Previous Article | Next Article 
Molecular and Cellular Biology, September 1998, p. 4994-4999, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Phosphorylation of Nuclear MyoD Is Required for Its
Rapid Degradation
An
Song,1,
Qi
Wang,1
Mark G.
Goebl,1 and
Maureen A.
Harrington1,2,*
Department of Biochemistry and Molecular
Biology1 and
Department of
Medicine,2 Walther Oncology Center, Indiana
University School of Medicine, Indianapolis, Indiana 46202
Received 3 April 1998/Accepted 8 June 1998
 |
ABSTRACT |
MyoD is a basic helix-loop-helix transcription factor involved in
the activation of genes encoding skeletal muscle-specific proteins.
Independent of its ability to transactivate muscle-specific genes, MyoD
can also act as a cell cycle inhibitor. MyoD activity is regulated by
transcriptional and posttranscriptional mechanisms. While MyoD can be
found phosphorylated, the functional significance of this
posttranslation modification has not been established. MyoD contains
several consensus cyclin-dependent kinase (CDK) phosphorylation sites.
In these studies, we examined whether a link could be established
between MyoD activity and phosphorylation at putative CDK sites.
Site-directed mutagenesis of potential CDK phosphorylation sites in
MyoD revealed that S200 is required for MyoD hyperphosphorylation as
well as the normally short half-life of the MyoD protein. Additionally,
we determined that turnover of the MyoD protein requires the proteasome
and Cdc34 ubiquitin-conjugating enzyme activity. Results of these
studies demonstrate that hyperphosphorylated MyoD is targeted for rapid
degradation by the ubiquitin pathway. The targeted degradation of MyoD
following CDK phosphorylation identifies a mechanism through which MyoD
activity can be regulated coordinately with the cell cycle machinery
(CDK2 and CDK4) and/or coordinately with the cellular transcriptional
machinery (CDK7, CDK8, and CDK9).
 |
INTRODUCTION |
In animals, skeletal muscle is a
critical organ, as it is responsible for carrying out coordinated and
directed movements. The developmental events that ultimately give rise
to mature skeletal muscle can be divided into two major steps (reviewed
in references 27, 47, 48, and
50). The first step is determination of which
multipotential mesodermal cells become restricted to the myogenic
lineage. The second step is commitment of the myogenically determined
cells (myoblasts) to terminal differentiation. Terminal differentiation
involves cell cycle arrest, fusion of myoblasts leading to myotube
formation, and the production of skeletal muscle-specific structural
proteins. Cellular restriction to the myogenic lineage is in large part
under the control of determination genes which encode a family of
skeletal muscle-specific basic helix-loop-helix transcription factors,
including MyoD, Myf-5, myogenin, and MRF4. The first determination
gene, MyoD, was found by its ability to initiate the
conversion of fibroblasts into myoblasts (6), a property
subsequently found to be true for all four myogenic determination
genes. While mice containing a homozygous deletion of MyoD
develop normally, mice lacking both MyoD and
Myf-5 do not form skeletal muscle (36, 37). These
results indicate that MyoD and Myf-5 are critical
for the determination step in skeletal muscle development. Once MyoD is
activated, it continues to be expressed throughout development,
presumably through the ability of the MyoD protein to activate
MyoD transcription (46).
In addition to activating skeletal muscle-specific genes,
MyoD expression can also lead to cell cycle arrest, even in
the absence of terminal myogenic differentiation (5, 26, 45, 47). The importance of MyoD as an inhibitor of cell cycle
progression can also be seen during wound repair (29). When
muscle from mice lacking MyoD is injured, the animals are deficient in
the regeneration of muscle tissue. The defect in regeneration appears to be the result of the increased potential of satellite cells for
self-renewal rather than fusion and myotube formation. One potential
mechanism by which MyoD can arrest cell cycle progression is through
the transcriptional activation of the CIP1 gene, which encodes the cyclin-dependent kinase (CDK)-inhibitory protein p21 (14, 33). Consistent with a role for MyoD in negatively
regulating cell cycle progression during G1, overexpression
of cyclin D1 results in an inhibition of MyoD-dependent transcription
and might lead to a decrease in p21 production (35, 42). The
cyclin D1-mediated decrease in MyoD transactivation activity correlates with a concomitant increase in the abundance of a phosphorylated form
of the MyoD protein, although MyoD has not been shown to be a substrate
of cyclin D complexes (35, 42, 46). Alternatively, MyoD has
been proposed to inhibit cell cycle progression by binding the Rb
protein and interfering with E2F-dependent transcription events, which
include the activation of a number of genes required for exit from
G1 or DNA replication (3, 13, 44).
These results suggest that a CDK controls MyoD protein activity,
possibly through direct phosphorylation of the MyoD protein. The CDKs
have been termed proline-directed protein kinases, as their substrates
are phosphorylated on serines or threonines that are preceded by a
proline (30). MyoD protein has seven putative CDK
phosphorylation sites. We demonstrate here that the MyoD protein is
likely to be phosphorylated on a serine residue within one of these CDK
consensus sites and that the prevention of phosphorylation at this site
leads to the stabilization of the MyoD protein. Furthermore, agents
that inhibit the ubiquitin-dependent pathway of protein degradation, a
pathway intimately linked to the turnover of several key regulators of
cell cycle progression, also cause the stabilization of MyoD. Based on
these results, we propose that the functional significance of MyoD
phosphorylation is to control the level of MyoD protein rather than to
alter the transactivating activity of the MyoD protein.
 |
MATERIALS AND METHODS |
Cell culture.
Cell culture and transient transfections were
performed as described previously (15). Nuclear extracts
were prepared as described elsewhere (1). Where indicated,
extracts were treated with 1 U of calf intestine alkaline phosphatase
(Gibco BRL Co.) for 30 min at 37°C prior to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Plasmids and DNA manipulations.
Plasmid 4TRTK-CAT (kindly
provided by S. Konieczny, Purdue University) contains four copies in
tandem of the E-box sequence present in the muscle creatine kinase gene
enhancer. The E-box sequences are upstream of the thymidine kinase (TK)
gene basal promoter that controls the expression of the bacterial
chloramphenicol acetyltransferase (CAT) gene.
All DNA manipulations were performed by using standard techniques
(38). The MyoD gene was liberated from plasmid
pVZC11b (6) (kindly provided by A. Lassar) by cleavage with
EcoRI/HindIII and ligated into the
EcoRI/HindIII fragment of pALTER-1 (Promega, Madison, Wis.). Site-directed mutagenesis was performed by using the
Altered Sites Mutagenesis System II (Promega), with oligonucleotides described in the legend to Fig. 2, according to the manufacturer's instructions. The presence of each mutation was verified by DNA sequencing using Sequenase (U.S. Biochemicals, Cleveland, Ohio) according to the manufacturer's instructions. An
EcoRI/HindIII DNA fragment containing
MyoD was ligated into the
EcoRI/HindIII fragment of pCB6
(28) (kindly provided by F. Rauscher). Cloning into pCB6
allows for expression under the control of the cytomegalovirus immediate-early gene promoter in mammalian cells (15).
