Previous Article | Next Article 
Molecular and Cellular Biology, September 1998, p. 5109-5120, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
An Endocrine-Exocrine Switch in the Activity of the
Pancreatic Homeodomain Protein PDX1 through Formation of a Trimeric
Complex with PBX1b and MRG1 (MEIS2)
Galvin H.
Swift,1,*
Ying
Liu,1
Scott D.
Rose,1
Larry J.
Bischof,2
Scott
Steelman,3
Arthur M.
Buchberg,3
Christopher V. E.
Wright,4 and
Raymond J.
MacDonald1
Department of Molecular Biology and Oncology,
University of Texas Southwestern Medical Center, Dallas, Texas
752351; Departments of
Biochemistry2 and
Cell
Biology,4 Vanderbilt University School of
Medicine, Nashville, Tennessee, 37232; and
Kimmel Cancer
Center, Jefferson Medical College, Philadelphia, Pennsylvania
191073
Received 19 February 1998/Returned for modification 29 April
1998/Accepted 1 June 1998
 |
ABSTRACT |
HOX proteins and some orphan homeodomain proteins form
complexes with either PBX or MEIS subclasses of homeodomain
proteins. This interaction can increase the binding specificity and
transcriptional effectiveness of the HOX partner. Here we show that
specific members of both PBX and MEIS subclasses form a multimeric
complex with the pancreatic homeodomain protein PDX1 and switch the
nature of its transcriptional activity. The two activities of PDX1 are exhibited through the 10-bp B element of the transcriptional enhancer of the pancreatic elastase I gene (ELA1). In pancreatic
acinar cells the activity of the B element requires other elements of the ELA1 enhancer; in
-cells the B element can activate
a promoter in the absence of other enhancer elements. In acinar cell
lines the activity is mediated by a complex comprising PDX1, PBX1b, and
MRG1 (MEIS2). In contrast,
-cell lines are devoid of PBX1b and MRG1,
so that a trimeric complex does not form, and the
-cell-type activity is mediated by PDX1 without PBX1b and
MRG1. The presence of specific nuclear isoforms of PBX and MEIS is
precisely regulated in a cell-type-specific manner. The
-cell-type
activity can be detected in acinar cells if the B element
is altered to retain binding of PDX1 but prevent binding of the
PDX1-PBX1b-MRG1 complex. These observations suggest that association
with PBX and MEIS partners controls the nature of the transcriptional
activity of the organ-specific PDX1 transcription factor in exocrine
versus endocrine cells.
 |
INTRODUCTION |
The mammalian pancreas is a compound
gland of endocrine and exocrine tissues derived from the embryonic
endoderm (62). Approximately 90% of the pancreas is
exocrine tissue, comprising acinar cells that synthesize and secrete
digestive enzymes and ductal cells that secrete and channel the fluid
that transports the acinar enzymes to the duodenum. About 1% of the
pancreas is endocrine tissue, comprising four principal cell types
synthesizing insulin (
-cells), glucagon (
-cells), somatostatin
(
-cells), and pancreatic polypeptide (PP cells) organized into
islets scattered throughout the exocrine pancreas. The endocrine and
exocrine compartments are structurally and functionally integrated
through an islet-acinar portal blood system that facilitates the
regulation of acinar cell functions directly by islet peptide hormones
(81).
The exocrine-endocrine relationship begins at the inception of
pancreogenesis: both tissues are derived from a common endodermal cell
lineage (for reviews, see references 34 and
73). This shared lineage may be expected to result
in shared strategies and effectors for gene transcription, but with the
important requirement that neither endocrine hormones or exocrine
digestive enzymes be synthesized in the wrong compartment. Divergence
of islet and acinar cell lineages may occur by modification of a
pancreatic regulatory network through the differential expression
of regulatory molecules such as transcription factors (or possibly by
the differential use of a shared factor) to activate exocrine or
endocrine-specific gene sets.
Several homeodomain proteins are important components of the
transcriptional network that controls pancreogenesis (1, 22, 50,
69, 74). The homeodomain transcription factors encoded by the
HOX gene clusters are key mediators in setting up the body plan during animal development (29, 33). Different members of this large gene family are essential for correct specification of
cell identity, despite having very similar DNA binding sites in vitro.
The exquisite specificity of many of these proteins in vivo depends in
part on interaction with the PBC family of homeodomain proteins (for
reviews, see references 39 and
82). Other homeodomain proteins whose genes are not
part of the HOX gene clusters, such as engrailed and the
pancreas- and duodenum-specific factor PDX1, also interact with PBC
family members (57, 58).
PDX1 (previously termed IPF1 [51], STF1
[35], X1Hbox8 [84], IDX1
[41], or
-TF1 [32]) is critical to
pancreogenesis. PDX1-deficient mice are born without endocrine and
exocrine pancreatic tissues (22, 50). An apancreatic human
who is also PDX1 deficient due to a homozygous point mutation in the
PDX1 gene has been identified (76). In adult mice
PDX1 has a selective endodermal expression pattern limited to the
epithelial cells of the pancreas and the rostral duodenum (50,
84). PDX1 expression is first detected in the primitive
endodermal gut tube at sites that give rise to dorsal and ventral
pancreatic buds about one-half day later (19, 22).
Subsequently during normal development, PDX1 is present in the
epithelial cells of the bud that give rise to pancreatic islet, acinar,
and ductal cells (19). Pancreogenesis in PDX1-deficient mice
is arrested at this stage, prior to the appearance of differentiated islet and acinar cells. As development progresses, PDX1 is present in
amylase-expressing precursors of acinar cells, as well as in islet
cell precursors expressing insulin, somatostatin, or glucagon (19). In the pancreas of adult mice, PDX1 is present at the highest levels in
-cells of the islets and at much lower levels in
other islet cell types and in acinar cells (85). In mature
-cells, PDX1 participates in the activation of several
-cell-specific promoters, including those of the insulin, Glut2
transporter, and glucokinase genes (51, 56, 79, 80).
In this report we show that PDX1 also participates in the activation of
the transcriptional enhancer of at least one acinar cell-specific
gene, that for elastase I (ELA1), and therefore plays
a role in acinar cell function as well. The rat ELA1
enhancer consists of three transcription factor binding sites: elements A, B, and C. The A element is the primary determinant of acinar cell-specific transcription; a homomultimeric repeat of a 26-bp A
element directs pancreatic acinar cell expression in transgenic mice
(66). The activity of the A element is mediated by the acinar cell-specific factor PTF1 (14, 66), which is proposed to be a key regulator that defines the acinar phenotype (14, 27,
59). The C element is bound by tissue-nonspecific factors that
augment the activity of PTF1 (32). The third element of the
enhancer, the B element, is active in
-cells as well as acinar cells
(31, 32). However, its roles in these two cell types are
different. In acinar cells of mice, the B element acts only in concert
with the other enhancer elements; in this context it plays a secondary
role by augmenting the activity of the acinar cell-specific A element.
In islets of transgenic mice, the B element directs expression
selectively to
-cells. This
-cell-specific activation property of
the B element is manifested both within the context of the enhancer and
as a homomultimeric repeat. The repeated form of the B element is
inactive in acinar cells. Thus, the B element alone can activate a
simple promoter in
-cells, whereas in acinar cells it requires
the participation of other enhancer elements (31).
We show that the distinct acinar cell and
-cell activities of the B
element are mediated by complexed and uncomplexed forms of PDX1,
respectively. In acinar cell lines, a PDX1 complex containing two
additional homeodomain proteins, PBX1b and MRG1 (MEIS2), participates in the enhancer. In
-cell lines, this complex does not form and PDX1
in the absence of these two cofactors is capable of activating a
reporter gene containing a repeat of the B element. The trimeric complex, which acts within the three-element enhancer, cannot activate
the B-element repeat. Conversely, PDX1 without PBX1b and MRG1 can
activate the B repeat but is not functional within the context of
the enhancer. Therefore, the different activities of PDX1 are dependent
on whether it is complexed with PBX1b and MRG1. We suggest that
the use of this shared pancreatic transcription factor in
two different ways contributes to the activation of different gene sets
that distinguish the exocrine and endocrine lineages.
 |
MATERIALS AND METHODS |
Gene construction.
The ELA1 enhancer-promoter
construct contains ELA1 gene sequences from nucleotide
205
to +8 fused to a human growth hormone (hGH) reporter gene as described
previously (54). In the various ELA1 B-element
multimer constructs, five or six copies of double-stranded oligonucleotides (described below) were multimerized and placed in
front of the ELA1 minimal promoter from nucleotide
92 to
+8, linked to an hGH reporter gene, as described previously
(32). To express PDX1 in transfected cells, the coding
sequence of mouse PDX1, with 5' and 3' untranslated regions from the
Xenopus laevis
-globin gene (28), was cloned
into the pBK-CMV expression plasmid (Stratagene, La Jolla, Calif.)
(details are available upon request). The lacZ region of the
plasmid, between the cytomegalovirus (CMV) promoter and the cloning
cassette, was removed to enhance eukaryotic expression. Full-length
clones of PBX1a and PBX1b were in the pBK-RSV plasmid (Stratagene)
(23).
Cell lines.
The endocrine lines were
TC-3, derived from
an insulinoma of a mouse bearing a simian virus 40 T-antigen gene
directed by insulin gene regulatory elements (16), and Ins1
and RIN1046-38 (RIN38), rat insulinoma cell lines induced by radiation
(2, 61). The acinar cell lines were 266-6 (ATCC CRL-2151),
derived from an acinar pancreatic tumor of a mouse bearing a T-antigen transgene directed by ELA1 regulatory sequences
(53); C5-2E, derived from an acinar pancreatic tumor of a
mouse bearing a T-antigen transgene directed by rat trypsin 1 gene
regulatory sequences (32a); and AR42J (ATCC CRL-1492),
derived from an azaserine-induced acinar pancreatic carcinoma of a rat
(21). AR42J is a widely used model of pancreatic acinar
cells with some amphicrine properties (68). An additional
exocrine cell line, ARIP (ATCC CRL-1674), was also derived from an
azaserine-induced pancreatic carcinoma of a rat (21). The
cell lines HeLa (ATCC CCL-2), Rat2 (ATCC CRL-1764), NIH 3T3 (ATCC
CRL-1658), and Jurkat (ATCC TIB-152) were utilized as nonpancreatic
controls. All key results were confirmed with multiple endocrine,
exocrine, and nonpancreatic cell lines because of the
limitations of any single cell line as a model of the tissue from which
it was derived.
Transfections.
266-6, AR42J, and HeLa cells were transfected
by the calcium phosphate technique (18). RIN38 and
TC-3
cells were transfected by electroporation (83). Expression
of the transfected genes was monitored by determination of hGH
accumulation in the medium (70) by using a radioimmunoassay
(Nichols Institute, San Juan Capistrano, Calif.). All transfection
results were corrected for varying transfection efficiencies, based on
the activity of a cotransfected reporter gene control. Internal control
plasmids contained either a Rous sarcoma virus-chloramphenicol
acetyltransferase fusion gene (30) or a
CMV-
-galactosidase fusion gene (pCMV
-2; Clontech, San Francisco,
Calif.). Chloramphenicol acetyltransferase enzyme activity was assayed
as described by Nielsen et al. (48), and
-galactosidase activity was assayed according to directions provided
by Tropix, Inc., Bedford, Mass. The activities of all constructs were
assayed in duplicate in two or more independent experiments.
EMSA and antibody supershift assay.
Nuclear extracts were
prepared by a slight modification of the procedure of Dignam et al.
(15) as described by Kruse et al. (32). Mobility
shift binding reactions and electrophoresis were as described by Swift
et al. (78). In some of the electrophoretic mobility shift
assays (EMSAs) of 266-6 nuclear extracts, the GATA4-B-oligonucleotide complex was competed with a GATA binding site oligonucleotide,
G1
(78). In EMSA with added antibodies, nuclear extract was incubated for 10 min at room temperature with 1 to 3 µl of rabbit serum or purified immunoglobulin G fractions prior to incubation with oligonucleotides under standard EMSA conditions. EMSA with the
rabbit reticulocyte lysate containing in vitro-translated (IVT) factors
was done similarly.
Oligonucleotides.
The unmodified (wild-type) B-element
oligonucleotides and the transversion mutants B through H have been
described previously (78). The wild-type B element had the
coding-strand sequence CTTATCAGATAAATGAGTTGA and
noncoding-strand sequence AGTCAACTCATTTATCTGATA, creating a
double-stranded oligonucleotide encompassing nucleotides
162 to
144
of the rat ELA1 gene. The bases mutated by transversion were
changed from A to C, C to A, G to T, and T to G. The PBX-PDX1 consensus
binding site oligonucleotide from the TseII site of the somatostatin
gene (35, 57) had the top-strand sequence GTACTGCATGATTAATTACTGA and bottom-strand sequence
GATCTCAGTAATTAATCATGCA. The TseII site is identical at 12 of
13 nucleotides to the selected binding site of PBX1 and HOXB-7
(46).
Antibodies.
Polyclonal rabbit antibodies used in this study
included anti-PDX1 (anti-STF1 [a generous gift of Marc Montminy] or
anti-X1Hbox8 [19]); anti-PBX (raised against PBX1b; it
detects all members of the PBX family [5]); antibody
specific for PBX1, PBX2, or PBX3 (Santa Cruz Biotechnology, Inc.); or
antibody specific for PBX1a or PBX1b. The antibody specific for PBX1a
was raised against a peptide corresponding to amino acids 383 to 400 of
the PBX1a protein, and the antibody specific for PBX1b was raised
against a peptide corresponding to amino acids 331 to 347 of the PBX1b protein. The specificity and suitability of each PBX antibody in both
Western blotting (shown in Fig. 6A) and EMSA conditions (data not
shown) were tested with the IVT PBX proteins (see below). Polyclonal
rabbit antibodies specific for MEIS1 and MRG1 were raised against
peptides containing the first 16 amino acids of each protein.
Northern blots.
RNAs from cell lines were isolated with RNA
STAT 60 (Tel-Test B, Inc., Friendswood, Tex.). Pancreatic RNA was
isolated by the guanidine thiocyanate procedure (37).
Poly(A)-enriched RNA was obtained by binding to oligo(dT) columns. RNA
was assayed by Northern blotting of RNA resolved by electrophoresis in
methyl mercury hydroxide (77) and transferred to Zeta-probe
membranes (Bio-Rad).
Cloning of mouse PBX cDNAs.
A cDNA library from the mouse
acinar pancreatic cell line 266-6 was created in LambdaZap. Of a total
library of 1.2 × 106 clones, 3.5 × 105 clones were screened with a mixture of a full-length
human PBX1a clone and partial clones of human PBX2 and PBX3.
Seventy-three clones were identified as potential members of the mouse
PBX family. These clones were further identified by hybridization with
short fragments specific for the N-terminal coding sequence of each class of human PBX. The complete sequence of a full-length clone of
each mouse PBX species was determined with an ABI 377 sequencer.
IVT.
Constructs for in vitro translation (IVT) were prepared
as follows. Mouse PDX1-coding sequence with the Xenopus
-globin 5' untranslated region was cloned into the
HindIII and SalI sites of the pSP64 vector
(Promega, Madison, Wis.) so that the PDX1-coding sequence is under the
control of SP6 promoter. Human PBX1a- and PBX1b-coding sequences with
the Xenopus
-globin 5' untranslated region were cloned
into the BglII and PstI sites of the pSP73 vector
(Promega). To construct the PBX2 expression plasmid, mouse PBX2-coding
sequence was amplified by PCR and cloned into the NcoI and
XhoI sites of the pSP73 vector that contains the
Xenopus
-globin 5' untranslated region. Mouse PBX3a- and
PBX3b-coding sequences were also amplified by PCR and cloned into the
NcoI and SphI sites of the same vector. The
PBX-coding sequences were all under the control of SP6 promoter. MRG1a
cDNA was under the control of the T7 promoter in the vector pET-28b
(Novagen, Madison, Wis.).
Coupled in vitro transcription and translation were performed with the
Promega TNT coupled reticulocyte lysate system according to the
manufacturer's instructions. Relative molar amounts of IVT proteins
were estimated from the [35S]methionine incorporation and
the molar fraction of methionine in each protein.
Western blots.
Thirty micrograms of cytoplasmic or nuclear
extracts was resolved by sodium dodecyl sulfate-10% polyacrylamide
gel electrophoresis and electrotransferred to Immobilon polyvinylidene
difluoride membranes (Millipore, Bedford, Mass.). Filters were then
blocked overnight with a solution of 5% nonfat dry milk and 0.5%
Tween 20 in phosphate-buffered saline. After blocking, filters were incubated with antibody for 1 h. The bound primary antibody was detected by incubation with horseradish peroxidase-conjugated donkey
anti-rabbit immunoglobulins (Amersham, Arlington Heights, Ill.) and
reaction with an enhanced chemiluminescence detection kit (Pierce,
Inc., Rockford, Ill.).
 |
RESULTS |
Activity of the B element in cultured pancreatic cells.
To
determine the basis for the two different activities of the
ELA1 B element in the acinar cells and
-cells of the
pancreas, we analyzed its activity both as a homomultimeric repeat and
as part of the ELA1 enhancer in various pancreatic acinar
cell and
-cell lines. The B-element repeat activated expression only
in the
-cell lines (Fig. 1),
consistent with its restricted activity only in
-cells of transgenic
mice. The complete three-element enhancer is active only in the acinar
cell lines (Fig. 1), consistent with its activity in acinar cells of
mice. However, the single B element residing within the enhancer is not
active in the
-cell lines, in contrast to its action in
-cells of
mice (32). Both the repeat and enhancer forms of the B
element are inactive in nonpancreatic cell lines (i.e., HeLa [Fig. 1]
and NIH 3T3 and Rat2 [data not shown]). Thus, the two different
activities of the B element in mice are largely reproduced in acinar
cell and
-cell lines.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Activity of the ELA1 enhancer and the
ELA1 B-element repeat in acinar cell, -cell, and
nonpancreatic cell lines. The enhancer (nucleotides 205 to 93 of
the ELA1 gene) contains three elements: A, B, and C. The
B-element repeat has five tandem copies of the B element. The reporter
gene in each case was the hGH gene under the direction of the rat
ELA1 minimal promoter (nucleotides 92 to +8 in the
ELA1 gene). Construct details are in Materials and Methods.
Fold activity is expressed as the ratio of the activity of the test
construct to the activity of the minimal promoter. The activity of the
enhancer relative to that of the promoter is much greater in 266-6 than
in the acinar AR42J cells because the activity of the minimal promoter
in the 266-6 cells is extremely low and the activity of the enhancer is
high. The differences in levels of reporter gene activity between the
expressing and nonexpressing cell lines for both the ELA1
enhancer and the ELA1 B-element repeat are statistically
significant (P < 0.001) in all instances.
|
|
Different regions of the B element mediate the endocrine and acinar
cell activities.
Previous results suggested that two different
regions of the initially defined B element may be active in acinar
cells versus
-cells (32, 78). To define the minimal
region required for activity of the B element in
-cells, overlapping
4-bp transversion mutations of the element (Fig.
2A) were tested as homomultimeric repeats
by transfection into the RIN38
-cell line. The mutant repeats were
linked to the minimal promoter of the ELA1 gene (nucleotides
92 to +8). The results are not dependent on the ELA1
promoter specifically, because the B-element multimer (31,
32b) and the ELA1 enhancer (52) can also
activate other minimal promoters, resulting in the same specificity of
expression in transgenic mice and transfected cells. Mutations within
an 8-bp region, ATAAATGA, effectively inactivated the
B-element multimer in RIN38 cells (Fig. 2B).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
One side of the B element is more important in acinar
cells than in islet cells. (A) Sequence of the B element (rat
ELA1 nucleotides 162 to 143) with the region of each
4-bp transversion mutation indicated by underlining or overlining. (B)
Percent activity of repeats of each mutant in RIN38 cells compared to
the activity of the repeat of the unmodified element. Error bars
represent standard errors of the mean. (C) Comparison of the relative
activity of each mutant B element in RIN38 and 266-6 cells revealed
that the 5' side of the element is more critical to activity in 266-6 acinar cells than in RIN38 -cells. The data for each mutant B
element within the context of the enhancer in acinar 266-6 cells was
taken from reference 78.
|
|
The same series of mutations introduced into the B element within the
context of the

