Previous Article | Next Article ![]()
Molecular and Cellular Biology, September 1998, p. 5021-5031, Vol. 18, No. 9
Department of Genetics and Microbiology,
University of Geneva Medical School (CMU), CH1211 Geneva,
Switzerland
Received 9 February 1998/Returned for modification 24 March
1998/Accepted 25 May 1998
The Sendai virus P/C mRNA expresses eight primary translation
products by using a combination of ribosomal choice and
cotranscriptional mRNA editing. The longest open reading frame (ORF) of
the mRNA starts at AUG104 (the second initiation site) and
encodes the 568-amino-acid P protein, an essential subunit of the viral
polymerase. The first (ACG81), third (ATG114),
fourth (ATG183), and fifth (ATG201) initiation
sites are used to express a C-terminal nested set of polypeptides
(collectively named the C proteins) in the +1 ORF
relative to P, namely, C', C, Y1, and Y2, respectively. Leaky scanning accounts for translational initiation at the first three start
sites (a non-ATG followed by ATGs in progressively stronger contexts).
Consistent with this, changing ACG81/C' to ATG
(GCCATG81G) abrogates expression from the
downstream ATG104/P and ATG114/C initiation
codons. However, expression of the Y1 and Y2 proteins remains normal in
this background. We now have evidence that initiation from
ATG183/Y1 and ATG201/Y2 takes place via a
ribosomal shunt or discontinuous scanning. Scanning complexes appear to
assemble at the 5' cap and then scan ca. 50 nucleotides (nt) of the 5'
untranslated region before being translocated to an acceptor site at or
close to the Y initiation codons. No specific donor site sequences are
required, and translation of the Y proteins continues even when
their start codons are changed to ACG. Curiously,
ATG codons (in good contexts) in the P ORF, placed either 16 nt
upstream of Y1, 29 nt downstream of Y2, or between the Y1 and
Y2 codons, are not expressed even in the
ACGY1/ACGY2 background. This indicates that
ATG183/Y1 and ATG201/Y2 are privileged start
sites within the acceptor site. Our observations suggest that the shunt
delivers the scanning complex directly to the Y start codons.
The vast majority of eukaryotic
mRNAs are monocistronic and express a single open reading frame (ORF)
which initiates from the ATG codon nearest the capped 5' end. This
initiation site is chosen by a scanning mechanism in which initiation
factors, 40S ribosomal subunits, and initiator Met-tRNA bind to the
capped 5' end of the mRNA and linearly scan the nucleotide sequence for the first start codon (the 5' scanning model; for a review, see reference 29). Some eukaryotic viral mRNAs, like the
Sendai virus (SeV) P/C mRNA, however, express two ORFs which overlap (Fig. 1). Such mRNAs therefore also
initiate proteins at start codons which are not 5' proximal. To
account for initiation on these bicistronic mRNAs, a modified scanning
model which allows for leaky scanning, i.e., scanning in which the
scanning complex can bypass the first start codon to some extent
when it is not in an optimal context for initiation and thereby can
initiate at a downstream start codon, was proposed (23).
This model followed from the realization that the nucleotide sequence
surrounding the start codon (the context) was important for the
efficiency with which ribosomes initiate protein synthesis, with the
strongest determinant for efficiency being a purine at position
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Sendai Virus Y Proteins Are Initiated by a
Ribosomal Shunt
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
3,
followed by a G at position +4.

View larger version (16K):
[in a new window]
FIG. 1.
Schematic representation of the SeV P/C mRNA. The
1,943-nt-long SeV P/C mRNA is shown as a horizontal line, with the
various ORFs as boxes. The P ORF is shown as a shaded box, the C ORF
(position +1 relative to P, encoding the C', C, Y1, and Y2 proteins) is
shown as an open box, and the internal V ORF (position
1 relative to
P) is shown as a black box. The V and W proteins are generated by
cotranscriptional editing of the P/C mRNA, during which a +1 G (for V)
and +2 Gs (for W) are inserted at nucleotide position 1053. This fuses
these ORFs to the N-terminal half of P. The 81-nt 5' UTR is also
indicated. Numbers refer to nucleotide positions relative to the 5' end
of the P/C mRNA.
Eukaryotic mRNAs known to initiate proteins at two start codons are
nevertheless uncommon, and those that initiate at more than two start
codons are rare. The most extreme example of an mRNA known to
initiate proteins at multiple start sites remains the SeV P/C mRNA,
which uses five start codons located 81 to 201 nucleotides (nt)
from the 5' end and a start codon located more than 1500 nt from
the 5' end to generate eight primary translation products (C', P, C,
Y1, Y2, V, W, and X) (Fig. 1). The second start site (and 5'-proximal
ATG codon) generates three proteins (P, V, and W) containing the
same N-terminal 317 amino acids (aa) but different C-terminal regions,
as this mRNA is cotranscriptionally edited by the SeV polymerase via
the programmed insertion of zero, one, or two G residues
(45). The X protein, which represents approximately the
C-terminal 95 aa of the 568-aa-long P protein, is thought to be
initiated in a cap-dependent but scanning-independent manner
(5). The first ribosomal start site (an unusual ACG start
codon) and the third, fourth, and fifth start sites (all ATG
codons) generate a nested set of four C proteins (termed C', C, Y1,
and Y2, of 215, 204, 183, and 175 aa, respectively) with a common C
terminus, irrespective of whether the mRNA is edited (6, 18,
33). The Y proteins do not appear to be generated by proteolytic
cleavage of the C or C' protein, because a recombinant SeV which does
not express either C or C' (due to mutation of their start codons)
overexpresses the Y proteins (25a). The available evidence
suggests that whereas the first three start sites (for the C', P, and C
proteins) are accessed by leaky scanning, it is unlikely that the last
two start sites (for the Y proteins) are accessed by a mechanism
involving only linear movement of the scanning complex. For example,
the leaky-scanning model posits that when successive initiation
codons are used, they will be increasingly efficient as
start sites. However, the Y1 and Y2 start sites are in the weakest
context of the five, with neither a purine at position
3 nor a G at
position +4. Only the first, inherently weak, ACG81 start
codon is in an otherwise optimal context
(GCCACGGAT) for initiation
(2, 16). More importantly, mutation of the 5'-proximal ACG
initiation site to ATG
(GCCA81TGG; hereafter referred to as ATG81/C') increased C'
expression by as much as fivefold and eliminated initiation from the
downstream ATG104/P and ATG114/C start
codons, presumably because the very favorable context of ATG81/C' precludes any leaky scanning. Expression from
ATG183/Y1 and ATG201/Y2, in contrast, was
either normal or, in some instances, increased (6). The
continued expression of the Y proteins under these conditions suggested
that initiation from these distal start sites was scanning independent,
or discontinuous.