Plasmid pADANS-tx61 (kindly provided by S. Plon), which contains the
human
CDC34 gene (
9,
34), was used to generate a
PCR product consisting of the coding region of
CDC34 with an
EcoRI
site at the 5' end and a
HindIII site
at the 3' end of the DNA
fragment, respectively, using
Taq
DNA polymerase with primer 1
(5' GTGGTCGAATTCCCCCGCGCTGCTCCGACC
3') and primer 2 (5' TTTATTCTGAAGCTTTCAGGACTCCTCCGTGCC
3')
according to the manufacturer's instructions (Boehringer
Mannheim
Corp.). The PCR product was then ligated into the
EcoRI/
HindIII
fragment of the mammalian
expression vector pCB6 (
15) to generate
pCB6-CDC34.
pCB6-dnCDC34 was generated as follows. Plasmid pADANS-tx61
was used as
template for PCR using primers 1 and 4 (5'
ACGGGGGACGTGTCTATCTCCATCTCCCACCCGCCGGTG
3') as well as primers 2 and 3 (5' CACCGGCGGGTGGGAGATGGAGATAGACACGTCCCCCGT
3') in two
separate reactions as described above. These two PCR
products were then
placed together with primers 1 and 2 for several
further rounds of
amplification. The resulting PCR product was
placed into pCB6 as
described above.
Half-life determination.
To determine the MyoD protein
half-life, cell cultures were incubated for 16 h following
transfection and then harvested by trypsinization. Equal numbers of
cells were replated into 60-mm-diameter dishes; 24 h after
replating, one set of cultures was harvested and nuclear extracts were
prepared. The remaining cultures were treated with cycloheximide (final
concentration, 35.5 µM). At the indicated time points, one set of
cultures was harvested and nuclear extracts were prepared. Equal
volumes of nuclear extracts from each sample were separated by SDS-PAGE
(10% gel) and analyzed by Western blotting with affinity-purified
anti-MyoD. The relative amounts of MyoD protein were quantitated with a
Bio-Rad GS-250 Molecular Imager. The half-lives were calculated as
described previously (40). Where noted, identical blots were
analyzed by Western analysis using anti-Cdc2 antibodies as instructed
by the manufacturer (Santa Cruz, Inc.).
Antibody generation and Western blot analysis.
Plasmid pGEX
MyoD (23) (kindly provided by the late H. Weintraub) encodes
a glutathione S-transferase (GST)-MyoD fusion protein that
can be produced in bacteria. Recombinant GST-MyoD was prepared as
described previously (23). Purified recombinant GST-MyoD
fusion protein was used to prepare rabbit polyclonal antisera
(performed by HRP Inc., Denver, Colo.). Antibodies were affinity
purified as described previously (9), using the recombinant GST-MyoD fusion protein. SDS-PAGE and Western blotting were performed as described previously (9).
Antibodies against human Cdc34 were generated as follows. PCR was
performed on pADANS-TX61 with the primers
TCCGCCGCCCATATGGCTCGGCCGCTAGTGCCC
and
TTTATTCTGCATATGTCAGGACTCCTCCGTGCC to generate a DNA fragment
containing the human
CDC34 gene with an
NdeI site
at both the
5' and 3' ends. This PCR product was ligated into the
NdeI site
of pET28a (Novagen, Inc.), generating a fusion
gene encoding a
Cdc34 protein tagged with six histidine residues at the
amino
terminus. The His-tagged Cdc34 was produced in bacteria as
previously
described (
9), purified by using
Ni
2+-nitrilotriacetic acid agarose (Qiagen Inc.) according
to the
manufacturer's instructions, and used for the production of
antisera
(performed by HRP Inc.). Antibodies against human Cdc34 were
affinity
purified as described previously, using His-tagged Cdc34
(
9).
 |
RESULTS |
Serine 200 is required for the hyperphosphorylation of MyoD.
Overexpression of cyclin D1 leads to hyperphosphorylation of MyoD
protein and inhibition of MyoD-dependent transcription (35, 42). To explore the possibility that MyoD is a CDK substrate, five of the seven potential CDK phosphorylation sites were individually changed to alanines by site-directed mutagenesis. At the sixth and
seventh potential CDK sites (GTQSPTPDAA), S296 and T298 were changed to
alanines simultaneously (Fig. 1). The
MyoD genes encoding the six mutant proteins or the wild-type
protein were subcloned into a mammalian expression vector that places
the cDNAs under the control of the cytomegalovirus immediate-early gene
promoter and simian virus 40 polyadenylation signals (see Materials and Methods). The expression constructs were transfected into C3H10T1/2 fibroblasts, and nuclear extracts were prepared 36 h later. MyoD proteins were then visualized by Western analysis of the separated nuclear proteins with anti-MyoD antibodies (Fig.
2A). Nuclear extracts were used, as
preliminary experiments revealed that the wild-type MyoD protein was
difficult to visualize consistently in whole-cell lysates (unpublished
observations). Western analysis indicated that cells expressing
wild-type MyoD or all but one of the serine-to-alanine
mutations produced a 45-kDa form of MyoD as well as a slower-migrating
form (Fig. 2A, lanes 2 to 4 and 6 to 8). However, cells expressing
SP3-MyoD, encoding the MyoD S200A protein, lacked the
slower-migrating form (Fig. 2A, lane 5). Treatment of nuclear extracts
with alkaline phosphatase prior to SDS-PAGE also caused a loss of the
slower-migrating form of MyoD expressed from the wild-type gene (Fig.
2B; compare lanes 1 and 2); however, alkaline phosphatase had no effect
on the mobility of the MyoD S200A protein (Fig. 2B, lanes 3 and 4).
These results are consistent with experiments on endogenous MyoD,
demonstrating that phosphorylation of MyoD retards its migration during
SDS-PAGE (46). These results indicate that the
slower-migrating form of MyoD is phosphorylated and that this
phosphorylation event requires a serine residue at position 200 in the
MyoD protein. However, from these experiments we cannot determine
whether S200 is the site of phosphorylation or whether phosphorylation
of S200 is required for phosphorylation at a different position.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram of the MyoD protein indicating
functional domains and putative CDK phosphorylation sites. NLS, nuclear
localization signal.
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Hyperphosphorylation of MyoD requires S200. Thirty
micrograms of pCB6+ vector or pCB6+ containing wild-type or mutated
MyoD was transfected into C3H10T1/2 fibroblasts as described
in Materials and Methods. At 36 h after transfection, cells were
harvested; nuclear extracts were prepared and separated by SDS-PAGE.
Separated proteins were subjected to Western analysis using anti-MyoD
antibodies. (A) Lanes (oligonucleotide sequences in brackets): 1, vector alone; 2, MyoD (wild-type MyoD); 3, SP1-MyoD (MyoD S5A [ELLSPPLR ELLAPPLR]); 4, SP2-MyoD (MyoD S37A [CFDSPDLR CFDAPDLR]); 5, SP3-MyoD (MyoD S200A [DASSPRSN DASAPRSN]); 6, SP4-MyoD (MyoD S262A [STDSPAAP STDAPAAP]); 7, SP5-MyoD (MyoD S277A [PPESPPGP PPEAPPGP]); 8, SP6-MyoD (MyoD T296A/S298A [GTQTPSPDA GTQA PAPDA]).
