Previous Article | Next Article 
Molecular and Cellular Biology, September 1998, p. 5320-5331, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
GATA-Dependent Expression of the Interleukin-1
Receptor-Related T1 Gene in Mast Cells
Thomas
Gächter,
Dirk R.
Moritz,
Jaqueline
Gheyselinck, and
Roman
Klemenz*
Division of Cancer Research, Department of
Pathology, University Hospital, CH-8091 Zürich, Switzerland
Received 10 April 1998/Returned for modification 21 May
1998/Accepted 12 June 1998
 |
ABSTRACT |
The murine delayed-early serum-responsive gene T1 encodes
glycoproteins of the interleukin-1 receptor family. Transcriptional initiation in fibroblasts is regulated by c-Fos and gives rise to a
rare 5-kb mRNA and an abundant 2.7-kb mRNA. These transcripts are
translated into a receptor-like membrane-anchored protein and a
secreted protein consisting only of the ectodomain. In mast cells, T1
gene transcription is initiated 10.5 kb further upstream than in
fibroblasts and gives rise predominantly to the 5-kb transcript under
normal growth conditions. Here we demonstrate that calcium ionophore
stimulation of mast cells resulted in an upregulation of T1 gene
expression and a switch from the long to the short T1 transcript. This
was paralleled by the disappearance of the receptor-type T1 protein on
the mast cell surface and the secretion of large amounts of the
truncated T1 protein. c-Fos and a T1 enhancer, which have previously
been identified to be essential for T1 expression in fibroblasts, were
not required for calcium ionophore-mediated T1 gene upregulation.
Overexpression of the transcription factor GATA-1 in mast cells caused
elevated T1 synthesis. Three GATA elements were identified in the
minimal GATA-responsive mast cell promoter. Mutational analysis
revealed that all three GATA elements are involved in T1 gene
expression. Point mutations within the middle GATA element eliminated
promoter activity completely, while mutations of the distal and
proximal GATA binding sites reduced promoter strength by factors of 2 and 5, respectively. Exogenous expression of GATA-1 was not sufficient
to activate the mast cell-specific promoter in NIH 3T3 fibroblasts.
 |
INTRODUCTION |
The T1 gene, also designated ST2 or
DER4, was originally isolated as an oncoprotein and growth
factor-responsive gene in murine fibroblasts (25, 28, 57,
63). T1 is transcribed into an abundant 2.7-kb and a rare 5-kb
mRNA upon stimulation of fibroblasts with proliferation-inducing agents
(serum, lysophosphatidic acid, platelet-derived growth factor, and
fibroblast growth factor) (23), with proinflammatory
cytokines (interleukin-1 [IL-1] and tumor necrosis factor alpha
[TNF-
]) (27, 29), or in response to oncogene
expression. Mitogen-triggered T1 gene induction in NIH 3T3 cells is
mediated by transcription factors of the AP-1 family (23,
60). An essential tetradecanoyl phorbol acetate-responsive element (TRE), a binding site for AP-1 proteins, is located within the
T1 enhancer 3.6 kb upstream of the transcription initiation site used
in fibroblasts (60). Moreover, overexpression of c-Fos and
FosB was sufficient for T1 gene induction in these cells
(23). Likewise, the rat homolog of T1, fit-1, was
identified as a c-Fos-responsive gene (2).
Both T1 transcripts are initiated at the same site in fibroblasts, and
differential 3' processing is the underlying mechanism for the
generation of the two different transcripts (13). Mast cells
synthesize mainly the 5-kb T1 mRNA under normal growth conditions. Transcription initiates 10.5 kb further upstream than in fibroblasts (13). The alternative, noncoding first exons used in
fibroblasts and mast cells are spliced to the common second exon, where
the translation start site is located. Thus, the proteins encoded by
the short and long T1 transcripts share the same amino-terminal portion
and diverge only eight amino acids before the carboxy terminus of the
small T1 protein. The 5-kb mRNA is translated into a receptor-like,
plasma membrane-spanning glycoprotein (T1M), whereas the 2.7-kb T1
transcript encodes a secreted glycoprotein (T1S) representing the
ectodomain of T1M.