205/

93
ELA1 enhancer previously
delineated
a longer sequence of 10 bp,
AGATAAATGA,
required in 266-6 acinar
cells (
78). In addition to
the differences in the length of
the active element in the two cell
types and in the context in
which it is active (as a repeat in

-cells and as part of the
three-element enhancer in acinar cells),
the relative importance
of particular nucleotide positions within the
element differed.
We compared the relative effects of the mutations in
the B-element
repeats in RIN38 cells and of the same mutations in the B
element
within the
ELA1 enhancer in 266-6 cells (Fig.
2C).
The bases at
the 5' side of the B element are critical to its activity
in the
266-6 acinar cells and are of less importance in the

-cell
line.
This result implies that the acinar cell and

-cell activities
are mediated by different factor complexes with different sequence
requirements and is consistent with the different complexes that
form
on this element in nuclear extracts from each cell type (see
below).
Different complexes containing PDX1 are active in
-cells and
acinar cells.
To understand the basis of the two activities of the
B element in the
-cells and acinar cells, we identified the
transcription factors that are responsible for its activity in each
cell type. Previous results for RIN38
-cells identified a binding
activity, termed
TF-1, with nucleotide sequence requirements
coincident with the 8-bp region essential to activity in RIN38 cell
transfections (32). A different binding activity, termed the
C complex (Fig. 3), was identified in
nuclear extracts of 266-6 acinar cells (78). This complex is
not present in RIN38 nuclear extracts. The binding specificity of the C
complex matched the B-element region critical to the activity of the
enhancer in the acinar cell line (78). The C complex is
formed by the interaction of a factor (termed L) with migration and
binding specificity similar to those of
TF-1 and another factor(s)
which did not appear to bind to the B element on its own. The results
presented below demonstrate that
TF-1 and L are identical and are
contained in the C complex.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
The active complexes in RIN38 -cells and in 266-6 acinar cells contain PDX1. Anti-PDX1 serum ( -PDX1) or preimmune
serum (P.I.) was added to EMSA mixtures with the B-element
oligonucleotide (see Materials and Methods). The identity of each major
gel shift band is indicated at the left of each panel. Antibody against
PDX1 eliminated the complex previously termed TF-1 in RIN38 cells
(32) and L in 266-6 cells (78). Antibody against
PDX1 also eliminated the slow-mobility complex in 266-6 cells
previously termed the C complex (78). The EMSA of 266-6 nuclear extract without added antibody (lane none) is shown as a
shorter exposure than for the other lanes in the panel in order to
better visualize the three binding activities. GATA4 is present in
266-6 nuclear extracts and bound to the B oligonucleotide in EMSAs but
is not responsible for the activity of the B element in these cells
(78).
|
|
The high AT content of the B element suggested that the active factors
in each cell type might be homeodomain proteins. An
appropriate
candidate was the pancreas- and duodenum-specific
homeodomain protein
PDX1, which binds to an element in the insulin
gene promoter (
51,
56) and is critical to pancreatic development
(
22,
50). Antibody specific for either rat or
Xenopus PDX1
specifically eliminated the

TF-1 band from RIN38 nuclear extracts
(Fig.
3, left panel, and data not shown). Thus, the

TF-1 binding
activity from RIN38

-cells contains PDX1. In nuclear extracts
from
266-6 acinar cells, anti-PDX1 antibody eliminated both the
L complex,
with mobility similar to that of