(B) Lanes: 1, wild-type MyoD-containing nuclear extracts; 2, wild-type
MyoD-containing nuclear extracts pretreated with calf intestine
alkaline phosphatase; 3, MyoD S200A-containing nuclear extracts; 4, MyoD S200A nuclear extracts pretreated with calf intestine alkaline
phosphatase.
|
|
Mutation of serine 200 to alanine increases the ability of MyoD to
transactivate a muscle-specific promoter.
Since
SP3-MyoD, encoding the MyoD S200A protein, prevented
formation of the slower-migrating MyoD species, we set out to determine whether this mutation would also affect MyoD function. One consequence of preventing the formation of the hyperphosphorylated form of MyoD
might be an increase or decrease in the ability of the MyoD protein to
transactivate muscle-specific genes. To determine the importance of
phosphorylation for MyoD transactivation activity, the ability of the
mutant proteins to transactivate expression of a reporter construct
under the control of the muscle creatine kinase promoter/enhancer E box
was examined (see Materials and Methods). In transiently transfected
C3H10T1/2 fibroblasts, MyoD S200A exhibited a modest but significant
increase in reporter transactivation compared to wild-type MyoD (Fig.
3). All six mutant MyoD proteins were at
least as effective as wild-type MyoD at activating transcription from
this promoter. These results indicate that the phosphorylation event
abolished by the MyoD S200A mutant protein increases MyoD
transactivating activity. Interestingly, SP5-MyoD and SP6-MyoD also led
to increased 4TRTK-CAT activity, although these mutants had no obvious
effect on the abundance of the hyperphosphorylated form of MyoD.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Increased 4TRTK-CAT activity in C3H10T1/2 fibroblasts
expressing MyoD proteins containing mutations of CDK consensus
phosphorylation sites. Wild-type (WT) or mutant MyoD
expression vectors, 4TRTK-CAT, and a TK-luciferase vector were
cotransfected into C3H10T1/2 fibroblasts. Cultures were harvested
36 h posttransfection, and luciferase and CAT activities were
determined. The results are presented as percentages of the
transactivating ability of wild-type MyoD, which was arbitrarily set to
100%. Each experiment was done in duplicate, and each CAT assay
contained equivalent amounts of luciferase activity. The results
presented are means ± standard deviations of three separate
experiments.
|
|
Mutation of serine 200 to alanine causes an increase in the
half-life of MyoD.
CDK-dependent phosphorylation events have been
proposed to control protein stability (22, 25). To determine
if the SP3-MyoD mutation affected MyoD protein stability,
the half-lives of the mutant MyoD proteins were determined as described
in Materials and Methods. The half-life of wild-type MyoD in nuclear
extracts was found to be about 30 min (Fig.
4 and Table
1), which compares well with the
previously determined value of 30 to 60 min (46). The
half-life of each of the mutant MyoD proteins described above was also
determined (see Materials and Methods). The MyoD S200A mutant was found
to have a half-life of about 147 min, approximately fivefold longer
than that of the wild-type protein (Fig. 4 and Table 1). These results
indicate that one role of MyoD phosphorylation is to destabilize the
MyoD protein. Additionally, they suggest that the increased 4TRTK-CAT
transactivation in response to SP3-MyoD may be due to increased
steady-state levels of the mutant MyoD protein resulting from decreased
protein turnover. Interestingly, the SP4-MyoD and SP5-MyoD proteins
were also slightly more stable than wild-type MyoD protein (Table 1).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Increased stability of MyoD S200A. The half-lives of
nuclear wild-type MyoD and MyoD S200A were determined as described in
Materials and Methods. C3H10T1/2 fibroblasts transiently transfected
with either wild-type MyoD (WT-MyoD) (A) or MyoD S200A (B) were treated
with cycloheximide for the times indicated; nuclear extracts were
prepared and subjected to Western analysis. Identical blots were
subjected to Western analysis with anti-Cdc2 antibodies to verify
sample loading.
|
|
Requirement for components of the ubiquitin pathway in MyoD
degradation.
Short-lived proteins are often degraded by a large,
complex protease known as the 26S proteasome (11, 17). The
relatively short half-life of MyoD led us to determine whether the
degradation of MyoD might be dependent on 26S proteasome activity.
Leucyl-leucyl-norleucinal (LLnL) has been described as a potent
inhibitor of the 26S proteasome (39), and therefore the
effect of LLnL on the stability of the MyoD protein was determined. In
the presence of LLnL, wild-type MyoD protein becomes more stable
(compare Fig. 5A and B). This result
indicates that the turnover of MyoD is dependent on the function of the
26S proteasome. Further, in the presence of LLnL, there is a
preferential accumulation of the phosphorylated form of the MyoD
protein under steady-state conditions (Fig. 5C; compare lanes 2 and 3 to lane 1). A preferential accumulation of phosphorylated MyoD would be
expected if phosphorylated MyoD were the preferred substrate of the
proteasome.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 5.
The proteasome inhibitor LLnL stabilizes the
hyperphosphorylated form of MyoD. (A and B) C3H10T1/2 fibroblasts
transiently transfected with wild-type MyoD were treated with
cycloheximide for the times indicated in the absence (A) or presence
(B) of LLnL; nuclear extracts were prepared and subjected to Western
analysis. The same blots were subjected to Western analysis with
anti-Cdc2 antibodies to verify sample loading. (C) C3H10T1/2
fibroblasts transiently transfected with wild-type MyoD were not
treated (lane 1) or treated with LLnL for 1 h (lane 2) or 2 h
(lane 3) prior to harvest; nuclear extracts were prepared and subjected
to Western analysis.
|
|
Most proteins that are degraded by the 26S proteasome are first
targeted to the proteasome by the attachment of ubiquitin
(
17,
39). Consistent with this observation, MyoD protein is
ubiquitinated in vitro following the addition of purified ubiquitin
machinery components (
12). In yeast, several cell cycle
ubiquitination
events have been shown to be under the control of the
Cdc34p (Ubc3p)
ubiquitin-conjugating enzyme (
7,
10,
34).
Furthermore,
Cdc34p has also been shown to control the function of the
transcription
factors Gcn4p and Rgt1p (
21,
24). In mammalian
cells, human
Cdc34 has been proposed to serve a function analogous to
that
of its yeast counterpart (
32,
34). The prolonged
half-life
of MyoD in the presence of LLnL as well as the effects of
phosphorylation
on MyoD stability led us to consider a role for the
Cdc34 enzyme
in controlling the degradation of MyoD. This possibility
was tested
directly by examining the effect of expressing wild-type and
a
dominant-negative allele of human
CDC34
(dn
CDC34) (
2) on the
stability of MyoD. C3H10T1/2
fibroblasts were transiently transfected
with wild-type
MyoD
and either wild-type
CDC34 or dn
CDC34. Thirty-six
hours later, nuclear extracts were prepared and the steady-state
levels
of the MyoD protein were compared by Western analysis.
