specific for one cell line, we also studied the motility
of another
cell line, a human mammary luminal epithelial cell
line, R4.2, which
expresses activated Ha-Ras (see Materials and
Methods). This cell line
does not proliferate in colonies, and
the growing cells are normally
motile (Fig.
6). Microinjection
of RhoE induced a significant increase
of 37% (
P 
0.04) in the
migration speed of R4.2
cells compared to the speed of control
cells injected with IgG (Fig.
6). Taken together with the RhoE-induced
disruption of the actin
cytoskeleton, these results suggest that
the disappearance of stress
fibers and focal adhesions enhances
the cell migration rate. This
suggestion is in accordance with
previous observations in MDCK cells,
in which a RhoA-induced dense
network of stress fibers antagonizes
locomotion (
41).
 |
DISCUSSION |
The Rho family members Rho, Rac, and Cdc42 are well characterized
with regard to regulating the formation of specific actin-containing structures, although the physiological relevance of these responses remains to be established. In addition, the functions of most other
members of the family are unclear. We have cloned the mouse homolog of
the human RhoE gene (16) and investigated its
role in regulating actin organization. Phylogenetic studies show that RhoE is more closely related to RhoA, RhoB, and RhoC than to Rac and
Cdc42 and, interestingly, this protein has the same effector domain as
RhoA, RhoB, and RhoC (16), except for amino acid 36 (Asn), analogous to position 31 in Ras (Val) (Fig.
7). This domain is important in Ras
superfamily proteins for interactions with downstream targets. In
contrast, in the region corresponding to the insert helix of RhoA and
Rac1 (residues 124 to 136 in RhoA), a structure exclusive to Rho family
proteins (19, 53), only 5 of 13 amino acids are identical
between RhoE and RhoA (Fig. 7). RhoE actually shows the strongest
sequence similarity to human Rho8, followed by Rho7 and Rho6, for which
sequences are available in the EMBL database but are not yet published.
These sequences may form a separate subfamily of Rho proteins.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the amino acid sequences of RhoA and RhoE
in the effector domain and the insert helix. Sequence alignment between
these two proteins showed very similar effector domains (except for one
amino acid) but many differences in the insert helices. Letters in
white represent identical residues.
|
|
Rho GTPases normally exist in two conformational states, an active
GTP-bound form and an inactive GDP-bound form (4). RhoE has
the five highly conserved G motifs known to be important for the
nucleotide-binding and catalytic functions of the Ras-related protein
superfamily (6), and indeed we have found that RhoE efficiently binds GTP, in accordance with previous results obtained with human RhoE (16). However, under our experimental
conditions, GDP binding was not detected, suggesting that the affinity
for GDP is extremely low and consistent with the observation that RhoE
does not bind GDP in vivo (16). RhoE thus appears to differ from other Rho family proteins in not having a stable GDP-bound conformation.
RhoE has substitutions at three positions known to be important for GTP
hydrolysis (16). It has a serine at each position (17, 64, and 66), equivalent to amino acids 12 (Gly), 59 (Ala), and 61 (Gln) in
Ras. Despite these structural differences, we have demonstrated that
RhoE exhibits intrinsic GTPase activity (both thrombin-cleaved RhoE and
a GST-RhoE fusion), although at a low rate compared with other Rho
family proteins. Other GTPases containing substitutions at positions
which participate in the binding and hydrolysis of GTP have been
reported elsewhere (18, 39). For example, Rap proteins have
a threonine instead of the highly conserved glutamine at position 61 (37). Rad and Gem proteins contain substitutions at position
61 (equivalent to position 12 in Ras) in the G1 motif and at position
108 (equivalent to position 60 in Ras) in the strongly conserved
DX2G sequence of the G3 motif (55). However, all
of these proteins exhibit GTPase activity. Furthermore, like RhoE, Rad
has a low intrinsic GTPase activity, and single mutations at positions
equivalent to 12 and 61 in Ras did not affect the Rad GTPase activity,
although mutations at both residues increased the GTPase activity
(55). Similarly, mutations at the three specific substituted
residues in RhoE resulted in an increase in the rate of GTP hydrolysis,
observed with the RhoE double mutant A64Q66 and the RhoE triple mutant
G17A64Q66 (16). Given the three substitutions in RhoE, it is
likely that the mechanism of GTP hydrolysis varies from that defined
for Ras. Indeed, it is worth noting that the different structures of
GTPases solved so far suggest variations in the exact mechanism of GTP hydrolysis; for example, the crystal structure of RhoA-GDP demonstrates a novel mode of Mg2+ binding (53). It is also
reasonable to suggest that to turn off RhoE efficiently in vivo, a
specific GAP must exist, as has been reported for Rap and Rad (45,
55), although no GAP activity for RhoE was detected in cell
extracts (16).
Previous experiments with human RhoE did not detect any GTPase activity
(16). The apparent discrepancy between these results and
ours may be due to our use of a protease-deficient strain of E. coli. We have observed that the RhoE protein from E. coli JM101 is slightly truncated, whereas the RhoE protein from a
protease-deficient strain, BL21, is full length. Removal of a small
portion of the protein could affect the detection of GTPase activity.