TF-1, and the acinar
cell-specific
C complex (Fig.
3, right panel). Therefore, the
266-6 acinar cell
nuclear extract has two B-element binding activities
containing PDX1.
The slower-migrating form (the C complex) corresponds
to the active
species in these cells (
78).
PDX1 can activate the B element in nonpancreatic cells.
To
confirm the ability of PDX1 to activate transcription through the B
element, we tested the effect of PDX1 on the expression of the
B-element repeat reporter gene in HeLa cells (Table
1). The B repeat does not increase the
activity of a minimal promoter in HeLa cells (Fig. 1), consistent with
the absence of the pancreatic transcription factor PDX1. When exogenous
PDX1 was added by cotransfection, the activity directed by the B repeat
increased 100-fold (Table 1), whereas the activity of the minimal
promoter without the repeat was not affected (data not shown). In
contrast, increasing the level of PDX1 in 266-6 cells did not activate
the B-repeat reporter gene, consistent with the inability of the acinar
form of PDX1 (the C complex) to activate the B element in the absence of the A and C elements of the ELA1 enhancer.
PDX1 mRNA is present in exocrine as well as endocrine cell
lines.
Although it is not strongly expressed throughout the acinar
tissue of the adult mouse pancreas, PDX1 is detectable in
amylase-positive exocrine cells in the developing mouse pancreas at
least as late as 16.5 days postcoitum (19, 50) and in the
acinar cells of the frog throughout life (84). Moreover,
lacZ reporter genes under the direction of the PDX1
transcriptional control region express
-galactosidase in the acinar
cells of the adult mouse, although at a substantially lower level than
in the islets (85). Therefore, the presence of PDX1 in the
acinar cell line 266-6 is not surprising. Indeed, PDX1 mRNA was present
in all pancreatic cell lines tested, including three insulinoma lines
(RIN38,
TC-3, and Ins1) and three acinar cell lines (266-6, AR42J,
and C5-2E) of widely divergent origins, as well as mouse pancreas (Fig.
4, top panel) and rat pancreas (data not
shown). The levels of PDX1 mRNA in the cell lines are similar, except
for smaller amounts in the rat AR42J acinar cell line. PDX1 protein
levels, as assayed by Western blot analysis, parallel the mRNA levels
in the various pancreatic cell lines (data not shown). PDX1 mRNA was
not detected in Northern blots of poly(A)-enriched RNA from HeLa, NIH
3T3, or Rat2 fibroblast cells (data not shown). Therefore, the presence of PDX1 is a general and selective property of pancreatic acinar cell
as well as
-cell lines.

View larger version (102K):
[in this window]
[in a new window]
|
FIG. 4.
PDX1 mRNA and multiple species of PBX mRNA are present
in both acinar and endocrine cell lines. Each lane contained 5 µg of
poly(A) RNA from mouse pancreas or the cell line indicated at the top.
(Top panel) Hybridization with a PDX1 probe revealed PDX1 message in
both exocrine and endocrine cell lines. As previously observed
(41, 51), a 2.3-kb mouse PDX1 mRNA was detected in the mouse
cells, whereas shorter mRNAs of 1.5 and 1.2 kb were found in rat cells.
(Bottom panel) The same Northern blot membrane as in the top panel was
hybridized to a full-length PBX1 cDNA probe, which hybridizes with all
three known PBX family members. The panel was then hybridized with
short probes specific for either PBX1, PBX2, or PBX3. Bands specific
for PBX1, PBX2, and PBX3 are indicated by 1, 2, and 3, respectively.
The three major PBX1 RNAs from the murine cell lines were 7.7, 3.8, and
2.8 kb, whereas human transcripts of 7.6 and 2.2 kb have been reported
(42). The major PBX2 transcript in these cell lines was 1.7 kb, smaller than the 3.2-kb PBX2 RNA of human cells (42).
The PBX3 RNA present in each cell line is approximately 4 kb.
|
|
PDX1 forms a complex with PBX in acinar cell but not
-cell
lines.
PDX1 is one of a group of homeodomain proteins that
interacts with members of the PBC family of homeodomain proteins
(13, 47, 57, 60). In humans, this family includes PBX1a and
PBX1b (splice variants differing at the carboxyl terminus), PBX2, and PBX3a and PBX3b (also carboxyl-terminal splice variants) (24, 42,
49). In Drosophila the PBX homolog EXD is an essential partner to many of the HOX proteins controlling cell specification (38, 82). A complex containing PDX1 and a PBX can bind to the TseII element of the rat somatostatin gene (57). To
determine whether a PBX protein is part of the C complex, a polyclonal
antibody that recognizes all members of the PBX family was added to
266-6 nuclear extract. This addition eliminated the C complex (Fig. 5A). Therefore, the complex responsible
for activity of the B element in 266-6 acinar cells contains both PDX1
and PBX. Anti-PBX antibodies had no effect on the B-element binding
activities in RIN38 nuclear extract (Fig. 5A). Thus, we infer that PDX1
is bound to the B element without a PBX partner in RIN38
-cells and
in this uncomplexed form can activate a linked minimal promoter. In
contrast, a complex containing both PDX1 and PBX binds the B element in
266-6 cells, but this complex is not sufficient to activate
transcription, requiring instead the cooperation of the factors bound
to the other enhancer elements.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
The active complex in 266-6 cells contains PBX1b as well
as PDX1. (A) An antibody specific for the PBX family ( -PBX)
eliminated the C complex from 266-6 nuclear extract (left panel);
neither an antibody specific for the PBX family nor preimmune serum
(P.I.) eliminated the PDX1 complex in RIN38 nuclear extract, although
this complex was completely eliminated by anti-PDX1 antibody ( -PDX1)
(right panel). (B) An antibody specific for PBX1 ( -PBX1), but not an
antibody specific for PBX2 ( -PBX2) or PBX3 ( -PBX3), supershifted
the PDX1-PBX-containing C complex. Asterisks mark the positions of the
supershifted complexes. (C) An antibody specific for PBX1b ( -PBX1b),
but neither an antibody specific for PBX1a ( -PBX1a) nor preimmune
serum, also supershifts the C complex. An asterisk marks the position
of the supershifted complex. To simplify the binding pattern by
eliminating the binding of GATA4, the EMSA mixtures include a
competitor oligonucleotide bearing a GATA binding site (78)
(see Materials and Methods). The B-element oligonucleotide (see
Materials and Methods) was the 32P-labeled probe
throughout. Each panel shows lanes from a single gel.
|
|
mRNAs for PBX1, PBX2, and PBX3 are in acinar and endocrine cell
lines.
To determine whether the presence of PBX in a
PDX1-PBX complex in pancreatic cells was correlated simply with
the presence of a Pbx mRNA, we examined the distribution of
the mRNAs for PBX1, PBX2, and PBX3 in the pancreatic acinar cell and
-cell lines (Fig. 4, bottom panel). Multiple species of
Pbx1 RNA are present in each cell line, regardless of their
endocrine or exocrine origins. Transcripts of Pbx2 and
Pbx3 are also present in each cell line. The presence of
Pbx mRNAs in both cell types cannot explain the selective
formation of the PDX1-PBX complex in acinar cells but is consistent
with previous reports that mRNAs for all three Pbx genes are
widespread (42, 65). The acinar cell specificity of the
complex must therefore be controlled after transcription of the
Pbx genes.
To further examine the PBX mRNAs present in the 266-6 acinar cell line,
we screened a 266-6 cDNA library and identified cDNAs
encoding PBX1a
and -1b, PBX2, and PBX3a and -3b (Table
2). The
clones for the mouse PBX1 splice
variants, PBX1a and PBX1b, encode
amino acid sequences identical to
those of the human proteins.
The mouse forms of PBX2 and the PBX3
splice variants, PBX3a and
PBX3b, are extremely similar to the human
proteins, with only
nine amino acid residues different for PBX2, one
for PBX3a, and
two for PBX3b. The presence of cDNA clones representing
all three
classes of PBX is consistent with the detection of mRNAs for
all
three classes by Northern hybridization.
PBX1b is a component of the active PDX1-PBX complex of 266-6 acinar
cells.
To identify the PBX protein(s) present in the C complex
from 266-6 nuclear extracts, we examined the effect of adding
antibodies specific for PBX1, -2, or -3 on the gel mobility complexes
formed on the B element with nuclear extract from 266-6 acinar cells. The C complex was diminished by the antibody specific for PBX1 but was
unaffected by antibodies specific for PBX2 or PBX3 (Fig. 5B).
Furthermore, an antibody specific for PBX1b eliminated the C
complex, whereas complex formation was unaffected by an
antibody specific for PBX1a (Fig. 5C). Therefore, although mRNAs for
all five PBXs are present in 266-6 cells, only a single PBX protein species, PBX1b, is present in the C complex with PDX1.
Of the five PBX isoforms assayed by Western analysis, only PBX1b and
PBX2 were detected in nuclear extracts of 266-6 cells
(Fig.
6A). Therefore, the selective presence of
the 1b isoform
of PBX in the C complex is explained in part by
the absence of
all other PBX proteins except PBX2, and PBX2 must be
excluded
from the complex by some other process.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 6.
Nuclear and cytoplasmic distribution of PBX species for
endocrine and exocrine pancreatic cells. (A) 266-6 nuclear extract
contains PBX1b and PBX2, whereas RIN38 nuclear extract contains only
PBX2. Western analyses of nuclear extracts (30 µg of total
protein/lane) from 266-6 or RIN38 cells were probed with antibodies
specific to PBX1a, PBX1b, PBX2, and PBX3. IVT PBX species (0.5 µl)
present in each panel demonstrate the specificity and reactivity of
each antibody. (B) PBX1b is present in three different exocrine cell
lines but is absent in three endocrine cell lines. Western analyses of
nuclear extracts (30 µg of total protein/lane) from the acinar cell
lines AR42J, ARIP, and 266-6 and the -cell lines RIN38, TC-3, and
Ins1, as well as a control (Jurkat pre-B) cell line, were probed with
antibodies specific for PBX1. (C) Cytoplasmic versus nuclear
localization of PBX species in 266-6 acinar and RIN38 endocrine cells.
Cytoplasmic and nuclear extracts (30 µg of total protein/lane) probed
with antibodies specific to PBX1, PBX2, and PBX3 detected PBX1b only in
the 266-6 nuclear compartment, PBX2 in both the nuclei and cytoplasm of
both the endocrine and acinar cell lines, and PBX3b only in the
cytoplasm of the two cell lines. Numbers on the left in each panel are
molecular masses in kilodaltons.
|
|
PBX1b was present in nuclear extracts from all three exocrine
pancreatic cell lines examined but was absent from the nuclear
extracts
of all three

-cell lines (Fig.
6B). Therefore, the presence
of
nuclear PBX1b may be a distinguishing trait of exocrine pancreatic
cell
lines. Because PBX1 transcripts were detectable in the

-cell
lines
(Fig.
4B) and the activity of the
Drosophila PBX homolog
EXD
is regulated by cytoplasmic-to-nuclear translocation (
3,
40), we compared cytoplasmic and nuclear fractions from RIN38
and
266-6 cells (Fig.
6C). Neither cytoplasmic fraction contained
either
PBX1 isoform, demonstrating that the endocrine cells are
devoid of PBX1
protein and not simply blocked in its nuclear import.
These results
show that the C complex containing PBX1b cannot
form in the