The steady-state
level of MyoD protein was dramatically elevated
by the presence of the
dnCdc34 protein, whereas expression of
wild-type
CDC34 had
no obvious effect on MyoD levels (Fig.
6A;
compare lanes 3 and 4). The effect of
dnCdc34 protein was not
due to differential expression of the
dominant-negative and wild-type
Cdc34 proteins, as both forms of Cdc34
were efficiently produced
in the C3H10T1/2 fibroblasts (Fig.
6).
Interestingly, the levels
of Cdc34 were high in the nuclear extracts
(Fig.
6) and low in
the cytoplasm (data not shown), indicating that the
subcellular
location of Cdc34 is also consistent with a role for Cdc34
in
MyoD degradation. These results indicate that the rapid degradation
of nuclear MyoD is controlled by Cdc34 ubiquitin-conjugating activity.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of a dnCDC34 stabilizes MyoD.
C3H10T1/2 fibroblasts were transiently transfected with
MyoD, CDC34, or both; nuclear extracts were
prepared and subjected to Western analysis as described for Fig. 5. (A)
Western analysis of nuclear extracts prepared from cells transfected
with the indicated plasmids and incubated in the presence of anti-MyoD.
Lanes: 1, pCB6+; 2, pCB6+ and wild-type MyoD; 3, wild-type
MyoD and wild-type CDC34; 4, wild-type
MyoD and dnCDC34. (B) Western analysis of the
samples described for panel A, incubated with anti-Cdc34.
|
|
 |
DISCUSSION |
We demonstrate here that serine residue 200, located within a CDK
consensus phosphorylation site in the MyoD protein, is required for the
formation of a specific phosphorylated form of MyoD, often referred to
as hyperphosphorylated MyoD. When serine 200 is changed to an alanine,
the hyperphosphorylated form of MyoD is absent. Mutations that
eliminate other potential CDK phosphorylation sites do not affect the
presence of hyperphosphorylated MyoD. While we do not know the nature
of the protein kinase responsible for MyoD phosphorylation, we can
propose several possible candidates based on the function of MyoD as a
transcription factor with roles in differentiation and cell cycle
progression. One possibility is that MyoD is a substrate of Cdc2, Cdk2,
or Cdk4 complexes that control progression through the cell cycle. Such
a phosphorylation event might regulate the cell cycle-inhibitory
effects of MyoD. In fact, increasing the levels of cyclin D1 resulted
in an elevation of the hyperphosphorylated form of MyoD as well as
inhibition of terminal myogenic differentiation (35, 42).
However, Cdk4-cyclin D complexes have not been shown to phosphorylate
MyoD. An alternative model is that CDKs associated with the
transcriptional machinery, Cdk7, Cdk8, and Cdk9, modify MyoD. These
kinases and their associated cyclin subunits have been proposed to
regulate transcriptional elongation (for a review, see reference
19). In this instance, transcriptional elongation
may be regulated by a process that requires the modification and
subsequent elimination of transcription factors like MyoD. Under these
conditions, MyoD would be required for initiation of transcription, and
its targeted degradation would be required for processivity of the
transcriptional machinery along the transcribed gene (elongation).
When the half-lives of wild-type and the various mutant MyoD proteins
were determined, the S200A change was found to dramatically alter the
half-life of MyoD. MyoD S200A has a half-life (147 min) about five
times longer than that of wild-type MyoD (30 min). The increased
stability of MyoD S200A is likely to be responsible for the increased
4TRTK-CAT activity detected in C3H10T1/2 fibroblasts overexpressing
MyoD S200A compared to wild-type MyoD. In contrast, removal of the
other potential CDK sites had a much more modest effect on the MyoD
half-life. The 30-min half-life was determined for nuclear MyoD.
Whether the MyoD present in the cytoplasm has the same half-life is not
clear. These results suggest that phosphorylation of MyoD at serine 200 is a prerequisite for MyoD degradation.
Most short-lived proteins in the cell are targeted for degradation by
ubiquitin modification (11, 17). Ubiquitination of many
proteins leads to their destruction via the 26S proteasome. Indeed,
wild-type MyoD protein is a short-lived protein. The steady-state level
of wild-type MyoD protein is increased in the presence of the LLnL, a
proteasome inhibitor (39), which suggests that inhibition of
proteasome activity stabilizes MyoD. Interestingly, in the presence of
LLnL, there is a preferential increase in the amount of
hyperphosphorylated MyoD, as would be expected if the
hyperphosphorylated form of MyoD is the actual target of the
proteasome. Recently, Horwitz (18) described a myoblast cell
line in which nuclear MyoD had become unstable and the cells had lost
the ability to differentiate into myotubes. These studies point to a
relationship between MyoD activity and the stability of the MyoD
protein.
In this study, we have demonstrated that expression of a
dominant-negative allele of human CDC34 leads to the
accumulation of the MyoD protein. While expression of a dnCdc34 protein
may indirectly perturb the ubiquitination machinery, we favor the possibility that the Cdc34 protein is directly involved in the destruction of MyoD. The Cdc34 protein was first identified in yeast as
a regulator of the G1-to-S phase transition
(10). It is a member of the family of ubiquitin-conjugating
enzymes that can catalyze the addition of ubiquitin to other protein
substrates. A characteristic of Cdc34 substrates in yeast is that they
must first be phosphorylated by Cdc28-cyclin complexes (8, 16, 22,
43, 51). In mammals, Cdc34 has been invoked to destabilize p27Kip1 and therefore is a likely regulator of the
G1-to-S phase transition (32). Furthermore,
human Cdc34 is a predominantly nuclear protein (our results and
reference 26). MyoD can be ubiquitinated in vitro
(12), and its half-life is controlled by phosphorylation through a potential CDK site. Therefore, we propose that
phosphorylation of nuclear MyoD leads to its Cdc34-dependent
ubiquitination, thus targeting MyoD for destruction via the 26S
proteasome.
The potential control of MyoD levels through CDK
phosphorylation-dependent ubiquitination suggests a mechanism for
coordinating transcription events during the G1-to-S phase
progression in myoblasts. At least two other proteins associated with
the transcriptional machinery, p53 and Rb, are substrates of CDKs as
well as potential substrates of Cdc34. The stability of the p53 protein
also appears to be controlled by CDK-dependent phosphorylation at a
site, SSSPQPKKK, very similar to that found in MyoD, ASSPRSN
(25). Recently, Connell-Crowley et al. (4)
reported that phosphorylation of a similar site in Rb, PSSPLRI, is
critical to the inactivation of the Rb protein (see also reference
20). Therefore, depending on cellular growth status,
or potentially as a mechanism to enhance transcriptional elongation,
the activities of MyoD, Rb, and p53 may be coordinately activated or
alternatively eliminated by CDK-dependent phosphorylation. A role for
phosphorylation in targeting a regulatory protein for degradation has
been postulated in a number of cases, including p27Kip1 and
B-lymphocyte-specific Rag2 (25, 31, 41, 49). In fact, one
could speculate that the activities of unrelated cellular events are
coordinated by the regulated degradation of several proteins
simultaneously.
 |
ACKNOWLEDGMENTS |
A.S. and Q.W. contributed equally to this work.