Some mRNAs (e.g., picornavirus and hepatitis C virus [HCV] RNAs, mammalian Bip RNA, and Drosophila antennapedia mRNA; for reviews, see references 20, 21, and 29) are thought to initiate protein synthesis by an alternate mechanism, in which preinitiation complexes bind directly to an internal ribosome entry site (IRES) without scanning from the 5' end of the mRNA. IRES-directed initiation is distinguished from that of 5' scanning by its independence of both a 5' cap group on the mRNA and the cap-binding initiation factor eIF-4E, although the other canonical initiation factors of the eIF-4F complex (namely, eIF-4A and eIF-4G) are all generally involved (32, 35, 36). Recent work, however, has found that the HCV and classical swine fever virus IRESs, which are structurally distinct from those of picornaviruses, can assemble 43S preinitiation complexes independently of these canonical eIFs as well as eIF-4E (36a).
In earlier work, we suggested that initiation of the Y proteins may occur via an IRES-like element positioned somewhere downstream of ATG114/C. However, this turned out to be unlikely for the following reasons.
(i) Y protein initiation in vitro was as sensitive to inhibition by cap analogs as that of C', P, and C.
(ii) Host protein synthesis is shut off in poliovirus-infected cells due to the selective cleavage of eIF-4G, the largest subunit of the cap-binding eIF-4F complex. However, in cells coinfected with SeV and poliovirus, Y protein synthesis was turned off as efficiently as that of C', P, and C (reference 15 and unpublished results). Initiation of the Y proteins is clearly cap dependent, both in vitro and in vivo.
(iii) The now-classical assay for identification of an IRES element is to place the prospective sequence between nonoverlapping ORFs of a bicistronic mRNA and to examine the requirement of each ORF for functional eIF-4F (22, 34). Despite repeated attempts, however, we were unable by this test to find the slightest evidence that an IRES was present near ATG183/Y1 and ATG201/Y2 of the P/C mRNA (unpublished results).
(iv) IRESs are generally found only on mRNAs with long 5' untranslated regions (UTRs) containing multiple, unused upstream ATGs, as well as highly structured regions which can act as barriers to scanning complexes. A notable exception to these rules is cellular Bip, whose translation is thought to be mediated via an IRES even though the ca. 220-nt 5' UTR contains little obvious secondary structure and no ATGs (27, 28). Likewise, there is no evidence for stable structures within the 5' end of the SeV P/C mRNA (6a, 17), and all four ATGs (and one ACG) in the 5' 201 nt of this mRNA are clearly functional.
More recently, some mRNAs have been found to initiate protein synthesis by yet another mechanism, shunting, which combines aspects of both 5' scanning and internal initiation. Here, scanning complexes enter from the capped 5' end of the mRNA but then are shunted downstream, bypassing intervening segments of the 5' UTR, which, like IRESs, include multiple unused ATGs and strong secondary structures which normally block 5' scanning (13). This shunting is promoted by a cis-acting element thought to be present within the highly structured region of the 5' UTR (the donor site), which directs the translocating scanning complex to a defined landing or acceptor site, where it resumes its decoding of the mRNA. The list of such mRNAs is still quite limited and includes the pregenome RNAs of the pararetroviruses cauliflower mosaic virus (CaMV) (13) and rice tungro bacilliform virus (RTBV) (14) and the adenovirus late mRNAs (46). This paper reports that the SeV Y proteins are initiated via a shunt which bypasses the C', P, and C protein start sites and delivers scanning complexes directly to ATG183/Y1 and ATG201/Y2, even though there is no evidence of a highly structured region in the 5' UTR. Moreover, similar to the IRES of HCV (37) and the shunt of RTBV (14), substitution of normally weak start codons (like ACG) for ATG183 and ATG201 has only a small effect on Y protein synthesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of mutants. (i) Insertion of stem-loops.
The
plasmid pGEM-P/Cwt has been previously described (7). At
position 23, 53, or 73 of the 5' UTR, a unique BglII site was introduced by PCR-mediated site-directed mutagenesis. The oligonucleotide 5' TATAGGATCCCCTTGAGACCTCCGTACCCTGCAGG 3'
(containing eight terminal nucleotides that are self-complementary) was
self-annealed and filled in with Klenow fragment. It was then digested
with BamHI and cloned into the BglII sites,
thereby generating the clones stem-loop23,
stem-loop53, and stem-loop73 (the estimated
G° for the inserted stem-loop was
54 kcal/mol). Stem-loop1 and stem-loop81 were generated by
using the self-annealing oligonucleotide 5' GATCGGGCGCGTGGTGGCGGCTGCAGCCGCCACCACGCGCCC 3' (the estimated
G° was
54 kcal/mol). The self-annealed
oligonucleotide was filled in with Klenow fragment and blunt ligated
into the NcoI site at position 81 (stem-loop81)
or ligated directly into the BamHI site of the plasmid
multiple cloning site (stem-loop1).