As it is known that Rho proteins induce cell-type-specific changes in
actin reorganization, we studied the effects of RhoE using two
different cell types. MDCK cells have stress fibers associated with
integrin-containing adhesion complexes, and microinjection of
recombinant V14RhoA stimulates stress fiber formation (41). In contrast, we showed that RhoE microinjection resulted in the rapid
disappearance of stress fibers and the appearance of aggregates of
actin filaments inside the cytoplasm. These aggregates could well have
been the remnants of stress fibers that became detached from focal
adhesions, as they disappeared with time after injection. In addition,
RhoE induced a loss of focal adhesions, which are also regulated by
RhoA (42). Time-lapse videomicroscopy showed that by 10 h after microinjection of RhoE, cells were much flatter and more spread
out than control cells (data not shown). Considering that stress fibers
act to maintain cell tension, it is likely that the loss of these actin
structures directly leads to cell spreading. Indeed, in other cellular
systems the loss of stress fibers is accompanied by rapid cell
spreading and, interestingly, the overexpression of dominant-negative
N-terminally truncated ROK
, a downstream target for RhoA, induces
cell spreading in HeLa and Swiss 3T3 cells (26).
Our results suggest that RhoE may inhibit signalling downstream of RhoA
to prevent RhoA from stimulating stress fiber formation. One
possibility is that it competes with RhoA for interaction with one or
more downstream effectors, explaining our observation that RhoE was
unable to inhibit stress fiber formation when coinjected with V14RhoA.
This hypothesis is also supported by the fact that RhoA and RhoE have
almost identical effector domains (Fig. 7), indicating that they are
likely to interact with common downstream targets. However, although
RhoE induced the loss of stress fibers, it did not completely mimic the
effects of C3 transferase, a specific inhibitor of Rho function
(29). MDCK cells have actin bundles at the periphery of
colonies which are broken occasionally at places where lamellipodia
extend outward (14, 41). Inhibition of RhoA function by C3
transferase microinjection results in the disappearance of these
peripheral bundles (41). In contrast, RhoE did not
detectably affect the peripheral bundles, at either early or late times
after microinjection, even at the highest RhoE concentration we could
obtain. It is possible that this result reflects an inability to
introduce high enough concentrations of RhoE to inhibit RhoA signalling
completely, as peripheral actin bundles are more stable than stress
fibers and microinjection of low concentrations of C3 transferase leads
to a loss of stress fibers before peripheral actin bundles are
disassembled (RMG and AJR, unpublished data). An alternative
possibility is that RhoE interacts with some but not all downstream
targets of RhoA and that the targets involved in regulating stress
fiber formation differ from those involved in peripheral bundle
formation. Interestingly, the insert helix (amino acids 124 to 136 in
RhoA) is not conserved between RhoA and RhoE (Fig. 7). It has recently
been hypothesized that this insert helix may be responsible for
conferring effector specificity among Rho family members
(53). The effector domain and the insert region of a GTPase
may interact with different downstream targets; for example, the Rac
insert region has been implicated in the activation of NADPH oxidase
but not of PAK65 (17). RhoE may therefore interact with
common RhoA effectors via its conserved effector domain but with
different targets via its insert helix. Alternatively, as single point
mutations inside the effector domains of Rac and Cdc42 can alter their
interaction with different targets (24), subtle differences
in or around the effector domains of RhoE and RhoA could alter effector
specificity. Identification of downstream targets of RhoE will provide
insights into the signalling pathways regulating stress fiber
formation.
MDCK cells are highly motile in the presence of HGF/SF, spreading over
the first 4 to 6 h after stimulation and then scattering as a
consequence of cell-cell detachment (48). The dynamic
assembly and disassembly of actin filaments provide the driving force
for cell motility (13, 25, 31), and inhibitors of actin
polymerization, such as cytochalasin B, prevent the scattering of MDCK
cells (44). RhoE by itself did not mimic HGF/SF, in contrast
to the rapid effect of activated H-Ras resembling HGF/SF-induced
spreading (41), although it did induce some spreading in the
long term. In the presence of HGF/SF, however, RhoE-injected cells
showed an increase in migration speed. Similarly, RhoE induced an
increase in the migration rate of R4.2 human mammary epithelial cells. Interestingly, previous studies suggested that highly motile or transformed cells have few stress fibers (8, 10, 28) and that a high level of stress fibers induced by RhoA inhibits HGF/SF motility (41). It is likely, therefore, that the
RhoE-induced disappearance of stress fibers is responsible for the
observed enhancement in migration.