-cell
lines because PBX1b protein is absent.
It is noteworthy that each PBX isoform has a different pattern of
subcellular and cell type distribution (Fig.
6C). PBX1a
protein is not
detected in either 266-6 or RIN38 cells. PBX1b
protein is absent from
RIN38 cells and is present in 266-6 cells
almost exclusively in the
nucleus. PBX2 protein is in both the
nuclear and cytoplasmic fractions
of both cell lines. Whereas
PBX3a is not detected, PBX3b is in the
cytoplasmic fractions,
but not the nuclear fractions, of both the
endocrine and acinar
cells.
PBX1, PBX2, and PBX3 can form complexes with PDX1 in vitro.
To
determine whether each of the PBX isoforms is capable of forming a
complex with PDX1 on the B element, in vitro-translated mouse PDX1 and
each species of IVT PBX were tested for their abilities to bind
separately and as a PDX1-PBX complex. IVT PDX1 bound to the B element
had a mobility identical to that of L in the 266-6 nuclear extract
(Fig. 7). In contrast, among the IVT PBX
species little if any complex formed in the absence of PDX1. The faint but detectable complexes formed by PBX3a are consistent with previous findings that only PBX3 can bind a PBX consensus site in the absence of
a homeodomain protein partner (46). All of the IVT PBX
species formed complexes with PDX1 on the B element. However, the
electrophoretic mobility of each heterodimeric complex, including that
of PDX1-PBX1b, was greater than the mobility of the native C
complex (Fig. 7). The slower electrophoretic mobility of the native C
complex than that of the IVT PDX1-PBX1b suggested the presence of an
additional factor(s) in the native complex.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 7.
IVT PDX1 and PBX can form complexes on the B element.
cDNA clones for PDX1 and each of the species of PBX were transcribed
and translated in vitro (see Materials and Methods). An equal molar
amount of each IVT PBX species was added to an EMSA mixture containing
32P-labeled B oligonucleotide in the presence or absence of
the same amount of IVT PDX1. The IVT PDX1 was capable of forming a
complex on the B oligonucleotide (first lane), but each PBX isoform was
largely unable to bind the oligonucleotide in the absence of PDX1. PDX1
and each of the PBX species were able to form a heteromeric complex on
the B element. All of the PDX1-PBX complexes had a greater mobility
than the PDX1- and PBX1b-containing C complex from 266-6 nuclear
extract (rightmost lane).
|
|
The third protein of the complex is MRG1.
Because the
MEIS family of homeodomain cofactors can interact with members of
both the PBX and HOX protein families (12, 64, 72), we
tested whether a MEIS family protein is present in the C complex,
although a trimeric complex containing both MEIS and PBX had not
yet been described. Antibodies against MRG1 (MEIS2), decreased
the intensity of the C complex by more than half (Fig.
8A). Therefore, the acinar cell-specific
C complex contains three different homeodomain proteins: PDX1, PBX1b,
and MRG1. The slight decrease in intensity of the C complex when
anti-MEIS1 is added may be due to the presence of MEIS1 in a small
fraction of the complexes.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 8.
The C complex contains MRG1 (MEIS2). (A) An antibody
specific for MRG1 ( -MRG1) largely eliminates the C complex bound to
the B element. The binding of GATA4 present in the 266-6 nuclear
extract was eliminated by inclusion of a competitor oligonucleotide
bearing a GATA binding site (see Materials and Methods). (B) Western
analyses of nuclear extracts (30 µg of total protein/lane) from the
266-6 or RIN38 cell line probed with antibodies specific for MEIS1 or
MRG1 revealed that MEIS1 and MRG1 are present only in the acinar cell
line. Numbers on the left and right indicate molecular masses in
kilodaltons. (C) A complex containing IVT PDX1, IVT PBX1b, and IVT
MRG1a has a mobility identical to that of the C complex. Each of the
three IVT proteins was incubated alone or in combinations, as indicated
at the top, with an oligonucleotide containing a consensus PBX-PDX1
binding site (see Materials and Methods). The addition of equal molar
amounts of the IVT proteins or of twofold molar amounts is indicated
above the lanes. The rightmost lane shows the PDX1 and C complex formed
on this oligonucleotide when incubated with 266-6 extract. The
mobilities of IVT PDX1 (i), IVT PDX1-PBX1b (ii), and IVT
PDX1-PBX1b-MRG1a (iii) complexes are indicated at the left.
|
|
Consistent with the presence of MRG1 in the exocrine specific C
complex, MRG1 is found in 266-6, but not RIN38, nuclear extracts
(Fig.
8B). MRG1 is also present in the other two exocrine pancreatic
lines
examined, AR42J and ARIP, and is absent from the two other
insulinoma cell lines, Ins1 and

TC-3 (data not shown).
Therefore,
the presence of both MRG1 and PBX1b is a distinguishing
characteristic
of exocrine versus endocrine pancreatic cell lines.
MEIS1 is also
found in 266-6, but not RIN38, nuclear extracts
(Fig.
8B).
IVT PDX1, PBX1b, and MRG1a form a complex with a mobility
identical to that of the C complex on a consensus PDX1-PBX
binding
site (Fig.
8C). MRG1a cannot bind alone or in pairwise
combination
with either PDX1 or PBX1b but requires both of the other
factors
to be present in order to participate in the complex. Doubling
the amount of PBX1b increased the levels of the PDX1-PBX1b and
PDX1-PBX1b-MRG1a complexes. Doubling the amount of MRG1a led to
a
disappearance of the PDX1-PBX1b complex.
PBX binding alters the activity of PDX1 in acinar cells.
Our
results indicate that binding of the C complex (PDX1-PBX1b-MRG1) to the
B element is required to complement the activity of the A and C
enhancer elements in acinar cells. In contrast, a repeat of the B
element is inactive in these cells, although it is active in
-cells
in which both PBX1b and MRG1 are absent. Therefore, the presence of
PBX1b and/or MRG1 in the acinar binding complex appears to suppress the
ability of PDX1 to activate the B-element repeat. The different
transcriptional activities of PDX1 and the PDX1-PBX1b-MRG1 complex are
summarized in Fig. 9. To test whether
eliminating binding of the C complex while retaining binding of PDX1
would create elements that are active as repeats in the acinar 266-6 cell line, we tested several of the 4-bp transversion mutants shown in
Fig. 2. Mutant B, which reduces C-complex binding without affecting
PDX1 binding, was indeed active as a repeat in 266-6 cells, to a level
10% that of the intact enhancer (Figure 10, row b). Mutant C, which strongly
decreases C-complex formation but also decreased PDX1 binding, was less
active (Figure 10, row c). Mutant D eliminates both C-complex and PDX1
binding and, as predicted, was inactive (Figure 10, row d). In
contrast, in the RIN38
-cell line, mutant B was as active as the
unmodified B element (Figure 10, row b), consistent with the activity
of the B repeat requiring only PDX1 binding in these cells. Both
mutants C and D, which interfered with PDX1 binding, had greatly
reduced activity in the
-cell line (Figure 10, rows c and d).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 9.
Summary of the activities of the complexed and
uncomplexed forms of PDX1. (A) The minimal elastase I enhancer
comprises three short sequence elements, all of which are required for
enhancer activity in acinar cell lines. The pancreatic acinar
cell-specific factor PTF1 binds the A element, an unidentified complex
binds the C element, and the PDX1-PBX1b-MRG1 complex binds the B
element. In -cell lines, PTF1 is absent and PDX1 with the C-element
binding factors is not sufficient for enhancer activity. (B) A 2-bp
mutation (indicated by the pair of short vertical lines) in the PBX
half site prevents PBX binding and inactivates the enhancer in acinar
cell lines. (C) In acinar cells the PDX1-PBX1b-MRG1 complex binds and
the repeat is inactive. In -cells the B element repeat binds PDX1
without PBX1b-MRG1 and is active. (D) Mutation of the PBX half site in
the B element (B-P2) has no effect on the activity of the repeat in
-cells but activates the repeat in acinar cells by preventing
PBX1b-MRG1 binding.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 10.
Activity of a mutant B-element repeat in acinar 266-6 cells requires the absence of a PBX binding site and an intact PDX1
binding site, whereas activity in RIN38 cells is largely unaffected by
the presence or absence of a PBX binding site. The sequence of the
ELA1 B element is shown in row a, and the changes in each
modified element tested are shown below the wild-type sequence. Rows:
a, wild-type B element; b, mutant B; c, mutant C; d, mutant D; e,
mutant B-P2; f, B-P2I+; g, wild type (wt). Mutants B, C, and D
correspond to those shown in Fig. 2. Boxes around the sequences
indicate the binding sites for PBX and PDX1 based on the effects of
mutations on PDX1 and C-complex binding and the model of Knoepfler et
al. (26). The panel at the left shows the EMSA binding
patterns with oligonucleotides of each element in 266-6 nuclear
extract. The positions of PDX1 and the C complex are marked at the top
of the panel. The top of the gel is to the right. The GC-rich mutant D
created a binding site for an unknown factor that migrated faster than
the PDX1 complex and was incapable of activating the repeat. The band
between the PDX1 and the C complex is the GATA4 complex. At the right
is the activity of each repeat construct in transfections of 266-6 or
RIN38 cells. The activities of the mutant B-element repeats in RIN38
cells are expressed as percentages of the activity of the unmodified B
repeat. The activities of the mutant B repeats in 266-6 cells are
expressed as percentages of the activity of the ELA1
enhancer construct (nucleotides 205 to 93), because the unmodified
B repeat is inactive in 266-6 cells.
|
|
The PBX binding site of the B element contains a central AGAT, in
contrast to the TGAT of the PBX consensus binding site (
11,
26,
46). To more clearly establish the dependence of the activity
of
a homomultimeric element on the absence of PBX1b binding, we
created a
2-base mutation of this core PBX binding site (AGAT
to ATCT).
This mutation completely eliminated C-complex binding
retained
PDX1 binding (B-P2; Figure
10, row e). As predicted for
selectively
eliminating PBX binding, this mutant was highly active
as a repeat in
266-6 cells as well as RIN38 cells (Fig.
10, row
e, and 9D). A further
change (Fig.
10, row f) which strengthens
PDX1 binding by making the
element better match the PDX1 site
of the strong PBX-PDX1 site found in
the somatostatin gene (
57)
further increased the activity of
the repeat in the acinar cell
line. In contrast to the activity of the
B-P2 repeat, the same
2-bp mutation in the context of the three-element
enhancer reduced
the activity of the enhancer 10-fold in 266-6 acinar
cells (data
not shown), consistent with the acinar cell requirement for
PBX
binding for enhancer activity (Fig.
9B). These results indicate
that the association of PBX1b-MRG1 with PDX1 acts as a switch
to change
the nature of PDX1 activity.
In 266-6 cells the B-element multimer was not activated by adding
exogenous PDX1 (Table
1), presumably because there is sufficient
PBX1b
and MRG1 to form the C complex with the additional PDX1.
Because the
B-P2 multimer construct (Fig.
10, row e) (which binds
PDX1 but not the
C complex) was active in 266-6 cells, we tested
whether it would
respond to increased levels of PDX1. Increasing
PDX1 led to an ninefold
increase in the activity of the B-P2 mutation
(Table
1). This induction
confirms that PDX1 can activate transcription
even in acinar cells,
provided that binding by the complete C
complex is prevented.
 |
DISCUSSION |
PDX1 is active alone and as part of a PDX1-PBX1b-MRG1 complex.
PBX and MEIS proteins are generally thought to affect HOX factor
activity by providing additional binding site specificity and affinity
that are important for HOX function in vivo (39, 72). More
recently, the Drosophila MEIS homolog homothorax (HTH) has
been implicated in controlling HOX function by regulating the nuclear
import of the HOX cofactor and PBX homolog EXD (64). Here we
provide evidence that PBX and MEIS in combination can change the
qualitative nature of the transcriptional activity of an organ-specific
homeodomain factor in a cell-specific manner. Our results show that two
different pancreatic transcription factor complexes can bind to and
activate transcription through the B element of the ELA1
enhancer and that the nature of the transcriptional activation differs
for the two complexes. The pancreatic homeodomain factor PDX1 is common
to both complexes. In pancreatic acinar cell lines a complex containing
PDX1, PBX1b, and MRG1 (MEIS2) binds the B element. In
-cell
lines PDX1 binds alone.
PBX1b is a member of the PBC family of homeodomain proteins (
8,
9), which includes EXD of
Drosophila, Ceh-20 of
Caenorhabditis,
and PBX1, PBX2, and PBX3 of vertebrates. In
addition to containing
a highly conserved homeodomain, the PBC proteins
are characterized
by an extra three amino acid residues between helices
1 and 2
of the homeodomain, a feature of the TALE superclass of
homeodomain
proteins (
7). The PBC proteins form heterodimers
with members
of the
Antennepedia class of homeodomain
proteins, which share
similar homeodomain sequences and a conserved
pentapeptide motif
(consensus, YPWMR) required for the HOX-PBC
interaction near and
amino terminal to the homeodomain (
13,
47,
60). Compared
to either HOX or PBC proteins alone, HOX-PBC
heterodimers have
increased binding affinities, extended DNA
recognition sites of
10 to 13 rather than 6 bp (
11,
46), and
in some instances
a recognition sequence different from the simple
composite of
the HOX and PBC consensus half sites (reviewed in
reference
39).
Thus, the association of a PBC
protein with a HOX protein is thought
to confer the affinity and
binding site recognition specificity
required for the in vivo functions
of HOX proteins.
PDX1 is a member of the
Antennepedia class of homeodomain
proteins (
35) and is part of the recently discovered ParaHox
cluster
expressed in the endoderm (
6).
PDX1
expression is restricted
to the pancreas and rostral duodenum
(
50). PDX1 binds its recognition
site effectively without a
PBX partner (reference
57 and this
study), although
a PBX partner does stabilize binding in vitro
(
57). PDX1 is
inherently capable of interacting with all five
PBX family members
tested (Fig.
7). Our results show that (depending
on the context) PDX1
can be transcriptionally effective without
a PBX partner: it is active
in