(ii) Replacement of 5' UTR. For the clone RFXATG81, the 5' UTR of a plasmid containing a cDNA clone of RFX-AP (9) was PCR amplified with an upstream oligonucleotide containing a SacI site and a downstream oligonucleotide overlapping the RFX-AP initiation codon and containing an NcoI site (. .CCA69TGG. .). The 5' UTR of the SeV clone ATG81 was removed by SacI/NcoI digestion and replaced by the SacI/NcoI-digested PCR fragment of RFX-AP. For the clone U1ATG81, a pGEM3 clone containing the cDNA of the human U1 snRNA-associating A protein (42) was digested with NcoI (containing the ATG start codon) and PstI (within the downstream region of the polylinker), thereby removing all of the coding region and the 3' UTR. Into the remaining plasmid backbone was inserted the SeV ATG81 coding region as an NcoI/PstI fragment.
(iii) Spacer mutant. The sequence between C114 and Y1183 was generated by using two overlapping oligonucleotides containing BamHI sites at their 5' ends. These oligonucleotides were annealed and then digested with BamHI. The fragment of 66 bp was introduced into the BamHI site of the clone pGEM-P/CBamHI, in which a BamHI site had been introduced between the ATG104/P and ATG114/C start codons at position 106.
(iv) Mutant ACGY1/Y2. Mutant ACGY1/Y2 was obtained by fusion PCR starting from the SeV pGEM-P/Cwt. The first PCR product was generated by using a T7 primer (positive sense) combined with negative primer A (5' CGTCGAGGAATCCGATAACGTCCGAGAGCGACTCTC 3') to introduce ACG codons at positions 183 and 201. The second PCR product was obtained with the negative-sense oligonucleotide PEcoP (see below), complementary to position 1178 on the P/C mRNA, and the positive-sense primer B (5' GACGTTATCGGATTCCTCGACGCTGTCCTGTCGAG 3'), which overlapped by 22 nt the negative primer A. The fragments from the first and second PCRs were combined in a final fusion PCR. The product of this reaction was digested with SacI (within the upstream polylinker region) and EagI (position 1005 on the P/C mRNA) and then substituted into the SeV P/C backbone.
(v) Insertion of ATG codons within the P ORF. Insertion of ATG codons within the P ORF was performed by fusion PCR starting from both the SeV P/Cwt and the ATG81 clones. The first PCR product was generated by using a T7 primer (positive sense) combined with a series of negative-sense primers (a, b, c, d, and e [see below]) to introduce an ATG codon at positions 131, 167, 194, 230, and 287. The second PCR product was obtained with the negative-sense oligonucleotide PEcoP, complementary to position 1178 on the P/C mRNA, and a series of positive-sense primers, a', b', c', d', and e' (see below), that overlapped by 10 to 12 bp with primers a, b, c, d, and e. The fragments from the first and second PCRs were combined in a final fusion PCR. The product of this reaction was digested with SacI (within the upstream polylinker region) and EagI (position 1005 on the P/C mRNA) and then substituted into the SeV P/C backbone. The primers mentioned above were as follows: T7, 5' TAATACGACTCACTATAGGG 3'; PEcoP, 5' GGGCACGTCTTGCAAACAC 3'; a, 5' CAGAATCCATTTTAAGAATGAAGGC 3'; a', 5' TAAAATGGATTCTGAAGTTGAGAGG 3'; b, 5' GCGACTCCATTCCTCCTGGCGCC 3'; b', 5' AGGAATGGAGTCGCTCTCGGATG 3'; c, 5' GCATCGAGCATTCCGATAACATCCGAGAG 3'; c', 5' CGGAATGCTCGATGCTGTCCTGTCG 3'; d, 5' GTCCCCTCCCATGTCAGTTGGTTCACTCG 3'; d', 5' GACATGGGAGGGGACAGAAGC 3'; e, 5' ATGGGCCATGCCTGGTCCTTGGGGAG 3'; and e', 5' AGGCATGGCCCATAGAGCCAAAAG 3'.
(vi) Deletion mutants. Starting from the clones in which new ATGs had been inserted around the Y start sites (see above), 116 nt from the 5' end (including the C', P, and P initiation codons) was deleted by introducing a BamHI site at position 116, digesting the clones with BamHI/PstI, and recloning the fragment into pGEM3.
Cellular expression. Confluent HeLa or A549 cell monolayers seeded on 5-cm-diameter petri dishes were infected at 2 to 5 PFU/cell with a vaccinia virus recombinant expressing T7 RNA polymerase (vTF7-3 [10]). At 1 h postinfection, the infecting medium was replaced with a transfection mix composed of 0.5 ml of minimal essential medium and 10 µl of transfectASE (39) combined with the various plasmid DNAs as indicated in the figure legends. The cells were incubated at 33°C for 24 h before the monolayer was solubilized in 150 mM NaCl- 50 mM Tris-HCl (pH 7.4)-10 mM EDTA-0.6% Nonidet P-40. Nuclei were removed by pelleting at 12,000 × g for 5 min. Immunoblotting of the cytoplasmic extracts was performed as outlined previously (5) with the disodium 3-(4-methoxyspiro{1,2-dioxetane-3,2'-(5'-chloro)tricyclo[3.3.1.1]decan}-4-yl)phenyl phosphate (CSPD) chemiluminescent substrate (Boehringer). The C/C' antiserum was raised in rabbits against a bacterial fusion protein. The P monoclonal antibody (1.180) was a gift from Claes Oervell, Stockholm, Sweden (30). Transfection of all P/C plasmid constructs was performed in triplicate, and the Western blots were quantitated by densitometry (Molecular Dynamics).