As in MDCK cells, the microinjection of RhoE into Bac1.2F5 macrophages
led to actin reorganization: cells extended broad, web-like
actin-containing structures linking filopodium-like structures or
smaller pseudopodia among longer and more numerous filopodium-like structures. This phenotype is clearly different from that observed in
MDCK cells but may reflect a common mechanism for inhibiting RhoA
signalling. In cells such as fibroblasts, RhoA is required to maintain
a spread morphology by stimulating the attachment of stress fibers to
focal adhesion sites (42). However, in cells that do not
contain stress fibers, such as monocytes or macrophages and neuronal
cells, RhoA is involved in maintaining cell tension and a round
morphology (1, 2, 21). Microinjection of RhoA into Bac1.2F5
macrophages results in cell contraction and a more rounded appearance,
whereas microinjection of C3 transferase into Bac1.2F5 macrophages
leads to cell flattening and radial spreading (2). This
response to C3 transferase is distinct from the morphology induced by
RhoE, possibly, as described above, because RhoE only partially
inhibits RhoA signalling. Interestingly, however, treatment of human
monocytes and monocytic cell lines with C3 transferase leads to cell
spreading with filopodial and pseudopodial extensions (1),
resembling the RhoE-induced morphology in Bac1.2F5 cells.
The downstream targets of RhoE are not known yet, but its intracellular
localization suggests where it is likely to exert its biological
function. Three-dimensional reconstructions of confocal images showed
that aggregates containing RhoE and actin are localized at the basal
surfaces of MDCK cells, suggesting that they represent disrupted stress
fibers. This localization may be similar to that reported for RhoE in
osteosarcoma cells, where RhoE was observed in punctate structures
distinct from focal adhesions (16). The localization of RhoE
at the lateral membranes of MDCK cells suggests a role in cell-cell
adhesion. Since RhoA is required to form adherens junctions in
keratinocytes and MDCK cells (7, 50, 54), it would be
interesting to determine if RhoE regulates junction formation or acts
to inhibit RhoA signalling at this level. RhoE also appeared to
localize to microvilli, suggesting that it could be involved in
maintaining these actin-containing structures. In Bac1.2F5 macrophages,
RhoE was associated with membrane ruffles, as has been reported
for RhoA (49); this localization of RhoE is also consistent
with its acting to antagonize RhoA.
Ruffles, cell-cell adhesion sites, and microvilli are specialized
regions where actin filaments are linked to the plasma membrane. Recently, several studies have linked Rho to the ezrin/moesin/radixin family of proteins, which are implicated in actin filament-plasma membrane association (30, 51). Further studies focusing on the possible colocalization of ezrin/moesin/radixin proteins and RhoE
should provide more information on the role of RhoE in regulating actin
organization.
 |
ACKNOWLEDGMENTS |
We are grateful to Ritu Garg for excellent cell culture
assistance, to Robert Harris and Thomas Eichholtz (Glaxo Wellcome) for
the gift of the R4.2 cell line, and to Alan Entwistle for assistance
with confocal laser scanning microscopy and image processing. We thank
Emma Cannell for characterizing the r13, r15, r16, and r20 clones, Nick
Totty for laser desorption mass spectrometric analysis of recombinant
RhoE, and Jeff Settleman for advice and discussion of results. We also
thank Ignacio Perez-Roger for help with the sequence analysis software.
This work was supported by European Communities grant
ERBCHBGCT940702.
 |
ADDENDUM IN PROOF |
After submission of this paper, the sequences of Rho6,
Rho7, and Rho8 were published (C. D. Nobes et
al., J. Cell Biol. 141:1-11, 1998) and were renamed
Rnd1, Rnd2, and Rnd3, respectively.
The protein encoded by Rnd3 is identical to RhoE, except
that it has an extra 15 amino acids at the N terminus.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Ludwig
Institute for Cancer Research, 91 Riding House St., London W1P 8BT,
United Kingdom. Phone: (44)-171-878-4088. Fax: (44)-171-878-4040.
E-mail: anne{at}ludwig.ucl.ac.uk.
 |
REFERENCES |
| 1.
|
Aepfelbacher, M.,
M. Essler,
E. Huber,
A. Czech, and P. C. Weber.
1996.
Rho is a negative regulator of human monocyte spreading.
J. Immunol.
157:5070-5075[Abstract].
|
| 2.
|
Allen, W. E.,
G. E. Jones,
J. W. Pollard, and A. J. Ridley.
1997.
Rho, Rac and Cdc42 regulate actin organization and cell adhesion in macrophages.
J. Cell Sci.
110:707-720[Abstract].
|
| 3.
|
Amano, M.,
M. Ito,
K. Kimura,
Y. Fukata,
K. Chihara,
T. Nakano,
Y. Matsuura, and K. Kaibuchi.
1996.
Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase).
J. Biol. Chem.
271:20246-20249[Abstract/Free Full Text].
|
| 4.
|
Boguski, M. S., and F. McCormick.
1993.
Proteins regulating Ras and its relatives.
Nature
366:643-654[Medline].
|
| 5.
|
Boocock, C. A.,
G. E. Jones,
E. R. Stanley, and J. W. Pollard.
1989.
Colony-stimulating factor-1 induces rapid behavioural responses in the mouse macrophage cell line, BAC1.2F5.
J. Cell Sci.
93:447-456[Abstract/Free Full Text].
|
| 6.
|
Bourne, H. R.,
D. A. Sanders, and F. McCormick.
1991.
The GTPase superfamily: conserved structure and molecular mechanism.