-cell lines, which do not form
a PDX1-PBX complex, and its action
through the B element (outside
the context of the elastase enhancer)
does not require an intact
PBX half site.
A third homeodomain protein, MRG1 (MEIS2), is also in the acinar
PDX1-containing complex.
Mrg1 is one of the three known
members
of the
Meis family of homeobox genes
(
Meis1,
Mrg1, and
Mrg2) (
44,
75). Each member encodes multiple isoforms (
43,
55).
The
prototypic
Meis family gene,
Meis1, was
identified as a common
site for retroviral integration in myeloid
leukemias of BXH-2
mice (
43). The MEIS family homeodomain is
closely related to
the PBC homeodomain, including the three-amino-acid
insertion
characteristic of the TALE superclass (
7). The
relatedness
of the MEIS and PBC homeodomains suggested that MEIS
proteins
may have functions similar to those of the PBC proteins, such
as binding cooperatively with other homeodomain proteins
(
43).
Indeed, the frequent coactivation of
Meis1
with
Hoxa7 or
Hoxa9 in myeloid leukemias
suggested that MEIS proteins may work in
concert with some HOX
proteins (
45). Shen et al. (
72) have
shown that
MEIS proteins form cooperative DNA binding complexes
with the
ABD-B-like subset of HOX proteins (HOX paralog groups
9 through
13). This paralog subgroup complements the subgroup
(HOX1 through -10)
which form complexes with PBX (
71). MEIS1
can also bind
cooperatively with PBX1b to a combined PBX-MEIS
consensus site
(TGAT/TGACAG) (
12). Aside from contributing
binding
stability, a transcriptional role for MEIS in these complexes
has not been shown. However, a natural cyclic AMP-responsive element
in
the bovine
CYP17 gene has been shown to bind a PBX1-MEIS
complex
(
5). Our results add to the understanding of the
role of MEIS
proteins by demonstrating that MRG1 forms a multimeric
complex
containing both a PBX and an organ-specific homeodomain
protein.
The presence of PDX1, PBX1b, and MRG1 in a single mobility shift
complex indicates that the active form of PDX1 in acinar
cells is part
of a novel trimeric complex of an organ-specific
homeodomain protein, a
PBC family member, and a MEIS protein.
As the MEIS1 and HOX interaction
domains map to different regions
of the PBX1 protein (
25),
it is likely that the complex forms
through the simultaneous
interaction of MRG1 and PDX1 with PBX1b.
The short, 10- to 12-bp
binding site for the C complex on the
B element is consistent with
DNA contacts by both components of
a PDX1-PBX1 dimer but is
inconsistent with contacts by all three
members of the PDX1-PBX1b-MRG1
trimer. The ability of MEIS to
interact with both PBX and a subset
of HOX proteins in the absence
of DNA (
12,
72), coupled with
the ability of the B element
to bind IVT PDX1-PBX, but not IVT
PBX1b-MRG1a or IVT MRG1a-PDX1,
implies that the MRG1
interaction in the trimeric complex does
not require a specific DNA
recognition site. Berthelsen et al.
(
4) have recently
described a trimeric complex of HOXB1, PBX1,
and PREP1 (pKNOX1) that
binds a HOXB1-PBX site. PREP1 (pKNOX1)
is a member of the TALE
homeodomain family with a homeodomain
most closely related to the MEIS
subfamily. In the trimeric complex,
the PREP1 homeodomain is not
required for DNA binding of the complex,
similar to the model we
propose for PDX1, PBX1b, and MRG1.
PDX1 and the PDX1-PBX1b-MRG1 complex have different transcriptional
activities.
The activity of the ELA1 transcriptional
enhancer in the acinar 266-6 cell line requires the binding of the
PDX1-PBX1b-MRG1 trimer to the B element, the acinar cell-specific
factor PTF1 to the A element (66, 67), and an
as-yet-unidentified factor to the C element. The PDX1-PBX1b-MRG1
complex apparently acts in concert with the other enhancer-bound
transcription factors, and in this context, PDX1 alone bound to the B
element is not sufficient. Therefore, mutations in the PBX binding site
within the B element that eliminate binding of the PDX1-PBX1b-MRG1
trimer, while still permitting PDX1 binding, inactivate the
enhancer in the acinar cell line.
Although the PDX1-PBX1b-MRG1 complex is required for the activity of
the three-element elastase enhancer, PDX1 is sufficient
for activation
of an artificial enhancer constructed by multimerizing
the B element.
Moreover, formation of the PDX1-PBX1b-MRG1 complex
prevents
transcriptional activation from the binding site repeat.
Therefore, in
this context the association with PBX1b-MRG1 represses
transcriptional
activation by PDX1, whereas in the context of
the enhancer the trimeric
complex is required and PDX1 alone is
insufficient.
In the 266-6 acinar cell line, all three proteins of the
PDX1-PBX1b-MRG1 complex are present, and the different activities
of
the complex and of PDX1 can be elicited under appropriate conditions.
Thus, B elements with PBX half-site mutations that eliminate trimer
binding are inactive in the enhancer. However, the same mutation
activates a repeat construct in these acinar cells, because it
allows
PDX1 binding without associated PBX1b and MRG1.
RIN38

-cells cannot form a PDX1-PBX1b-MRG1 complex because they
contain neither PBX1b nor MRG1. Therefore, the activity of
a B-element
repeat is dependent only on the presence of a PDX1
binding site, and
the presence or absence of a PBX half-site has
little, if any, effect.
Although nuclei of the

-cell line contain
PBX2, this factor does not
form a complex with PDX1 on the B element
in nuclear extracts, and
the lack of importance of the PBX binding
site within the B element in
these cells implies that it also
does not form a complex with PDX1 on
the B element in living cells.
It is not clear whether PBX1b or MRG1 (or both) alters the
transcriptional activity of PDX1. The interaction with PBX1b may
confer
this change; in this instance MRG1 may contribute properties
not
detected in our analyses. PBX1a and -1b proteins, for example,
have a
curious repressing activity associated with a region N
terminal to the
homeodomain (
36). This activity is detected
in transfected
cells, is not dependent on DNA binding, and can
repress the effect of
some but not all transcription factors (e.g.,
Sp1 but not p53 or VP16).
However, inhibitory effects on homeodomain
partners have not been
reported. Alternatively, because the PDX1-PBX1b-MRG1
complex does
not form in the absence of the PBX half site, PBX1b
may serve to
recruit MRG1, which then would provide the functions
required within
the context of the elastase enhancer and coincidentally
interfere with
the PDX1 activation of the B-element repeat.
The disparate regulation of Pbx family members implies
the existence of distinct functions for each isoform.
We have
shown that Pbx family members are regulated at multiple
posttranscriptional points in both acinar cell and
-cell lines,
including control of protein synthesis or stability, nuclear localization, and formation of multimeric complexes with
other homeodomain proteins. For example, although mRNAs
for PBX1a and -1b, PBX2, and PBX3a and -3b are all present in the
acinar 266-6 cell line (Table 2), PBX1a and PBX3a are not found in
these cells, indicating regulation of either the synthesis or stability
of these PBX species. Regulation in RIN38 cells is similarly complex: PBX1b as well as PBX1a and PBX3a are absent from these cells, although
transcripts for PBX1, as well as PBX2 and PBX3, are present (Fig. 4).
The nuclear import of the PBX proteins is also differentially
controlled. PBX1b is detectable only in the nuclei of the 266-6
cells.
In both the acinar cell and

