Previous Article | Next Article 
Mol Cell Biol, August 1998, p. 4899-4913, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Disruption of PML Subnuclear Domains by the Acidic IE1 Protein of
Human Cytomegalovirus Is Mediated through Interaction with PML and
May Modulate a RING Finger-Dependent Cryptic Transactivator
Function of PML
Jin-Hyun
Ahn,1
Edward J.
Brignole III,1 and
Gary S.
Hayward1 2 *
Molecular Virology Laboratories, Departments
of Pharmacology and Molecular Sciences1 and
of Oncology,2 Johns Hopkins
University School of Medicine, Baltimore, Maryland 21205
Received 20 March 1998/Returned for modification 22 April
1998/Accepted 7 May 1998
 |
ABSTRACT |
Both of the major immediate-early (IE) proteins IE1 and IE2 of
human cytomegalovirus (HCMV) as well as input viral DNA and sites of
viral IE transcription colocalize with or adjacent to punctate PML
domains (PML oncogenic domains [PODs] or nuclear domain 10) in the
nucleus within the first few hours after infection of permissive human
fibroblasts. However, colocalization of IE1 and PML in PODs is only
transient, with both proteins subsequently redistributing into a
nuclear diffuse form. These processes are believed to promote
efficient viral IE transcription and initiation of DNA synthesis
especially at low multiplicities of infection. To examine
the mechanism of PML displacement by IE1, we carried out indirect
immunofluorescence assay experiments with plasmids expressing
intact or deleted forms of PML and IE1 in DNA-transfected cells. The
results demonstrated that deletion of the C-terminal acidic region of
IE1 uncouples the requirements for displacement of both endogenous and
coexpressed PML from those needed to target to the PODs. Mutant PML
proteins containing either a Cys point mutation within the N-terminal
RING finger domain or a small deletion (of positions 281 to 304) within the coiled-coil region did not localize to the PODs but
instead gave a nuclear diffuse distribution, similar to that produced
by intact PML in the presence of IE1. Endogenous PML also colocalized
with IE1 in metaphase chromosomes in HCMV or recombinant adenovirus
type 5-IE1-infected HF cells undergoing mitosis, implying that there
may be a direct physical interaction between IE1 and PML. Indeed, a
specific interaction between IE1 and PML was observed in a yeast
two-hybrid assay, and the strength of this interaction was comparable
to that of IE2 with the retinoblastoma protein. The RING finger mutant
form of PML showed a threefold-lower interaction with IE1 in the yeast system, and deletion of the N-terminal RING finger domain of PML abolished the interaction. Consistent with the IFA results, a mutant
IE1 protein that lacks the C-terminal acidic region was sufficient for
interaction with PML in the yeast system. The two-hybrid interaction
assay also showed that both the N-terminal RING finger domain and the
intact coiled-coil region of PML are required cooperatively for
efficient self-interactions involving dimerization or oligomerization. Furthermore, truncated or deleted GAL4/PML fusion proteins that retained the RING finger domain but lacked the intact coiled-coil region displayed an unmasked cryptic transactivator function in both
yeast and mammalian cells, and the RING finger mutation abolished this
transactivation property of PML. Therefore, we suggest that a direct
interaction between IE1 and the N-terminal RING finger domain of PML
may inhibit oligomerization and protein-protein complex formation by
PML, leading to displacement of PML and IE1 from the PODs, and that
this interaction may also modulate a putative conditional
transactivator function of PML.
 |
INTRODUCTION |
Several herpesvirus nuclear
regulatory proteins expressed at immediate-early (IE) times after
infection target to specific punctate subdomains in the nucleus of host
cells, where they appear to exert as yet unknown roles in facilitating
initial events in viral mRNA transcription and DNA replication.
Interactions within the first few hours of infection between these
viral regulatory proteins and appropriate cellular proteins present
at these punctate loci, such as the PML tumor suppressor, may play a
key enhancing (although not necessarily essential) role for increasing
the efficiency of the productive lytic cycle processes. In this study,
we evaluated the possibility of a direct interaction between the
cytomegalovirus (CMV) IE1 protein and the cellular PML protein that
might be responsible for both the targeting to and disruption of the
PML oncogenic domains (PODs).
Human CMV (HCMV) typically causes asymptomatic infection in
immunocompetent individuals. However, infection of newborns and of
immunocompromised individuals, as well as reactivation from latent
infection, can lead to severe disease complications and pathogenesis
(7, 55). During permissive lytic HCMV infection, viral gene
expression occurs in a three-step sequential fashion (IE, early, and
late), in which both the IE proteins and virion factors are required
for the subsequent efficient induction of the early and late genes
(48, 63). Two IE nuclear phosphoproteins, IE1 (UL123, IE72
[72-kDa IE protein]) and IE2 (UL122, IE86), which are expressed from
differentially spliced mRNA species generated from the major IE (MIE)
locus (65, 66), are the first and most abundantly expressed
HCMV IE gene products and are also the only viral proteins synthesized
in some nonpermissive cell types (43).
The role of the IE2 (IE86) protein as an essential transcriptional
transactivator and DNA binding repressor has been partially defined
(11, 12, 30, 45, 49, 58-60). However, the role of IE1,
which is important for efficient lytic cycle infection at low
multiplicity of infection (MOI) but is not essential in cell culture at
high MOI (26, 54), is poorly understood. One study has
suggested that IE1 can transactivate the MIE promoter through upstream
NF
B sites (10), but this has not been confirmed. The
491-amino-acid (aa) IE1 protein shares 87 aa at the N terminus with IE2
but is otherwise largely hydrophobic, except for a highly acidic
Glu-rich C-terminal region. Unlike IE2 or the IE175 (ICP4), IE110
(ICP0), IE63 (ICP27), and IE68 (ICP22) nuclear regulatory proteins of
herpes simplex virus (HSV), stable constitutive expression of IE1 in
cell lines is fully compatible with long-term cell survival. Because
the IE1 coding region displays selective CpG suppression and the IE1
protein preferentially associates with metaphase chromosomes, it has
been suggested that like EBNA-1 of Epstein-Barr virus (EBV), it may
potentially play a role in maintenance of the latent state of HCMV DNA
(31, 44).
Recently, considerable attention has been focused on the fact that
several key regulatory proteins encoded by DNA viruses target to a set
of punctate subdomains within the nucleus at very early times after
infection (reviewed in reference 16). These PML-containing subdomains (PODs or nuclear domain 10) are spherical structures with a size of 0.3 to 0.5 µm in which the PML RING finger
protein surrounds an electron-dense core associated with the nuclear
matrix (19, 39, 70). They appear to be dynamic structures
that form between 10 and 20 distinct bodies distributed throughout the
nucleus in most cell types (3, 53). Several cellular
proteins including PML (19, 39, 70), SP100 (68), NDP55 (27), PIC 1 (5), and PLZF (38)
have all been reported to be present in the PODs. Among them, the
PML proto-oncogene was first identified as part of a fusion protein
with the alpha retinoic acid receptor (RAR
) that resulted from the
t(15;17) translocation in acute promyelocytic leukemia (APL) (14,
25, 35, 36, 57). In the NB4 cell line derived from an APL tumor, the localization of PML and PML/RAR
is changed from the normal punctate nuclear bodies to a nuclear and cytoplasmic micropunctate pattern. However, when NB4 cells are treated with retinoic acid (RA), the normal punctate PML distribution pattern is restored and the
cells regain both normal cell growth controls and the ability to
differentiate (19, 27, 39).
The crucial role of the dominant negative PML/RAR
fusion protein in
the pathogenesis of APL has been confirmed by the observation that
PML/RAR
transgenic mice develop a form of acute leukemia with a
differentiation block at the promyelocyte stage (29). The
PML punctate pattern is also regulated by cell cycle progression (19). Although little is known about the function of
proteins present in the PODs, they appear to be involved in cell
proliferation processes because PML acts as a growth and tumor
suppressor when overexpressed (46, 50, 56), and its gene
expression is up-regulated by alpha and gamma interferons
(64). Also, PML has been suggested to have a transcriptional
modulator function because the PML/RAR
fusion protein shows altered
transactivator or repressor properties (depending on the target gene
tested) compared to RAR
(14, 35).
In human HSV type 1 (HSV-1) infection, the viral regulatory protein
IE110 (or ICP0), which is also a member of the RING finger protein
family, transiently colocalizes with PML in the PODs and then
apparently displaces PML, leading to complete loss of detectable PML
indirect immunofluorescence assay (IFA) signals in the cell (20,
52, 53). Adenovirus type 5 (Ad5) infection causes a morphological
change in the PODs from the spherical punctate structures to fibrous
"track" structures, and some POD proteins relocalize into viral
replication compartments (8, 15, 61). Furthermore, during
Ad5 infection, at least three early proteins (E1A, E1b 55-kDa protein,
and E4-ORF3 11-kDa protein) associate with the PML bodies, although the
viral E4-ORF3 11-kDa protein alone is sufficient to induce
reorganization of the PODs (8, 15). The nuclear antigen
EBNA-5 of EBV stably colocalizes with the PODs in both EBV-infected B
cells and cell lines (67), and large tumor antigen of simian
virus 40 (SV40) is distributed adjacent to the PODs in some transfected
cell types (8).
Several groups have shown that HCMV infection in permissive human
fibroblasts in culture also causes displacement of PML from the PODs
into a nuclear diffuse form (1, 37, 41). We also showed
previously that the PODs are targeted by both the isolated IE1 and IE2
proteins of HCMV (1). However, HCMV IE1 only transiently colocalizes with PML in the PODs, and subsequently both IE1 and PML
become distributed as nuclear diffuse forms. This contrasts with IE110
itself becoming punctate but with an accompanying complete loss of the
PML signal as in HSV-1 infection, or the reorganization of the
spherical PODs structures into fibrous track structures as seen in Ad5
infection, and suggests that each virus has developed different ways to
interact with and disrupt or reorganize the PODs. The fact that the
HCMV IE1 protein alone is sufficient for displacement and
redistribution of PML in transiently transfected cells, as well as in
cell lines stably expressing IE1 and in cells infected with a
recombinant defective Ad5 vector expressing IE1 (Ad5-IE1)
(1), led us to investigate the mechanism for targeting to
and disruption of the PODs by IE1.
In this study, we used double-label IFA, cotransfection experiments,
and yeast two-hybrid interaction assays to show that targeting to and
disruption of the PODs by HCMV may be mediated through direct
interaction of the IE1 protein with the N-terminal RING finger domain
of PML. We also demonstrate that removal of the intact
-helical
coiled-coil (dimerization) region of PML uncovers a cryptic activation
domain and that this unmasked transactivator property of PML requires
the N-terminal RING finger domain.
 |
MATERIALS AND METHODS |
Mammalian cell cultures and virus infection.
Permissive
human fibroblast (HF) cells and Vero cells were grown in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum. The
HCMV(Towne) virus stock used was prepared as described by LaFemina et
al. (44). Preparation of Ad5-IE1, referred to previously as
RAd31 (71), was described previously (1). For
infection, HF cells were seeded into four-well chamber slides (0.6 × 105/well), and the subconfluent cells were infected with
the HCMV or Ad5-IE1 at an MOI of <1.0 PFU per cell. Input supernatant
virus (25 µl) was adsorbed for 1.5 h at 37°C, and then the
inoculum was replaced with 500 µl of fresh warmed medium at time zero
(1). For the experiment using IE1 (exon 4)-deleted HCMV
(26), samples of the defective mutant virus CR208 and its
parent wild-type Towne virus were provided by Edward S. Mocarski
(Stanford University, Stanford, Calif.). HF cells were seeded into
four-well chamber slides and were infected with either CR208 or its
parent Towne virus at an MOI of either 0.1 or 10 PFU per cell.
Mammalian expression plasmids.
Genomic versions of the
HCMV(Towne) IE1 and IE2 coding regions were all derived from
Escherichia coli plasmid pRL103, which contains the 20.8-kb
HindIII C fragment encompassing the entire leftward-oriented MIE gene transcription unit (42). The
parent effector plasmid pRL45 contains a 6.6-kb
EcoRI-SalI subfragment expressing both IE1 and
IE2 under the control of their natural transcriptional and splicing
signals, whereas pMP17 and pMP18 express either IE1 or IE2 only in the
same background. Further derivatives in plasmids pMP10, pMP11, and
pRL55, expressing both mutant IE1 and wild-type IE2, and in plasmids
pRL60, pRL61, and pRL74, expressing mutant IE1 only, were described
previously (44, 60).
Plasmid pCMX-PML (35), expressing the intact human PML
protein (560 aa) was provided by Ronald M. Evans (The Salk Institute, San Diego, Calif.); plasmid pGH623-5, encoding a version of PML containing point mutations within the RING finger domain
(C88P89
S88R89), was
described previously (13). To generate plasmids expressing PML(1-447) (PML containing aa 1 to 447) in pJHA286, PML(1-267) in
pJHA287, PML(1-267,
C88P89
S88R89) in
pJHA288, PML(224-560) in pJHA289, PML(1-560,
281-304) in pJHA290,
and PML(1-560,
C88P89
S88R89
281-304) in pJHA291, the NcoI-BamHI fragment
containing the wild-type PML of pCMX-PML was replaced by the
NcoI-BamHI fragments containing mutant PML from
the yeast versions expressing GAL4-DB (GAL4 DNA-binding domain; aa 1 to
147)/PML fusion proteins in pJHA252, pJHA253, pJHA273, pJHA280, pEB1,
and pEB2 (see below), respectively.
To construct a set of mammalian expression plasmids for
GAL4-DB/PML fusion proteins,
XhoI-
BamHI
fragments containing truncated
GAL4-DB/PML fusions from the yeast
versions in pJHA238, pJHA247,
pJHA252, pJHA253, pJHA273, pJHA277,
and pJHA250 (see below) were
moved between the
XhoI-
BglII sites of a parent modified
pSV
2-GAL4-DB
vector (pGH250) to generate
pSV
2-GAL4-DB/PML(1-560) in pJHA258,
pSV
2-GAL4-DB/PML(1-560,
C
88P
89
S
88R
89)
in pJHA259, pSV
2-GAL4-DB/PML(1-447)
in pJHA260,
pSV
2-GAL4-DB/PML(1-267) in pJHA261,
pSV
2-GAL4-DB/PML(1-267,
C
88P
89
S
88R
89) in
pJHA275, pSV
2-GAL4-DB/PML(97-267) in pJHA278,
and
pSV
2-GAL4-DB/PML(447-560) in pJHA263, respectively.
Transient DNA transfection and CAT assays.
In transfection
experiments for IFA, Vero cells were seeded into two-well chamber
slides (0.4 × 105/well) and DNA was introduced into
the subconfluent cells for 48 h using the HEPES-buffered saline
version of the calcium phosphate procedure described previously
(58). In transfection experiments for chloramphenicol
acetyltransferase (CAT) assays, the target control adenovirus E1b
promoter (E1b-CAT) and the test reporter gene GAL45/E1b-CAT
with five tandomly repeated 17-bp GAL4 binding sites added upstream
were used (47). Vero cells were seeded into six-well plates
(2 × 105/well), and DNA transfection, harvesting at
48 h, and the CAT assay were carried out as described previously
(58). Percent conversion of
[14C]chloramphenicol to acetylated forms was measured
with an Instant Imager (Packard Instrument Company, Downer Grove,
Ill.).
Antibodies and IFA.
Mouse monoclonal antibodies (MAbs) 6E1
and 12E2 against the IE1 (exon 4) and IE2 (exon 5), respectively, were
obtained from Vancouver Biotech (Vancouver, B.C., Canada), and MAb
CH810, which detects epitopes present in both IE1 and IE2
(exons 2 and 3), was purchased from Chemicon (Temecula, Calif.). Rabbit
antipeptide polyclonal antibodies (PAbs) directed against amino acids
at positions 484 to 498 (PML-C) or at positions 1 to 17 (PML-N) of the
human PML oncoprotein were described elsewhere (1, 13).
For IFA, both virus-infected and DNA-transfected cells were fixed by
either the methanol or the paraformaldehyde procedure.
For the methanol
procedure (used for metaphase chromosome analysis),
the cells were
washed in Tris-buffered saline (TBS), then permeabilized
with absolute
methanol at 20° for 10 min, and rehydrated in ice-cold
TBS for 5 min.
For the more usual standard paraformaldehyde procedure,
the cells were
washed in phosphate-buffered saline (PBS), fixed
with 1%
paraformaldehyde solution in PBS at 20°C for 5 min, and
then
permeabilized in ice-cold 0.2% Triton X-100 solution in PBS
for 20 min. The cells were incubated with mouse MAbs at dilutions
of
1:200-fold for 6E1, 12E2, and CH810, 1:1,000-fold for the PML-C
antibody, and 1:500-fold for the PML-N antibody. The antibody
incubations were carried out in TBS at 30°C for 1 h, followed
by
incubation with fluorescein isothiocyanate (FITC)-labeled goat
anti-mouse immunoglobulin G (IgG) or by rhodamine-coupled goat
anti-rabbit IgG antibody at 1:100-fold dilution at 37°C for 45
min.
For double labeling, monoclonal and polyclonal antibodies
were
incubated together. Slides were screened and photographed
with a 40×
oil immersion objective on a Leitz Dialux 20EB epifluorescence
microscope using Kodak T-Max P3200 film. For confocal microscopy,
Noran
OZ CLSM confocal microscope system with intervision software
(Noran
Inc., Madison, Wis.) was used.
In vitro transcription and translation.
Plasmid pCMX-PML was
linearized downstream of the coding region by BamHI and in
vitro transcribed by using the T7 polymerase plus mRNA capping kit from
Stratagene. In vitro translation was carried out with rabbit
reticulocyte lysates as specified by the manufacturer (Promega) and as
described elsewhere (12).
Western blot assay.
Vero cells were transfected for 48 h with 3 µg of pCMX-PML plasmid DNA per well in a six-well plate. HF
cells were infected with HCMV(Towne) at an MOI of 1.0 for 6 h in a
100-mm-diameter dish. Untransfected or transfected Vero cells and
mock-infected or HCMV-infected HF cells were washed twice with
cold PBS and lysed in ice-cold lysis buffer (50 mM Tris-HCl [pH 8.0],
150 mM NaCl, 1.0% Nonidet P-40, 0.5% sodium deoxycholate, 0.1%
sodium dodecyl sulfate [SDS]). Cell extracts were subjected to
SDS-polyacrylamide gel electrophoresis through a 10% acrylamide gel
followed by electroblotting onto nitrocellulose. The blots were blocked
by incubation for 1 h at 20°C in 1× PBS containing 0.1% Tween
20 and 5% nonfat dry milk. The blots were then washed three more times
for 10 min and incubated for 1.5 h at 20°C with either
1:1,000-diluted mouse MAb 5E10 against PML (provided by K. van der
Krann; 66a), rabbit PAb PML-C diluted 1:2,000, or
mouse MAb 6E1 directed against IE1 diluted 1:3,000. After three 10-min
washes with PBS-Tween 20, the blots were incubated with horseradish
peroxidase-conjugated goat anti-mouse or anti-rabbit IgG (Bio-Rad) for
1 h at 20°C. The blots were washed three times, and reacting
protein bands were detected with an enhanced chemiluminescence system
(Amersham RP2106) using Kodak XAR film.
Construction of plasmids for yeast analyses. (i) GAL4-DB
fusions.
All GAL4-DB fusions for expression in yeast were
generated in pAS1-CYH2 (2, 18). Plasmid pCJC442 expressing
the GAL4-DB/IE1(1-491) fusion protein was generated by placing the
BamHI fragment containing the entire IE1 cDNA from pCJC180
into pAS1-CYH2. Plasmid pJHA238 expressing the GAL4-DB/PML(1-560)
fusion protein was constructed by subcloning of the
NcoI-BamHI fragment containing the entire PML
cDNA from pCMX-PML into pAS1-CYH2. Plasmids pYW18 containing the
GAL4-DB/EBNA-1(1-641,
102-325) fusion protein (69)
and pCJC420 containing GAL4-DB/IE2(290-579) (2) were
described elsewhere. Control plasmids pRb2 expressing
GAL4-DB/Rb(301-928), pSE1112 expressing GAL4-DB/SNF1, and pSE1111
containing GAL4-A/SNF4 (18) were provided by Stephen J. Elledge.
To generate plasmids expressing the GAL4-DB/mutant PML fusions, an
NcoI-
SmaI fragment (codons 1 to 447 in pJHA252),
an
NcoI-
PvuII
fragment (codons 1 to 267 in
pJHA253), an
NcoI-
AvrII fragment
(codons 1 to 96 in pJHA254), and an
AvrII-
PvuII fragment (codons
97 to 267 in pJHA277) from the parent plasmid pJHA238 were placed
in
frame behind the GAL4-DB of pAS1-CYH2. Plasmid pJHA250 expressing
GAL4-DB/PML(448-560) was generated by an in-frame deletion between
the
NcoI and
SmaI sites from pJHA238. To generate
plasmid pJHA280
expressing GAL4-DB/PML(224-560), the
NcoI-
BamHI fragment containing
PML codons 224 to
560 was PCR amplified (5' primer [LGH3013],
TAGGATCCATGGAGCTCAAGTGC GACATC; 3' primer [LGH1737],
CACGATGCACAGTTGAAG)
from pJHA238 and placed into the
NcoI and
BamHI sites of pAS1-CYH2.
In addition,
plasmid pJHA247 expressing GAL4-DB/PML(1-560,
C
88P
89
S
88R
89)
was
constructed by placing the
NcoI-
BamHI fragment
from pGH623-5
(
13) into pAS1-CYH2. Subsequently, plasmids
pJHA273 expressing
GAL4-DB/PML(1-267,
C
88P
89
S
88R
89) and
pJHA274 expressing GAL4-DB/PML(1-96,
C
88P
89
S
88R
89) were
generated from plasmid pJHA247 by replacing
a restriction fragment
containing the point mutations into pAS1-CYH2.
To generate plasmids
pEB1 expressing GAL4-DB/PML(1-560,