Nature
349:117-127[Medline].
|
| 7.
|
Braga, V. M.,
L. M. Machesky,
A. Hall, and N. A. Hotchin.
1997.
The small GTPases Rho and Rac are required for the establishment of cadherin-dependent cell-cell contacts.
J. Cell Biol.
137:1421-1431[Abstract/Free Full Text].
|
| 8.
|
Bretscher, A.
1991.
Microfilament structure and function in the cortical cytoskeleton.
Annu. Rev. Cell Biol.
7:337-374.
|
| 9.
|
Burridge, K., and M. Chrzanowska Wodnicka.
1996.
Focal adhesions, contractility, and signaling.
Annu. Rev. Cell Dev. Biol.
12:463-518[Medline].
|
| 10.
|
Burridge, K.,
K. Fath,
T. Kelly,
G. Nuckolls, and C. Turner.
1988.
Focal adhesions: transmembrane junctions between the extracellular matrix and the cytoskeleton.
Annu. Rev. Cell Biol.
4:487-525.
|
| 11.
|
Chihara, K.,
M. Amano,
N. Nakamura,
T. Yano,
M. Shibata,
T. Tokui,
H. Ichikawa,
R. Ikebe,
M. Ikebe, and K. Kaibuchi.
1997.
Cytoskeletal rearrangements and transcriptional activation of c-fos serum response element by Rho-kinase.
J. Biol. Chem.
272:25121-25127[Abstract/Free Full Text].
|
| 12.
|
Chrzanowska-Wodnicka, M., and K. Burridge.
1996.
Rho-stimulated contractility drives the formation of stress fibers and focal adhesions.
J. Cell Biol.
133:1403-1415[Abstract/Free Full Text].
|
| 13.
|
Cooper, J. A.
1991.
The role of actin polymerization in cell motility.
Annu. Rev. Physiol.
53:585-605[Medline].
|
| 14.
|
Dowrick, P. G.,
A. R. Prescott, and R. M. Warn.
1991.
Scatter factor affects major changes in the cytoskeletal organization of epithelial cells.
Cytokine
3:299-310[Medline].
|
| 15.
|
Entwistle, A., and M. Noble.
1994.
Optimizing the performance of confocal point scanning laser microscopes over the full field of view.
J. Microsc.
175:238-251.
|
| 16.
|
Foster, R.,
K. Q. Hu,
Y. Lu,
K. M. Nolan,
J. Thissen, and J. Settleman.
1996.
Identification of a novel human Rho protein with unusual properties: GTPase deficiency and in vivo farnesylation.
Mol. Cell. Biol.
16:2689-2699[Abstract].
|
| 17.
|
Freeman, J. L.,
A. Abo, and J. D. Lambeth.
1996.
Rac "insert region" is a novel effector region that is implicated in the activation of NADPH oxidase, but not PAK65.
J. Biol. Chem.
271:19794-19801[Abstract/Free Full Text].
|
| 18.
|
Hart, P. A., and C. J. Marshall.
1990.
Amino acid 61 is a determinant of sensitivity of rap proteins to the ras GTPase activating protein.
Oncogene
5:1099-1101[Medline].
|
| 19.
|
Hirshberg, M.,
R. W. Stockley,
G. Dodson, and M. R. Webb.
1997.
The crystal structure of human rac1, a member of the rho-family complexed with a GTP analogue.
Nat. Struct. Biol.
4:147-152[Medline].
|
| 20.
|
Ishizaki, T.,
M. Naito,
K. Fujisawa,
M. Maekawa,
N. Watanabe,
Y. Saito, and S. Narumiya.
1997.
p160ROCK, a Rho-associated coiled-coil forming protein kinase, works downstream of Rho and induces focal adhesions.
FEBS Lett.
404:118-124[Medline].
|
| 21.
|
Jalink, K.,
E. J. van Corven,
T. Hengeveld,
N. Morii,
S. Narumiya, and W. H. Moolenaar.
1994.
Inhibition of lysophosphatidate- and thrombin-induced neurite retraction and neuronal cell rounding by ADP ribosylation of the small GTP-binding protein Rho.
J. Cell Biol.
126:801-810[Abstract/Free Full Text].
|
| 22.
|
Kimura, K.,
M. Ito,
M. Amano,
K. Chihara,
Y. Fukata,
M. Nakafuku,
B. Yamamori,
J. Feng,
T. Nakano,
K. Okawa,
A. Iwamatsu, and K. Kaibuchi.
1996.
Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase).
Science
273:245-248[Abstract].
|
| 23.
|
Kozma, R.,
S. Ahmed,
A. Best, and L. Lim.
1995.
The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts.
Mol. Cell. Biol.
15:1942-1952[Abstract].
|
| 24.
|
Lamarche, N.,
N. Tapon,
L. Stowers,
P. D. Burbelo,
P. Aspenstrom,
T. Bridges,
J. Chant, and A. Hall.
1996.
Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade.
Cell
87:519-529[Medline].
|
| 25.
|
Lauffenburger, D. A., and A. F. Horwitz.