-cell lines, PBX3b is detectable
only in
the cytoplasm, whereas PBX2 is distributed between the
two
compartments.
A final level of control of nuclear PBX species must occur to regulate
the formation of the complex. PDX1 in acinar cell nuclear
extracts is
complexed only with PBX1b and MRG1, even though other
PBX and MEIS
isoforms are present. Thus, although PBX2 is present
in both RIN38 and
266-6 nuclei and IVT PBX2 and PDX1 can form
a complex on the B element,
no PDX1-PBX2-containing complex can
be detected in nuclear extracts of
either cell type.
The result of this complex regulatory scheme is the presence of only
the PBX1b isoform in the C complex of acinar cells, despite
the
presence in these cells of the mRNAs for all five isoforms
and the
proteins of three isoforms. This implies that the other
PBX isoforms
might have different activities that would be inappropriate
for the C
complex.
MEIS and the nuclear localization of PBX isoforms.
The
translocation of EXD from cytoplasm to nucleus is dependent on the
presence of HTH, the Drosophila MEIS homolog
(64). Because MEIS1 can substitute for HTH to induce this
translocation in Drosophila S2 cells, the nuclear
localization of mammalian PBX species is also likely to depend on the
presence of an MEIS isoform. We have shown, however, that MRG1 and
MEIS1 (which are present in 266-6 cells but absent in RIN38 cells) are
not sufficient for the nuclear localization of all PBX isoforms, as
PBX3b is found only in the cytoplasm of both cell types. Similarly,
PBX2, which is partially nuclear in both cell lines, must require the presence of an unidentified MEIS species (e.g., MRG2) in both cell
lines or not require an MEIS partner to be imported into the nucleus.
It remains to be determined whether MEIS1 or MRG1 mediates the nuclear
import of PBX1.
Recently, Casares and Mann (
10) have shown that HTH is
required for proper development of the
Drosophila head.
Because nuclear
EXD is not sufficient for head development, HTH appears
to have
a required function in addition to inducing the nuclear
translocation
of EXD. Its participation in multisubunit homeoprotein
complexes
of the sort described in this report may be one such
function.
The existence of multiple MEIS genes (
44,
75), as well as
multiple splice variants of MEIS transcripts (
43,
55),
potentially
adds complexity both to the regulation of PBX localization
and
to the variety of dimer and trimer complexes of PBX, MEIS, and
other homeodomain proteins which may control developmental pathways.
Also yet to be determined is whether posttranscriptional regulation
of
MEIS expression occurs in various cells and tissues. Labial,
a HOX
partner of EXD (
63), is also regulated during
Drosophila development by translocation from the cytoplasm
to the nucleus
(
20), raising the possibility that control of
nuclear import
may be a widespread mode of regulating homeodomain
protein activity.
The endocrine-exocrine dichotomy.
The presence of both PBX1b
and MRG1 in all three exocrine cell lines and their absence in all
three
-cell lines tested suggest that the PDX1-PBX1b-MRG1 complex
and the uncomplexed PDX1 perform important cell-type-specific functions
in the exocrine and endocrine tissue compartments, respectively.
The insulin gene promoter is the best studied of the
regulatory regions of
-cell genes known to be regulated by PDX1. The
rat insulin gene promoter elements A1 and A3/A4 (17) are
activated by PDX1 (51), do not bind PDX1-PBX complexes
(57), and do not contain PBX or MEIS binding sites. The
activity of PDX1 on the insulin promoter without participation of a PBX
partner is as would be expected if the absence of PBX1b and MRG1 in
-cell lines extends to the
-cells of islets. The genes for
glucokinase and GLUT2, which also are expressed selectively in
-cells, have been shown to have functional PDX1 binding sites in
their promoters (79, 80). We predict that these sites as well will be found not to depend on PBX or MEIS binding. If a PDX1-PBX1b-MRG1 complex is the active form of PDX1 in the mature acinar
cells of animals, whereas PDX1 unfettered by other homeodomain partners
is active in
-cells, a switch in PDX1 activity may be an important
control point in distinguishing the acinar cell and
-cell lineages
during pancreogenesis. It will be important to discover how and when
PBX and MEIS appear during pancreogenesis and how this is related to
the adoption of acinar cell and
-cell fates.
 |
ACKNOWLEDGMENTS |
We thank Fred Kruse for early contributions to this work, Jeana
Buxton for excellent technical assistance, Mike Waterman for helpful
discussions and critique of the manuscript, Marc Montminy for providing
anti-STF1 antiserum, and Ira O. Daar for providing MEIS1 and MRG1
antisera.
This work was supported by grant DK-27430 from the National Institutes
of Health (NIH) and a grant from the Juvenile Diabetes Foundation
International to R.J.M. and by NIH grants CA-21124 to A.M.B., DK-42502
to C.V.E.W., and DK-28350 to M. R. Waterman.
Galvin H. Swift and Ying Liu contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Oncology, University of Texas Southwestern
Medical Center, Dallas, TX 75235-9140. Phone: (214) 648-1942. Fax:
(214) 648-1915. E-mail: swift{at}hamon.swmed.edu.
 |
REFERENCES |
| 1.
|
Ahlgren, U.,
S. L. Pfaff,
T. M. Jessell,
T. Edlund, and H. Edlund.
1997.
Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells.
Nature
385:257-260.
|
| 2.
|
Asfari, M.,
D. Janjic,
P. Meda,
G. Li,
P. A. Halban, and C. B. Wollheim.
1992.
Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines.
Endocrinology
130:167-178.
|
| 3.
|
Aspland, S. E., and R. A. White.
1997.
Nucleocytoplasmic localisation of extradenticle protein is spatially regulated throughout development in Drosophila.
Development
124:741-747.
|
| 4.
|
Berthelsen, J.,
V. Zappavigna,
E. Ferretti,
F. Mavilio, and F. Blasi.
1998.
The novel homeoprotein Prep1 modulates Pbx-Hox protein cooperativity.
EMBO J.
8:1434-1445.
|
| 5.
|
Bischof, L. J.,
N. Kagawa,
J. J. Moskow,
Y. Takahashi,
A. Iwamatsu,
A. M. Buchberg, and M. R. Waterman.
1998.
Members of the Meis1 and Pbx homeodomain protein families cooperatively bind a cAMP-responsive sequence (CRS1) from CYP17.
J. Biol. Chem.
273:7941-7948.
|
| 6.
|
Brooke, N. M.,
J. Garcia-Fernandez, and P. W. H. Holland.
1998.
The ParaHox cluster is an evolutionary sister of the Hox gene cluster.
Nature
392:920-923.
|
| 7.
|
Burglin, T. R.
1997.
Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals.
Nucleic Acids Res.
25:4173-4180.
|
| 8.
|
Burglin, T. R.
1994.
A comprehensive classification of homeobox genes, p. 27-71.
In
D. Duboule (ed.), Guidebook to the homeobox genes. Oxford University Press, Oxford, United Kingdom.
|
| 9.
|
Burglin, T. R., and G. Ruvkun.
1992.
New motif in PBX genes.
Nat. Genet.
1:319-320.
|
| 10.
|
Casares, F., and R. S. Mann.
1998.
Control of antennal versus leg development in Drosophila.
Nature
392:723-726.
|
| 11.
|
Chang, C.-P.,
L. Brocchieri,
W.-F. Shen,
C. Largman, and M. L. Cleary.
1996.
Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus.
Mol. Cell. Biol.
16:1734-1745.
|
| 12.
|
Chang, C.-P.,
Y. Jacobs,
T. Nakamura,
N. A. Jenkins,
N. G. Copeland, and M. L. Cleary.
1997.
Meis proteins are major in vivo DNA binding partners for wild-type but not chimeric Pbx proteins.
Mol. Cell. Biol.
17:5679-5687.
|
| 13.
|
Chang, C.-P.,
W.-F. Shen,
S. Rozenfeld,
H. J. Lawrence,
C. Largman, and M. L. Cleary.
1995.
Pbx proteins display hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins.
Genes Dev.
9:663-674.
|
| 14.
|
Cockell, M.,
B. J. Stevenson,
M. Strubin,
O. Hagenbuchle, and P. K. Wellauer.
1989.
Identification of a cell-specific DNA-binding activity that interacts with a transcriptional activator of genes expressed in the acinar pancreas.
Mol. Cell. Biol.
9:2464-2476.
|
| 15.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489.
|
| 16.
|
Efrat, S.,
S. Linde,
H. Kofod,
D. Spector,
M. Delannoy,
S. Grant,
D. Hanahan, and S. Baekkeskov.
1988.
Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene.
Proc. Natl. Acad. Sci. USA
85:9037-9041.
|
| 17.
|
German, M.,
S. Ashcroft,
K. Docherty,
H. Edlund,
T. Edlund,
S. Goodison,
H. Imura,
G. Kennedy,
O. Madsen,
D. Melloul,
L. Moss,
K. Olson,
M. A. Permutt,
J. Philippe,
R. P. Robertson,
W. J. Rutter,
P. Serup,
R. Stein,
D. Steiner,
M.-J. Tsai, and M. D. Walker.
1995.
The insulin gene promoter: a simplified nomenclature.
Diabetes
44:1002-1004.
|
| 18.
|
Graham, F. L., and A. J. van der Eb.
1973.
A new technique for the assay of infectivity of human adenovirus 5 DNA.
Virology
52:456-467.
|
| 19.
|
Guz, Y.,
M. R. Montminy,
R. Stein,
J. Leonard,
L. W. Gamer,
C. V. E. Wright, and G. Teitelman.
1995.
Expression of murine STF-1, a putative insulin gene transcription factor, in cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny.
Development
121:11-18.
|
| 20.
|
Immergluck, K.,
M. Lawrence, and M. Bienz.
1990.
Induction across germ layers in Drosophila mediated by a genetic cascade.
Cell
62:261-268.
|
| 21.
|
Jessop, N. W., and R. J. Hay.
1980.
Characteristics of two rat pancreatic exocrine cell lines derived from transplantable tumors.
In Vitro
16:212.
|
| 22.
|
Jonsson, J.,
L. Carlsson,
T. Edlund, and H. Edlund.
1994.
Insulin-promoter-factor 1 is required for pancreas development in mice.
Nature
371:606-609.
|
| 23.
|
Kagawa, N.,
A. Ogo,
Y. Takahashi,
A. Iwamatsu, and M. R. Waterman.
1994.
A cAMP-regulatory sequence of CYP17 is a cellular target for the homeodomain protein PBX1.
J. Biol. Chem.
269:18716-18719.
|
| 24.
|
Kamps, M. P.,
A. T. Look, and D. Baltimore.
1991.
A new homeobox gene contributes the DNA binding domain of the t(1:19) translocation in pre-B ALL.
Cell
60:547-555.
|
| 25.
|
Knoepfler, P. S.,
K. R. Calvo,
H. Chen,
S. E. Antonarakis, and M. P. Kamps.
1997.
Meis and pKnox1 bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in oncoprotein E2a-Pbx1.
Proc. Natl. Acad. Sci. USA
94:14553-14558.
|
| 26.
|
Knoepfler, P. S.,
Q. Lu, and M. P. Kamps.
1996.
Pbx1-Hox heterodimers bind DNA on inseparable half-sites that permit intrinsic DNA binding specificity of the Hox partner at nucleotides 3' to a TAAT motif.
Nucleic Acids Res.
24:2288-2294.
|
| 27.
|
Krapp, A.,
M. Knofler,
F. Frutiger,
G. J. Hughes,
O. Hagenbuchle, and P. K. Wellauer.
1996.