| |
RESULTS |
|---|
|
|
|---|
Evidence for a shunting mechanism. The strongest evidence that ribosome initiation from ATG183/Y1 and ATG201/Y2 does not occur by leaky scanning is that mutation of the 5'-proximal ACG81 start site to ATG (GCCA81TGG [ATG81/C']) eliminated initiation from the second and third ATG104/P and ATG114/C start codons but had no effect on or increased initiation from ATG183/Y1 and ATG201/Y2. This result was obtained originally by translation in a wheat germ extract and then in cells infected with vaccinia virus recombinants carrying the SeV P/C gene (6). Since we currently use the vaccinia virus-T7 RNA polymerase system (10) for transient cellular expression, it was important to confirm this observation with this system. HeLa cells infected with a vaccinia virus expressing T7 RNA polymerase were transfected with plasmids expressing either P/Cwt or the mutant ATG81/C' genes. The accumulation of the C, P, C', Y1, and Y2 proteins was measured by immunoblotting, and the level of each protein expressed by the ATG81/C' mRNA relative to that expressed by the wild-type (wt) mRNA is shown in Fig. 2. The results are similar to those described previously. There was no evidence of ribosomal scanning to reach ATG104/P and ATG114/C, as indicated by the absence of the P and C proteins. Nevertheless, total Y protein expression (Y1 plus Y2) remained unchanged, with an increase in the levels of Y1 and a decrease in the levels of Y2 (see also Fig. 6).
|
G) of >
40 kcal/mol have been shown to
act as barriers to migrating initiation complexes and to block 5'
scanning (4, 24, 25). We therefore introduced such
structures (
G >
50 kcal/mol; see Materials and
Methods) at positions 1, 23, 53, and 73 within the wt background and at
position 81 within the ATG81/C' background and examined
their effect on the relative expression of the products initiated at
the five sequential start sites (Fig. 3).
Insertion of the stem-loop at the very 5' end of the mRNA (stem-loop1) blocked all protein expression from the P/C
mRNA (Fig. 3A). Since the presence of strong secondary structure near
the 5' end of the mRNA is known to prevent the binding of the scanning
complex, this result is consistent with the notion that all initiation (including that at the Y protein ATGs) requires the cap group. When the
structural barrier was inserted at either nt 23 or 53, it strongly
inhibited initiation from all five start sites (5- to 10-fold for
stem-loop23 and 10- to 20-fold for stem-loop53)
(Fig. 3B and C), indicating that the scanning complex has to traverse
at least the first 53 nt of the UTR before being translocated downstream, if a shunt is operating. When inserted at position 73 (stem-loop73), the barrier appeared to become leaky; i.e.,
significant levels of expression (40 to 100%, relative to the wt) were
observed from all five start sites (Fig. 3D). The scanning complexes
were apparently able to bypass the structural barrier in
stem-loop73 and then resume scanning at or before
ACG81/C', since mutation of ACG81 to
GCG81 (which is not used as an initiation codon) within
this construct (stem-loop73/GCG81) eliminated
expression of the C' protein and slightly (but reproducibly) increased
that of the P and C proteins (Fig. 3E). The combined expression of the
Y proteins (Y1 plus Y2) from both stem-loop73 constructs
approached wt levels, with a preferential expression of Y2. Most
remarkably, the pattern of expression from the
stem-loop81/ATG81 mRNA (Fig. 3F) was rather
similar to that of the ATG81 mRNA without the added
structural barrier (Fig. 2), in that (i) C' expression continued (at
67% of the wt level), whereas that of P and C were eliminated, and
(ii) Y protein expression also continued and was limited almost
entirely to that of Y1. The structural barrier in
stem-loop81/ATG81 was introduced as an
NcoI cassette into the same site (CCA81TGG)
generated when ACG81 was changed to ATG. This
insertion leaves ATG codons in good contexts on either side of the
stem-loop, both in the C protein ORF. However, only the downstream ATG
appeared to be used, because a longer form of the C' protein was not
detected. This could be because the stem-loop structure blocks
initiation at the upstream (but not the downstream) ATG or because the
shunt effectively causes the upstream site to be bypassed. In any
event, these results suggest that the scanning complex can bypass a
structural barrier and initiate at ACG81/C' or
ATG81/C' (at a high frequency) even when this
initiation site is found just downstream of the barrier. Since
ribosomes on this mRNA also initiate at ATG183/Y1
with high efficiency, they apparently cannot initiate at
ATG104/P or ATG114/C because these latter sites
are bypassed via the shunt. The results in Fig. 3 also highlight the
curious variability in selection of the Y1 and Y2 start codons, an
observation noted previously (6).
|
The shunt donor site.
Scanning complexes which bypass the
highly structured region of shunting mRNAs are thought to disengage
from and to reengage the mRNA at specific sites, the shunt donor and
acceptor sites. The above results are consistent with a donor site
between positions 53 and 73. To more precisely locate this site,
deletions were made within the 5' UTR in the ATG81/C'
background (
1-23,
1-53,
1-73,
23-53,
23-73, and
53-73). We found, however, that none of these deletions (and in
particular
53-73) prevented expression of the Y proteins (data not
shown). This unexpected result led us to examine mRNAs with more
radical modifications in the 5' UTR. We replaced the entire 5' UTR of the SeV P/C (ATG81) mRNA with that from two cellular mRNAs
of similar lengths (the human U1 snRNA-associated A protein
and RFX-AP transcription factor [9,
42]), whose translational initiation is assumed to proceed normally via a cap-dependent continuous-scanning mechanism. Fusion with
the 68-nt-long 5' UTR from RFX-A mRNA left the C' protein ATG in a
highly favorable context
(. .ACCATGG. .), whereas fusion
with the 86-nt-long 5' UTR of U1-A mRNA left the C' start
codon in a poorer context
(. .TCCATGG. .). When both of these
chimeric mRNAs were expressed by plasmid transfection, the C'
protein remained at levels equivalent to those of the parental P/C
(ATG81/C') and was apparently insensitive to the
context (Fig. 4). There was no evidence
of any initiation of the P and C proteins in the RFX-ATG81 construct
(Fig. 4, lane 4), whereas traces of C protein (but not P protein) were
expressed from the U1-ATG81 construct, suggesting that the
ATG81 in the poorer context is a little leaky. Expression
of the Y proteins in both chimeric mRNAs was normal. We were thus
unable to identify a specific sequence within the 5' UTR which acts as a shunt donor site in the SeV P/C mRNA.