We acknowledge the National Institutes of Health (grants GM43792 and
GM45460), the Indiana Affiliate of the American Heart Association, and
the Diabetes Research and Training Center for financial support. M.A.H.
is a Scholar of the Leukemia Society of America.
We thank Peter A. Jones and Sharon Plon for their insightful comments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, Indiana University School of
Medicine, 635 Barnhill Dr., Indianapolis, IN 46202. Phone: (317)
274-7527. Fax: (317) 274-7592. E-mail:
maureen_harrington{at}iucc.iupui.edu.
Present address: Department of Pediatrics, Stanford University
Medical Center, Stanford, CA 94305-5119.
 |
REFERENCES |
| 1.
|
Andrews, N. C., and D. V. Faller.
1991.
A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells.
Nucleic Acids Res.
19:2499[Free Full Text].
|
| 2.
|
Banerjee, A.,
R. J. Deshaies, and V. Chau.
1995.
Characterization of a dominant negative mutant of the cell cycle ubiquitin-conjugating enzyme Cdc34.
J. Biol. Chem.
270:26209-26215[Abstract/Free Full Text].
|
| 3.
|
Cobrinik, D.
1996.
Regulatory interactions among E2Fs and cell cycle control proteins.
Curr. Top. Microbiol. Immunol.
208:32-59.
|
| 4.
|
Connell-Crowley, L.,
J. W. Harper, and D. W. Goodrich.
1997.
Cyclin D1/Cdk4 regulates retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation.
Mol. Biol. Cell
8:287-301[Abstract].
|
| 5.
|
Crescenzi, M.,
T. P. Fleming,
A. B. Lassar,
H. Weintraub, and S. A. Aaronson.
1990.
MyoD induces growth arrest independent of differentiation in normal and transformed cells.
Proc. Natl. Acad. Sci. USA
87:8442-8446[Abstract/Free Full Text].
|
| 6.
|
Davis, R. L.,
H. Weintraub, and A. Lassar.
1987.
Expression of a single transfected cDNA converts fibroblasts to myoblasts.
Cell
51:987-1000[Medline].
|
| 7.
|
Deshaies, R. J.,
V. Chau, and M. Kirschner.
1995.
Ubiquitination of the G1 cyclin Cln2p by a Cdc34p-dependent pathway.
EMBO J.
14:303-312[Medline].
|
| 8.
|
Feldman, R. M. R.,
C. C. Correll,
K. B. Kaplan, and R. J. Deshaies.
1997.
A complex of Cdc4p, Skp1p, and Cdc53p/Cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p.
Cell
91:221-230[Medline].
|
| 9.
|
Goebl, M. G.,
L. Goetsch, and B. Byers.
1994.
The Ubc3 (Cdc34) ubiquitin-conjugating enzyme is ubiquitinated and phosphorylated in vivo.
Mol. Cell. Biol.
14:3022-3029[Abstract/Free Full Text].
|
| 10.
|
Goebl, M. G.,
J. Yochem,
S. Jentsch,
J. P. McGrath,
A. Varshavsky, and B. Byers.
1988.
The yeast cell cycle gene CDC34 encodes a ubiquitin-conjugating enzyme.
Science
241:1331-1335[Abstract/Free Full Text].
|
| 11.
|
Goldberg, A. L.
1995.
Functions of the proteasome: the lysis at the end of the tunnel.
Science
268:522-523[Free Full Text].
|
| 12.
|
Gonen, H.,
I. Stancovski,
D. Shkedy,
T. Hadari,
B. Bercovich,
E. Bengal,
S. Mesilat,
O. Abu-Hatoum,
A. L. Schwartz, and A. Ciechanover.
1996.
Isolation, characterization, and partial purification of a novel ubiquitin-protein ligase, E3.
J. Biol. Chem.
271:302-310[Abstract/Free Full Text].
|
| 13.
|
Gu, W.,
J. W. Schneider,
G. Condorelli,
S. Kaushal,
V. Mahdavi, and B. Nadal-Ginard.
1993.
Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation.
Cell
72:309-324[Medline].
|
| 14.
|
Halevy, O.,
B. G. Novitch,
D. B. Spicer,
S. X. Skapek,
J. Rhee,
G. J. Hannon,
D. Beach, and A. B. Lassar.
1995.
Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD.
Science
267:1018-1021[Abstract/Free Full Text].
|
| 15.
|
Harrington, M. A.,
B. Konicek,
A. Song,
X. L. Xia,
W. J. Fredericks, and F. J. Rauscher, III.
1993.
Inhibition of colony-stimulating factor-1 promoter activity by the product of the Wilms' tumor locus.
J. Biol. Chem.
268:21271-21275[Abstract/Free Full Text].
|
| 16.
|
Henchoz, S.,
Y. Chi,
B. Catarin,
I. Herskowitz,
R. J. Deshaies, and M. Peter.
1997.
Phosphorylation- and ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor Far1p in budding yeast.
Genes Dev.
11:3046-3060[Abstract/Free Full Text].
|
| 17.
|
Hochstrasser, M.
1995.
Ubiquitin, proteasomes, and the regulation of intracellular protein degradation.
Curr. Opin. Cell Biol.
7:215-223[Medline].
|
| 18.
|
Horwitz, M.
1996.
Hypermethylated myoblasts specifically deficient in MyoD autoactivation as a consequence of instability of MyoD.
Exp. Cell Res.
226:170-182[Medline].
|
| 19.
|
Jones, K. A.
1997.
Taking a new TAK on Tat transactivation.
Genes Dev.
11:2593-2599[Free Full Text].
|
| 20.
|
Kato, J.,
H. Matsushime,
S. W. Hiebert,
M. E. Ewen, and C. J. Sherr.
1993.
Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4.
Genes Dev.
7:331-342[Free Full Text].
|
| 21.
|
Kornitzer, D.,
B. Raboy,
R. G. Kulka, and G. R. Fink.
1994.
Regulated degradation of the transcription factor Gcn4.
EMBO J.
13:6021-6030[Medline].
|
| 22.
|
Lanker, S.,
M. H. Valdivieso, and C. Wittenberg.
1996.
Rapid degradation of the G1 cyclin Cln2 induced by CDK-dependent phosphorylation.
Science
271:1597-1601[Abstract].
|
| 23.
|
Lassar, A. B.,
J. N. Buskin,
D. Lockshon,
S. Apone,
S. D. Hauschka, and H. Weintraub.
1989.
MyoD is a sequence-specific DNA binding protein requiring a region of myc homology to bind to the muscle creatine kinase promoter.
Cell
58:823-831[Medline].
|
| 24.
|
Li, F. N., and M. Johnston.
1997.
Grr1 of Saccharomyces cerevisiae is connected to the ubiquitin proteolysis machinery through Skp1: coupling glucose sensing to gene expression and the cell cycle.
EMBO J.
16:5629-5638[Medline].
|
| 25.
|
Lin, W.-C., and S. Desiderio.
1993.
Regulation of V(D)J recombination activator protein RAG-2 by phosphorylation.
Science
260:953-959[Abstract/Free Full Text].
|
| 26.
|
Lisztwan, J.,
A. Marti,
H. Sutterluty,
M. Gstaiger,
C. Wirbelauer, and W. Krek.
1998.