Both T1 proteins belong to the immunoglobulin (Ig) superfamily and in
particular to the IL-1 receptor (IL-1R) family (41, 45, 67).
The tight chromosomal linkage of the T1 gene and the genes encoding the
type I and type II IL-1R on mouse chromosome 1 (59) and
human chromosome 2 (58) as well as the highly conserved exon/intron structure of these three genes (53) strongly
suggest a common ancestory. However, the cytokines IL-1
and IL-1
do not bind to the T1 protein (26, 49). Studies using
recombinant chimeric receptor proteins consisting of the extracellular,
ligand binding domain of IL-1R type I fused to the intracellular part of T1M suggest that the two receptors activate the same signal transduction cascades (26, 41, 47). The identification of putative T1 ligands has recently been reported by two groups (16, 27).
The expression patterns of the two T1 transcripts differ significantly.
The 2.7-kb T1 mRNA has been detected in fibroblast cell lines (25,
28, 57, 63), in the skin, retina, and bone (49), in
the developing mammary gland, and in Ha-ras-induced murine
mammary adenocarcinomas (48). Abundant expression of the
5-kb T1 transcript is restricted to the major hematopoietic organs
(fetal liver, spleen, and bone marrow) (49) and to the lung
(2). Using T1-specific monoclonal antibodies (MAbs)
(42), we have recently identified mast cells as the only
cells of the hematopoietic system which express T1M (43).
All developmental stages of mast cells were shown to express high
levels of T1M.
Mast cell progenitors originate from the bone marrow (BM), migrate via
the bloodstream, and invade mucosal and connective tissues, where they
terminally differentiate into morphologically distinct mature mast
cells. They are rich in cytoplasmic granules that store inflammatory
mediators such as proteoglycans, histamine, serotonin, TNF-
, and
proteases. Mast cell activation results in rapid degranulation and the
synthesis and release of cytokines (e.g., TNF-
, IL-1, and IL-3) and
lipid mediators, including prostaglandin D2 and leukotriene
C4. One of the best-studied activation mechanisms of mast
cells is triggered by multivalent antigens which bind to IgE on the
cell surface and thereby mediate aggregation of the high-affinity Fc
receptor (Fc
RI). Some aspects of this mode of activation can be
mimicked by calcium ionophore treatment, which results in elevated
levels of cytoplasmic Ca2+, a hallmark of IgE-mediated mast
cell activation. Mast cells participate in acute and persistent
inflammatory responses. They play an important role in the pathogenesis
of IgE-dependent allergic disorders and anaphylaxis (4, 14).
Furthermore, mast cells can take part in acquired immune responses
against parasites (36, 51), and it was recently shown that
they are able to orchestrate life-saving host responses to bacterial
infection (9, 15, 32).
GATA proteins belong to the family of zinc finger-containing
transcription factors and play an important role in the regulation of
hematopoiesis (44, 52, 62). They bind with high affinity and
slightly different specificities to the consensus DNA sequence motif
(A/T)GATA(A/G). Six proteins of the GATA transcription factor family
have been identified, and each member has a distinct tissue distribution pattern. GATA-1 and GATA-2 are expressed in mast cells,
erythroblasts, and megakaryocytes (34, 68), and they are
instrumental for tissue-specific gene expression. Genes that are
selectively expressed in mast cells and whose expression depends on
GATA proteins include those encoding carboxypeptidase A, several mast
cell proteases, and the IgE receptor
chain (3, 12, 31,
68). Sequence analysis of the mast cell-specific T1 promoter revealed the presence of three consensus GATA elements.
Here we demonstrate that GATA-1 is indeed involved in mast
cell-specific T1 gene expression. We further show that calcium ionophore stimulation of mast cells leads to an upregulation of T1 gene
expression which is paralleled by a switch from the production of the
long to the short T1 transcript and followed by the secretion of T1S.
This effect can be blocked by cyclosporin A, a potent immunosuppressive
drug (20). In contrast to fibroblasts, c-Fos is not involved
in basal and calcium ionophore-stimulated T1 expression in mast cells.
In addition, we provide evidence that the enhancer which is essential
for T1 gene activity in fibroblasts is dispensable for mast
cell-specific T1 expression.
 |
MATERIALS AND METHODS |
Cell culture.