|
The acceptor site. The shunt model posits that the scanning complex, having detached from the upstream region of the 5' UTR, is translocated to a specific sequence or structure downstream which acts as a shunt acceptor site. To help define the latter element, we duplicated the sequence between ATG114/C and ATG183/Y1 (excluding the ATGs) and inserted this 66-nt sequence as a spacer between the P protein and C protein start sites (via a BamHI site introduced at position 106, ...A104TGGATCCAGA114TG...). This was carried out in the ATG81/C' background, as this 5'-proximal start codon is itself a strong barrier to scanning complexes and thus highlights the shunt. Due to the insertion (Fig. 5), (i) the Y1 and Y2 protein ATGs are displaced downstream by 66 nt, whereas the C protein ATG is now positioned at approximately the same distance from the 5' end of the mRNA (180 nt) as the Y1 ATG in the wt background (183 nt); (ii) the new C protein ATG114+66/C is now flanked by the same upstream (but not the same downstream) sequences as Y1; and (iii) the length of the C' protein has been increased by 22 aa.
|
3, a G
at position +4, nor an A or a C at position +5
(. .CGGA183CGTTA. .
and
. .TCGA201CGCTG. .) (2, 16), whereas in HCV and RTBV the non-ATG
initiation codons are in relatively good contexts. The fact
that ATG183/Y1 and ATG201/Y2 can be
mutated to ACG without significant loss of activity suggests that these
initiation codons do not constitute a critical sequence element of
the acceptor site. This result is consistent with the notion that the
shunt delivers the scanning complex directly to the Y protein start
codons by using sequence elements at or near ATG183/Y1
and ATG201/Y2, permitting initiation at a high efficiency
independent of the nature and context of these start sites.
|
3 to an A, Y1 becomes the major translation product (data
not shown). The shunted initiation complex therefore appears to be able
to recognize context elements. We tried to take advantage of this
context effect to map the limits of the shunt acceptor site. ATGs in
relatively good contexts (i.e., at least with purines at position
3)
were introduced into the P ORF at positions 131, 167, 194, 230, and 287 (PATG131, PATG167, PATG194,
PATG230, and PATG287, respectively), i.e.,
upstream of, downstream of, and between the Y1 and Y2 start
sites, initially within the ACG183/Y1 and
ACG201/Y2 background. The rationale for this approach
is that if the new ATG falls within the acceptor site, it should be
preferentially selected as a start codon over ACG183/Y1
and ACG201/Y2. This will in turn generate an
N-terminally truncated P protein rather than a Y protein. The
results from this experiment were, however, somewhat unexpected, as
none of the newly introduced ATGs led to a truncated P protein (Fig.
7). In constructs PATG131,
PATG230, and PATG287, Y1 and Y2 protein levels
were similar to those observed in the parent construct (P/C-Y1/Y2 ACG).
In construct PATG167, however, in which the new ATG
codon is positioned only 16 nt upstream of ACG183/Y1,
Y1 protein expression increased ninefold compared to that observed in
the parent construct, whereas Y2 expression remained unchanged (Fig. 7,
lane 7). Similarly, insertion of the new ATG between the Y1 and Y2 ACGs
(7 nt upstream from ACG201/Y2 and 11 nt downstream from
ACG183/Y1), namely, PATG194, resulted in an
increased expression of the Y2 protein (fourfold), whereas Y1
expression remained unchanged (Fig. 7, lane 8). The insertion of strong
start codons within the P ORF, just upstream (but not downstream)
of either the Y1 or Y2 ACG codon, thus enhances initiation from
these non-ATGs under conditions in which initiation from the inserted
ATGs does not occur. When these new ATG codons were inserted into
the P/Cwt background (i.e., Y1/Y2 start on ATG codons), the
enhancement of Y protein expression by PATG167 and
PATG194 was less apparent, as higher levels of Y1 and Y2
were produced in this background (Fig. 7, lanes 4 and 5), nor was there
expression of a truncated P protein. These results appear to map the
acceptor site to a region that just spans the two Y protein start
codons. They also suggest that within this region the Y initiation
sites are privileged even when they are ACG codons flanked by good
ATGs.
|
PATG131,
PATG167,
PATG194,
PATG230,
and
PATG287) were then expressed in vivo. Immunoblotting
revealed expression of truncated P proteins from all of these
constructs, with migrations consistent with the position of the
inserted ATG (Fig. 8). These ATG start
sites are therefore efficiently recognized by a continuous-scanning complex.
|
| |
DISCUSSION |
|---|
|
|
|---|
Selection of a translational start site on eukaryotic mRNAs generally involves the entry of a scanning complex at the m7GTP-5' cap, followed by the continuous linear scanning of the RNA to locate the initiation codon. Consistent with this, the vast majority of eukaryotic mRNAs are monocistronic. There are, however, two notable exceptions, (i) cap-independent internal initiation directed by an IRES and (ii) cap-dependent but discontinuous scanning, or ribosomal shunting. Both of these mechanisms can bypass barriers which would otherwise impede initiation at a downstream start site by a continuous scanning process. These barriers can be highly stable secondary structures found within the long 5' UTRs, as in, e.g., the IRES-directed translation of picornavirus RNAs (21) and the D. antennapedia mRNA (31) and the shunt-mediated translation of CaMV 35S RNA (13) and the adenovirus late mRNAs (46). These long 5' UTRs often have several potential ATG start sites which have been conserved, at least in the case of the viral systems because they form elements which are important in viral replication (1, 3, 41). IRESs and shunts may also be used to maximize translation under conditions which are not optimal for continuous scanning, when the function of the eIF-4F complex is down-regulated. For example, the D. antennapedia mRNA is expressed during mitotic division early in development, mammalian Bip expression increases during heat shock, and translation of adenovirus mRNAs containing the tripartite leader is promoted during late gene expression (27, 28). These are all conditions in which eIF-4E phosphorylation is low and consequently cap-dependent translation is compromised (for a review, see reference 41). Similarly, picornavirus infection results in the cleavage of eIF-4G, another key component of the eIF-4F complex (21).