281-304)
and pEB2 expressing
GAL4-DB/PML(1-560,
C
88P
89
S
88R
89

281-304),
the
NcoI-
KpnI fragment containing
PML(1-304) from pJHA238 was
replaced by the
NcoI-
KpnI fragments containing PML(1-280) PCR
amplified from pJHA238 or containing PML(1-280,
C
88P
89
S
88R
89)
PCR
amplified from pJHA247 (5' primer [LGH 3026], GAAGATCTTCC
ATGGAGCCTGCAC; 3' primer [LGH 3027],
GGGGTACCCGCGGATCAGCTCCT).
Plasmid pJHA294 expressing
GAL4-DB/PML(96-560,

281-304) was generated
by deleting an
NcoI-
AvrII fragment from pEB1. Plasmids pLZ59
expressing
GAL4-DB/110(104-240) and pLZ60 expressing
GAL4-DB/110(104-240,
C
152P
153
S
152R
153)
were described elsewhere (
72).
(ii) GAL4-A fusions.
All GAL4-A (GAL4 activation domain; aa
768 to 881) fusions were generated in pACTII (2, 18).
Plasmids pJHA140 expressing GAL4-A/IE2(1-579) and pJHA239 expressing
GAL4-A/IE1(1-491) were generated by placing the BglII
fragment containing the entire IE2 cDNA from pJHA122 (2) and
the BamHI fragment containing the entire IE1 cDNA from
pCJC442, respectively, into pACTII.
To generate plasmids expressing the GAL4-A/mutant IE1 fusion proteins,
an
NcoI fragment (codons 1 to 231 in pJHA255), an
NcoI-
BamHI
fragment (codons 232 to 491 in
pJHA249), an
NcoI-
BamHI fragment
containing a
deletion between two
EcoRV sites (codons 1 to 491

132 to 274 in pJHA251), and an
EcoRV fragment (codons 132 to
274 in pJHA257) from the parent plasmid pJHA239 were placed in
frame
behind the GAL4-A of pACTII. Plasmid pJHA300 encoding
GAL4-A/IE1(1-346)
was constructed by deleting a
BglII
fragment (codons 347 to 491)
from the parent plasmid pJHA239.
For plasmids expressing GAL4-A/PML fusions, the
NcoI-
SalI fragments containing PML fragments from
yeast version expressing
GAL4-DB/PML fusions were moved into the
NcoI-
XhoI sites of pACTII
to generate plasmids
expressing GAL4-A/PML(1-560) in pJHA266,
GAL4-A/PML(1-560,
C
88P
89
S
88R
89) in
pJHA267, GAL4-A/PML(1-447)
in pJHA268, GAL4-A/PML(1-267)
in pJHA269, GAL4-A/PML(1-96) in
pJHA270,
GAL4-A/PML(224-560) in pJHA281, GAL4-A/PML(447-560) in
pJHA271,
GAL4-A/PML(1-560,