NIH 3T3 cells were grown in Dulbecco's
modified Eagle's medium (DMEM; Life Technologies, Inc.) supplemented
with 10% fetal calf serum (FCS), penicillin (100 U/ml), and
streptomycin (100 µg/ml). To arrest cell growth, the cells were
incubated for 24 h in DMEM containing 0.5% FCS. This medium was
replaced with fresh DMEM containing 10% FCS to stimulate cell cycle
entry.
BM cultures were prepared by flushing femurs and tibias of mice with
Iscove's modified Dulbecco's medium (IMDM; GibcoBRL). BM cells were
cultured in IMDM containing GLUTAMAX I
(L-alanyl-L-glutamine; 868 mg/liter; Gibco-BRL)
supplemented with 10% FCS, 50 µM 2-mercaptoethanol, penicillin (100 U/ml), streptomycin (100 µg/ml), and 2% conditioned culture
supernatant from murine IL-3-secreting X63/IL-3 cells (24)
(complete IMDM). BM cultures were enriched for mast cells by
repetitively subculturing the suspension cells in the presence of IL-3.
After approximately 4 weeks in culture, >98% of the cells displayed a
typical mast cell-like phenotype, as shown by double-positive flow
cytometry staining for c-Kit and surface IgE receptor (66) as well as by Giemsa staining (42). To obtain BM-derived
cultured mast cells (BMCMCs) from c-fos
/
mice which are osteopetrotic, we cut the femur into small pieces and
incubated the fragmented bone in complete IMDM.
The calcium ionophore A23187 (Calbiochem) was added at 1 µM unless
otherwise indicated. Actinomycin D (
Streptomyces sp.;
Calbiochem)
and cyclosporin A (
Trichoderma polysporum;
Calbiochem) were added
at 5 and 0.5 µg/ml, respectively.
Plasmid constructions.
pBS-A was obtained by cloning an
EcoRI/TaqI fragment containing 16 bp of the
distal exon 1 and 314 bp of 5' flanking sequence into the
EcoRI and ClaI sites of pBluescript
KS+ (pBSKS+; Stratagene). The
XbaI/XhoI insert of pBS-A was subsequently cloned
into the NheI/XhoI site of the promoterless
secreted alkaline phosphatase (SEAP) expression vector (pSEAP; Tropix,
Inc.) to give rise to pA. pBS-B and pBS-C were constructed by
introducing a 2.6-kb SacI/EcoRI fragment and a
6-kb EcoRI fragment which flank the restriction fragment
inserted into pBS-A into the SacI/EcoRI and
EcoRI sites, respectively, of pBS-A. The
SacI/XhoI insert of pBS-B whose SacI
end was made blunt was cloned into the blunt-ended NheI and
XhoI sites of pSEAP to obtain pB. To construct pC,
we first introduced additional restriction sites into plasmid pSEAP. The oligonucleotides
5'-CTAGCGAATTCCTCGAGAGATCTGCGGCCGCGGGCCCACTAGTA-3' and
5'-AGCTTACTAGTGGGCCCGCGGCCGCAGATCTCTCGAGGAATTCG-3' were
annealed and ligated into the NheI/HindIII
site of pSEAP. The SpeI/XhoI insert of pBS-C was
then introduced into the NheI and XhoI sites of
this modified plasmid. The HincII site upstream of the ATG initiation codon in exon 2 was converted into an EcoRI site
in previous experiments (60). A 0.8-kb
HindIII/EcoRI fragment flanking this site was
cloned into the HindIII/EcoRI site of plasmid
pBCSK+ (Stratagene) to obtain pHelp-1. A 9.7-kb
HindIII fragment (positions
12.9 to
3.2 kb with
respect to the transcription start site used in fibroblasts) was
inserted into the HindIII site of pHelp-1. The
XhoI/NotI insert of this construct was introduced
into the XhoI/NotI site of the modified SEAP
vector to give rise to pD. To obtain the plasmid pE, we first
destroyed the SacI restriction site in pBSKS+ by
treatment with T4 DNA polymerase. The 9.7-kb HindIII
fragment described above was cloned into this modified vector. The
SacI insert (positions
10.1 to
3.9 kb) was deleted from
this plasmid, and the HindIII insert from the resulting
construct was introduced into the HindIII site of
pHelp-1. The XhoI/SpeI fragment of this plasmid
was thereafter ligated into the XhoI/SpeI site of
the modified SEAP vector.