1996.
Cell migration: a physically integrated molecular process.
Cell
84:359-369[Medline].
|
| 26.
|
Leung, T.,
X. Q. Chen,
E. Manser, and L. Lim.
1996.
The p160 RhoA-binding kinase ROK is a member of a kinase family and is involved in the reorganization of the cytoskeleton.
Mol. Cell. Biol.
16:5313-5327[Abstract].
|
| 27.
|
Leung, T.,
E. Manser,
L. Tan, and L. Lim.
1995.
A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes.
J. Biol. Chem.
270:29051-29054[Abstract/Free Full Text].
|
| 28.
|
Lloyd, A. C.,
H. F. Paterson,
J. D. Morris,
A. Hall, and C. J. Marshall.
1989.
p21H-ras-induced morphological transformation and increases in c-myc expression are independent of functional protein kinase C.
EMBO J.
8:1099-1104[Medline].
|
| 29.
|
Machesky, L. M., and A. Hall.
1996.
Rho: a connection between membrane receptor signalling and the cytoskeleton.
Trends Cell Biol.
6:304-310.
[Medline] |
| 30.
|
Mackay, D. J.,
F. Esch,
H. Furthmayr, and A. Hall.
1997.
Rho- and rac-dependent assembly of focal adhesion complexes and actin filaments in permeabilized fibroblasts: an essential role for ezrin/radixin/moesin proteins.
J. Cell Biol.
138:927-938[Abstract/Free Full Text].
|
| 31.
|
Mitchison, T. J., and L. P. Cramer.
1996.
Actin-based cell motility and cell locomotion.
Cell
84:371-379[Medline].
|
| 32.
|
Morgan, C.,
J. W. Pollard, and E. R. Stanley.
1987.
Isolation and characterization of a cloned growth factor dependent macrophage cell line, BAC1.2F5.
J. Cell. Physiol.
130:420-427[Medline].
|
| 33.
|
Narumiya, S.,
T. Ishizaki, and N. Watanabe.
1997.
Rho effectors and reorganization of actin cytoskeleton.
FEBS Lett.
410:68-72[Medline].
|
| 34.
|
Nishiyama, T.,
T. Sasaki,
K. Takaishi,
M. Kato,
H. Yaku,
K. Araki,
Y. Matsuura, and Y. Takai.
1994.
rac p21 is involved in insulin-induced membrane ruffling and rho p21 is involved in hepatocyte growth factor- and 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced membrane ruffling in KB cells.
Mol. Cell. Biol.
14:2447-2456[Abstract/Free Full Text].
|
| 35.
|
Nobes, C. D., and A. Hall.
1995.
Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia.
Cell
81:53-62[Medline].
|
| 36.
|
O'Hare, M. J.,
M. G. Omerod,
P. Monaghan,
E. B. Lane, and B. A. Gusterson.
1991.
Characterisation in vitro of luminal and myoepithelial cells isolated from the human mammary gland by cell sorting.
Differentiation
46:209-221[Medline].
|
| 37.
|
Pizon, V.,
P. Chardin,
I. Lerosey,
B. Olofsson, and A. Tavitian.
1988.
Human cDNAs rap1 and rap2 homologous to the Drosophila gene Dras3 encode proteins closely related to ras in the `effector' region.
Oncogene
3:201-204[Medline].
|
| 38.
|
Postma, F. R.,
K. Jalink,
T. Hengeveld, and W. H. Moolenaar.
1996.
Sphingosine-1-phosphate rapidly induces Rho-dependent neurite retraction: action through a specific cell surface receptor.
EMBO J.
15:2388-2392[Medline].
|
| 39.
|
Reynet, C., and C. R. Kahn.
1993.
Rad: a member of the Ras family overexpressed in muscle of type II diabetic humans.
Science
262:1441-1444[Abstract/Free Full Text].
|
| 40.
|
Ridley, A. J.
1996.
Rho: theme and variations.
Curr. Biol.
6:1256-1264[Medline].
|
| 41.
|
Ridley, A. J.,
P. M. Comoglio, and A. Hall.
1995.
Regulation of scatter factor/hepatocyte growth factor responses by Ras, Rac, and Rho in MDCK cells.
Mol. Cell. Biol.
15:1110-1122[Abstract].
|
| 42.
|
Ridley, A. J., and A. Hall.
1992.
The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell
70:389-399[Medline].
|
| 43.
|
Ridley, A. J.,
H. F. Paterson,
C. L. Johnston,
D. Diekman, and A. Hall.
1992.
The small GTP-binding protein rac regulates growth factor-induced membrane ruffling.
Cell
70:401-410[Medline].
|
| 44.
|
Rosen, E. M.,
L. Meromsky,
I. Goldberg,
M. Bhargava, and E. Setter.
1990.
Studies on the mechanism of scatter factor. Effects of agents that modulate intracellular signal transduction, macromolecule synthesis and cytoskeleton assembly.
J. Cell Sci.
96:639-649[Abstract/Free Full Text].
|
| 45.
|
Rubinfeld, B.,
W. J. Crosier,
I. Albert,
L. Conroy,
R. Clark,
F. McCormick, and P. Polakis.
1992.