In this paper, we have provided evidence that a ribosomal shunt operates in the initiation of the SeV Y1 and Y2 proteins. These initiation sites are the fourth and fifth start codons on the P/C mRNA, and in this instance, it is the upstream ACG81/C', ATG104/P, and ATG114/C start sites, rather than strong secondary structure, which act as barriers to initiation at ATG183/Y1 and ATG201/Y2 by a strictly linear scanning mechanism. The ribosomal shunt is thus another mechanism used by this viral mRNA to expand its repertoire of gene products, in addition to leaky scanning and mRNA editing. We have no evidence that the shunt is also used to regulate viral gene expression under particular conditions, but this, of course, remains possible (see below).
Ribosomal shunts have so far been described for viral mRNAs, i.e., those of the plant pararetroviruses CaMV and RBTV, adenovirus, and now SeV. We note that several features of the SeV and CaMV shunts are similar and are distinct from that described for adenovirus, as follows.
(i) Discontinuous scanning is thought to occur through cis-acting donor and acceptor sites within the 5' UTR, with the acceptor site being close to or overlapping the initiation codon (13). Our attempts to locate the shunt donor site by deleting regions within the 5' UTR failed to identify this element. Indeed, replacement of the entire P/C mRNA 5' UTR with those from two cellular mRNAs (selected only for the lengths of their 5' UTRs) also failed to perturb Y protein expression. This suggests that there is no defined sequence or structures within the 5' UTR required for translocation of the scanning complex to the downstream initiation site. The donor site in CaMV also does not appear to include a specific primary nucleotide sequence but maps to the upstream base of a hairpin structural element (stem I) within the leader (8a, 13, 19). For adenovirus, in contrast, shunting was dependent on precise cis-acting elements within the structured 5' tripartite leader (46).
(ii) The Y protein start sites could be displaced 66 nt downstream without perturbing the efficiency of the shunt, consistent with the absence of a precise donor site. Similarly, displacement of the CaMV acceptor site downstream by ca. 1,800 nt did not affect the efficiency of this shunt (12). In contrast, for the adenovirus late mRNAs, displacement of the initiating ATG downstream abolished initiation (46). Further, in all adenovirus serotypes, the distance between the end of the tripartite leader and the ATG start codon is always <35 nt, suggesting that the adenovirus shunt has a strict range limit.
(iii) Both the CaMV and SeV shunts, but not that of adenovirus, continue to operate in the presence of functional ATGs upstream. The adenovirus shunt apparently is perturbed by the presence of 80S ribosomes on the mRNA (46).
Irrespective of these differences, both shunts differ from cap-independent IRES-directed initiation in that the preinitiation complex must engage the capped end of the mRNA and scan the beginning of the 5' UTR before being translocated downstream. Since the SeV shunt does not appear to do this to simply move the preinitiation complex to a defined donor site, this step may be required for the preinitiation complex to acquire (or modify) factors without which it cannot be productively transferred to the acceptor site. An alternative possibility to explain the apparent absence of a precise donor site is that scanning complexes are continually falling off the mRNA as they search for an initiation codon. For the majority of eukaryotic mRNAs whose translation is initiated by continuous scanning, these detached complexes would reenter the mRNA via the 5' cap and thereby pass unnoticed. When a downstream shunt acceptor site is present, however, they can also bind directly to it and initiate at internal start codons. Such a model predicts that shunting should function in trans, and indeed trans shunting was reported for CaMV (13). Although detachment of the scanning complexes is viewed here as a stochastic process, certain sequence elements within the 5' UTR, or trans-acting protein factors (see below), may enhance this event. Alternatively, scanning complexes may be translocated directly from the 5' UTR to the internal acceptor site without detaching from the mRNA, which would constitute simply a shunt without a defined donor site. Once again, this process could be modulated by cis- and trans-acting factors.
The precise nature of the SeV acceptor site remains unresolved. Computer analysis reveals only weak secondary structural elements within the first 300 nt of the mRNA (6a, 17), and it is not impossible that the acceptor site is a linear cis-acting sequence that overlaps the Y initiation codons. We note that the SeV X protein is also expressed by cap-dependent internal initiation at one of two possible ATG codons ca. 1,500 nt from the 5' end (5). Alignment of the sequences flanking the X and Y start sites reveals no apparent homology, apart from the fact that in each case there are two ATGs separated by five codons. Whether this spacing is an important element of these initiation sites remains unclear. It is also possible that the acceptor site interacts with factors which regulate the efficiency of the shunt. Specific cellular proteins are known to modulate translation of the ferritin mRNA by binding to the iron-responsive element within the 5' UTR (26, 40), and general RNA binding proteins render translation cap dependent in vitro (44). Likewise, the adenovirus shunt is promoted by one or more late viral gene products (46), and the CaMV shunt is transactivatable by the viral ORF VI protein (11). We have no evidence that an SeV gene product can modulate the shunt. However, Y protein expression changes (relative to expression of the other products of the P/C mRNA) in different cell lines infected with SeV (8) and the ratio between the Y1 and Y2 proteins clearly varies depending on the system of expression used (6). Thus, regulation of the shunt by cellular factors remains possible. Such factors may function by binding to and stabilizing existing weak structures at or near the Y1 and Y2 start codons, thereby facilitating the binding of the preinitiation complex at the acceptor site.