281-304) in pEB5, and GAL4-A/PML(1-560,
C
88P
89
S
88R
89

281-304) in pEB6.
Yeast two-hybrid interaction assays.
Saccharomyces
cerevisiae Y190 (MATa gal4
gal80
his3-
200 trp1-901 ade2-101 ura3-52 leu2-3,-112
URA3::GAL1-lacZ
LYS2::GAL-HIS3 cyhR), a
derivative of Y153 (18), was used in a two-hybrid system. Complete and synthetic media for yeast growth and the yeast
transformation method were described elsewhere (62). Both a
plasmid encoding the GAL4-DB fusion (Trp+) and a plasmid encoding the
GAL4-A fusion (Leu+) were introduced into Y190 cells. The double
transformants were selected in the plates lacking both Trp and Leu, and
the production of
-galactosidase was assayed by both a
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
filter assay and a quantitative assay using
o-nitrophenyl-
-D-galactopyranoside (ONPG) as
described previously (2). For rapid in situ assays of
lacZ expression from yeast colonies, an X-Gal filter assay was used and between 6 and 10 independent colonies of each type were
screened simultaneously. The nitrocellulose filters were laid onto the
plate and allowed to wet completely, then lifted off of the plate
carefully to avoid smearing the colonies, and placed into liquid
nitrogen to permeabilize the cells. After 10 s, the filters were
removed from the liquid nitrogen and placed cell side up in a petri
dish containing 3MM paper soaked with Z buffer (60 mM
Na2HPO4, 40 mM
Na2H2PO4 · 2H2O,
10 mM KCl, 1 mM MgSO4 · 7H2O, 50 mM
-mercaptoethanol) plus 1 mg of X-Gal per ml. The filters were then
incubated at 30°C for appropriate times for development of a positive
blue color. For quantitation of the
-galactosidase activity in
yeast, 2-ml cultures were grown in the appropriate synthetic medium to
an optical density at 600 nm of 2.0, then 0.4 ml of the culture was
harvested, and the
-galactosidase activity within the cells was
assayed by the standard method using ONPG after permeabilizing the
cells with chloroform and SDS (27a). The unit of
-galactosidase was defined as 1,000(A420
1.75A550)/(A600 × t × v) (t, reaction time [minutes]; v,
reaction volume [milliliters]).
 |
RESULTS |
An IE1-defective mutant virus does not disrupt PODs.
In
permissive HF cells infected with wild-type HCMV(Towne), IE1
transiently targets to PODs and subsequently displaces the cellular PML
protein from the PODs, with both proteins redistributing into a nuclear
diffuse form (1). The IE1 protein alone is sufficient for
this process in Vero cells transiently transfected with a plasmid
expressing IE1, as well as in permissive U373 cell lines constitutively
expressing IE1 and in HF cells infected with Ad5-IE1 (1).
The specific requirement for IE1 in this process in HCMV-infected cells
was further investigated by using a recently described IE1-defective mutant (26). The CR208 virus contains a deletion of the exon 4 segment of IE1 within the HCMV(Towne) background and fails to give
efficient lytic cycle infection at low MOI, although it is able to grow
relatively normally in cell culture at high MOI (26). HF
cells were infected with either the parent wild-type Towne or CR208
virus for 6 h at both low and high MOI (i.e., 0.1 or 10 PFU/cell).
The staining patterns of both IE2 and PML in infected cells were
analyzed by double-label IFA with both mouse MAb 12E2 against IE2 and
rabbit PAb PML-C. Cells infected with the Towne virus parent showed the
typical mixture of diffuse plus punctate IE2 staining (1),
together with the uniform dispersed nuclear pattern for PML at both
low- and high-MOI infection (Fig. 1,
upper two panels). However, in cells infected with the CR208 virus, an
unaltered nuclear punctate staining pattern of PML was observed in all
infected cells under both low- and high-MOI conditions and the IE2
punctate patterns were unaffected (Fig. 1, lower two panels). This
result clearly demonstrates that displacement of PML from the PODs in
HCMV-infected cells depends on expression of IE1 and that even at high
MOI, the IE1-defective mutant virus does not affect the distribution
pattern of PML.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
Cells infected with an HCMV mutant that does not express
IE1 fail to disperse the PML protein from punctate domains (PODs) into
a nuclear diffuse pattern. The photographs show a comparison of PML
staining patterns in HF cells infected with either HCMV(Towne) (upper
two panels) or the CR208( IE1) virus (lower two panels) at a low
MOI of 0.1 and a high MOI of 10. At 6 h after infection, the cells
were fixed with paraformaldehyde followed by double-label IFA. IE2 was
detected with mouse MAb 12E2 and FITC-labeled anti-mouse IgG (left).
PML was detected in the same fields with rabbit anti-PML PML-C PAb and
rhodamine-coupled anti-rabbit IgG (right). Note the typical punctate
POD patterns of PML in adjacent uninfected cells at low MOI.
|
|
PML protein levels in HF cells are not affected by HCMV
infection.
Because several variant PML proteins are expressed by
C-terminal alternative splicing (25), we investigated
whether either the total PML protein levels or the ratio of
the different forms of PML were changed in HCMV-infected HF cells
after being displaced from the PODs. To confirm the validity of our
assay for PML, the protein produced by human cDNA plasmid pCMX-PML in
total-cell extracts from DNA-transfected Vero cells was subjected to
Western blot analysis using MAb 5E10 as a probe (66a). This
antibody is expected to detect only the predominant nuclear isoforms of endogenous PML as well as the protein produced from pCMX-PML. The
result revealed that indeed a novel PML protein with a molecular mass
of 68 kDa was enriched in pCMX-PML-transfected cells (Fig. 2B, lane 2) compared to those in
untransfected cells (Fig. 2B, lane 1). As a control, the
35S-labeled PML protein that was produced from pCMX-PML by
in vitro transcription and translation also proved to migrate at 68 kDa (Fig. 2A). When total extracts prepared from mock-infected HF cells or
cells infected with HCMV for 6 h were used, very similar levels of
a predominant 68-kDa form of the protein were also detected from both
extracts with MAb 5E10 (Fig. 2B, lanes 3 and 4). Furthermore, Western
blot analysis with PAb PML-C directed against the C terminus of PML
showed that the entire complex patterns of multiple isoforms of the PML
protein detectable with this antibody were very similar in
mock-infected (Fig. 2C, lane 1) and HCMV-infected (lane 2) HF cells,
whereas with MAb 6E1 against IE1, the IE1 (72-kDa) protein was detected
only in extracts from the HCMV-infected HF cells (lane 4). Overall,
these results suggest that the total levels of PML protein in
HCMV-infected cells remain unaffected after displacement from the PODs
compared to those in uninfected cells, and that there are also no
obvious modifications in the sizes or ratios of the different isoforms
of PML present.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the PML protein levels between
mock-infected, transfected, and HCMV-infected cells. (A)
Detection of the in vitro-translated pCMX-PML cDNA protein
product (560 aa). [35S]Met-labeled PML proteins were
synthesized in reticulocyte extracts from template RNA transcribed in
vitro with T7 polymerase from BamHI-linearized plasmid
pCMX-PML and analyzed on SDS-10% polyacrylamide gels. (B) Detection
of nuclear forms of the PML protein by mouse MAb 5E10, using extracts
prepared from pCMX-PML-transfected Vero cells and HCMV-infected HF
cells. Total extracts (35 µg of protein) prepared from untransfected
(lane 1) or pCMX-PML-transfected Vero cells (lane 2) and from
mock-infected (lane 3) or HCMV-infected HF cells (lane 4) were
electrophoretically fractionated on SDS-10% polyacrylamide gels, and
Western blot analysis was performed by incubating the membrane with MAb
5E10 directed against PML. (C) Comparison of the levels of all forms of
the PML protein detectable in mock-infected and HCMV-infected HF cells.
Gel fractionated extracts from mock-infected (30 µg for lane 2 and 8 µg for lane 3) and HCMV-infected HF cells (30 µg for lane 2 and 8 µg for lane 4) were subjected to Western blot analysis using either
rabbit PAb PML-C directed against the C terminus of PML (lanes 1 and 2)
or mouse MAb 6E1 against IE1 (lanes 3 and 4).
|
|
Evaluation of the IE1 protein domains required for PML displacement
and the nuclear diffuse distribution pattern.
To determine whether
specific regions of the IE1 protein are required for PML displacement,
the PML staining patterns of Vero cells transfected with plasmids
encoding mutant IE1 proteins were investigated by double-label IFA. A
schematic representation describing the proteins encoded by each
plasmid and a summary of the localization patterns of IE1 and IE2 in
transfected Vero cells are presented in Fig.
3. In the initial experiments, we first
mapped the epitope for mouse MAb 6E1 to a region from codons 131 to
274 in IE1 exon 4 and that for MAb 12E2 to a region from codons 99 to
136 in IE2 exon 5 (data not shown) (Fig. 3, bottom). The epitope
for MAb CH810 has been previously mapped to within the exon 2 and 3 region common to both IE1 and IE2 (44).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Summary of the localization patterns of IE1, IE2, and
PML in Vero cells transiently transfected with genomic plasmids
expressing deleted versions of IE1. At the top is an illustration of
the overlapping five exon structure (solid bar) of the MIE gene
transcription unit in the inverted (i.e., viral) genomic orientation.
The positions of key restriction sites used to generate the deleted or
truncated versions of IE1 are indicated above the diagram. Bg,
BglII; EV, EcoRV; Sp, SpeI. The
enhancer/promoter region of the MIE locus (ENH; hatched bar) and the
translation start (ATG) and termination (TAA) sites as well as
polyadenylation sites (pA) are also indicated. Below is a comparison of
the structures of the proteins encoded by the variant MIE expression
gene plasmids used. Open bars represent coding regions, with gaps
denoting in-frame deletions; diamonds indicate inserted
triple-terminator oligonucleotides. The estimated map locations for the
epitopes recognized by MAbs 6E1, 12E2, and CH810 are shown at the
bottom (hatched bars). To detect IE1, IE2, and PML, FITC-labeled MAb
6E1 (for IE1), 12E2 (for IE2), and CH810 (for both IE1 and IE2) were
used in double-label IFA experiments together with rhodamine-coupled
rabbit PAb against PML. IFA patterns; ND, nuclear diffuse; P, punctate;
ND/P, mixture of nuclear diffuse and punctate; G, nuclear granular
structures.
|
|
We have previously shown (
1,
44) that a mutant IE1 protein
truncated in the C-terminal region at codon 347 (encoded by
plasmid
pRL74) gave mostly large spherical globular or ring structures
within
the nucleus, rather than the normal nuclear diffuse distribution
pattern seen with the transfected parent wild-type IE1 protein
(pMP17).
This aberrant distribution pattern of the C-terminally
truncated mutant
IE1 protein was observed even in the presence
of IE2 (both are encoded
by plasmid pRL55 [Fig.
4c]) and with
another similar IE1 deletion protein truncated at codon 274 (pMP11
[not shown]). In contrast, two mutant IE1 proteins containing
internal in-frame deletions between codons 132 and 274 (pRL60
[Fig.
4g]) or between codons 291 and 320 (pRL61 [Fig.
4i]) displayed
a
typical nuclear diffuse pattern. Since the 48-h transient expression
assay does not detect the intermediate stage of transient targeting
to
PODs seen at the earliest times in infection, the latter result
does
not address whether these two deleted forms of IE1 have lost
or retain
the ability to target to the PODs.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of wild-type or mutant IE1 expression on
distribution of the endogenous PML proteins in transient expression
assays. Vero cells were transfected with plasmids encoding various
mutant IE1 proteins and fixed with paraformaldehyde followed by
double-label IFA at 48 h after transfection. (a and b) Paired
photographs of cells receiving plasmid pMP17 encoding wild-type
IE1(1-491); (c and d) pRL55 encoding both IE1(1-346) and wild-type IE2;
(e and f) pRL74 encoding IE1(1-346); (g and h) pRL60 encoding
IE1( 132-274); (i and j) pRL61 encoding IE1( 291-320). (a, c, e, g,
and i) Detection of IE1 with mouse MAb 6E1 (a, c, e, and i) or MAb
CH810 (g) and FITC-labeled anti-mouse IgG. (b, d, f, h, and j)
Detection of PML in the same fields with rabbit anti-PML-C PAb and
rhodamine-coupled anti-rabbit IgG.
|
|
The patterns of displacement of PML from the PODs by mutant IE1
proteins was also examined by double-label IFA approaches
using
rhodamine-coupled rabbit anti-PML (PML-C) and FITC-labeled
mouse
anti-IE1 (6E1) antibodies. The results for nuclear diffuse
or punctate
PML signals are summarized in Fig.
3. As a positive
control, the
transfected wild-type IE1 protein completely displaced
endogenous PML
from the PODs into a nuclear diffuse form in all
cells expressing IE1
in the presence or absence of IE2 (Fig.
4a
and b). However, truncated
IE1 proteins that lack the C-terminal
regions between 346 to 491 (pRL55
and pRL74) (Fig.
4c to f) as
well as between 131 to 491 (pMP10) and 274 to 491 (pMP11) (not
shown) all failed to displace PML from the punctate
bodies. Similarly,
the internally deleted IE1 proteins that lacked only
the regions
from codons 132 to 274 (pRL60) or codons 290 to 320 (pRL61)
also
failed to displace PML from the punctate bodies, although in this
case the two mutant IE1 proteins themselves showed a typical nuclear
diffuse pattern (Fig.
4g to j). Importantly, the large aberrant
IE1
globules seen with IE1(1-346) still touched or encompassed
all of the
much smaller endogenous PML punctate domains.
We conclude that parts of at least three segments of IE1 exon 4 including codons 132 to 274, 291 to 320, and beyond 346 are
all
required for normal PML displacement, whereas the region between
codons
1 to 346 encompasses all domains necessary for targeting
to the PODs.
Since the internally deleted IE1(

132-274) and IE1(

291-320)
versions neither form stable punctate structures nor displace
PML, they
appear likely to have lost the ability to target to
the PODs. Unlike
the RING finger mutants of HSV IE110, none of
the HCMV IE1 mutants
tested resulted in direct stable colocalization
with PML in the PODs,
although those lacking the C-terminal acidic
domain did produce a
stable interaction in larger aberrant structures
that either surround
or lie adjacent to endogenous PODs. Therefore,
the latter mutant
appears to uncouple the requirements for targeting
to POD-related
structures from actual displacement of PML.
Evaluation of the PML protein domains required for POD
localization.
To study the mechanism of PML displacement to a
nuclear diffuse form by HCMV IE1, we also needed to examine the domain
requirements within PML for POD localization. PML contains an
N-terminal RING finger domain, two adjacent Cys/His-rich B-box regions,
a coiled-coil probable dimerization region, and a C-terminal Ser-rich
domain with a possible nuclear localization signal (NLS) (see Fig. 6). Therefore, we obtained a mammalian cDNA expression plasmid encoding the
intact human PML protein (in pCMX-PML) under the control of the HCMV
MIE enhancer/promoter region (35) and generated several variants expressing mutant deleted or truncated PML proteins. Initially, we investigated the localization patterns of overexpressed PML proteins by IFA in transiently transfected Vero cells by using two
antipeptide PAbs directed against the N (PML-N) and C (PML-C) termini
of PML, although preliminary tests showed that unlike the PML-C
antibody, the PML-N antibody did not detect the endogenous PML signals
in Vero cells (data not shown). The exogenous wild-type PML protein
alone formed five to six large globular bodies, which appeared to have
coalesced with or incorporated all of the normal smaller endogenous PML
containing PODs (Fig. 5a).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
Localization patterns of wild-type and mutant PML in
transfected Vero cells. Vero cells were transfected with plasmids
expressing the wild-type (wt) PML(1-560) protein (pCMX-PML) (a),
PML(1-560,
C88P89 S88R89)
(pGH623-5) (b), PML(1-447) (pJHA286) (c), PML(1-267)
(pJHA287) (d), PML(1-267,
C88P89 S88R89)
(pJHA288) (e), PML(224-560) (pJHA289) (f), PML(1-560,
282-304) (pJHA290) (g), and PML(1-560,
C88P89 S88R89
282-304) (pJHA291) (h). The cells were fixed with paraformaldehyde
at 48 h after transfection followed by IFA with anti-PML-C PAb (a,
b, g, and h) or anti-PML-N PAb (c, d, e, and f) and rhodamine-coupled
anti-rabbit IgG. Phase-contrast images confirming the nuclear plus
cytoplasmic locations of PML(1-447) are available upon request.
|
|
Unlike the transfected wild-type PML protein, four of the five mutant
PML proteins tested all gave nuclear diffuse distribution
patterns of
PML detectable by the PML-C antibody. These four mutants
contained either point mutations
(C
88P
89
S
88R
89)
within the RING
finger domain (Fig.
5b), a deletion of 25 aa
(

281-304) within
the coiled-coil region (Fig.
5g), both of the
above-mentioned
mutations
(C
88P
89
S
88R
89