Localization of the rap1GAP catalytic domain and sites of phosphorylation by mutational analysis.
Mol. Cell. Biol.
12:4634-4642[Abstract/Free Full Text].
|
| 46.
|
Self, A. J., and A. Hall.
1995.
Measurement of intrinsic nucleotide exchange and GTP hydrolysis rates.
Methods Enzymol.
256:67-76[Medline].
|
| 47.
|
Smith, D. S., and K. S. Johnson.
1988.
Single-step purification of polypeptides expressed in E. coli as fusions with glutathione S-transferase.
Gene
67:31-40[Medline].
|
| 48.
|
Stoker, M., and M. Perryman.
1985.
An epithelial scatter factor released by embryo fibroblasts.
J. Cell Sci.
77:209-223[Abstract].
|
| 49.
|
Takaishi, K.,
T. Sasaki,
T. Kameyama,
S. Tsukita,
S. Tsukita, and Y. Takai.
1995.
Translocation of activated Rho from the cytoplasm to membrane ruffling area, cell-cell adhesion sites and cleavage furrows.
Oncogene
11:39-48[Medline].
|
| 50.
|
Takaishi, K.,
T. Sasaki,
H. Kotani,
H. Nishioka, and Y. Takai.
1997.
Regulation of cell-cell adhesion by Rac and Rho small G proteins in MDCK cells.
J. Cell Biol.
139:1047-1059[Abstract/Free Full Text].
|
| 51.
|
Tsukita, S.,
S. Yonemura, and S. Tsukita.
1997.
ERM proteins: head-to-tail regulation of actin-plasma membrane interaction.
Trends Biochem. Sci.
22:53-58[Medline].
|
| 52.
|
Van Aelst, L., and C. D'Souza-Schorey.
1997.
Rho GTPases and signaling networks.
Genes Dev.
11:2295-2322[Free Full Text].
|
| 53.
|
Wei, Y.,
Y. Zhang,
U. Derewenda,
X. Liu,
W. Minor,
R. K. Nakamoto,
A. V. Somlyo,
A. P. Somlyo, and Z. S. Derewenda.
1997.
Crystal structure of RhoA-GDP and its functional implications.
Nat. Struct. Biol.
4:699-703[Medline].
|
| 54.
|
Zhong, C.,
M. S. Kinch, and K. Burridge.
1997.
Rho-stimulated contractility contributes to the fibroblastic phenotype of Ras-transformed epithelial cells.
Mol. Biol. Cell.
8:2329-2344[Abstract/Free Full Text].
|
| 55.
|
Zhu, J.,
C. Reynet,
J. S. Caldwell, and C. R. Kahn.
1995.
Characterization of Rad, a new member of Ras/GTPase superfamily, and its regulation by a unique GTPase-activating protein (GAP)-like activity.
J. Biol. Chem.
270:4805-4812[Abstract/Free Full Text].
|
Mol Cell Biol, August 1998, p. 4761-4771, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Meima, M. E., Webb, B. A., Witkowska, H. E., Barber, D. L.
(2009). The Sodium-Hydrogen Exchanger NHE1 Is an Akt Substrate Necessary for Actin Filament Reorganization by Growth Factors. J. Biol. Chem.
284: 26666-26675
[Abstract]
[Full Text]
-
Klein, R. M., Aplin, A. E.
(2009). Rnd3 Regulation of the Actin Cytoskeleton Promotes Melanoma Migration and Invasive Outgrowth in Three Dimensions. Cancer Res.
69: 2224-2233
[Abstract]
[Full Text]
-
Li, Y.-H., Ghavampur, S., Bondallaz, P., Will, L., Grenningloh, G., Puschel, A. W.
(2009). Rnd1 Regulates Axon Extension by Enhancing the Microtubule Destabilizing Activity of SCG10. J. Biol. Chem.
284: 363-371
[Abstract]
[Full Text]
-
Liebig, T., Erasmus, J., Kalaji, R., Davies, D., Loirand, G., Ridley, A., Braga, V. M.M.
(2009). RhoE Is Required for Keratinocyte Differentiation and Stratification. Mol. Biol. Cell
20: 452-463
[Abstract]
[Full Text]
-
Klein, R. M., Spofford, L. S., Abel, E. V., Ortiz, A., Aplin, A. E.
(2008). B-RAF Regulation of Rnd3 Participates in Actin Cytoskeletal and Focal Adhesion Organization. Mol. Biol. Cell
19: 498-508
[Abstract]
[Full Text]
-
Komatsu, S., Ikebe, M.
(2007). The Phosphorylation of Myosin II at the Ser1 and Ser2 Is Critical for Normal Platelet-derived Growth Factor induced Reorganization of Myosin Filaments. Mol. Biol. Cell
18: 5081-5090
[Abstract]
[Full Text]
-
Gadea, G., de Toledo, M., Anguille, C., Roux, P.