Plasmids pL-SH4.9 and pL-SH4.9 mut a, constructed previously
(
60), contain 4.9 kb of T1 sequence spanning the region 5'
of the translation start codon up to position

3.7 kb. A point
mutation had been introduced within the TRE sequence in the enhancer
in
construct pL-SH4.9 mut a. The
SmaI/
EcoRI fragment
of each of
these plasmids was cloned into the blunt-ended
HindIII and
EcoRI
sites of the promoterless
SEAP expression vector pSEAP2-Basic
(Tropix). The resulting plasmids
contain 4.9 kb of T1 sequence
5' of the open reading frame including
the proximal exon 1 and
the enhancer in its nonmutated (pHelp-wt) or
mutated (pHelp-TREmut)
form. A
XhoI/
ApaI fragment
of pHelp-1 was then inserted into the
XhoI/
ApaI
sites of these plasmids. Through this cloning step,
T1 sequences
harboring the distal exon 1 and 2.6 kb of 5' flanking
sequences were
introduced into the constructs pHelp-wt and pHelp-TREmut
to give rise
to pF and pG, respectively.
To generate pS-G, the
NdeI/
BamHI fragment of
pM1

-GH (
33) containing a minimal rabbit

-globin
promoter and a single binding
site for the GATA transcription factors
was cloned into the
NheI
and
BglII sites of
pSEAP2-Basic. The ends that were generated
by restriction with
NdeI and
NheI were blunted for this cloning
step.
The empty expression vector pXM was generated by digestion of
pXM-mGATA-1 encoding the murine GATA-1 protein (
61) with
XhoI
and religation.
Site-directed mutagenesis.
Introduction of point mutations
into construct pA was performed by generating mutated
EcoRI/XhoI fragments by PCR as described by Ho et
al. (22). The mutated fragments were used to replace the
EcoRI/XhoI fragment in pA. The subsequent
insertion of the 6-kb EcoRI fragment (0.3 to 6.3 kb upstream
of the distal exon 1) into the EcoRI site of the mutated
plasmid pA resulted in the various mutated pC constructs. The mutation
of each site was chosen such that a novel restriction site was
introduced which allowed us to verify successful generation of the
mutation. The following new restriction sites were introduced: dGATA,
NheI; mGATA, BfrI; pGATA, ScaI; SP1,
HindIII; and TRE, BamHI. The following
primers were used to generate the mutations: 5'-pA
(5'-GGATCCCCCGGGCTGCAGGAATTCGGTCTATCT-3'), pA-3'
(5'-AGATCTCTCGAGGTCGACGGTATCGAACCACCA-3'), dGmut-5'
(5'-CTTGAAGGTCCATGGCTAGCAGGGTAAAACTGGAAG-3'), dGmut-3'
(5'-CTTCCAGTTTTACCCTGCTAGCCATGGACCTTCAAG-3'), mGmut-5' (5'-GTTCCTGTAAGTAACTCTTAAGGAACAGGAGGTGTT-3'), mGmut-3'
(5'-AACACCTCCTGTTCCTTAAGAGTTACTTACAGGAAC-3'), pGmut-5'
(5'-ACAGGAGGTGTTAGAAGTACTTGGCAACTGTATTGG-3'), pGmut-3' (5'-CCAATACAGTTGCCAAGTACTTCTAACACCTCCTGT-3'), SP1mut-5'
(5'-CAGCCAGCAGGAATTAAGCTTGTTTTTTTGTTTTGA-3'), SP1mut-3'
(5'-TCAAAAGAAAAAAACAAGCTTAATTCCTGCTGGCTG-3'), TREmut-5' (5'-GACAAACAGTAAAATGGATCCAGATGGTTAACAGCT-3'), and TREmut-3'
(5'-AGCTGTTAACCATCTGGATCCATTTTACTGTTTGTC-3').
Transfections.