281-304) (Fig.
5h), or an N-terminal
truncation (

1-223) (Fig.
5f). Furthermore, none of these four
mutant PML proteins interfered
with endogenous PML, since normal-sized
PODs were still detected within
the nuclear diffuse background
in those cells expressing mutant PML
proteins. However, a C-terminal
truncated PML(1-447) protein that
lacked the proposed NLS formed
large aggregated bodies that were
detectable with the PML-N antibody
and were predominantly cytoplasmic
(Fig.
5c). Two smaller PML
proteins, which were truncated at codon 267 with or without the
RING finger mutation and lacked both the
coiled-coil region and
the NLS (Fig.
5d and e), were both distributed
as diffuse forms
throughout the cell as detected with the
PML-N antibody. Therefore,
these IFA results showed that the N-terminal
RING finger domain
and the intact coiled-coil region of PML are both
required for
punctate body formation (presumably through
dimerization or oligomerization
and other protein-protein
interactions) and that the putative
NLS or some other C-terminal
feature is also needed for efficient
nuclear POD localization.
Evaluation of the PML protein domains required for
self-interaction.
Because both the RING finger motif and the
coiled-coil motif of PML are believed to be involved in protein-protein
interactions including self-interaction, we investigated the ability of
the mutant PML proteins that were used for IFA experiments to
self-interact in a yeast two-hybrid genetic assay. Various plasmids
encoding GAL4-A/PML fusion proteins were introduced into yeast Y190
cells together with a plasmid encoding GAL4-DB/PML(1-560), and the
ability to self-interact was tested in both an initial X-Gal
filter color assay and a quantitative ONPG assay. In control
experiments, yeast cells that received only a single plasmid encoding
each of the GAL4-DB/PML fusion proteins alone or each of the
GAL4-A/PML fusion proteins alone did not activate the target
UASGal/GAL1-lacZ reporter gene (data not shown),
whereas cells that received both wild-type plasmids expressing
GAL4-DB/PML(1-560) and GAL4-A/PML(1-560) produced very
strong
-galactosidase activity (Fig.
6, line 1). Three deleted PML fusion
proteins, GAL4-A/PML(1-267), GAL4-A/PML(1-96), and GAL4-A/PML(447-560), that each lacked the entire
coiled-coil region did not gave any significant interaction
(less than 1% of the wild-type level) with the intact
GAL4-DB/PML(1-560) fusion protein (lines 4, 5, and 7),
suggesting that the coiled-coil region is probably essential
for self-interactions. However, three mutant PML fusion proteins, one
containing only a
C88P89
S88R89 change within the RING finger domain (line 2), another representing the C
terminus and coiled-coil region only (codons 224 to 560) (line 6), and
a third containing a 25-amino-acid deletion within the coiled-coil
region (
281-304) (line 8), retained only 7.4, 5, and 14.6%,
respectively, of wild-type interaction activity with the
GAL4-DB/PML(1-560) fusion protein. Furthermore, a double-mutant PML
fusion protein containing both the
C88P89
S88R89 change
and the coiled-coil domain deletion (
281-304) completely abolished the ability to interact with the wild-type protein (line 9). These results demonstrate that both the N-terminal RING finger domain and the
coiled-coil region of PML are required to be intact for efficient
self-interaction.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of mutant PML proteins on self-interaction
measured with a yeast two-hybrid assay. (Left) Diagram illustrating the
structure of the GAL4-A/PML fusion proteins used. The two major
translocation fusion points occurring within the PML protein (at
positions 552 and 955) in PML/RAR fusions in APL are indicated by
arrows. The proposed NLS (at positions 467 to 490) is indicated
(36). The location of the paired RING finger point mutations
(C88P89 S88R89) is
indicated by a star. The amino acid positions of the restriction enzyme
cleavage sites used to generate the GAL4-A/mutant PML fusion are
indicated. Dotted bars, N-terminal Pro-rich domain and C-terminal
Ser-rich domain; black bars, RING finger domain (left) and two adjacent
Cys/His-rich domains (right); hatched bars, putative -helical
region. Av, AvrII; Pv, PvuII; Sm,
SmaI. (Right) Qualitative and quantitative results of the
yeast self-interaction assay. No detectable -galactosidase activity
was measured in Y190 cells transformed with the plasmid encoding the
GAL4-DB/PML(1-560) fusion protein alone. Plasmids encoding a
variety of GAL4-A/PML fusion proteins were then introduced together
with GAL4-DB/PML(1-560) into Y190 cells. Transformants were
selected on plates lacking Trp and Leu, and -galactosidase activity
of the transformants was measured as described in Materials and
Methods. Lines: 1, GAL4-A/PML(1-560) in pJHA266; 2, GAL4-A/PML(1-560,
C88P89 S88R89)
(pJHA267); 3, GAL4-A/PML(1-447) (pJHA268); 4, GAL4-A/PML(1-267)
(pJHA269); 5, GAL4-A/PML(1-96) (pJHA270); 6, GAL4-A/PML(224-560) (pJHA281); 7, GAL4-A/PML(447-560)
(pJHA271); 8, GAL4-A/PML(1-560, 281-304) (pEB5); 9, GAL4-A/PML(1-560,
C88P89 S88R89
281-304) (pEB6). aMean values for -galactosidase
units for interaction between GAL4-DB/PML(1-560) and
GAL4-A/PML(1-560) in duplicated assays are indicated as 100%. The
relative activity of control SNF1/SNF4 interaction in the same assay
was 148%. bSelf-interaction with the
GAL4-DB/PML(96-560, 281-304) fusion protein encoded by plasmid
pJHA294.
|
|
Interestingly, when we characterized the coiled-coil deletion
PML(

281-304) protein in a homodimerization assay with itself,
the GAL4-A/PML(1-560,

281-304) fusion protein was still able
to
interact (at 12% efficiency) with the GAL4-DB/PML(96-560,

281-304)
fusion protein (line 8), suggesting that the small
coiled-coil
region deletion between codons 281 and 304 does not abolish
all
self-interaction functions of the protein. Nevertheless, this
mutant PML(

281-304) protein does not appear to retain the
ability
to assemble normal protein-protein complexes because of its
failure
to be incorporated into PODs (Fig.
5g). Taken together with the
IFA results, the lack of efficient self-interaction (or
oligomerization)
by several distinct mutant PML proteins appears to
correlate with
the failure of POD localization (seen in Fig.
5).
Furthermore,
the C-terminal truncated PML fusion protein
GAL4-A/PML(1-447),
although it retained both an intact N-terminal
RING finger domain
and the coiled-coil region, also showed only 2.7%
self-interaction
activity (Fig.
6, line 3). Perhaps the property of
strong self-interaction
(and aggregation) in the cytoplasm observed
with the nonfusion
version (Fig.
5c) also prevents this version of the
GAL4-fusion
PML protein from undergoing efficient nuclear transport in
yeast.
Coexpression of IE1 and PML also leads to an altered diffuse
distribution of exogenous PML.
We have shown above that expression
of wild-type IE1 alone causes displacement of endogenous PML from the
PODs and leads to the subsequence redistribution of PML together with
IE1 in a nuclear diffuse form. This process occurs in DNA-transfected
HF or Vero cells, in U373 astrocytoma or Vero cell lines constitutively
expressing IE1, and in HF cells infected with recombinant adenovirus
(Ad5-IE1) (1). Furthermore, the two events correlate to such
a high degree that in our previous studies of HCMV-infected HF cells at
different times between 2 and 12 h after infection, all 110 cells
scored that displayed punctate IE1 also had fully colocalized punctate PML, whereas all 390 cells scored that displayed diffuse IE1 also had
fully diffuse PML patterns. This was the case irrespective of whether
rabbit PAb PML-C or mouse MAb 5E10 was used to detect PML and whether
rabbit anti-IE1 PAb or mouse MAb CH810 or 6E1 was used to detect IE1.
To examine this phenomenon further, we cotransfected Vero cells with
the two plasmids encoding intact PML and wild-type IE1 together.
Nevertheless, despite the large globular pattern of overexpressed PML,
the results again showed that the presence of IE1 changed the PML
distribution to a uniform nuclear diffuse pattern in all coexpressing
cells (Fig. 7a and b).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of wild-type or mutant IE1 expression on
distribution of the PML proteins in cotransfection assays. Vero cells
were cotransfected with the following plasmid pairs: (a and b) pMP18
encoding wild-type IE1(1-491) and pCMX-PML encoding intact
PML(1-560); (c and d) pJHA300 encoding IE1(1-346) and pCMX-PML; (e
and f) pJHA300 and pJHA261 encoding mutant PML(1-267); (g and h)
pJHA300 and pJHA275 encoding mutant PML(1-267,
C88P89 S88R89). At
48 h after transfection, cells were fixed with paraformaldehyde
followed by double-label IFA. (a, c, e, and g) Detection of IE1 with
mouse MAb 6E1 and FITC-labeled anti-mouse IgG. (b, d, f, and h)
Detection of PML in the same fields with rabbit anti-PML PML-C (b and
d) or PML-N (f and h) PAb and rhodamine-coupled anti-rabbit IgG.
Phase-contrast images confirming the nuclear plus cytoplasmic locations
of PML(1-560) in the presence of IE1(1-346) are available upon
request.
|
|
The targeting of the mutant protein IE1(1-346) to POD-related
structures without displacement of PML seen in Fig.
4 was also
further
investigated in cotransfection assays. The IFA result
in cells
expressing both mutant IE1(1-346) and intact PML showed
that IE1(1-346)
colocalized with overexpressed PML in large nuclear
POD-like
structures, although PML signals were also detected as
cytoplasmic
bodies (Fig.
7c and d). This result reinforces our
observation that the
mutant IE1 protein lacking the C-terminal
acidic region still targets
to PODs but fails to displace PML
from the PODs.
We showed above that the N-terminal segment of PML(1-267) was
distributed as a diffuse form throughout both the nucleus and
cytoplasm
(Fig.
5d). However, when we investigated the effect
of IE1(1-346) on
the distribution pattern of PML(1-267), a strong
association of
PML(1-267) with IE1(1-346) was found in the nucleus
in
cotransfected cells (Fig.
7e and f). In contrast, when cells
were
cotransfected with both IE1(1-346) and PML(1-267,
C
88P
89
S
88R
89),
only
a very weak association of both proteins was detected (Fig.
7g and h).
These results again suggest that IE1 might interact
directly with PML,
that the intact RING finger domain of PML is
required for this
interaction, and that the Glu-rich acidic terminus
of IE1 is necessary
or responsible for displacement from the PODs.
PML associates together with IE1 in metaphase chromosomes in some
infected HF cells.
The PML staining pattern alters with cell cycle
progression in uninfected cells, displaying the typical nuclear body
staining in G1 phase but changing to multiple smaller dots
in late S phase and almost disappearing briefly in M phase (16,
40). We have previously shown that IE1 associates with metaphase
chromosomes after a methanol permeabilization procedure in those 1 to
2% of transiently DNA-transfected cells, or of constitutively
IE1-expressing cells in stable cell lines, that are undergoing mitosis
(44). This is also the case in the occasional mitotic cells
found during HCMV infection in both permissive and nonpermissive cell
types. Because of the precise correlation between displacement of PML from the PODs into a nuclear diffuse form and the apparently
simultaneous change in IE1 distribution from PODs to a nuclear diffuse
pattern in individual HCMV-infected cells (1), we also
investigated whether the distribution pattern of the two proteins again
correlated in those cells showing an association of IE1 with metaphase
chromosomes. When HF cells were infected with HCMV(Towne) at an MOI of
0.5 and stained at 72 h after infection, nearly 4% of the
infected cells showed a metaphase chromosome-associated IFA pattern of IE1 after methanol treatment, whereas the nonmitotic cells gave the
typical uniform nuclear diffuse pattern (Fig.
8A, green fluorescence). Double-label IFA
of these cells showed that PML also associated with (or
precipitated onto) metaphase chromosomes together with IE1 in all
of these same cells, whereas infected cells with a nuclear diffuse IE1
staining pattern always gave a nuclear diffuse PML staining pattern
(Fig. 8A). Similar results were obtained for HF cells infected with
Ad5-IE1 that were undergoing mitosis (Fig. 8B). Importantly, PML
was never seen to be associated with metaphase chromosomes after
methanol treatment in mitotic cells from uninfected cultures or in
those infected with Ad5 expressing
-galactosidase. These results
strongly imply that PML may be physically associated with IE1 after
displacement from the PODs during HCMV infection.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 8.
Confocal microscopy images demonstrating colocalization
between PML and IE1 in metaphase chromosomes in HCMV- or
Ad5-IE1-infected cells undergoing mitosis. HF cells were infected with
either HCMV(Towne) (A) or Ad5-IE1 (B) at an MOI of 0.5. At 72 h
after infection, the cells were permeabilized in absolute methanol at
20°C followed by double-label IFA. Left-hand panels (green
fluorescence), detection of IE1 with mouse MAb 6E1 and FITC-labeled
anti-mouse IgG; center panels (red fluorescence), detection of PML in
the same fields with rabbit anti-PML-C PAb and rhodamine-coupled
anti-rabbit IgG; Right-hand panels (yellow merge fluorescence),
confocal images from each fluorochrome were recorded and superimposed
to demonstrate colocalization. Two representative cells are shown
in the upper and lower sections of panel B.
|
|
Specific interactions between IE1 with PML in two-hybrid assays in
yeast.
The observation that the distribution of PML in infected
cells precisely correlated with that of IE1, when the latter was either
transiently associated with PODs or present as nuclear diffuse
forms in most cells after displacement from the PODs, as well as in a
form associated with metaphase chromosomes in the small percentage of
mitotic cells, led us to investigate the possibility of direct
protein-protein interactions between IE1 and PML. To do so, we used a
standard yeast two-hybrid interaction assay (23). The
results of representative experiments are shown in Fig.
9. As negative controls, when yeast cells
were transformed only with the single plasmids encoding each of the
GAL4-A/IE1 fusions alone, or with the GAL4-DB fusions with intact
PML(1-560) or deleted PML(97-267) or PML(224-560) alone,
none of these proteins activated the target
UASGal/GAL1-lacZ reporter gene (data not shown).
However, when plasmids containing the intact GAL4-DB fusion and the
intact GAL4-A fusion proteins were present together in the same
yeast cells, they gave blue color development in an X-Gal filter assay
(data not shown) and produced moderate levels of
-galactosidase
activity that were 20-fold higher than in negative interaction controls
(e.g., the combination of EBV EBNA-1 with IE1 or IE2) (Fig. 9;
compare line 3 with lines 1 and 2). Interestingly, the version of PML
containing point mutations within the RING finger domain
(C88P89
S88R89)
exhibited an interaction affinity 3 fold lower than that of the
wild-type protein (line 4). When we investigated the ability of PML
fusion proteins that either retained just the Cys/His-rich domain
(codons 97 to 267) or lacked the entire N-terminal domain (
1-223) to
interact with IE1, neither was able to do so (lines 5 and 6),
indicating that probably either the RING finger domain alone or both
the RING finger and adjacent Cys/His-rich domains may be essential for
the interaction with IE1. Note that truncated GAL4-DB domain fusions
containing the intact N terminus of PML could not be evaluated in this
assay because of their constitutive activator properties (see below). However, experiments set up in the reverse two-hybrid format eliminated this complication and showed that the GAL4-DB/IE1(1-491) fusion protein
was able to interact equally efficiently with both
GAL4-A/PML(1-560) and GAL-4-A/PML(1-267) in X-Gal filter assays
(not shown), although the level of interactions with this version of
the assay were weaker than with the original version of the assay. As a
negative control, the GAL4-DB/IE1(1-491) fusion protein alone did not
activate the target reporter gene. Therefore, the N-terminal region of PML containing the RING finger domain may be sufficient for interaction with IE1.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 9.
Yeast two-hybrid assays demonstrating specific
interactions between IE1 and PML. The GAL4-DB fusion proteins used were
GAL4-DB/EBNA-1(1-641, 102-325) (encoded by plasmid pYW18),
GAL4-DB/PML(1-560) (pJHA238), GAL4-DB/PML(1-560,
C88P89 S88R89)
(pJHA247), GAL4-DB/PML(97-267) (pJHA277), GAL4-DB/PML(224-560)
(pJHA280), GAL4-DB/SNF1 (pSE1112), and GAL4-DB/Rb(301-928) (pRb2). The
GAL4-A fusion proteins used were GAL4-A/IE1(1-491) (in pJHA239),
GAL4-A/IE2(1-579) (pJHA140), GAL4-A/IE1(1-346) (pJHA300),
GAL4-A/IE1(1-231) (pJHA255), GAL4-A/IE1(232-491) (pJHA249),
GAL4-A/IE1( 132-274) (pJHA251), GAL4-A/IE1(132-274) (pJHA257), and
GAL4-A/SNF4 (pSE1111). Paired plasmids encoding the GAL4-DB and GAL4-A
fusion proteins were introduced together into Y190 cells. Transformants
were selected on plates lacking Trp and Leu, and -galactosidase
activity of the transformants were measured. Mean values for
-galactosidase units in duplicated assays are denoted by the black
bars with error range indicated.
|
|
To determine whether any specific isolated subfragments of IE1 might be
capable of interaction with PML, we generated a series
of yeast
expression plasmids encoding truncated GAL4-A/IE1 fusions
and
investigated the abilities of these mutant IE1 proteins to
bind to the
intact GAL4-DB/PML(1-560) fusion protein. The results
showed that
the GAL4-A/IE1(1-346) fusion protein lacking the acidic
C-terminal
region of IE1 was able to interact strongly with the
intact
GAL4-DB/PML(1-560) protein (Fig.
9, line 7) but did so
with
threefold-reduced efficiency with the
GAL4-DB/PML(C
88P
89
S
88R
89)
mutant (line 8). However, the other fusion proteins used in this
experiment, GAL4-A/IE1(1-231), GAL4-A/IE1(232-491), GAL4-A/IE1
(