The p48 DNA-binding subunit of transcription factor PTF1 is a new exocrine pancreas-specific basic helix-loop-helix protein.
EMBO J.
15:4317-4329.
|
| 28.
|
Kreig, P. A., and D. A. Melton.
1984.
Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs.
Nucleic Acids Res.
12:7057-7070.
|
| 29.
|
Krumlauf, R.
1994.
Hox genes in vertebrate development.
Cell
78:191-201.
|
| 30.
|
Kruse, F.,
C. T. Komro,
C. H. Michnoff, and R. J. MacDonald.
1988.
The cell-specific elastase I enhancer comprises two domains.
Mol. Cell. Biol.
8:893-902.
|
| 31.
|
Kruse, F.,
S. D. Rose,
G. H. Swift,
R. E. Hammer, and R. J. MacDonald.
1995.
Cooperation between elements of an organ-specific transcriptional enhancer in animals.
Mol. Cell. Biol.
15:4385-4394.
|
| 32.
|
Kruse, F.,
S. D. Rose,
G. H. Swift,
R. E. Hammer, and R. J. MacDonald.
1993.
An endocrine-specific element is an integral component of an exocrine-specific pancreatic enhancer.
Genes Dev.
7:774-786.
|
| 32a.
| Kruse, F., and R. J. MacDonald. Unpublished
data.
|
| 32b.
| Lalgudi, R., S. D. Rose, and R. J. MacDonald. Unpublished data.
|
| 33.
|
Lawrence, P. A., and G. Morata.
1994.
Homeobox genes: their function in Drosophila segmentation and pattern formation.
Cell
78:181-189.
|
| 34.
|
Le Douarin, N. M.
1988.
On the origin of pancreatic endocrine cells.
Cell
53:169-171.
|
| 35.
|
Leonard, J.,
B. Peers,
T. Johnson,
K. Ferreri,
S. Lee, and M. R. Montminy.
1993.
Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells.
Mol. Endocrinol.
7:1275-1283.
|
| 36.
|
Lu, Q., and M. P. Kamps.
1996.
Selective repression by Pbx1 does not require the homeodomain.
Proc. Natl. Acad. Sci. USA
93:470-474.
|
| 37.
|
MacDonald, R. J.,
G. H. Swift,
A. E. Przybyla, and J. M. Chirgwin.
1987.
Isolation of RNA using guanidinium salts.
Methods Enzymol.
152:219-227.
|
| 38.
|
Mann, R. S.
1995.
The specificity of homeotic gene function.
Bioessays
17:855-863.
|
| 39.
|
Mann, R. S., and S.-K. Chan.
1996.
Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins.
Trends Genet.
12:258-262.
|
| 40.
|
Mann, R. S., and A.-S. Shaar.
1996.
Nuclear import of the homeodomain protein extradenticle in response to Wg and Dpp signalling.
Nature
383:630-633.
|
| 41.
|
Miller, C. P.,
R. E. McGehee, and J. F. Habener.
1994.
IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene.
EMBO J.
13:1145-1156.
|
| 42.
|
Monica, K.,
N. Galili,
J. Nourse,
D. Saltman, and M. L. Cleary.
1991.
PBX2 and PBX3, new homeobox genes with extensive homology to the human proto-oncogene PBX1.
Mol. Cell. Biol.
11:6149-6157.
|
| 43.
|
Moskow, J. J.,
F. Bullrich,
K. Huebner,
I. O. Daar, and A. M. Buchberg.
1995.
Meis1, a PBX1-related homeobox gene involved in myeloid leukemia in BXH-2 mice.
Mol. Cell. Biol.
15:5434-5443.
|
| 44.
|
Nakamura, T.,
N. A. Jenkins, and N. G. Copeland.
1996.
Identification of a new family of Pbx-related homeobox genes.
Oncogene
13:2235-2242.
|
| 45.
|
Nakamura, T.,
D. A. Largaespada,
J. D. J. Shaughnessy,
N. A. Jenkins, and N. G. Copeland.
1996.
Cooperative activation of Hoxa and Pbx-1-related genes in murine myeloid leukemias.
Nat. Genet.
12:149-153.
|
| 46.
|
Neuteboom, S. T. C., and C. Murre.
1997.
Pbx raises the DNA binding specificity but not the selectivity of Antennapedia Hox proteins.
Mol. Cell. Biol.
17:4696-4706.
|
| 47.
|
Neuteboom, S. T. C.,
L. T. C. Peltenburg,
M. A. van Dijk, and C. Murre.
1995.
The hexapeptide LFPWMR in HoxB-8 is required for cooperative DNA binding with PBX1 and PBX2 proteins.
Proc. Natl. Acad. Sci. USA
92:9166-9170.
|
| 48.
|
Nielsen, D. A.,
T. C. Chang, and D. J. Shapiro.
1989.
A highly sensitive, mixed-phase assay for chloramphenicol acetyltransferase activity in transfected cells.
Anal. Biochem.
179:19-23.
|
| 49.
|
Nourse, J.,
J. D. Melletin,
N. Galili,
J. Walkinson,
E. Stanbridge,
S. D. Smith, and M. L. Cleary.
1991.
Chromosomal translocation t(1;19) results in the synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor.
Cell
60:535-545.
|
| 50.
|
Offield, M. F.,
J. L. Jetton,
P. A. Labosky,
M. Ray,
R. W. Stein,
M. A. Magnuson,
B. L. M. Hogan, and C. V. E. Wright.
1996.
PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum.
Development
122:983-995.
|
| 51.
|
Ohlsson, H.,
K. Karlsson, and T. Edlund.
1993.
IPF1, a homeodomain-containing transactivator of the insulin gene.
EMBO J.
12:4251-4259.
|
| 52.
|
Ornitz, D. M.,
R. E. Hammer,
B. L. Davison,
R. L. Brinster, and R. D. Palmiter.
1987.
Promoter and enhancer elements from the rat elastase I gene function independently of each other and of heterologous enhancers.
Mol. Cell. Biol.
7:3466-3472.
|
| 53.
|
Ornitz, D. M.,
R. E. Hammer,
A. Messing,
R. D. Palmiter, and R. L. Brinster.
1987.
Pancreatic neoplasia induced by SV40 T-antigen expression in acinar cells of transgenic mice.
Science
238:188-193.
|
| 54.
|
Ornitz, D. M.,
R. D. Palmiter,
R. E. Hammer,
R. L. Brinster,
G. H. Swift, and R. J. MacDonald.
1985.
Specific expression of an elastase-human growth hormone fusion gene in pancreatic acinar cells of transgenic mice.
Nature
313:600-603.
|
| 55.
|
Oulad-Abdelghani, M.,
C. Chazaud,
P. Bouillet,
V. Sapin,
P. Chambon, and P. Dolle.
1997.
Meis2, a novel mouse Pbx-related homeobox gene induced by retinoic acid during differentiation of P19 embryonal carcinoma cells.
Dev. Dyn.
210:173-183.
|
| 56.
|
Peers, B.,
J. Leonard,
S. Sharma,
G. Teitelman, and M. R. Montminy.
1994.
Insulin expression in pancreatic islet cells relies on cooperative interactions between the helix loop helix factor E47 and the homeobox factor STF-1.
Mol. Endocrinol.
8:1798-1806.
|
| 57.
|
Peers, B.,
S. Sharma,
T. Johnson,
M. Kamps, and M. Montminy.
1995.
The pancreatic islet factor STF-1 binds cooperatively with Pbx to a regulatory element in the somatostatin promoter: importance of the FPWMK motif and of the homeodomain.
Mol. Cell. Biol.
15:7091-7097.
|
| 58.
|
Peltenburg, L. T. C., and C. Murre.
1996.
Engrailed and Hox homeodomain proteins contain a related Pbx interaction motif that recognizes a common structure present in Pbx.
EMBO J.
15:3385-3393.
|
| 59.
|
Petrucco, S.,
P. K. Wellauer, and O. Hagenbüchle.
1990.
The DNA-binding activity of transcription factor PTF1 parallels the synthesis of pancreas-specific mRNAs during mouse development.
Mol. Cell. Biol.
10:254-264.
|
| 60.
|
Phelan, M. L.,
I. Rambaldi, and M. S. Featherstone.
1995.
Cooperative interactions between HOX and PBX proteins mediated by a conserved peptide motif.
Mol. Cell. Biol.
15:3989-3997.
|
| 61.
|
Phillipe, J.,
W. L. Chick, and J. F. Habener.
1987.
Multipotential phenotypic expression of genes encoding peptide hormones in rat insulinoma cell lines.
J. Clin. Invest.
79:351-358.
|
| 62.
|
Pictet, R., and W. J. Rutter.
1972.
Development of the embryonic endocrine pancreas, p. 25-66.
In
D. F. Steiner, and N. Freinkel (ed.), Handbook of physiology: the endocrine pancreas, vol. 1. Williams and Wilkins, Baltimore, Md.
|
| 63.
|
Popperl, H.,
M. Bienz,
M. Studer,
S.-K. Chan,
S. Aparicio,
S. Brenner,
R. S. Mann, and R. Krumlauf.
1995.
Segmental expression of Hoxb-1 is controlled by a highly conserved autoregulatory loop dependent upon exd/pbx.
Cell
81:1031-1042.
|
| 64.
|
Rieckhof, G. E.,
F. Casares,
H. D. Ryoo,
M. Abu-Sharr, and R. S. Mann.
1997.
Nuclear translocation of extradenticle requires homothorax, which encodes an extradenticle-related homeodomain protein.
Cell
91:171-183.
|
| 65.
|
Roberts, V. J.,
M. A. van Dijk, and C. Murre.
1995.
Localization of PBX1 transcripts in developing rat embryos.
Mech. Dev.
51:193-198.
|
| 66.
|
Rose, S. D.,
F. Kruse,
G. H. Swift,
R. J. MacDonald, and R. E. Hammer.
1994.
A single element of the elastase I enhancer is sufficient to direct transcription selectively to the pancreas and gut.
Mol. Cell. Biol.
14:2048-2057.
|
| 67.
|
Rose, S. D., and R. J. MacDonald.
1997.
Evolutionary silencing of the human elastase I gene (ELA1).
Hum. Mol. Genet.
6:897-903.
|
| 68.
|
Rosewicz, S.,
D. Vogt,
N. Harth,
C. Grund,
W. W. Franke,
S. Ruppert,
E. Schweitzer,
E.-O. Riecken, and B. Wiedenmann.
1992.
An amphicrine pancreatic cell line: AR42J cells combine exocrine and neuroendocrine properties.
Eur. J. Cell Biol.
59:80-91.
|
| 69.
|
Sander, M.,
A. Neubuser,
J. Kalamaras,
H. C. Ee,
G. R. Martin, and M. S. German.
1997.
Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development.
Genes Dev.
11:1662-1673.
|
| 70.
|
Seldon, R. F.,
H. K. Burke,
M. E. Rowe,
H. M. Goodman, and D. D. Moore.
1986.
Human growth hormone as a reporter gene in regulation studies employing transient gene expression.
Mol. Cell. Biol.
6:3173-3179.
|
| 71.
|
Shen, W.-F.,
S. Rozenfeld,
H. J. Lawrence, and C. Largman.
1997.
The Abd-B-like Hox homeodomain proteins can be subdivided by the ability to form complexes with PBX1a on a novel DNA target.
J. Biol. Chem.
272:8198-8206.
|
| 72.
|
Shen, W. F.,
J. C. Montgomery,
S. Rozenfeld,
J. J. Moskow,
H. J. Lawrence,
A. M. Buchberg, and C. Largman.
1997.
AbdB-like Hox proteins stabilize DNA binding by the Meis1 homeodomain proteins.
Mol. Cell. Biol.
17:6448-6458.
|
| 73.
|
Slack, J. M. W.
1995.
Developmental biology of the pancreas.
Development
121:1569-1580.
|
| 74.
|
Sosa-Pineda, B.,
K. Chowdhury,
M. Torres,
G. Oliver, and P. Gruss.
1997.
The PAX4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas.
Nature
386:399-402.
|
| 75.
|
Steelman, S.,
J. J. Moskow,
K. Muzynski,
C. North,
T. Druck,
J. C. Montgomery,
K. Huebner,
I. O. Daar, and A. M. Buchberg.
1997.
Identification of a conserved family of Meis1-related homeobox genes.
Genome Res.
7:142-156.
|
| 76.
|
Stoffers, D. A.,
N. T. Zinkin,
V. Stanojevic,
W. L. Clarke, and J. F. Haener.
1997.
Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence.
Nat. Genet.
15:106-110.
|
| 77.
|
Swift, G. H.,
R. E. Hammer,
R. J. MacDonald, and R. L. Brinster.
1984.
Tissue-specific expression of the rat pancreatic elastase I gene in transgenic mice.
Cell
38:639-646.
|
| 78.
|
Swift, G. H.,
S. D. Rose, and R. J. MacDonald.
1994.
An element of the elastase I enhancer is an overlapping bipartite binding site activated by a heteromeric factor.
J. Biol. Chem.
269:12809-12815.
|
| 79.
|
Waeber, G.,
N. Thompson,
P. Nicod, and C. Bonny.
1996.
Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor.
Mol. Endocrinol.
10:1327-1334.
|
| 80.
|
Watada, H.,
Y. Kajimoto,
Y. Umayahara,
T. Matsuoka,
H. Kaneto,
Y. Fujitani,
T. Kamada,
R. Kawamori, and Y. Yamasaki.
1996.