For transient transfections, NIH 3T3 cells
were plated at a density of 1.5 × 104
cells/cm2 in 3.5-cm-diameter tissue culture dishes and
grown for 24 h. Cells were transfected with 5 µg of total
plasmid DNA by the Ca2+ phosphate precipitation method
(64). Six hours after addition of the precipitate, cells
were washed twice with phosphate-buffered saline (PBS) and incubated in
DMEM containing 10% FCS for 40 h. For serum stimulation,
transfected cells were grown for 16 h in DMEM-10% FCS and
subsequently starved in DMEM-0.5% FCS for 24 h. Thereafter the
medium was replaced with 1.5 ml of fresh DMEM-10% FCS, and the cells
were maintained in this medium for an additional 24 h; 100 µl of
the medium was then removed for SEAP activity measurements. The cells
were rinsed twice with cold PBS, scraped from the plate in 1.5 ml of
cold PBS, pelleted, resuspended in 100 µl of cold 40 mM Tris-HCl (pH
7.5)-1 mM EDTA-150 mM NaCl, and disrupted by three cycles of
freeze-thawing. Cell debris were removed by centrifugation, and the
supernatant was used to measure
-galactosidase activity as specified
by Miller (40).
For stable transfections, NIH 3T3 cells were grown on 10-cm-diameter
plates and transfected with 19 µg of the expression vector
pXM-mGATA-1 and 1 µg of plasmid pSV
2neo, encoding the
neomycin
phosphotransferase gene (
54). The precipitate was
removed after
16 h, and neomycin-resistant clones were selected in
medium supplemented
with G418 (1 mg/ml).
Mast cells were washed once with cold electroporation buffer
(IMDM-GLUTAMAX), pelleted, and resuspended at 2 × 10
7
to 4 × 10
7 cells/ml in electroporation buffer. Then
0.5-ml aliquots of the
cell suspension were transferred to the
electroporation cuvettes,
65 to 85 µg of total plasmid DNA was added
and mixed with the
cell suspension, and the mixture was incubated for
10 min at room
temperature. The cells were electroporated once at 320 V
and 960
µF, incubated for 15 min at 37°C, transferred into
5-cm-diameter
culture dishes, and grown in 6 ml of complete IMDM for
42 h. Subsequently,
the cells were harvested by centrifugation and
resuspended in
4 ml of fresh medium; 1 ml of this cell suspension was
removed
and washed once with cold PBS, and

-galactosidase activity
was
determined as described above. The remaining cells (3 ml) were
grown in 3.5-cm-diameter dishes for an additional 20 h. For
Ca
2+ ionophore stimulation, the cell suspension was split
into two
equal parts. One half was left untreated, while the other was
stimulated with 1 µM A23187 for 20 h; 120 µl of the culture
supernatant
was then taken to measure SEAP activity.
SEAP assay.
SEAP activity was determined with a
Phospha-Light chemiluminescent reporter gene assay kit as specified by
the manufacturer (Tropix). The compositions of the buffers in this kit
have not been specified. A 100- or 120-µl aliquot of cell culture
medium was harvested and cleared by centrifugation at 12,000 × g for 10 s; 80 µl of the supernatant was then added
to 240 µl of 1× dilution buffer, and endogenous alkaline phosphatase
was heat inactivated at 65°C for 30 min. The tubes were cooled to
room temperature, and 150 µl of the medium was transferred to fresh tubes (this was always done in duplicate); 100 µl of the assay buffer
was added, and the mixture was incubated for 5 min at room temperature.
Subsequently, 100 µl of reaction buffer was added, and the solution
was mixed and immediately transferred into a small scintillation vial.
After 30 min, the chemiluminescence was measured in a scintillation
counter (Packard 1900 TR; TriCarb).
Northern blot analysis.
RNA was prepared as described by
Chomczynski and Sacchi (6). Five or 7.5 µg of total RNA
was denatured by glyoxylation, separated on 1% agarose gels
(38), and transferred onto nylon membranes (GeneScreen Plus;
Du Pont-NEN). The following DNA fragments were radiolabeled as
described by Feinberg and Vogelstein (10, 11), purified over
Nick columns (Sephadex G-50; Pharmacia), and used as hybridization
probes: T1, a 1-kb HindIII fragment from plasmid
pMV7TORF (23), spanning the entire T1 open reading frame
present on the 2.7-kb mRNA; c-fos, a 1-kb PstI
fragment from the plasmid pv-fos, harboring the cDNA of the FBJ murine leukemia virus-derived v-fos gene (8);
c-jun, a 1.5-kb EcoRI/BamHI fragment
from plasmid pTZ jun, containing 1.5 kb of c-jun cDNA; and
mGATA-1, a 1.8-kb XhoI fragment from plasmid pXM-mGATA-1
(61).