(2007). Loss of p53 promotes RhoA ROCK-dependent cell migration and invasion in 3D matrices. JCB
178: 23-30
[Abstract]
[Full Text]
-
Boswell, S. A., Ongusaha, P. P., Nghiem, P., Lee, S. W.
(2007). The Protective Role of a Small GTPase RhoE against UVB-induced DNA Damage in Keratinocytes. J. Biol. Chem.
282: 4850-4858
[Abstract]
[Full Text]
-
Gee, J M W, Shaw, V E, Hiscox, S E, McClelland, R A, Rushmere, N K, Nicholson, R I
(2006). Deciphering antihormone-induced compensatory mechanisms in breast cancer and their therapeutic implications. Endocr Relat Cancer
13: S77-S88
[Abstract]
[Full Text]
-
Lartey, J., Gampel, A., Pawade, J., Mellor, H., Bernal, A. L.
(2006). Expression of RND Proteins in Human Myometrium. Biol. Reprod.
75: 452-461
[Abstract]
[Full Text]
-
Harada, A., Katoh, H., Negishi, M.
(2005). Direct Interaction of Rnd1 with FRS2{beta} Regulates Rnd1-induced Down-regulation of RhoA Activity and Is Involved in Fibroblast Growth Factor-induced Neurite Outgrowth in PC12 Cells. J. Biol. Chem.
280: 18418-18424
[Abstract]
[Full Text]
-
Galindo, C. L., Fadl, A. A., Sha, J., Pillai, L., Gutierrez, C. Jr., Chopra, A. K.
(2005). Microarray and Proteomics Analyses of Human Intestinal Epithelial Cells Treated with the Aeromonas hydrophila Cytotoxic Enterotoxin. Infect. Immun.
73: 2628-2643
[Abstract]
[Full Text]
-
Govek, E.-E., Newey, S. E., Van Aelst, L.
(2005). The role of the Rho GTPases in neuronal development. Genes Dev.
19: 1-49
[Abstract]
[Full Text]
-
Villalonga, P., Guasch, R. M., Riento, K., Ridley, A. J.
(2004). RhoE Inhibits Cell Cycle Progression and Ras-Induced Transformation. Mol. Cell. Biol.
24: 7829-7840
[Abstract]
[Full Text]
-
Medjkane, S., Novikov, E., Versteege, I., Delattre, O.
(2004). The Tumor Suppressor hSNF5/INI1 Modulates Cell Growth and Actin Cytoskeleton Organization. Cancer Res.
64: 3406-3413
[Abstract]
[Full Text]
-
Wennerberg, K., Der, C. J.
(2004). Rho-family GTPases: it's not only Rac and Rho (and I like it). J. Cell Sci.
117: 1301-1312
[Abstract]
[Full Text]
-
Dvorsky, R., Blumenstein, L., Vetter, I. R., Ahmadian, M. R.
(2004). Structural Insights into the Interaction of ROCKI with the Switch Regions of RhoA. J. Biol. Chem.
279: 7098-7104
[Abstract]
[Full Text]
-
Ishikawa, Y., Katoh, H., Negishi, M.
(2003). A Role of Rnd1 GTPase in Dendritic Spine Formation in Hippocampal Neurons. J. Neurosci.
23: 11065-11072
[Abstract]
[Full Text]
-
Evans, H. R., Sutton, J. M., Holloway, D. E., Ayriss, J., Shone, C. C., Acharya, K. R.
(2003). The Crystal Structure of C3stau2 from Staphylococcus aureus and Its Complex with NAD. J. Biol. Chem.
278: 45924-45930
[Abstract]
[Full Text]
-
Liu, T., Bauskin, A. R., Zaunders, J., Brown, D. A., Pankurst, S., Russell, P. J., Breit, S. N.
(2003). Macrophage Inhibitory Cytokine 1 Reduces Cell Adhesion and Induces Apoptosis in Prostate Cancer Cells. Cancer Res.
63: 5034-5040
[Abstract]
[Full Text]
-
Oinuma, I., Katoh, H., Harada, A., Negishi, M.
(2003). Direct Interaction of Rnd1 with Plexin-B1 Regulates PDZ-RhoGEF-mediated Rho Activation by Plexin-B1 and Induces Cell Contraction in COS-7 Cells. J. Biol. Chem.
278: 25671-25677
[Abstract]
[Full Text]
-
Riento, K., Guasch, R. M., Garg, R., Jin, B., Ridley, A. J.
(2003). RhoE Binds to ROCK I and Inhibits Downstream Signaling. Mol. Cell. Biol.
23: 4219-4229
[Abstract]
[Full Text]
-
Abe, T., Kato, M., Miki, H., Takenawa, T., Endo, T.
(2003). Small GTPase Tc10 and its homologue RhoT induce N-WASP-mediated long process formation and neurite outgrowth. J. Cell Sci.
116: 155-168
[Abstract]
[Full Text]
-
Fujita, H., Katoh, H., Ishikawa, Y., Mori, K., Negishi, M.
(2002). Rapostlin Is a Novel Effector of Rnd2 GTPase Inducing Neurite Branching. J. Biol. Chem.