The human glucokinase gene beta-cell-type promoter: an essential role of insulin promoter factor 1/PDX-1 in its activation in HIT-T15 cells.
Diabetes
45:1478-1488.
|
| 81.
|
Williams, J. A., and I. D. Goldfine.
1993.
The insulin-acinar relationship., p. 789-802.
In
V. L. W. Go (ed.), The pancreas: biology, pathobiology and disease, 2nd ed. Raven Press, New York, N.Y.
|
| 82.
|
Wilson, D. S., and C. Desplan.
1995.
Cooperating to be different.
Curr. Biol.
5:32-34.
|
| 83.
|
Wong, T.-K., and E. Neumann.
1982.
Electric field mediated gene transfer.
Biochem. Biophys. Res. Commun.
107:584-587.
|
| 84.
|
Wright, C. V. E.,
P. Schnegelsberg, and E. M. De Robertis.
1988.
X1Hbox 8: a novel Xenopus homeoprotein restricted to a narrow band of endoderm.
Development
104:787-794.
|
| 85.
|
Wu, K.-L.,
M. Gannon,
M. Peshavaria,
M. F. Offield,
E. Henderson,
M. Ray,
A. Marks,
L. W. Gamer,
C. V. E. Wright, and R. Stein.
1997.
Hepatocyte nuclear factor 3 is involved in pancreatic -cell-specific transcription of the pdx-1 gene.
Mol. Cell. Biol.
17:6002-6013.
|
Molecular and Cellular Biology, September 1998, p. 5109-5120, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, C., Fang, R., Davis, C., Maravelias, C., Sibley, E.
(2009). Pdx1 inactivation restricted to the intestinal epithelium in mice alters duodenal gene expression in enterocytes and enteroendocrine cells. Am. J. Physiol. Gastrointest. Liver Physiol.
297: G1126-G1137
[Abstract]
[Full Text]
-
Agoston, Z., Schulte, D.
(2009). Meis2 competes with the Groucho co-repressor Tle4 for binding to Otx2 and specifies tectal fate without induction of a secondary midbrain-hindbrain boundary organizer. Development
136: 3311-3322
[Abstract]
[Full Text]
-
Oliver-Krasinski, J. M., Stoffers, D. A.
(2008). On the origin of the {beta} cell. Genes Dev.
22: 1998-2021
[Abstract]
[Full Text]
-
Spagnoli, F. M., Brivanlou, A. H.
(2008). The Gata5 target, TGIF2, defines the pancreatic region by modulating BMP signals within the endoderm. Development
135: 451-461
[Abstract]
[Full Text]
-
Diaz, V. M., Mori, S., Longobardi, E., Menendez, G., Ferrai, C., Keough, R. A., Bachi, A., Blasi, F.
(2007). p160 Myb-Binding Protein Interacts with Prep1 and Inhibits Its Transcriptional Activity. Mol. Cell. Biol.
27: 7981-7990
[Abstract]
[Full Text]
-
Murtaugh, L. C.
(2007). Pancreas and beta-cell development: from the actual to the possible. Development
134: 427-438
[Abstract]
[Full Text]
-
Deramaudt, T. B., Sachdeva, M. M., Wescott, M. P., Chen, Y., Stoffers, D. A., Rustgi, A. K.
(2006). The PDX1 Homeodomain Transcription Factor Negatively Regulates the Pancreatic Ductal Cell-specific Keratin 19 Promoter. J. Biol. Chem.
281: 38385-38395
[Abstract]
[Full Text]
-
Daftary, G. S., Taylor, H. S.
(2006). Endocrine Regulation of HOX Genes. Endocr. Rev.
27: 331-355
[Abstract]
[Full Text]
-
Miyatsuka, T., Kaneto, H., Shiraiwa, T., Matsuoka, T.-a., Yamamoto, K., Kato, K., Nakamura, Y., Akira, S., Takeda, K., Kajimoto, Y., Yamasaki, Y., Sandgren, E. P., Kawaguchi, Y., Wright, C. V.E., Fujitani, Y.
(2006). Persistent expression of PDX-1 in the pancreas causes acinar-to-ductal metaplasia through Stat3 activation. Genes Dev.
20: 1435-1440
[Abstract]
[Full Text]
-
Liu, H., Strauss, T. J., Potts, M. B., Cameron, S.
(2006). Direct regulation of egl-1 and of programmed cell death by the Hox protein MAB-5 and by CEH-20, a C. elegans homolog of Pbx1. Development
133: 641-650
[Abstract]
[Full Text]
-
Lebrun, P., Montminy, M. R., Van Obberghen, E.
(2005). Regulation of the Pancreatic Duodenal Homeobox-1 Protein by DNA-dependent Protein Kinase. J. Biol. Chem.
280: 38203-38210
[Abstract]
[Full Text]
-
Brendolan, A., Ferretti, E., Salsi, V., Moses, K., Quaggin, S., Blasi, F., Cleary, M. L., Selleri, L.
(2005). A Pbx1-dependent genetic and transcriptional network regulates spleen ontogeny. Development
132: 3113-3126
[Abstract]
[Full Text]
-
Sarno, J. L., Kliman, H. J., Taylor, H. S.
(2005). HOXA10, Pbx2, and Meis1 Protein Expression in the Human Endometrium: Formation of Multimeric Complexes on HOXA10 Target Genes. J. Clin. Endocrinol. Metab.
90: 522-528
[Abstract]
[Full Text]
-
Haller, K., Rambaldi, I., Daniels, E., Featherstone, M.
(2004). Subcellular Localization of Multiple PREP2 Isoforms Is Regulated by Actin, Tubulin, and Nuclear Export. J. Biol. Chem.
279: 49384-49394
[Abstract]
[Full Text]
-
Rave-Harel, N., Givens, M. L., Nelson, S. B., Duong, H. A., Coss, D., Clark, M. E., Hall, S. B., Kamps, M. P., Mellon, P. L.
(2004). TALE Homeodomain Proteins Regulate Gonadotropin-releasing Hormone Gene Expression Independently and via Interactions with Oct-1. J. Biol. Chem.
279: 30287-30297
[Abstract]
[Full Text]
-
Chao, S.-H., Harada, J. N., Hyndman, F., Gao, X., Nelson, C. G., Chanda, S. K., Caldwell, J. S.
(2004). PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem.
279: 16111-16120
[Abstract]
[Full Text]
-
Qin, P., Haberbusch, J. M., Zhang, Z., Soprano, K. J., Soprano, D. R.
(2004). Pre-B Cell Leukemia Transcription Factor (PBX) Proteins Are Important Mediators for Retinoic Acid-dependent Endodermal and Neuronal Differentiation of Mouse Embryonal Carcinoma P19 Cells. J. Biol. Chem.
279: 16263-16271
[Abstract]
[Full Text]
-
Liberzon, A., Ridner, G., Walker, M. D.
(2004). Role of intrinsic DNA binding specificity in defining target genes of the mammalian transcription factor PDX1. Nucleic Acids Res
32: 54-64
[Abstract]
[Full Text]
-
Annicotte, J.-S., Fayard, E., Swift, G. H., Selander, L., Edlund, H., Tanaka, T., Kodama, T., Schoonjans, K., Auwerx, J.
(2003). Pancreatic-Duodenal Homeobox 1 Regulates Expression of Liver Receptor Homolog 1 during Pancreas Development. Mol. Cell. Biol.
23: 6713-6724
[Abstract]
[Full Text]
-
Matsuoka, T.-a., Zhao, L., Artner, I., Jarrett, H. W., Friedman, D., Means, A., Stein, R.
(2003). Members of the Large Maf Transcription Family Regulate Insulin Gene Transcription in Islet {beta} Cells. Mol. Cell. Biol.
23: 6049-6062
[Abstract]
[Full Text]
-
Kobayashi, M., Fujioka, M., Tolkunova, E. N., Deka, D., Abu-Shaar, M., Mann, R. S., Jaynes, J. B.
(2003). Engrailed cooperates with extradenticle and homothorax to repress target genes in Drosophila. Development
130: 741-751
[Abstract]
[Full Text]
-
Troy, P. J., Daftary, G. S., Bagot, C. N., Taylor, H. S.
(2003). Transcriptional Repression of Peri-Implantation EMX2 Expression in Mammalian Reproduction by HOXA10. Mol. Cell. Biol.
23: 1-13
[Abstract]
[Full Text]
-
Holland, A. M., Hale, M. A., Kagami, H., Hammer, R. E., MacDonald, R. J.
(2002). Experimental control of pancreatic development and maintenance. Proc. Natl. Acad. Sci. USA
99: 12236-12241
[Abstract]
[Full Text]
-
Zhang, X., Friedman, A., Heaney, S., Purcell, P., Maas, R. L.
(2002). Meis homeoproteins directly regulate Pax6 during vertebrate lens morphogenesis. Genes Dev.
16: 2097-2107
[Abstract]
[Full Text]
-
Kim, S. K., Hebrok, M.
(2001). Intercellular signals regulating pancreas development and function. Genes Dev.
15: 111-127
[Full Text]
-
Dutta, S., Gannon, M., Peers, B., Wright, C., Bonner-Weir, S., Montminy, M.
(2001). PDX:PBX complexes are required for normal proliferation of pancreatic cells during development. Proc. Natl. Acad. Sci. USA
10.1073/pnas.031561298v1
[Abstract]
[Full Text]
-
Peshavaria, M., Cissell, M. A., Henderson, E., Petersen, H. V., Stein, R.
(2000). The PDX-1 Activation Domain Provides Specific Functions Necessary for Transcriptional Stimulation in Pancreatic {beta}-Cells. Mol. Endocrinol.
14: 1907-1917
[Abstract]
[Full Text]
-
Adell, T., Gómez-Cuadrado, A., Skoudy, A., Pettengill, O. S., Longnecker, D. S., Real, F. X.
(2000). Role of the Basic Helix-Loop-Helix Transcription Factor p48 in the Differentiation Phenotype of Exocrine Pancreas Cancer Cells. Cell Growth Differ.
11: 137-147
[Abstract]
[Full Text]
-
Dong, P., Chu, J, Panganiban, G
(2000). Coexpression of the homeobox genes Distal-less and homothorax determines Drosophila antennal identity. Development
127: 209-216
[Abstract]
-
Shanmugam, K., Green, N. C., Rambaldi, I., Saragovi, H. U., Featherstone, M. S.
(1999). PBX and MEIS as Non-DNA-Binding Partners in Trimeric Complexes with HOX Proteins. Mol. Cell. Biol.
19: 7577-7588
[Abstract]
[Full Text]
-
Jacobs, Y., Schnabel, C. A., Cleary, M. L.
(1999). Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity. Mol. Cell. Biol.
19: 5134-5142
[Abstract]
[Full Text]
-
Affolter, M., Marty, T., Vigano, M. A.
(1999). Balancing import and export in development. Genes Dev.
13: 913-915
[Full Text]
-
Shen, W.-F., Rozenfeld, S., Kwong, A., Komuves, L. G., Lawrence, H. J., Largman, C.
(1999). HOXA9 Forms Triple Complexes with PBX2 and MEIS1 in Myeloid Cells. Mol. Cell. Biol.
19: 3051-3061
[Abstract]
[Full Text]
-
Ryoo, H., Marty, T, Casares, F, Affolter, M, Mann, R.
(1999). Regulation of Hox target genes by a DNA bound Homothorax/Hox/Extradenticle complex. Development
126: 5137-5148
[Abstract]
-
Schwartz, P. T., Perez-Villamil, B., Rivera, A., Moratalla, R., Vallejo, M.
(2000). Pancreatic Homeodomain Transcription Factor IDX1/IPF1 Expressed in Developing Brain Regulates Somatostatin Gene Transcription in Embryonic Neural Cells. J. Biol. Chem.
275: 19106-19114
[Abstract]
[Full Text]
-
Viswanath, R. L., Rose, S. D., Swift, G. H., MacDonald, R. J.
(2000). A Binary Mechanism for the Selective Action of a Pancreatic beta -Cell Transcriptional Silencer. J. Biol. Chem.
275: 40273-40281
[Abstract]
[Full Text]
-
Dusing, M. R., Florence, E. A., Wiginton, D. A.
(2001). PDX-1 Is Required for Activation in Vivo from a Duodenum-specific Enhancer. J. Biol. Chem.
276: 14434-14442
[Abstract]
[Full Text]
-
Liu, Y., MacDonald, R. J., Swift, G. H.
(2001). DNA Binding and Transcriptional Activation by a PDX1{middle dot}PBX1b{middle dot}MEIS2b Trimer and Cooperation with a Pancreas-specific Basic Helix-Loop-Helix Complex. J. Biol. Chem.
276: 17985-17993
[Abstract]
[Full Text]
-
Wang, Y., Yin, L., Hillgartner, F. B.
(2001). The Homeodomain Proteins PBX and MEIS1 Are Accessory Factors That Enhance Thyroid Hormone Regulation of the Malic Enzyme Gene in Hepatocytes. J. Biol. Chem.
276: 23838-23848
[Abstract]
[Full Text]
-
Dutta, S., Gannon, M., Peers, B., Wright, C., Bonner-Weir, S., Montminy, M.
(2001). PDX:PBX complexes are required for normal proliferation of pancreatic cells during development. Proc. Natl. Acad. Sci. USA
98: 1065-1070
[Abstract]
[Full Text]