Association of human CUL-1 and ubiquitin-conjugating enzyme CDC34 with the F-box protein p45SKP2: evidence for evolutionary conservation in the subunit composition of the CDC34-SCF pathway.
EMBO J.
17:368-383[Medline].
|
| 27.
|
Ludolph, D. C., and S. F. Konieczny.
1995.
Transcription factor families: muscling in on the myogenic program.
FASEB J.
9:1595-1604[Abstract].
|
| 28.
|
Madden, S. L.,
D. M. Cook,
J. F. Morris,
A. Gashler,
V. P. Sukhatme, and F. J. Rauscher, III.
1991.
Transcriptional repression mediated by the WT1 Wilm's tumor gene product.
Science
253:1550-1553[Abstract/Free Full Text].
|
| 29.
|
Megeney, L. A.,
B. Kablar,
K. Garrett,
J. E. Anderson, and M. A. Rudnicki.
1996.
MyoD is required for myogenic stem cell function in adult skeletal muscle.
Genes Dev.
10:1173-1183[Abstract/Free Full Text].
|
| 30.
|
Moreno, S., and P. Nurse.
1990.
Substrates for p34cdc2: in vivo veritas?
Cell
61:549-551[Medline].
|
| 31.
|
Morisaki, H.,
A. Fujimoto,
A. Ando,
Y. Nagata,
K. Ikeda, and M. Nakanishi.
1997.
Cell cycle-dependent phosphorylation of p27 cyclin-dependent kinase inhibitor by cyclin E/CDK2.
Biochem. Biophys. Res. Commun.
240:386-390[Medline].
|
| 32.
|
Pagano, M.,
S. W. Tam,
A. M. Theodoras,
P. Beer-Romero,
G. Dell Sal,
V. Chau,
P. R. Yew,
G. R. Draetta, and M. Rolfe.
1995.
Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27.
Science
269:682-685[Abstract/Free Full Text].
|
| 33.
|
Parker, S. B.,
G. Eichele,
P. Zhang,
A. Rawls,
A. T. Sands,
A. Bradley,
E. N. Olson,
J. W. Harper, and S. J. Elledge.
1995.
p53-independent expression of p21Cip1 in muscle and other terminally differentiating cells.
Science
267:1024-1027[Abstract/Free Full Text].
|
| 34.
|
Plon, S. E.,
K. A. Leppig,
H.-N. Do, and M. Groudine.
1993.
Cloning of the human homolog of the CDC34 cell cycle gene by complementation in yeast.
Proc. Natl. Acad. Sci. USA
90:10484-10488[Abstract/Free Full Text].
|
| 35.
|
Rao, S. S.,
C. Chu, and D. S. Kohtz.
1994.
Ectopic expression of cyclin D1 prevents activation of gene transcription by myogenic basic helix-loop-helix regulators.
Mol. Cell. Biol.
14:5259-5267[Abstract/Free Full Text].
|
| 36.
|
Rudnicki, M. A.,
T. Braun,
S. Hinuma, and R. Jaenisch.
1992.
Inactivation of MyoD in mice leads to up-regulation of the myogenic HLH gene Myf-5 and results in apparently normal muscle development.
Cell
71:383-390[Medline].
|
| 37.
|
Rudnicki, M. A.,
P. N. J. Schnegelsberg,
R. H. Stead,
T. Braun,
H.-H. Arnold, and R. Jaenisch.
1993.
MyoD or Myf-5 is required for the formation of skeletal muscle.
Cell
75:1351-1359[Medline].
|
| 38.
|
Sambrook, J. E.,
F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 39.
|
Seemüller, E.,
A. Lupas,
D. Stock,
J. Löwe,
R. Huber, and W. Baumeister.
1995.
Proteasome from Thermoplasma acidophilum: a threonine protease.
Science
268:579-582[Abstract/Free Full Text].
|
| 40.
|
Segel, I. H.
1976.
p376. Biochemical calculations, 2nd ed.
John Wiley & Sons, New York, N.Y.
|
| 41.
|
Sheaff, R. J.,
M. Groudine,
M. Gordon,
J. M. Roberts, and B. E. Clurman.
1997.
Cyclin E-CDK2 is a regulator of p27Kip1.
Genes Dev.
11:1464-1478[Abstract/Free Full Text].
|
| 42.
|
Skapek, S. X.,
J. Rhee,
D. B. Spicer, and A. B. Lassar.
1995.
Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase.
Science
267:1022-1024[Abstract/Free Full Text].
|
| 43.
|
Skowyra, D.,
K. L. Craig,
M. Tyers,
S. J. Elledge, and J. W. Harper.
1997.
F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex.
Cell
91:209-219[Medline].
|
| 44.
|
Slansky, J. E., and P. J. Farnham.
1996.
Introduction to the E2F family: protein structure and gene regulation.
Curr. Top. Microbiol. Immunol.
208:1-31[Medline].
|
| 45.
|
Sorrentino, V.,
R. Pepperkok,
R. L. Davis,
W. Ansorge, and L. Philipson.
1990.
Cell proliferation inhibited by MyoD independently of myogenic differentiation.
Nature (London)
345:813-815[Medline].
|
| 46.
|
Thayer, M. J.,
S. J. Tapscott,
R. L. Davis,
W. E. Wright,
A. B. Lassar, and H. Weintraub.
1989.
Positive autoregulation of the myogenic determination gene MyoD.
Cell
58:241-248[Medline].
|
| 47.
|
Thorburn, A. M.,
P. A. Walton, and J. R. Feramisco.
1993.
MyoD induced cell cycle arrest is associated with increased nuclear affinity of the Rb protein.
Mol. Biol. Cell
4:705-713[Abstract].
|
| 48.
|
Venuti, J. M., and P. Cserjesi.
1996.
Molecular embryology of skeletal myogenesis.
Curr. Top. Dev. Biol.
34:169-206[Medline].
|
| 49.
|
Vlach, J.,
S. Hennecke, and B. Amati.
1997.
Phosphorylation-dependent degradation of the cyclin-dependent kinase inhibitor p27Kip1.
EMBO J.
16:5334-5344[Medline].
|
| 50.
|
Weintraub, H.,
R. Davis,
S. Tapscott,
M. Thayer,
M. Krause,
R. Benezra,
T. K. Blackwell,
D. Turner,
S. Hollenberg,
Y. Zhuang, and A. Lassar.
1991.
The MyoD family: nodal point during specification of the muscle cell lineage.
Science
251:761-766[Abstract/Free Full Text].
|
| 51.
|
Willems, A. R.,
S. Lanker,
E. E. Patton,
K. L. Craig,
T. F. Nason,
N. Mathias,
R. Kobayashi,
C. Wittenberg, and M. Tyers.
1996.
Cdc53 targets phosphorylated G1 cyclins for degradation by the ubiquitin proteolytic pathway.
Cell
62:453-463.
|
Molecular and Cellular Biology, September 1998, p. 4994-4999, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sadeh, R., Breitschopf, K., Bercovich, B., Zoabi, M., Kravtsova-Ivantsiv, Y., Kornitzer, D., Schwartz, A., Ciechanover, A.