132-274),
and GAL4-A/IE1(132-274), all failed to interact with
GAL4-DB/PML(1-560) (Fig.
9, lines 9 to 12). This set of fusion
proteins contained a hemagglutinin epitope tag (inserted behind
the
GAL4-A on plasmid pACTII), which allowed us to confirm by
using Western
blot analysis with anti-hemagglutinin antibody (data
not shown) that
these GAL4-A/mutant IE1 fusion proteins were of
the expected sizes and
all gave comparable levels of expression
relative to the wild-type
fusion protein in the yeast cells. Therefore,
the isolated segment of
IE1(1-346) but not smaller fragments is
sufficient for interaction with
PML in yeast, which is fully consistent
with the results obtained above
with similar mutant IE1 proteins
by IFA studies in transfected Vero
cells (Fig.
4 and
7).
Importantly, PML did not demonstrate any significant interaction with
IE2 in the same assay (Fig.
9, line 13), and IE1 does
not interact with
itself in such assays (data not shown). Compared
to other
protein-protein interactions that were used as positive
controls, the
strength of the interaction of the intact IE1 and
PML fusion proteins
(90 × 10
3 U) was 20% to 40% as efficient as
either the self-dimerization
interaction of the intact PML protein in
the same yeast cell background
(516 × 10
3 U [data
not shown]) or the SNF1 interaction with SNF4 (line 15),
but was
comparable to the affinity of the IE2 interaction with
Rb (100 × 10
3 U) (line 14) (
27b). Therefore, consistent
with our IFA data,
these genetic assays using a yeast two-hybrid system
identified
a specific protein-protein interaction between IE1 and
PML that
appears to be mediated through the RING finger domain of
PML and
does not require the C-terminal acidic domain of IE1.
Unmasking of a cryptic transactivator domain in PML in yeast GAL4
fusion assay.
In APL cells, the t(15;17) chromosome translocation
produces C-terminally truncated aberrant PML proteins as well as the
PML/RAR
fusion proteins (57). The N-terminal portion of
PML has been suggested to have some form of transcriptional modulator
function because the PML/RAR
fusion causes an alteration in the
RA-dependent transactivation function of the RAR
(14,
35). In our initial study to investigate possible biological
functions of the interaction of IE1 with the RING finger domain of PML
(in addition to the disruption of PODs), we generated a set of yeast
expression plasmids encoding C-terminal truncated GAL4-DB/PML
fusion proteins (illustrated in Fig.
10A) but discovered that several of
these forms gave a direct transactivator function in yeast (Fig.
10B). Neither the intact GAL4-DB/PML(1-560) protein nor
GAL4-DB/PML(1-447) containing both the N-terminal Cys-rich domains
and the intact coiled-coil region of PML had any activity in this assay
(lines 1 and 3). However, the shorter form GAL4-DB/PML(1-267),
which contains both the intact RING finger domain and the adjacent
Cys/His-rich domains but lacks the coiled-coil region, showed positive
transactivation on the target UASGal/GAL1-lacZ
reporter gene (line 4). Similarly, a GAL4-DB/PML(1-96) protein
containing the intact RING finger domain only (line 6) also showed
transactivation properties, although with a sixfold reduction in
activity compared to GAL4-DB/PML(1-267). In contrast, the
GAL4-DB/PML(96-267) (line 8), GAL4-DB/PML(224-560) (line 9),
and GAL4-DB/PML(447-560) (line 10) fusion proteins did not show any
transactivator properties.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 10.
Unmasking of a cryptic transactivator property within
the N-terminal domain of PML proteins in yeast cells. (A) Diagram
illustrating the structure of the GAL4-DB/PML (lines 1 to 12) and other
control GAL4-DB/IE2 (line 13) or GAL4-DB/IE110 (lines 14 and 15) fusion
proteins used. See Fig. 6 for details of PML protein features. (B)
-Galactosidase activity measured in Y190 cells transformed with
plasmids encoding the GAL4-DB/PML or other control fusion proteins.
Single-transformants were selected on plates lacking Trp, and
-galactosidase activity of the transformants was measured. Lines: 1, GAL4-DB/PML(1-560) in pJHA238; 2, GAL4-DB/PML(1-560,
C88P89 S88R89)
(pJHA247); 3, GAL4-DB/PML(1-447) (pJHA252); 4, GAL4-DB/PML(1-267) (pJHA253); 5, GAL4-DB/PML(1-267,
C88P89 S88R89)
(pJHA273); 6, GAL4-DB/PML(1-96) (pJHA254); 7, GAL4-DB/PML(1-96,
C88P89 S88R89)
(pJHA274); 8, GAL4-DB/PML96-267) (pJHA277); 9, GAL4-DB/PML(224-560)
(pJHA280); 10, GAL4-DB/PML(447-560) (pJHA250); 11, GAL4-DB/PML(1-560, 281-304) (pEB1); 12, GAL4-DB/PML(1-560,
C88P89 S88R89
281-304) (pEB2); 13, GAL4-DB/IE2(290-579) (pCJC420); 14, GAL4-DB/IE110(104-240) (pLZ59); 15, GAL4-DB/IE110(104-240,
C152P153 S152R153)
(pLZ60).
|
|
Quantitatively, the level of transactivation by
GAL4-DB/PML(1-267) on the yeast target reporter gene was
twofold higher than
that of GAL4-DB/IE2(290-579) (Fig.
10, line 13),
which contains
the C-terminal activator domain of HCMV IE2 (
2,
59). Since
the GAL4-DB/PML(1-267) protein lacks most of the
coiled-coil region
of PML that is required for dimerization and POD
localization,
we also examined whether a nearly intact
GAL4-DB/PML(1-560,