277: 45428-45434
[Abstract]
[Full Text]
-
Kontani, K., Tada, M., Ogawa, T., Okai, T., Saito, K., Araki, Y., Katada, T.
(2002). Di-Ras, a Distinct Subgroup of Ras Family GTPases with Unique Biochemical Properties. J. Biol. Chem.
277: 41070-41078
[Abstract]
[Full Text]
-
Solski, P. A., Helms, W., Keely, P. J., Su, L., Der, C. J.
(2002). RhoA Biological Activity Is Dependent on Prenylation but Independent of Specific Isoprenoid Modification. Cell Growth Differ.
13: 363-373
[Abstract]
[Full Text]
-
Katoh, H., Harada, A., Mori, K., Negishi, M.
(2002). Socius Is a Novel Rnd GTPase-Interacting Protein Involved in Disassembly of Actin Stress Fibers. Mol. Cell. Biol.
22: 2952-2964
[Abstract]
[Full Text]
-
Li, X., Bu, X., Lu, B., Avraham, H., Flavell, R. A., Lim, B.
(2002). The Hematopoiesis-Specific GTP-Binding Protein RhoH Is GTPase Deficient and Modulates Activities of Other Rho GTPases by an Inhibitory Function. Mol. Cell. Biol.
22: 1158-1171
[Abstract]
[Full Text]
-
Woods, D., Cherwinski, H., Venetsanakos, E., Bhat, A., Gysin, S., Humbert, M., Bray, P. F., Saylor, V. L., McMahon, M.
(2001). Induction of {beta}3-Integrin Gene Expression by Sustained Activation of the Ras-Regulated Raf-MEK-Extracellular Signal-Regulated Kinase Signaling Pathway. Mol. Cell. Biol.
21: 3192-3205
[Abstract]
[Full Text]
-
Ridley, A. J.
(2001). Rho GTPases and cell migration. J. Cell Sci.
114: 2713-2722
[Abstract]
[Full Text]
-
Hansen, S. H., Zegers, M. M. P., Woodrow, M., Rodriguez-Viciana, P., Chardin, P., Mostov, K. E., McMahon, M.
(2000). Induced Expression of Rnd3 Is Associated with Transformation of Polarized Epithelial Cells by the Raf-MEK-Extracellular Signal-Regulated Kinase Pathway. Mol. Cell. Biol.
20: 9364-9375
[Abstract]
[Full Text]
-
Ohba, Y., Mochizuki, N., Matsuo, K., Yamashita, S., Nakaya, M., Hashimoto, Y., Hamaguchi, M., Kurata, T., Nagashima, K., Matsuda, M.
(2000). Rap2 as a Slowly Responding Molecular Switch in the Rap1 Signaling Cascade. Mol. Cell. Biol.
20: 6074-6083
[Abstract]
[Full Text]
-
Camerer, E., Gjernes, E., Wiiger, M., Pringle, S., Prydz, H.
(2000). Binding of Factor VIIa to Tissue Factor on Keratinocytes Induces Gene Expression. J. Biol. Chem.
275: 6580-6585
[Abstract]
[Full Text]
-
Joberty, G., Perlungher, R. R., Macara, I. G.
(1999). The Borgs, a New Family of Cdc42 and TC10 GTPase-Interacting Proteins. Mol. Cell. Biol.
19: 6585-6597
[Abstract]
[Full Text]
-
Harton, J. A., Cressman, D. E., Chin, K., Der, C. J., -Y. Ting, J. P.
(1999). GTP Binding by Class II Transactivator: Role in Nuclear Import. Science
285: 1402-1405
[Abstract]
[Full Text]
-
Uberall, F., Hellbert, K., Kampfer, S., Maly, K., Villunger, A., Spitaler, M., Mwanjewe, J., Baier-Bitterlich, G., Baier, G., Grunicke, H. H.
(1999). Evidence That Atypical Protein Kinase C-{lambda} and Atypical Protein Kinase C-{zeta} Participate in Ras-mediated Reorganization of the F-actin Cytoskeleton. JCB
144: 413-425
[Abstract]
[Full Text]
-
Fukata, M, Nakagawa, M, Kuroda, S, Kaibuchi, K
(1999). Cell adhesion and Rho small GTPases. J. Cell Sci.
112: 4491-4500
[Abstract]
-
Wilde, C., Chhatwal, G. S., Schmalzing, G., Aktories, K., Just, I.
(2001). A Novel C3-like ADP-ribosyltransferase from Staphylococcus aureus Modifying RhoE and Rnd3. J. Biol. Chem.
276: 9537-9542
[Abstract]
[Full Text]
-
Versteeg, H. H., Hoedemaeker, I., Diks, S. H., Stam, J. C., Spaargaren, M., van Bergen en Henegouwen, P. M. P., van Deventer, S. J. H., Peppelenbosch, M. P.
(2000). Factor VIIa/Tissue Factor-induced Signaling via Activation of Src-like Kinases, Phosphatidylinositol 3-Kinase, and Rac. J. Biol. Chem.
275: 28750-28756
[Abstract]
[Full Text]