(2008). The N-terminal domain of MyoD is necessary and sufficient for its nuclear localization-dependent degradation by the ubiquitin system. Proc. Natl. Acad. Sci. USA
105: 15690-15695
[Abstract]
[Full Text]
-
Yablonka-Reuveni, Z., Day, K., Vine, A., Shefer, G.
(2008). Defining the transcriptional signature of skeletal muscle stem cells. J ANIM SCI
86: E207-E216
[Abstract]
[Full Text]
-
Hou, T., Ray, S., Brasier, A. R.
(2007). The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression. J. Biol. Chem.
282: 37091-37102
[Abstract]
[Full Text]
-
Lamour, V., Detry, C., Sanchez, C., Henrotin, Y., Castronovo, V., Bellahcene, A.
(2007). Runx2- and Histone Deacetylase 3-mediated Repression Is Relieved in Differentiating Human Osteoblast Cells to Allow High Bone Sialoprotein Expression. J. Biol. Chem.
282: 36240-36249
[Abstract]
[Full Text]
-
Ekmark, M., Rana, Z. A., Stewart, G., Hardie, D. G., Gundersen, K.
(2007). De-phosphorylation of MyoD is linking nerve-evoked activity to fast myosin heavy chain expression in rodent adult skeletal muscle. J. Physiol.
584: 637-650
[Abstract]
[Full Text]
-
Olguin, H. C., Yang, Z., Tapscott, S. J., Olwin, B. B.
(2007). Reciprocal inhibition between Pax7 and muscle regulatory factors modulates myogenic cell fate determination. JCB
177: 769-779
[Abstract]
[Full Text]
-
Shiraishi, S., Zhou, C., Aoki, T., Sato, N., Chiba, T., Tanaka, K., Yoshida, S., Nabeshima, Y., Nabeshima, Y.-i., Tamura, T.-a.
(2007). TBP-interacting Protein 120B (TIP120B)/Cullin-associated and Neddylation-dissociated 2 (CAND2) Inhibits SCF-dependent Ubiquitination of Myogenin and Accelerates Myogenic Differentiation. J. Biol. Chem.
282: 9017-9028
[Abstract]
[Full Text]
-
Shen, R., Wang, X., Drissi, H., Liu, F., O'Keefe, R. J., Chen, D.
(2006). Cyclin D1-Cdk4 Induce Runx2 Ubiquitination and Degradation. J. Biol. Chem.
281: 16347-16353
[Abstract]
[Full Text]
-
Dogra, C., Changotra, H., Mohan, S., Kumar, A.
(2006). Tumor Necrosis Factor-like Weak Inducer of Apoptosis Inhibits Skeletal Myogenesis through Sustained Activation of Nuclear Factor-{kappa}B and Degradation of MyoD Protein. J. Biol. Chem.
281: 10327-10336
[Abstract]
[Full Text]
-
Sun, L., Trausch-Azar, J. S., Ciechanover, A., Schwartz, A. L.
(2005). Ubiquitin-Proteasome-mediated Degradation, Intracellular Localization, and Protein Synthesis of MyoD and Id1 during Muscle Differentiation. J. Biol. Chem.
280: 26448-26456
[Abstract]
[Full Text]
-
Ma, K., Chan, J. K. L., Zhu, G., Wu, Z.
(2005). Myocyte Enhancer Factor 2 Acetylation by p300 Enhances Its DNA Binding Activity, Transcriptional Activity, and Myogenic Differentiation. Mol. Cell. Biol.
25: 3575-3582
[Abstract]
[Full Text]
-
Messina, G., Blasi, C., La Rocca, S. A., Pompili, M., Calconi, A., Grossi, M.
(2005). p27Kip1 Acts Downstream of N-Cadherin-mediated Cell Adhesion to Promote Myogenesis beyond Cell Cycle Regulation. Mol. Biol. Cell
16: 1469-1480
[Abstract]
[Full Text]
-
Tintignac, L. A., Lagirand, J., Batonnet, S., Sirri, V., Leibovitch, M. P., Leibovitch, S. A.
(2005). Degradation of MyoD Mediated by the SCF (MAFbx) Ubiquitin Ligase. J. Biol. Chem.
280: 2847-2856
[Abstract]
[Full Text]
-
Vinals, F., Ventura, F.
(2004). Myogenin Protein Stability Is Decreased by BMP-2 through a Mechanism Implicating Id1. J. Biol. Chem.
279: 45766-45772
[Abstract]
[Full Text]
-
Ishido, M., Kami, K., Masuhara, M.
(2004). In vivo expression patterns of MyoD, p21, and Rb proteins in myonuclei and satellite cells of denervated rat skeletal muscle. Am. J. Physiol. Cell Physiol.
287: C484-C493
[Abstract]
[Full Text]
-
Penrose, K. J., Garcia-Alai, M., de Prat-Gay, G., McBride, A. A.
(2004). Casein Kinase II Phosphorylation-induced Conformational Switch Triggers Degradation of the Papillomavirus E2 Protein. J. Biol. Chem.
279: 22430-22439
[Abstract]
[Full Text]
-
Di Carlo, A., De Mori, R., Martelli, F., Pompilio, G., Capogrossi, M. C., Germani, A.
(2004). Hypoxia Inhibits Myogenic Differentiation through Accelerated MyoD Degradation. J. Biol. Chem.
279: 16332-16338
[Abstract]
[Full Text]
-
Tintignac, L. A. J., Sirri, V., Leibovitch, M. P., Lecluse, Y., Castedo, M., Metivier, D., Kroemer, G., Leibovitch, S. A.
(2004). Mutant MyoD Lacking Cdc2 Phosphorylation Sites Delays M-Phase Entry. Mol. Cell. Biol.
24: 1809-1821
[Abstract]
[Full Text]
-
Batonnet, S., Leibovitch, M. P., Tintignac, L., Leibovitch, S. A.
(2004). Critical Role for Lysine 133 in the Nuclear Ubiquitin-mediated Degradation of MyoD. J. Biol. Chem.
279: 5413-5420
[Abstract]
[Full Text]
-
LANGEN, R. C. J., VAN DER VELDEN, J. L. J., SCHOLS, A. M. W. J., KELDERS, M. C. J. M., WOUTERS, E. F. M., JANSSEN-HEININGER, Y. M. W.
(2004). Tumor necrosis factor-alpha inhibits myogenic differentiation through MyoD protein destabilization. FASEB J.
18: 227-237
[Abstract]
[Full Text]
-
Vernon, A. E., Philpott, A.
(2003). A single cdk inhibitor, p27Xic1, functions beyond cell cycle regulation to promote muscle differentiation in Xenopus. Development
130: 71-83
[Abstract]
[Full Text]
-
Amack, J. D., Reagan, S. R., Mahadevan, M. S.
(2002). Mutant DMPK 3'-UTR transcripts disrupt C2C12 myogenic differentiation by compromising MyoD. JCB
159: 419-429
[Abstract]
[Full Text]
-
Wyzykowski, J. C., Winata, T. I., Mitin, N., Taparowsky, E. J., Konieczny, S. F.