281-304)
fusion protein containing just a
small 25-aa deletion within the
coiled-coil region might also unmask
the cryptic transactivator
properties in the same yeast one-hybrid
assay. Indeed, this small
deletion in the PML dimerization region also
revealed transactivator
properties comparable to those of the isolated
N terminus (line
11). Overall these results demonstrate that N-terminal
PML fragments
containing both the RING finger and the adjacent
Cys/His-rich
domains, or less efficiently just the RING finger domain
alone,
display cryptic transactivator functions that are not evident
in
the intact PML protein. Furthermore, the coiled-coil domain
may be
involved in blocking this function of the N-terminal RING
finger domain
region of PML.
The RING finger domain of PML plays a critical role in the unmasked
transactivator property of PML.
To investigate the role of the
RING finger domain itself in transactivation by PML, a mutation of a
Cys residue
(C88P89
S88R89) within the RING finger domain was generated in each of the
GAL4-DB/ PML(1-267), GAL4-DB/PML(1-96), and GAL4-DB/PML (1-560,
281-304) backgrounds. Interestingly,
GAL4-DB/PML(1-267,
C88P89
S88R89) (Fig.
10, line 5) showed a 3-fold lower level of transactivation compared to the parent GAL4-DB/PML(1-267) protein,
whereas both GAL4-DB/PML(1-96,
C88P89
S88R89)
(line 7) and GAL4-DB/PML(1-560, C88P89
S88R89
281-304) (line 12) displayed 100- and 60-fold reductions, respectively, and were almost devoid of any remaining transactivator function. A similar pattern of both a significant transactivation function with an isolated intact RING finger domain fusion protein from
HSV IE110 [in GAL4-DB/IE110(104-240) (line 14)] but an almost complete loss of this activity by mutation of a Cys residue within the
RING finger domain [in GAL4-DB/IE110(104-240),
C152P153
S152R153) (line 15)] was observed in control experiments. These results demonstrate that the RING finger domain itself plays a major role in
the unmasked transactivation activity of the C-terminal truncated PML
proteins and that such properties may be a common feature of RING
finger domains.
Masking of the cryptic N-terminal transactivator activity of PML is
also evident in mammalian cells.
To confirm that unmasking of a
transactivator function within the N terminus of the truncated PML
protein also occurred in mammalian cells, the GAL4-DB/mutant PML
proteins were also placed into an SV40 enhancer-derived vector and
expressed in Vero cells by transient DNA transfection together with the
E1b-CAT or GAL45/E1b-CAT target reporter plasmids. The
results of the CAT assay revealed that GAL4-DB/PML(1-267) was able
to activate the GAL45/E1b-CAT target reporter gene 22-fold
but failed to do so on the E1b-CAT control (Fig.
11, lanes 17 and 6). Consistent with
the results obtained with the yeast system, the RING finger domain
mutant GAL4-DB/PML(1-267,
C88P89
S88R89)
produced a threefold-lower level of transactivation compared to its
parent version, and none of the other GAL4-DB domain fusion proteins
containing segments of PML, including a version of
GAL4-DB/PML(97-267) with the RING finger domain omitted (lane 19),
had any activity. Quantitatively, the level of transactivation by
GAL4-DB/PML(1-267) in this assay was at least 20-fold greater than
that obtained with the intact PML fusion protein
[GAL4-DB/PML(1-560)], although it was 4-fold less than that
obtained in parallel assays with the HCMV IE2 C-terminal activator
domain (codons 544 to 579) as a GAL4-DB fusion protein (59)
(lane 21). Importantly, the masking effect of using the intact PML
protein in GAL4-DB/PML(1-560) or of just adding the adjacent
coiled-coil domain to the N-terminal activator domain in
GAL4-DB/PML(1-447) again blocked all transactivator activity (lanes
14 and 16). These results demonstrate that the 267-amino-acid N-terminal PML protein fragment containing just the RING finger and
adjacent Cys/His-rich motifs behaves as a functional transactivator in
domain swap assays in both yeast and mammalian cells, but that addition
of the adjacent
-helical coiled-coil region that is thought to be
required for dimerization masks this activity within the wild-type PML
protein.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
Assays for activator domains in PML using GAL4 fusion
proteins expressed in transient assays in mammalian cells. Vero cells
were cotransfected with plasmids containing either the parent E1b-CAT
or GAL45/E1b-CAT reporter target gene together with
plasmids encoding the GAL4-DB (pGH250) or GAL4-DB/PML fusion proteins.
A representative autoradiograph of a transient CAT assay is shown.
The basal samples show the levels of E1b-CAT or
GAL45/E1b-CAT expression in the presence of vector plasmid
DNA only. GAL4/IE2(544-579) in plasmid pMP54a containing the C-terminal
IE2 transactivator domain described previously (59) and
GAL4/CBF1(1-500) in plasmid pJH93 were used as positive and negative
controls, respectively (32). GAL4-DB/PML fusion proteins
tested were GAL4-DB/PML(1-560) in pJHA258, GAL4-DB/PML(1-560,
C88P89 S88R89) in
pJHA259, GAL4-DB/PML(1-447) in pJHA260, GAL4-DB/PML(1-267) in
pJHA261, GAL4-DB/PML(1-267,
C88P89 S88R89) in
pJHA275, GAL4-DB/PML(97-267) in pJHA278, and
GAL4-DB/PML(447-560) in pJHA263.
|
|
 |
DISCUSSION |
The role of the PML-containing nuclear bodies (PODs or nuclear
domain 10) in cell growth control and in very early events in DNA virus
infection appears likely to prove to be very important. Maul and
colleagues have demonstrated that input herpesvirus, adenovirus, and
SV40 DNA genomes, HCMV IE transcription, and even initial HSV and
adenovirus DNA synthesis are all localized in close proximity to POD
structures (33, 34, 51). Furthermore, they have also
pointed out that PODs and HCMV IE transcription domains often also
lie directly adjacent to or touching the RNP containing
SC35-positive spliceosome domains (3). Herpesvirus IE
transcription processes are very similar to those of rapidly induced or
activated cellular genes, including being under the control of
strong inducible enhancers and often (unlike delayed-early or
late genes) yielding spliced mRNA products. Therefore, it would not be
surprising if at IE stages of infection the DNA viruses all utilize
preexisting cellular machinery that might be localized to a limited
number of highly active chromosomal sites. At least some PODs
represent the cellular dense bodies detectable by electron microscopy in which a central matrix-associated core, including chromatin-like nucleofibrils, is decorated by a layer of PML and other
POD proteins (19, 39, 70).
The apparent replacement or displacement of PML and its associated
proteins from the PODs by the HSV IE110 (ICP0) protein or the CMV IE1
(IE72) protein could represent a way to increase the efficiency of
IE transcription; alternatively, at later times it could either be part
of the process of disrupting cellular transcription controls or
represent a way to recruit POD factors to other more dispersed
sites for delayed-early phase transcription events, or both. However,
although the suspicion is increasing that these phenomena involve
transcriptional events and factors, there is no direct evidence as yet
to pinpoint such a mechanism or to exclude other processes as well.
Because of the RA-reversible correlation between disruption of PODs and
the transformed or myeloid cell phenotype of NB4 cells (19, 27,
39), the dispersion or loss of PODs in M-phase cells (16,
19), and the disruption of PODs within 2 h of adenovirus,
HSV, or HCMV infection, it seems clear that protein-protein
interactions and protein complex aggregation and disaggregation are
central events in these processes.
Our results confirm and extend previous suggestions that although both
IE1 and IE2 independently target initially to the PODs, expression of
the HCMV IE1 protein only and not IE2 leads to displacement of the POD
proteins (1, 41). This is also unlike the IE110 and IE68
proteins of HSV, which both also very efficiently displace PML from
PODs but themselves end up stably-associated with either of two
distinct types of nuclear punctate bodies (20, 73). Instead,
the HCMV IE1 protein is subsequently found distributed uniformly
throughout the nucleoplasm, and this correlates with the timing of a
parallel change in the location of PML into a uniform diffuse
distribution also. Furthermore, endogenous PML also colocalized with
IE1 in condensed metaphase chromosomes in those IE1-expressing
transfected or infected cells that were undergoing mitosis, but PML was
never detected there in mitotic cells in the absence of IE1.
Our observations also confirmed previous findings that a transiently
expressed version of PML that is mutated in one of the Cys residues of
the RING finger domain fails to target to or colocalize with endogenous
PML despite presumably retaining the ability to heterodimerize with it
(6, 36, 46). Curiously, this finding is different than that
for the HSV IE110 protein, which still targets to PODs when its RING
finger is mutated or deleted but now is unable to displace PML, leading
to a stable colocalization of the two proteins in the PODs (13,
20). Although neither IE1 nor IE2 or any of the other cellular
proteins found in PODs are RING finger proteins, these results clearly
implicate the RING finger domains of PML as contributing in some way to
protein aggregation and complex formation in the PODs. The RING class zinc finger domains found in PML, IE110 and a number of other cellular
proteins (including BRCA-1 and RAG-1) are believed to be
protein-protein interaction motifs with similar cross-braced zinc-coordinated core structures but with distinct targeting
specificities (4, 6). For example, Everett et al.
(21) have shown that replacement of the IE110 RING finger
domain within IE110 by that of PML in an HSV genomic background fails
to restore an IE110-positive phenotype.
There is no evidence for a direct interaction between IE110 or its RING
finger domain with PML, but our data from yeast two-hybrid assays
strongly reinforces the concept that HCMV IE1 does interact directly
with PML. Furthermore, the RING finger point mutant form of PML was
severely compromised in its ability to interact with IE1 in yeast, and
deletion of the N-terminal 97 amino acids of PML including the RING
finger domain abolished the interaction. In both mammalian cell
cotransfection and yeast interaction studies we showed that the
truncated IE1 (1-346) protein is sufficient for interaction with PML,
although the ability of IE1 to target to the PODs and to displace PML
can apparently be dissociated by removal of the highly acidic C
terminus. The large central hydrophobic segment of IE1 is required to
be intact for both activities. The isolated N-terminal PML(1-267)
protein fragment encompassing the RING finger domain was also
sufficient for interaction with IE1 in yeast two-hybrid assays, and
overexpressed PML(1-267) was capable of being targeted to POD-like
structures in mammalian cells in the presence of IE1(1-346), although
it did not do so on its own. Despite previous statements (24,
28) about the presence of both zinc finger and leucine zipper
motifs in HCMV IE1 (which might be obvious candidates for PML
interaction domains), we do not consider that this is the case, because
neither of these proposed motifs fits with standard consensus patterns
nor are they conserved in the simian or rodent CMV homologs of the
human CMV IE1 protein (9).
The behavior of SP100 in NB4 cells, where it is released from PODs when
PML/RAR is dispersed but returns when PML/RAR is restored to the PODs
in the presence of RA, suggests that PML may be a key aggregation
factor that holds the POD multiprotein complexes together. The
targeting of both HCMV IE1 and HSV IE110 to PODs leading to the
subsequent release of both PML and SP100 would appear to be consistent
with this simplistic view. However, unlike the apparent direct
interaction of IE1 with PML, one would have to argue that IE110 and PML
compete for interaction with some other POD component that is not
itself displaced when PML is lost. Interestingly PML is known to
interact with a protein called PIC 1 that is related to ubiquitin
(5) and the C terminus of IE110 is known to bind to a
ubiquitin pathway regulating protein (22), which suggests
that some of these events might involve protein degradation and
stabilization, or even that the function of IE110 and PML might be
mediated by regulating the stability of ubiquitin-dependent cell cycle
or growth control proteins.
Recently, Le et al. (46) have also reported that deletions
of the coiled-coil domain or of the RING finger domains of the PML
protein resulted in its inability to assemble into PODs leading to a
nuclear diffuse distribution in transfected cells. Our results with
mutant PML proteins containing either point mutations within the RING
finger domain or a small deletion within the coiled-coil region
corroborate and extend their findings. Furthermore, our self-interaction assay of mutant PML proteins using the yeast two-hybrid assay demonstrated that the inability of mutant PML to
localize in PODs may result from a failure to either dimerize or to
oligomerize efficiently. Therefore, we suggest that the N-terminal RING
finger domain of PML may normally be involved in assembly of protein
complexes in the PODs by homo- and hetero-oligomerization. The
interaction of the HCMV IE1 protein with the RING finger domain of PML
would then disrupt this process, leading to displacement of PML into a
nuclear diffuse form in association with IE1.
Although the PML/RAR fusion protein apparently produces a RA-dependent
stimulation of AP-1 activity (17), we have been unable to
detect any direct or specific effects of wild-type PML, IE1, or
IE110 on AP-1-containing target reporter genes in cotransfection experiments in Vero cells (13a). The HSV IE110/PML RING
finger replacement protein also does not restore the transcriptional transactivation properties of the intact IE110 protein (21). Nevertheless, while investigating the properties of PML variants in
GAL4 domain swap assays in transfected mammalian cells, we discovered
that removal of the C terminus or even a small deletion within the
coiled-coil domain of PML uncovered a latent or cryptic transactivator
function that encompassed the RING finger and adjacent Cys/His-rich
domains. Furthermore, this function was inactivated by mutation of a
Cys residue within the RING finger, and the isolated RING finger
domains of PML or IE110 as GAL4 fusion proteins were both also active
in yeast one-hybrid transactivator domain assays in a totally RING
finger-dependent manner. These results suggest that the PML/RAR fusion
protein may generate a novel constitutive transactivator function that
is probably targeted to RAR- and RXR-containing promoter motifs and
that the wild-type PML protein itself has conditional cryptic
transactivator characteristics. This transactivator domain
appears to be normally masked by the coiled-coil C-terminal domain of
the protein but has the potential to be uncovered either by appropriate
protein modifications or by interactions with other unknown proteins.
Whether the masking involves subunit homodimerization interactions
directly or alternatively involves either conformational changes or an
intramolecular folding event is unresolved at present, although we
have been unable to detect any interaction between the isolated
N-terminal and C-terminal halves of PML in yeast two-hybrid assays
(2a). Therefore, it seems likely that interaction of IE1
with the RING finger region of PML not only leads to disaggregation of
PML-containing POD protein complexes but also either blocks or unmasks