The SeV shunt acceptor site also shares features found in IRES-directed initiation of HCV genome RNA. For both systems the initiator Met-tRNA anticodon interaction is less important than at normal start sites, as the substitution of non-ATG start codons has little effect. Furthermore, these internal start sites must be privileged, as the introduction of out-of-frame ATGs (in good contexts) does not interfere with this initiation. On the contrary, these silent ATGs can in some cases stimulate initiation from the authentic start sites severalfold (Fig. 7) (38). These introduced ATGs, on the other hand, become functional when either the IRES or the shunt is perturbed (in both instances by deleting upstream sequences), indicating that they can be recognized by linear-scanning complexes (38). The HCV IRES has recently been found to bind 40S subunits, forming complexes in which the start codon is placed in the ribosomal P site (36a). These complexes are stabilized by multiple IRES-40S subunit interactions, possibly including the 18S rRNA, such that the canonical initiation factors (eIF-3, eIF-4A, eIF-4B, and eIF-4F) are not required. Our results suggest that the SeV acceptor site can also position the shunted initiation complex directly at the start codon. However, the mechanism by which this occurs remains to be elucidated.
| |
ACKNOWLEDGMENTS |
|---|
We acknowledge Jean-Baptist Marq for excellent technical assistance and Patrick Linder for careful reading of the manuscript.
This work was supported by the Swiss National Science Foundation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Genetics and Microbiology, University of Geneva Medical School (CMU), 9 Ave. Champel, CH1211 Geneva, Switzerland. Phone: 41-22-702-57.27. Fax: 41-22-346-72.37. E-mail: curran{at}cmu.unige.ch.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Andino, R., G. E. Rieckhof, P. L. Achacosa, and D. Baltimore. 1993. Poliovirus RNA synthesis utilises an RNP complex formed around the 5'-end RNA. EMBO J. 12:3587-3598[Medline]. |
| 2. | Böck, R., and D. Kolakofsky. 1994. Positions +5 and +6 can be major determinants of the efficiency of non-AUG initiation codons for protein synthesis. EMBO J. 13:3608-3617[Medline]. |
| 3. | Bonneville, J.-M., T. Hohn, and P. Pfeiffer. 1988. Reverse transcription in the plant virus, cauliflower mosaic virus, p. 23-42. In E. Domingo, J. J. Holland, and P. Ahlquist (ed.), RNA Genetics. CRC Press, Boca Raton, Fla. |
| 4. |
Chevrier, D.,
C. Vézina,
J. Bastille,
C. Linhard,
N. Sonenberg, and G. Boileau.
1988.
Higher order structures of the 5'-proximal region decrease the efficiency of the porcine pro-opiomelanocortin mRNA.
J. Biol. Chem.
263:902-910 |
| 5. | Curran, J., and D. Kolakofsky. 1988. Scanning independent ribosomal initiation of the Sendai virus X protein. EMBO J. 7:2869-2874[Medline]. |
| 6. | Curran, J., and D. Kolakofsky. 1989. Scanning independent ribosomal initiation of the Sendai virus Y proteins in-vitro and in-vivo. EMBO J. 8:521-526[Medline]. |
| 6a. | Curran, J., and M. M. Pooggin. Unpublished data. |
| 7. | Curran, J. A., R. Boeck, and D. Kolakofsky. 1991. The Sendai virus P gene expresses both an essential protein and a negative regulator of RNA synthesis by shuffling modules via mRNA editing. EMBO J. 10:3079-3085[Medline]. |
| 8. |
Dillon, P. J., and K. C. Gupta.
1989.
Expression of five proteins from Sendai virus P/C mRNA in infected cells.
J. Virol.
63:974-977 |
| 8a. |
Dominguez, D. I.,
L. A. Ryabova,
M. M. Pooggin,
W. Schmidt-Puchta,
J. Fütterer, and T. Hohn.
1998.
Ribosome shunting in cauliflower mosaic virus.
J. Biol. Chem.
273:3669-3678 |
| 9. | Durand, B., P. Sperisen, P. Emery, E. Barras, M. Zufferey, B. Mach, and W. Reith. 1997. RFX-AP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J. 16:1045-1055[Medline]. |
| 10. |
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesises bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126 |
| 11. | Fütterer, J., J.-M. Bonneville, K. Gordon, M. deTapia, S. Karisson, and T. Hohn. 1990. Expression from polycistronic cauliflower mosaic virus pregenome RNA. Posttranscriptional control of gene expression. NATO ASI Ser. H49:349-357. |
| 12. | Fütterer, J., K. Gordon, H. Sanfaçon, J.-M. Bonneville, and T. Hohn. 1990. Positive and negative control of translation by the leader of cauliflower mosaic virus pregenomic 35S RNA. EMBO J. 9:1697-1707[Medline]. |
| 13. | Fütterer, J., Z. Kiss-Lászió, and T. Hohn. 1993. Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA. Cell 73:789-802[Medline]. |
| 14. | Fütterer, J., I. Potrykus, Y. Bao, L. Li, T. M. Burns, R. Hull, and T. Hohn. 1996. Position-dependent ATT initiation during plant pararetrovirus rice tungro bacilliform virus translation. J. Virol. 70:2999-3010[Abstract]. |
| 15. |
Giorgi, C., and D. Kolakofsky.
1984.
Effect of poliovirus superinfection on Sendai virus protein synthesis.
J. Virol.
52:298-299 |
| 16. | Grünert, S., and R. J. Jackson. 1994. The immediate downstream codon strongly influences the efficiency of utilisation of eukaryotic translation initiation sites. EMBO J. 13:3618-3630[Medline]. |
| 17. | Gupta, K. C., E. Ono, and X. Xu. 1996. Lack of correlation between Sendai virus P/C mRNA structure and its utilisation of two AUG start sites from alternate reading frames: implications for viral bicistronic mRNAs. Biochemistry 35:1223-1231[Medline]. |
| 18. |
Gupta, K. C., and S. Patwardhan.
1988.
ACG, the initiator codon for a Sendai virus protein.