(2002). Identification of Novel MyoD Gene Targets in Proliferating Myogenic Stem Cells. Mol. Cell. Biol.
22: 6199-6208
[Abstract]
[Full Text]
-
Park, K. C., Kim, J. H., Choi, E.-J., Min, S. W., Rhee, S., Baek, S. H., Chung, S. S., Bang, O., Park, D., Chiba, T., Tanaka, K., Chung, C. H.
(2002). Antagonistic regulation of myogenesis by two deubiquitinating enzymes, UBP45 and UBP69. Proc. Natl. Acad. Sci. USA
99: 9733-9738
[Abstract]
[Full Text]
-
Szewczyk, N. J., Peterson, B. K., Jacobson, L. A.
(2002). Activation of Ras and the Mitogen-Activated Protein Kinase Pathway Promotes Protein Degradation in Muscle Cells of Caenorhabditis elegans. Mol. Cell. Biol.
22: 4181-4188
[Abstract]
[Full Text]
-
Tang, T., Arbiser, J. L., Brandt, S. J.
(2002). Phosphorylation by Mitogen-activated Protein Kinase Mediates the Hypoxia-induced Turnover of the TAL1/SCL Transcription Factor in Endothelial Cells. J. Biol. Chem.
277: 18365-18372
[Abstract]
[Full Text]
-
Macpherson, P., Kostrominova, T., Tang, H., Goldman, D.
(2002). Protein Kinase C and Calcium/Calmodulin-activated Protein Kinase II (CaMK II) Suppress Nicotinic Acetylcholine Receptor Gene Expression in Mammalian Muscle. A SPECIFIC ROLE FOR CaMK II IN ACTIVITY-DEPENDENT GENE EXPRESSION. J. Biol. Chem.
277: 15638-15646
[Abstract]
[Full Text]
-
Sriuranpong, V., Borges, M. W., Strock, C. L., Nakakura, E. K., Watkins, D. N., Blaumueller, C. M., Nelkin, B. D., Ball, D. W.
(2002). Notch Signaling Induces Rapid Degradation of Achaete-Scute Homolog 1. Mol. Cell. Biol.
22: 3129-3139
[Abstract]
[Full Text]
-
Riou, P., Vandromme, M., Gazzolo, L.
(2001). Human T-Cell Leukemia Virus Type 1 Tax Protein Inhibits the Expression of the Basic Helix-Loop-Helix Transcription Factor MyoD in Muscle Cells: Maintenance of Proliferation and Repression of Differentiation. Cell Growth Differ.
12: 613-622
[Abstract]
[Full Text]
-
Polson, A. G., Huang, L., Lukac, D. M., Blethrow, J. D., Morgan, D. O., Burlingame, A. L., Ganem, D.
(2001). Kaposi's Sarcoma-Associated Herpesvirus K-bZIP Protein Is Phosphorylated by Cyclin-Dependent Kinases. J. Virol.
75: 3175-3184
[Abstract]
[Full Text]
-
Lindon, C., Albagli, O., Domeyne, P., Montarras, D., Pinset, C.
(2000). Constitutive Instability of Muscle Regulatory Factor Myf5 Is Distinct from Its Mitosis-Specific Disappearance, Which Requires a D-Box-Like Motif Overlapping the Basic Domain. Mol. Cell. Biol.
20: 8923-8932
[Abstract]
[Full Text]
-
Liu, C.-j., Wang, H., Zhao, Z., Yu, S., Lu, Y.-b., Meyer, J., Chatterjee, G., Deschamps, S., Roe, B. A., Lengyel, P.
(2000). MyoD-Dependent Induction during Myoblast Differentiation of p204, a Protein Also Inducible by Interferon. Mol. Cell. Biol.
20: 7024-7036
[Abstract]
[Full Text]
-
Roberts, B. J., Whitelaw, M. L.
(1999). Degradation of the Basic Helix-Loop-Helix/Per-ARNT-Sim Homology Domain Dioxin Receptor Via the Ubiquitin/Proteasome Pathway. J. Biol. Chem.
274: 36351-36356
[Abstract]
[Full Text]
-
Reynaud, E. G., Pelpel, K., Guillier, M., Leibovitch, M. P., Leibovitch, S. A.
(1999). p57Kip2 Stabilizes the MyoD Protein by Inhibiting Cyclin E-Cdk2 Kinase Activity in Growing Myoblasts. Mol. Cell. Biol.
19: 7621-7629
[Abstract]
[Full Text]
-
Alarid, E. T., Bakopoulos, N., Solodin, N.
(1999). Proteasome-Mediated Proteolysis of Estrogen Receptor: A Novel Component in Autologous Down-Regulation. Mol. Endocrinol.
13: 1522-1534
[Abstract]
[Full Text]
-
Pati, D., Meistrich, M. L., Plon, S. E.
(1999). Human Cdc34 and Rad6B Ubiquitin-Conjugating Enzymes Target Repressors of Cyclic AMP-Induced Transcription for Proteolysis. Mol. Cell. Biol.
19: 5001-5013
[Abstract]
[Full Text]
-
Fujio, Y., Guo, K., Mano, T., Mitsuuchi, Y., Testa, J. R., Walsh, K.
(1999). Cell Cycle Withdrawal Promotes Myogenic Induction of Akt, a Positive Modulator of Myocyte Survival. Mol. Cell. Biol.
19: 5073-5082
[Abstract]
[Full Text]
-
Gonen, H., Bercovich, B., Orian, A., Carrano, A., Takizawa, C., Yamanaka, K., Pagano, M., Iwai, K., Ciechanover, A.
(1999). Identification of the Ubiquitin Carrier Proteins, E2s, Involved in Signal-induced Conjugation and Subsequent Degradation of Ikappa Balpha. J. Biol. Chem.
274: 14823-14830
[Abstract]
[Full Text]
-
Kitzmann, M., Vandromme, M., Schaeffer, V., Carnac, G., Labbe, J.-C., Lamb, N., Fernandez, A.
(1999). cdk1- and cdk2-Mediated Phosphorylation of MyoD Ser200 in Growing C2 Myoblasts: Role in Modulating MyoD Half-Life and Myogenic Activity. Mol. Cell. Biol.
19: 3167-3176
[Abstract]
[Full Text]
-
Floyd, Z. E., Trausch-Azar, J. S., Reinstein, E., Ciechanover, A., Schwartz, A. L.
(2001). The Nuclear Ubiquitin-Proteasome System Degrades MyoD. J. Biol. Chem.
276: 22468-22475
[Abstract]
[Full Text]
-
Block, K., Boyer, T. G., Yew, P. R.
(2001). Phosphorylation of the Human Ubiquitin-conjugating Enzyme, CDC34, by Casein Kinase 2. J. Biol. Chem.
276: 41049-41058
[Abstract]
[Full Text]
-
Reynaud, E. G., Leibovitch, M. P., Tintignac, L. A. J., Pelpel, K., Guillier, M., Leibovitch, S. A.
(2000). Stabilization of MyoD by Direct Binding to p57Kip2. J. Biol. Chem.
275: 18767-18776
[Abstract]
[Full Text]