the ability of the N terminus of PML to function as a conditional
transactivator domain. Considering that IE1 also has a cryptic
transactivator domain, which lies within the N-terminal 87 aa that are
shared with IE2 (59), the possible functional outcomes of
IE1-PML interactions appear to be rather complex.
 |
ACKNOWLEDGMENTS |
This study was funded by Public Health Service research grant RO1
AI24576 to G.S.H. from the National Institute for Allergy and
Infectious Diseases.
We thank Peter O'Hare, James J.-D. Hsieh, and Yilong Wang for gifts of
plasmids. We also thank Dolores Ciufo for plasmids and rabbit PAbs
against PML. Generous gifts of yeast strains and plasmids from Stephen
J. Elledge (Baylor College of Medicine, Waco, Tex.), plasmids for PML
from Ronald M. Evans (The Salk Institute, San Diego, Calif.), the
Ad-IE1 vector from Gavin Wilkinson (University of Wales, College of
Medicine, Cardiff, United Kingdom), and MAb 5E10 from K. van der Krann
(Universiteit van Amsterdam) are greatly acknowledged. We are also
grateful to Edward S. Mocarski (Standford University, Calif.) for a
gift of samples of the pair of IE1-deleted CR208 virus and its parent
HCMV(Towne) virus. We also thank Mike Delannoy (Department of Cell
Biology, Johns Hopkins School of Medicine) for assistance with the
confocal microscopy analysis and Sarah Heaggans for help in preparation
of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Pharmacology and Molecular Sciences, Johns Hopkins University School of
Medicine, 725 N. Wolfe St., WBSB 317, Baltimore, MD 21205. Phone: (410)
955-8684. Fax: (410) 955-8685. E-mail:
Gary.Hayward{at}qmail.bs.jhu.edu.
 |
REFERENCES |
| 1.
|
Ahn, J.-H., and G. S. Hayward.
1997.
The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells.
J. Virol.
71:4599-4613[Abstract].
|
| 2.
|
Ahn, J.-H.,
C.-J. Chiou, and G. S. Hayward.
1998.
Evaluation and mapping of the DNA binding and oligomerization domains of the IE2 regulatory protein of human cytomegalovirus using yeast one and two hybrid interaction assays.
Gene
210:25-36[Medline].
|
| 2a.
| Ahn, J.-H. Unpublished data.
|
| 3.
|
Ascoli, C. A., and G. G. Maul.
1991.
Identification of a novel nuclear domain.
J. Cell Biol.
112:785-795[Abstract/Free Full Text].
|
| 4.
|
Barlow, P. N.,
B. Luisi,
A. Milner,
M. Elliott, and R. D. Everett.
1994.
Structure of the C3HC4 domain by 1H-nuclear magnetic resonance spectroscopy.
J. Mol. Biol.
237:201-211[Medline].
|
| 5.
|
Boddy, M. N.,
K. Howe,
L. D. Etkin,
E. Solomon, and P. S. Freemont.
1996.
PIC 1, a novel ubiquitin-like protein which interacts with the PML component of a multiprotein complex that is disrupted in acute promyelocytic leukemia.
Oncogene
13:971-982[Medline].
|
| 6.
|
Borden, K. L. B.,
M. N. Boddy,
J. Lally,
N. J. O'Reilly,
S. Martin,
K. Howe,
E. Solomon, and P. S. Freemont.
1995.
The solution structure of the RING finger domain from the acute promyelocytic leukaemia proto-oncogene PML.
EMBO J.
14:1532-1541[Medline].
|
| 7.
|
Britt, W. J., and C. A. Alford.
1996.
Cytomegalovirus, p. 2493-2523.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 8.
|
Carvalho, T.,
J.-S. Seeler,
K. Ohman,
P. Jordan,
U. Pettersson,
G. Akusjarvi,
M. Carmo-Fonseca, and A. Dejean.
1995.
Targeting of adenovirus E1A and E4-ORF3 proteins to nuclear matrix-associated PML bodies.
J. Cell Biol.
131:45-56[Abstract/Free Full Text].
|
| 9.
|
Chang, Y.-N.,
K.-T. Jeang,
T. Lietman, and G. S. Hayward.
1995.
Structural organization of the spliced immediate-early gene complex that encodes the major acidic nuclear (IE1) and trans-activator (IE2) proteins of African green monkey cytomegalovirus.
J. Biomed. Sci.
2:105-130[Medline].
|
| 10.
|
Cherrington, J. M., and E. S. Mocarski.
1989.
Human cytomegalovirus IE1 transactivates the promoter-enhancer via an 18-base-pair repeat element.
J. Virol.
63:1435-1440[Abstract/Free Full Text].
|
| 11.
|
Cherrington, J. M.,
E. L. Khoury, and E. S. Mocarski.
1991.
Human cytomegalovirus ie2 negatively regulates alpha gene expression via a short target sequence near the transcription start site.
J. Virol.
65:887-896[Abstract/Free Full Text].
|
| 12.
|
Chiou, C.-J.,
J. Zong,
I. Waheed, and G. S. Hayward.
1993.
Identification and mapping of dimerization and DNA-binding domains in the C terminus of the IE2 regulatory protein of human cytomegalovirus.
J. Virol.
67:6201-6214[Abstract/Free Full Text].
|
| 13.
| Ciufo, D., and G. S. Hayward. Evaluation of
colocalization interactions between the herpes simplex virus IE110
nuclear regulatory protein and the cellular PML and SP100 proteins in
infected and DNA-transfected cells. Submitted for publication.
|
| 13a.
| Ciufo, D., and G. S. Hayward. Unpublished data.
|
| 14.
|
de The, H.,
C. Lavau,
A. Marchio,
C. Chomienne,
L. Degos, and A. Dejean.
1991.
The PML-RAR fusion mRNA generated by the t(15;17) translocation of acute promyelocytic leukemia encodes a functionally altered RAR.
Cell
66:675-684[Medline].
|
| 15.
|
Doucas, V.,
A. M. Ishov,
A. Romo,
H. Juguilon,
M. D. Weitzman,
R. M. Evans, and G. G. Maul.
1996.
Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.
Genes Dev.
10:196-207[Abstract/Free Full Text].
|
| 16.
|
Doucas, V., and R. M. Evans.
1996.
The PML nuclear compartment and cancer.
Biochem. Biophys. Acta
1288:M25-M29[Medline].
|
| 17.
|
Doucas, V.,
J. P. Brockes,
M. Yaniv,
H. de The, and A. Dejean.
1993.
The PML-retinoic acid receptor translocation converts the receptor from an inhibitor to a retinoic acid-dependent activator of transcription factor AP-1.
Proc. Natl. Acad. Sci. USA
90:9345-9349[Abstract/Free Full Text].
|
| 18.
|
Durfee, T.,
K. Becherer,
P. L. Chen,
S. H. Yeh,
Y. Yang,
A. Kilburn,
W. H. Lee, and S. J. Elledge.
1993.
The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit.
Genes Dev.
7:555-569[Abstract/Free Full Text].
|
| 19.
|
Dyck, J. A.,
G. G. Maul,
W. H. Miller,
J. D. Chen,
A. Kakizuka, and R. M. Evans.
1994.
A novel macromolecular structure is a target of the promyelocyte-retinoic acid receptor oncoprotein.
Cell
76:333-343[Medline].
|
| 20.
|
Everett, R. D., and G. G. Maul.
1994.
HSV-1 IE protein Vmw110 causes redistribution of PML.
EMBO J.
13:5062-5069[Medline].
|
| 21.
|
Everett, R. D.,
G. G. Maul,
A. Orr, and M. Elliott.
1995.
The cellular RING finger protein PML is not a functional counterpart of the herpes simplex virus type 1 RING finger protein Vmw110.
J. Gen. Virol.
76:791-798[Abstract/Free Full Text].
|
| 22.
|
Everett, R. D.,
M. Meredith,
A. Orr,
A. Cross,
M. Kathoria, and J. Parkinson.
1997.
A novel ubiquitin-specific protease is dynamically associated with PML nuclear domain and binds to a herpesvirus regulatory protein.
EMBO J.
16:556-577.
|
| 23.
|
Fields, S., and O.-K. Song.
1989.
A novel genetic system to detect protein-protein interactions.
Nature
340:245-246[Medline].
|
| 24.
|
Ghazal, P., and J. A. Nelson.
1993.
Transcription factors and viral regulatory proteins as potential mediators of human cytomegalovirus pathogenesis.
Springer-Verlag, Berlin, Germany.
|
| 25.
|
Goddard, A. D.,
J. Borrow,
P. S. Freemont, and E. Solomon.
1991.
Characterization of a zinc finger gene disrupted by the t(15:17) in acute promyelocytic leukemia.
Science
254:1371-1374[Abstract/Free Full Text].
|
| 26.
|
Greaves, R. F., and E. S. Mocarski.
1998.
Defective growth correlates with reduced accumulation of a viral DNA replication protein after low-multiplicity infection by a human cytomegalovirus ie1 mutant.
J. Virol.
72:366-379[Abstract/Free Full Text].
|
| 27.
|
Grignani, F.,
M. Fagioli,
P. F. Ferrucci,
M. Alcalay, and P. G. Pelicci.
1993.
The molecular genetics of acute promyelocytic leukaemia.
Blood Rev.
7:87-93[Medline].
|
| 27a.
|
Guarente, L., and M. Ptashne.
1981.
Fusion of Escherichia coli lacZ to the cytochrome c gene of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
78:2199-2203[Abstract/Free Full Text].
|
| 27b.
|
Hagemeier, C.,
R. Caswell,
G. Hayhurst,
J. Sinclair, and T. Kouzarides.
1994.
Functional interaction between the HCMV IE2 transactivator and the retinoblastoma protein.
EMBO J.
13:2897-2903[Medline].
|
| 28.
|
Hayhurst, G. P.,
L. A. Bryant,
R. C. Caswell,
S. M. Walker, and J. H. Sinclair.
1995.
CCAAT box-dependent activation of the TATA-less human DNA polymerase promoter by the human cytomegalovirus 72-kilodalton major immediate-early protein.
J. Virol.
69:182-188[Abstract].
|
| 29.
|
He, L.-Z.,
C. Tribioli,
R. Rivi,
D. Peruzzi,
P. G. Pelicci,
V. Soares,
G. Cattoretti, and P. P. Pandolfi.
1997.
Acute leukemia with promyelocytic features in PML/RAR transgenic mice.
Proc. Natl. Acad. Sci. USA
94:5302-5307[Abstract/Free Full Text].
|
| 30.
|
Hermiston, T. W.,
C. L. Malone,
P. R. Witte, and M. F. Stinski.
1987.
Identification and characterization of the human cytomegalovirus immediate-early region 2 gene that stimulates gene expression from an inducible promoter.
J. Virol.
61:3214-3221[Abstract/Free Full Text].
|
| 31.
|
Honess, R. W.,
U. A. Gompels,
M. Craxton,
K. R. Cameron,
R. Staden,
B. G. Barrell,
Y.-N. Chang, and G. S. Hayward.
1989.
Global and local deviation from expected frequencies of CpG-dinucleotides in herpes virus DNAs may be diagnostic of differences in the states of their latent genomes.
J. Gen. Virol.
70:837-855[Abstract/Free Full Text].
|
| 32.
|
Hsieh, J. J.-D., and S. D. Hayward.
1995.
Masking of the CBF1/RBPJ transcriptional repressor domain by Epstein-Barr virus EBNA2.
Science
268:560-563[Abstract/Free Full Text].
|
| 33.
|
Ishov, A. M.,
R. M. Stenberg, and G. G. Maul.
1997.
Human cytomegalovirus immediate early interaction with host nuclear structures: Definition of an immediate transcription environment.
J. Cell Biol.
138:5-16[Abstract/Free Full Text].
|
| 34.
|
Ishov, A. M., and G. G. Maul.
1996.
The periphery of nuclear domain 10 (ND10) as site of DNA virus deposition.
J. Cell Biol.
134:815-826[Abstract/Free Full Text].
|
| 35.
|
Kakizuka, A.,
W. H. Miller, Jr.,
K. Umesono,
R. P. Warrell, Jr.,
S. R. Frankel,
V. V. V. S. Murty,
E. Dmitrovsky, and R. M. Evans.
1991.
Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR with a novel putative transcription factor.
Cell
66:663-674[Medline].
|
| 36.
|
Kastner, P.,
A. Pevez,
Y. Lute,
C. Rochette-Egly,
M. P. Gaub,
B. Durand,
M. Lanotte,
R. Berger, and P. Chambon.
1992.
Structure, localization and transcriptional properties of two classes of retinoic acid receptor fusion proteins in acute promyleocytic leukemia (APL); structural similarities with a new family of oncoproteins.
EMBO J.
11:629-642[Medline].
|
| 37.
|
Kelly, C.,
R. V. Driel, and G. W. G. Wilkinson.
1995.
Disruption of PML-associated nuclear bodies during human cytomegalovirus infection.
J. Gen. Virol.
76:2887-2893[Abstract/Free Full Text].
|
| 38.
|
Koken, M. H.,
A. Reid,
F. Quignon,
M. K. Chelbi-Alix,
J. M. Davies,
J. H. S. Kabarowski,
J. Zhu,
S. Dong,
S.-J. Chen,
Z. Chen,
C. C. Tan,
J. Licht,
S. Waxman,
H. de The, and A. Zelent.
1997.
Leukemia-associated retinoic acid receptor fusion partner, PML and PLZF, heterodimerize and colocalize to nuclear bodies.
Proc. Natl. Acad. Sci. USA
94:10255-10260[Abstract/Free Full Text].
|
| 39.
|
Koken, M. H.,
F. Puvion-Dutilleul,
M. C. Guillemin,
A. Viron,
G. Linares-Cruz,
N. Stuurman,
L. De Jong,
C. Szostechi,
F. Calvo,
C. Chomienne,
L. Degos,
E. Puvion, and H. de The.
1994.
The t(15:17) translocation alters a nuclear body in a retinoic acid-reversible fashion.
EMBO J.
13:1073-1083[Medline].
|
| 40.
|
Koken, M. H.,
G. Linares-Cruz,
F. Quignon,
A. Viron,
M. K. Chelbi-Alix,
J. Sobczak-Thepot,
L. Juhlin,
L. Degos,
F. Calvo, and H. de The.
1995.
The PML growth suppressor has an altered expression in human oncogenesis.
Oncogene
10:1315-1324[Medline].
|
| 41.
|
Korioth, F.,
G. G. Maul,
B. Plachter,
T. Stamminger, and J. Frey.
1996.
The nuclear domain 10 (ND10) is disrupted by the human cytomegalovirus gene product IE1.
Exp. Cell Res.
229:155-158[Medline].
|
| 42.
|
LaFemina, R. L., and G. S. Hayward.
1980.
Structural organization of the DNA molecules from human cytomegalovirus.
ICN-UCLA Symp. Mol. Biol.
18:39-55.
|
| 43.
|
LaFemina, R. L., and G. S. Hayward.
1988.
Differences in cell type-specific blocks to immediate early gene expression and DNA replication of human, simian and murine cytomegalovirus.
J. Gen. Virol.
69:355-374[Abstract/Free Full Text].
|
| 44.
|
LaFemina, R. L.,
M. C. Pizzorno,
J. D. Mosca, and G. S. Hayward.
1989.
Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalovirus in stable cell lines and its preferential association with metaphase chromosomes.
Virology
172:584-600[Medline].
|
| 45.
|
Lang, D., and T. Stamminger.
1993.
The 86-kilodalton IE-2 protein of human cytomegalovirus is a sequence-specific DNA-binding protein that interacts directly with the negative autoregulatory response element located near the cap site of the IE-1/2 enhancer-promoter.
J. Virol.
67:323-331[Abstract/Free Full Text].
|
| 46.
|
Le, X.-F.,
P. Yang, and K.-S. Chang.
1996.
Analysis of the growth and transformation suppressor domains of promyelocytic leukemia gene, PML.
J. Biol. Chem.
271:130-135[Abstract/Free Full Text].
|
| 47.
|
Lillie, J. W., and M. R. Green.
1989.
Transcription activation by the adenovirus E1A protein.
Nature
338:39-44[Medline].
|
| 48.
|
Liu, B., and M. F. Stinski.
1992.
Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.
J. Virol.
66:4434-4444[Abstract/Free Full Text].
|
| 49.
|
Liu, B.,
T. W. Hermiston, and M. F. Stinski.
1991.
A "cis"-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2.
J. Virol.
65:897-903[Abstract/Free Full Text].
|
| 50.
|
Liu, J.-H.,
Z.-M. Mu, and K.-S. Chang.
1995.
PML suppresses oncogenic transformation of NIH/3T3 cells by activated neu.
J. Exp. Med.
181:1965-1973[Abstract/Free Full Text].
|
| 51.
|
Maul, G. G.,
A. M. Ishov, and R. D. Everett.
1996.
Nuclear domain 10 as preexisting potential replication start sites of herpes simplex virus type-1.
Virology
217:67-75[Medline].
|
| 52.
|
Maul, G. G., and R. D. Everett.
1994.
The nuclear location of PML, a cellular member of the C3HC4 zinc-binding domain protein family, is rearranged during herpes simplex virus infection by the C3HC4 viral protein ICP0.
J. Gen. Virol.
75:1223-1233[Abstract/Free Full Text].
|
| 53.
|
Maul, G. G.,
H. H. Guldner, and J. G. Spivack.
1993.
Modification of discrete nuclear domains induced by herpes simplex virus type 1 immediate early gene 1 product (ICP0).
J. Gen. Virol.
74:2679-2690[Abstract/Free Full Text].
|
| 54.
|
Mocarski, E. S.,
G. W. Kemble,
J. M. Lyle, and R. F. Greaves.
1996.
A deletion mutant in the human cytomegalovirus gene encoding IE1491aa is replication defective due to a failure in autoregulation.
Proc. Natl. Acad. Sci. USA
93:11321-11326[Abstract/Free Full Text].
|
| 55.
|
Mocarski, E. S., Jr.
1996.
Cytomegalovirus and their replication, p. 2447-2492.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 56.
|
Mu, Z. M.,
K. V. Chin,
J. H. Liu,
G. Lozano, and K.-S. Chang.
1994.
PML, a growth suppressor disrupted in acute promyelocytic leukemia.
Mol. Cell. Biol.
14:6858-6867[Abstract/Free Full Text].
|
| 57.
|
Pandolfi, P. P.,
F. Grignani,
M. Alcalay,
A. Mencarelli,
A. Biondi,
F. LoCoco,
F. Grignani, and P. G. Pellicci.
1991.
Structure and origin of the acute promyelocytic leukemia myl/RAR cDNA and characterization of its retinoid-binding and transactivation properties.
Oncogene
6:1285-1292[Medline].
|
| 58.
|
Pizzorno, M. C., and G. S. Hayward.
1990.
The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site.
J. Virol.
64:6154-6165[Abstract/Free Full Text].
|
| 59.
|
Pizzorno, M. C.,
M.-A. Mullen,
Y.-N. Chang, and G. S. Hayward.
1991.
The functionally active IE2 immediate-early regulatory protein of human cytomegalovirus is an 80-kilodalton polypeptide that contains two distinct activator domains and a duplicated nuclear localization signal.
J. Virol.
65:3839-3852[Abstract/Free Full Text].
|
| 60.
|