J. Biol. Chem.
263:8553-8556 |
| 19. | Hemmings-Mieszczak, M., G. Steger, and T. Hohn. 1998. Regulation of CaMV 35S RNA translation is mediated by a stable hairpin in the leader. RNA 4:101-111[Abstract]. |
| 20. | Jackson, R. J. 1996. A comparative view of initiation site selection mechanisms, p. 31-70. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 21. | Jackson, R. J., and A. Kaminski. 1995. Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond. RNA 1:985-1000[Medline]. |
| 22. |
Jang, S. K.,
H. G. Krausslich,
M. J. Nicklin,
G. M. Duke,
A. C. Palmenberg, and E. Wimmer.
1988.
A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation.
J. Virol.
62:2636-2643 |
| 23. | Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283-292[Medline]. |
| 24. |
Kozak, M.
1989.
Circumstances and mechanisms of inhibition of translation by secondary structure in eukaryotic mRNAs.
Mol. Cell. Biol.
9:5134-5142 |
| 25. |
Kozak, M.
1989.
The scanning model for translation an update.
J. Cell. Biol.
108:229-241 |
| 25a. |
Latorre, P.,
T. Cadd,
M. Itoh,
J. Curran, and D. Kolakofsky.
1998.
The various Sendai virus C proteins are not functionally equivalent, and exert both positive and negative effects on viral RNA accumulation during the course of infection.
J. Virol.
72:5984-5993 |
| 26. |
Leibold, E. A., and H. N. Munro.
1988.
Cytoplasmic protein binds in-vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs.
Proc. Natl. Acad. Sci. USA
85:2171-2175 |
| 27. | Lindquist, S., and R. Petersen. 1990. Selective translation and degradation of heat-shock messenger RNAs in Drosophila. Enzyme 44:147-166[Medline]. |
| 28. | Macejak, D. G., and P. Sarnow. 1991. Internal initiation of translation mediated by the 5' leader of a cellular mRNA. Nature 353:90-94[Medline]. |
| 29. | Merrick, W. C., and J. W. B. Hershey. 1996. The pathway and mechanism of eukaryotic protein synthesis, p. 31-70. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. | Oervell, C., and M. Grandien. 1982. The effects of monoclonal antibodies on biological activities of structural proteins of Sendai virus. J. Immunol. 129:2779-2787[Medline]. |
| 31. |
Oh, S.-K.,
M. P. Scott, and P. Sarnow.
1992.
Homeotic gene Antennapedia mRNA contains 5'-noncoding sequences that confer translational initiation by internal ribosome binding.
Genes Dev.
6:1643-1653 |
| 32. | Ohlmann, T., M. Rau, V. M. Pain, and S. Morley. 1996. The C-terminal domain of eukaryotic protein synthesis initiation factor (eIF) 4G is sufficient to support cap-independent translation in the absence of eIF4E. EMBO J. 15:1371-1382[Medline]. |
| 33. |
Patwardhan, S., and K. C. Gupta.
1988.
Translation initiation potential of the 5' proximal AUGs of the polycistronic P/C mRNA of Sendai virus: a multipurpose vector for site specific mutagenesis.
J. Biol. Chem.
263:4907-4913 |
| 34. | Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334:320-325[Medline]. |
| 35. | Pestova, T. V., C. U. T. Hellen, and I. N. Shatsky. 1996. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol. Cell. Biol. 16:6859-6869[Abstract]. |
| 36. | Pestova, T. V., I. N. Shatsky, and C. U. T. Hellen. 1996. Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. Mol. Cell. Biol. 16:6870-6878[Abstract]. |
| 36a. |
Pestova, T. V.,
I. N. Shatsky,
S. P. Fletcher,
R. J. Jackson, and C. U. T. Hellen.
1998.
A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs.
Genes Dev.
12:67-83 |
| 37. | Reynolds, J. E., A. Kaminski, H. J. Kettinen, K. Grace, B. E. Clarke, A. R. Carroll, D. J. Rowlands, and R. J. Jackson. 1995. Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J. 14:6010-6020[Medline]. |
| 38. | Rijnbrand, R. C. A., T. E. M. Abbink, P. C. J. Haasnoot, W. J. M. Spaan, and P. J. Bredenbeek. 1996. The influence of AUG codons in the hepatitis C virus 5' nontranslated region on translation and mapping of the translation initiation window. Virology 226:47-56[Medline]. |
| 39. | Rose, J. K., I. Buonocore, and M. A. Whitt. 1991. A new cationic liposome reagent mediating nearly quantitative transfection of animal cells. BioTechniques 10:520-525[Medline]. |
| 40. | Rouault, T. A., M. W. Hentze, S. W. Caughman, J. B. Harford, and R. D. Klausner. 1988. Binding of a cytosolic protein to the iron-responsive element of human ferritin messenger RNA. Science 242:1207-1210. |
| 41. | Schneider, R. J. 1996. Adenovirus and vaccinia virus translational control, p. 575-605. In J. W. B. Hershey, M. B. Mathews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 42. | Sillekens, P. T. G., W. J. Habets, R. P. Beijer, and W. J. van Venraoij. 1987. cDNA cloning of the human U1 snRNA-associated A protein: extensive homology between U1 and U2 snRNP-specific proteins. EMBO J. 6:3841-3848[Medline]. |
| 43. | Slobodskaya, O. R., A. P. Gmyl, S. V. Maslova, E. A. Tolskaya, E. G. Viktorova, and V. I. Agol. 1996. Poliovirus neurovirulence correlates with the presence of a cryptic AUG upstream of the initiator codon. Virology 221:141-150[Medline]. |
| 44. | Svitkin, Y. V., L. P. Ovchinnikov, G. Dreyfuss, and N. Sonenberg. 1996. General RNA binding proteins render translation cap dependent. EMBO J. 15:7147-7155[Medline]. |
| 45. |
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
Editing of the Sendai virus P/C mRNA by G insertion occurs during mRNA synthesis via a virus-encoded activity.
J. Virol.
64:239-246 |
| 46. |
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev.
10:1557-1567 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»