Pizzorno, M. C.,
P. O'Hare,
L. Sha,
R. L. LaFemina, and G. S. Hayward.
1988.
trans-activation and autoregulation of gene expression by the immediate-early region 2 gene products of human cytomegalovirus.
J. Virol.
62:1167-1179[Abstract/Free Full Text].
|
| 61.
|
Puvion-Dutilleul, F.,
M. K. Chelbi-Alix,
M. Koken,
F. Quignon,
E. Puvion, and H. de The.
1995.
Adenovirus infection induces rearrangements in the intranuclear distribution of the nuclear body-associated PML protein.
Exp. Cell Res.
218:9-16[Medline].
|
| 62.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics. A laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 63.
|
Spaete, R. R., and E. S. Mocarski.
1987.
Insertion and deletion mutagenesis of the human cytomegalovirus genome.
Proc. Natl. Acad. Sci. USA
84:7213-7217[Abstract/Free Full Text].
|
| 64.
|
Stadler, M.,
M. K. Chelbi-Alix,
M. H. Koken,
L. Venturini,
C. Lee,
A. Saib,
F. Quignon,
L. Pelicano,
M. C. Guillemin, and C. Schindler.
1995.
Transcriptional induction of the PML growth suppressor gene by interferons is mediated through an ISRE and a GAS element.
Oncogene
11:2565-2573[Medline].
|
| 65.
|
Stenberg, R. M.,
P. R. Witte, and M. F. Stinski.
1985.
Multiple spliced and unspliced transcripts from human cytomegalovirus immediate-early region 2 and evidence for a common initiation site within immediate-early region 1.
J. Virol.
56:665-675[Abstract/Free Full Text].
|
| 66.
|
Stinski, M. F.,
D. R. Thomsen,
R. M. Stenberg, and L. C. Goldstein.
1983.
Organization and expression of the immediate early genes of human cytomegalovirus.
J. Virol.
46:1-14[Abstract/Free Full Text].
|
| 66a.
|
Stuurman, N.,
A. De Graaf,
A. Floore,
A. Josso,
B. Humbel,
L. De Jong, and R. Van Driel.
1992.
A monoclonal antibody recognizing nuclear matrix associated nuclear bodies.
J. Cell Sci.
101:773-784[Abstract/Free Full Text].
|
| 67.
|
Szekely, L.,
K. Pokrovskaja,
W.-Q. Jiang,
H. de The,
N. Ringertz, and G. Klein.
1996.
The Epstein-Barr virus-encoded nuclear antigen EBNA-5 accumulates in PML-containing bodies.
J. Virol.
70:2562-2568[Abstract].
|
| 68.
|
Szostecki, C.,
H. H. Guldner,
H. T. Netter, and H. Will.
1990.
Isolation and characterization of cDNA encoding a human nuclear antigen predominantly recognized by autoantibodies from patients with cirrhosis.
J. Immunol.
145:4338-4347[Abstract].
|
| 69.
|
Wang, Y.,
J. E. Finan,
J. M. Middeldrop, and S. D. Hayward.
1997.
P32/TAP, a cellular protein that interacts with EBNA-1 of Epstein-Barr virus.
Virology
236:18-29[Medline].
|
| 70.
|
Weis, K.,
S. Rambaud,
C. Lavau,
J. Janseu,
T. Carvalho,
M. Carmo-Fonseca,
A. Lamond, and A. Dejean.
1994.
Retinoic acid regulates aberrant nuclear localization of PML-RAR alpha in acute promyelocytic leukemia cells.
Cell
76:345-356[Medline].
|
| 71.
|
Wilkinson, G. W. G., and A. Akrigg.
1992.
Constitutive and enhanced expression from the CMV major IE promoter in a defective adenovirus vector.
Nucleic Acids Res.
20:2233-2239[Abstract/Free Full Text].
|
| 72.
|
Zhong, L.
1997.
Role of herpes simplex virus type-1 (HSV-1) immediate early proteins in intranuclear compartmentalization during HSV-1 infection. Ph.D. thesis.
Johns Hopkins University, Baltimore, Md.
|
| 73.
| Zhong, L., and G. S. Hayward. The herpes
simplex virus IE68(ICP22) immediate-early protein is associated with
novel nuclear punctate structures and causes the disruption of both
cellular PML oncogenic domains and spliceosome domains. Submitted for
publication.
|
Mol Cell Biol, August 1998, p. 4899-4913, Vol. 18, No. 8
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jafferji, I., Bain, M., King, C., Sinclair, J. H.
(2009). Inhibition of epidermal growth factor receptor (EGFR) expression by human cytomegalovirus correlates with an increase in the expression and binding of Wilms' Tumour 1 protein to the EGFR promoter. J. Gen. Virol.
90: 1569-1574
[Abstract]
[Full Text]
-
Hwang, J., Kalejta, R. F.
(2009). Human Cytomegalovirus Protein pp71 Induces Daxx SUMOylation. J. Virol.
83: 6591-6598
[Abstract]
[Full Text]
-
Kapasi, A. J., Clark, C. L., Tran, K., Spector, D. H.
(2009). Recruitment of cdk9 to the Immediate-Early Viral Transcriptosomes during Human Cytomegalovirus Infection Requires Efficient Binding to Cyclin T1, a Threshold Level of IE2 86, and Active Transcription. J. Virol.
83: 5904-5917
[Abstract]
[Full Text]
-
Busche, A., Marquardt, A., Bleich, A., Ghazal, P., Angulo, A., Messerle, M.
(2009). The Mouse Cytomegalovirus Immediate-Early 1 Gene Is Not Required for Establishment of Latency or for Reactivation in the Lungs. J. Virol.
83: 4030-4038
[Abstract]
[Full Text]
-
Huh, Y. H., Kim, Y. E., Kim, E. T., Park, J. J., Song, M. J., Zhu, H., Hayward, G. S., Ahn, J.-H.
(2008). Binding STAT2 by the Acidic Domain of Human Cytomegalovirus IE1 Promotes Viral Growth and Is Negatively Regulated by SUMO. J. Virol.
82: 10444-10454
[Abstract]
[Full Text]
-
Ling, P. D., Tan, J., Sewatanon, J., Peng, R.
(2008). Murine Gammaherpesvirus 68 Open Reading Frame 75c Tegument Protein Induces the Degradation of PML and Is Essential for Production of Infectious Virus. J. Virol.
82: 8000-8012
[Abstract]
[Full Text]
-
Prichard, M. N., Sztul, E., Daily, S. L., Perry, A. L., Frederick, S. L., Gill, R. B., Hartline, C. B., Streblow, D. N., Varnum, S. M., Smith, R. D., Kern, E. R.
(2008). Human Cytomegalovirus UL97 Kinase Activity Is Required for the Hyperphosphorylation of Retinoblastoma Protein and Inhibits the Formation of Nuclear Aggresomes. J. Virol.
82: 5054-5067
[Abstract]
[Full Text]
-
Kapasi, A. J., Spector, D. H.
(2008). Inhibition of the Cyclin-Dependent Kinases at the Beginning of Human Cytomegalovirus Infection Specifically Alters the Levels and Localization of the RNA Polymerase II Carboxyl-Terminal Domain Kinases cdk9 and cdk7 at the Viral Transcriptosome. J. Virol.
82: 394-407
[Abstract]
[Full Text]
-
Tavalai, N., Papior, P., Rechter, S., Stamminger, T.
(2008). Nuclear Domain 10 Components Promyelocytic Leukemia Protein and hDaxx Independently Contribute to an Intrinsic Antiviral Defense against Human Cytomegalovirus Infection. J. Virol.
82: 126-137
[Abstract]
[Full Text]
-
Sourvinos, G., Tavalai, N., Berndt, A., Spandidos, D. A., Stamminger, T.
(2007). Recruitment of Human Cytomegalovirus Immediate-Early 2 Protein onto Parental Viral Genomes in Association with ND10 in Live-Infected Cells. J. Virol.
81: 10123-10136
[Abstract]
[Full Text]
-
Yamashita, D., Komori, H., Higuchi, Y., Yamaguchi, T., Osumi, T., Hirose, F.
(2007). Human DNA Replication-related Element Binding Factor (hDREF) Self-association via hATC Domain Is Necessary for Its Nuclear Accumulation and DNA Binding. J. Biol. Chem.
282: 7563-7575
[Abstract]
[Full Text]
-
Woodhall, D. L., Groves, I. J., Reeves, M. B., Wilkinson, G., Sinclair, J. H.
(2006). Human Daxx-mediated Repression of Human Cytomegalovirus Gene Expression Correlates with a Repressive Chromatin Structure around the Major Immediate Early Promoter. J. Biol. Chem.
281: 37652-37660
[Abstract]
[Full Text]
-
Ueno, T., Eizuru, Y., Katano, H., Kurata, T., Sata, T., Irie, S., Ogawa-Goto, K.
(2006). Novel Real-Time Monitoring System for Human Cytomegalovirus- Infected Cells In Vitro That Uses a Green Fluorescent Protein-PML-Expressing Cell Line.. Antimicrob. Agents Chemother.
50: 2806-2813
[Abstract]
[Full Text]
-
Kang, H., Kim, E. T., Lee, H.-R., Park, J.-J., Go, Y. Y., Choi, C. Y., Ahn, J.-H.
(2006). Inhibition of SUMO-independent PML oligomerization by the human cytomegalovirus IE1 protein.. J. Gen. Virol.
87: 2181-2190
[Abstract]
[Full Text]
-
Tavalai, N., Papior, P., Rechter, S., Leis, M., Stamminger, T.
(2006). Evidence for a Role of the Cellular ND10 Protein PML in Mediating Intrinsic Immunity against Human Cytomegalovirus Infections.. J. Virol.
80: 8006-8018
[Abstract]
[Full Text]
-
Tamrakar, S., Kapasi, A. J., Spector, D. H.
(2005). Human Cytomegalovirus Infection Induces Specific Hyperphosphorylation of the Carboxyl-Terminal Domain of the Large Subunit of RNA Polymerase II That Is Associated with Changes in the Abundance, Activity, and Localization of cdk9 and cdk7. J. Virol.
79: 15477-15493
[Abstract]
[Full Text]
-
White, E. A., Spector, D. H.
(2005). Exon 3 of the Human Cytomegalovirus Major Immediate-Early Region Is Required for Efficient Viral Gene Expression and for Cellular Cyclin Modulation. J. Virol.
79: 7438-7452
[Abstract]
[Full Text]
-
Liao, G., Huang, J., Fixman, E. D., Hayward, S. D.
(2005). The Epstein-Barr Virus Replication Protein BBLF2/3 Provides an Origin-Tethering Function through Interaction with the Zinc Finger DNA Binding Protein ZBRK1 and the KAP-1 Corepressor. J. Virol.
79: 245-256
[Abstract]
[Full Text]
-
Nevels, M., Paulus, C., Shenk, T.
(2004). Human cytomegalovirus immediate-early 1 protein facilitates viral replication by antagonizing histone deacetylation. Proc. Natl. Acad. Sci. USA
101: 17234-17239
[Abstract]
[Full Text]
-
Xu, Y., Cei, S. A., Huete, A. R., Pari, G. S.
(2004). Human Cytomegalovirus UL84 Insertion Mutant Defective for Viral DNA Synthesis and Growth. J. Virol.
78: 10360-10369
[Abstract]
[Full Text]
-
Shin, J., Park, B., Cho, S., Lee, S., Kim, Y., Lee, S.-O., Cho, K., Lee, S., Jin, B.-S., Ahn, J.-H., Choi, E.-J., Ahn, K.
(2004). Promyelocytic Leukemia Is a Direct Inhibitor of SAPK2/p38 Mitogen-activated Protein Kinase. J. Biol. Chem.
279: 40994-41003
[Abstract]
[Full Text]
-
Nevels, M., Brune, W., Shenk, T.
(2004). SUMOylation of the Human Cytomegalovirus 72-Kilodalton IE1 Protein Facilitates Expression of the 86-Kilodalton IE2 Protein and Promotes Viral Replication. J. Virol.
78: 7803-7812
[Abstract]
[Full Text]
-
Lee, H.-R., Kim, D.-J., Lee, J.-M., Choi, C. Y., Ahn, B.-Y., Hayward, G. S., Ahn, J.-H.
(2004). Ability of the Human Cytomegalovirus IE1 Protein To Modulate Sumoylation of PML Correlates with Its Functional Activities in Transcriptional Regulation and Infectivity in Cultured Fibroblast Cells. J. Virol.
78: 6527-6542
[Abstract]
[Full Text]
-
Chee, A. V., Lopez, P., Pandolfi, P. P., Roizman, B.
(2003). Promyelocytic Leukemia Protein Mediates Interferon-Based Anti-Herpes Simplex Virus 1 Effects. J. Virol.
77: 7101-7105
[Abstract]
[Full Text]
-
Berthoux, L., Towers, G. J., Gurer, C., Salomoni, P., Pandolfi, P. P., Luban, J.
(2003). As2O3 Enhances Retroviral Reverse Transcription and Counteracts Ref1 Antiviral Activity. J. Virol.
77: 3167-3180
[Abstract]
[Full Text]
-
Shpargel, K. B., Ospina, J. K., Tucker, K. E., Matera, A. G., Hebert, M. D.
(2003). Control of Cajal body number is mediated by the coilin C-terminus. J. Cell Sci.
116: 303-312
[Abstract]
[Full Text]
-
Tang, Q., Maul, G. G.
(2002). Mouse Cytomegalovirus Immediate-Early Protein 1 Binds with Host Cell Repressors To Relieve Suppressive Effects on Viral Transcription and Replication during Lytic Infection. J. Virol.
77: 1357-1367
[Abstract]
[Full Text]
-
Lopez, P., Jacob, R. J., Roizman, B.
(2002). Overexpression of Promyelocytic Leukemia Protein Precludes the Dispersal of ND10 Structures and Has No Effect on Accumulation of Infectious Herpes Simplex Virus 1 or Its Proteins. J. Virol.
76: 9355-9367
[Abstract]
[Full Text]
-
Ishov, A. M., Vladimirova, O. V., Maul, G. G.
(2002). Daxx-Mediated Accumulation of Human Cytomegalovirus Tegument Protein pp71 at ND10 Facilitates Initiation of Viral Infection at These Nuclear Domains. J. Virol.
76: 7705-7712
[Abstract]
[Full Text]
-
Gravel, A., Gosselin, J., Flamand, L.
(2002). Human Herpesvirus 6 Immediate-Early 1 Protein Is a Sumoylated Nuclear Phosphoprotein Colocalizing with Promyelocytic Leukemia Protein-associated Nuclear Bodies. J. Biol. Chem.
277: 19679-19687
[Abstract]
[Full Text]
-
Hofmann, H., Sindre, H., Stamminger, T.
(2002). Functional Interaction between the pp71 Protein of Human Cytomegalovirus and the PML-Interacting Protein Human Daxx. J. Virol.
76: 5769-5783
[Abstract]
[Full Text]
-
Xu, Y., Ahn, J.-H., Cheng, M., apRhys, C. M., Chiou, C.-J., Zong, J., Matunis, M. J., Hayward, G. S.
(2001). Proteasome-Independent Disruption of PML Oncogenic Domains (PODs), but Not Covalent Modification by SUMO-1, Is Required for Human Cytomegalovirus Immediate-Early Protein IE1 To Inhibit PML-Mediated Transcriptional Repression. J. Virol.
75: 10683-10695
[Abstract]
[Full Text]
-
Wienzek, S., Dobbelstein, M.
(2001). Viral and Cellular Factors That Target the Promyelocytic Leukemia Oncogenic Domains Strongly Activate a Glucocorticoid-Responsive Promoter. J. Virol.
75: 5391-5397
[Abstract]
[Full Text]
-
Ahn, J.-H., Xu, Y., Jang, W.-J., Matunis, M. J., Hayward, G. S.
(2001). Evaluation of Interactions of Human Cytomegalovirus Immediate-Early IE2 Regulatory Protein with Small Ubiquitin-Like Modifiers and Their Conjugation Enzyme Ubc9. J. Virol.
75: 3859-3872
[Abstract]
[Full Text]
-
Wu, W.-S., Vallian, S., Seto, E., Yang, W.-M., Edmondson, D., Roth, S., Chang, K.-S.
(2001). The Growth Suppressor PML Represses Transcription by Functionally and Physically Interacting with Histone Deacetylases. Mol. Cell. Biol.
21: 2259-2268
[Abstract]
[Full Text]
-
Adamson, A. L., Kenney, S.
(2001). Epstein-Barr Virus Immediate-Early Protein BZLF1 Is SUMO-1 Modified and Disrupts Promyelocytic Leukemia Bodies. J. Virol.
75: 2388-2399
[Abstract]
[Full Text]
-
Wu, F. Y., Ahn, J.-H., Alcendor, D. J., Jang, W.-J., Xiao, J., Hayward, S. D., Hayward, G. S.
(2001). Origin-Independent Assembly of Kaposi's Sarcoma-Associated Herpesvirus DNA Replication Compartments in Transient Cotransfection Assays and Association with the ORF-K8 Protein and Cellular PML. J. Virol.
75: 1487-1506
[Abstract]
[Full Text]
-
Angulo, A., Ghazal, P., Messerle, M.
(2000). The Major Immediate-Early Gene ie3 of Mouse Cytomegalovirus Is Essential for Viral Growth. J. Virol.
74: 11129-11136
[Abstract]
[Full Text]
-
Parkinson, J., Everett, R. D.
(2000). Alphaherpesvirus Proteins Related to Herpes Simplex Virus Type 1 ICP0 Affect Cellular Structures and Proteins. J. Virol.
74: 10006-10017
[Abstract]
[Full Text]
-
Murphy, E. A., Streblow, D. N., Nelson, J. A., Stinski, M. F.
(2000). The Human Cytomegalovirus IE86 Protein Can Block Cell Cycle Progression after Inducing Transition into the S Phase of Permissive Cells. J. Virol.
74: 7108-7118
[Abstract]
[Full Text]
-
Hofmann, H., Flöss, S., Stamminger, T.
(2000). Covalent Modification of the Transactivator Protein IE2-p86 of Human Cytomegalovirus by Conjugation to the Ubiquitin-Homologous Proteins SUMO-1 and hSMT3b. J. Virol.
74: 2510-2524
[Abstract]
[Full Text]
-
Ahn, J.-H., Jang, W.-J., Hayward, G. S.
(1999). The Human Cytomegalovirus IE2 and UL112-113 Proteins Accumulate in Viral DNA Replication Compartments That Initiate from the Periphery of Promyelocytic Leukemia Protein-Associated Nuclear Bodies (PODs or ND10). J. Virol.
73: 10458-10471
[Abstract]
[Full Text]
-
Ishov, A. M., Sotnikov, A. G., Negorev, D., Vladimirova, O. V., Neff, N., Kamitani, T., Yeh, E. T.H., Strauss, J. F. III, Maul, G. G.
(1999). Pml Is Critical for Nd10 Formation and Recruits the Pml-Interacting Protein Daxx to This Nuclear Structure When Modified by Sumo-1. JCB
147: 221-234
[Abstract]
[Full Text]
-
Müller, S., Dejean, A.
(1999). Viral Immediate-Early Proteins Abrogate the Modification by SUMO-1 of PML and Sp100 Proteins, Correlating with Nuclear Body Disruption. J. Virol.
73: 5137-5143
[Abstract]
[Full Text]
-
Lyngso, C., Bouteiller, G., Damgaard, C. K., Ryom, D., Sanchez-Munoz, S., Norby, P. L., Bonven, B. J., Jorgensen, P.
(2000). Interaction between the Transcription Factor SPBP and the Positive Cofactor RNF4. AN INTERPLAY BETWEEN PROTEIN BINDING ZINC FINGERS. J. Biol. Chem.
275: 26144-26149
[Abstract]
[Full Text]
-
Dai, K.-S., Liew, C.-C.
(2001). A Novel Human Striated Muscle RING Zinc Finger Protein, SMRZ, Interacts with SMT3b via Its RING Domain. J. Biol. Chem.
276: 23992-23999
[Abstract]
[Full Text]