Primer extension.
End-labeled oligonucleotide TG2
(GCTCTCTGAGGTAGGGTCCAGAAGAGAAATCAC) (1.5 × 105 to 2 × 105 cpm) was mixed with 10 µg of total RNA, and primer extension reactions were performed as
described previously (13).
Immunoprecipitation of calcium ionophore-treated BMCMCs.
For
metabolic labeling, two identical cultures of 106 BMCMCs
were starved for methionine and cysteine by incubation for 30 min at
37°C in labeling medium (DMEM without methionine and cysteine, 2%
FCS, 2 mM L-glutamine). After starvation, the medium was
replaced with 5 ml of fresh labeling medium, and 0.5 mCi of
Tran35S-label (ICN) was added per culture. For the
stimulation with calcium ionophore, one BMCMC culture was supplemented
with 0.5 µM A23187 (Calbiochem). The control culture was left
untreated. After a 16-h incubation, the cell-free conditioned cell
culture supernatants were collected. The remaining cells were washed
three times with PBS and lysed in Nonidet P-40 (NP-40) lysis buffer (1% NP-40, 150 mM NaCl, 50 mM Tris-HCl [pH 8.0], 5 mM EDTA, 10 mM
iodoacetamide) supplemented with a cocktail of protease inhibitors (Complete; Boehringer). The postnuclear lysates as well as the conditioned culture supernatants were precleared by incubation with 100 µl of protein G-Sepharose beads (Pharmacia) for 1.5 h to
decrease nonspecific binding. Immunoprecipitation was carried out by
adding 30 µl of protein G-Sepharose beads with 3 µg of anti-T1 MAb
DJ8 (42) or IgG1 isotype control MAb and incubation for
6 h at 4°C. Immunoprecipitates were washed twice in NET-TON (0.65 M NaCl, 5 mM EDTA, 50 mM Tris-HCl, 0.5% Triton X-100, 1 mg of
bovine serum albumin per ml, 0.05% sodium azide), twice in NET-T (150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl, 0.5% Triton X-100, 0.05% sodium
azide), and once in distilled water. Beads were boiled in reducing
Laemmli sample buffer, and the eluted proteins separated by sodium
dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-PAGE).
The gel was rinsed in water, soaked for 20 min in 1 M sodium
salicylate, dried, and fluorographed at
80°C.
Flow cytometry of calcium ionophore-treated BMCMCs.
For flow
cytometry, BMCMCs were grown in six-well plates and stimulated with
different concentrations of the calcium ionophore A23187 for 16 h.
Cells were harvested, washed, and stained by adding 0.5 µg of MAb DJ8
per 106 cells for 30 min at 4°C. This was followed by the
addition of fluorescein isothiocyanate (FITC)-labeled goat anti-rat Ig
serum (Southern Biotechnology). Background staining was determined by addition of 0.5 µg of IgG1 isotype control as the first antibody. Dead cells were detected by propidium iodide staining and excluded from
the analysis. After washing and resuspending the cells in fluorescence-activated cell sorting buffer (PBS, 10% FCS, 0.1% sodium
azide), 10,000 forward scatter/side scatter-gated viable cells were
acquired and analyzed on a Becton Dickinson FACS Calibur flow
cytometer.
IgE-DNP stimulation.
Mast cells (2 × 106
cells/ml) were incubated in complete IMDM with anti-2,4-dinitrophenol
(DNP) IgE MAbs (0.5 µg/ml; Sigma Immuno Chemicals) for 24 h. For
determination of serotonin release, 1 µCi of 5-hydroxy
[G-3H]tryptamine creatine sulfate (Amersham Corp.) per ml
was added for the final 5 h of IgE sensitization. The cells were
then washed twice with complete IMDM, resuspended at 2 × 106 cells/ml, and exposed to DNP-derivatized human serum
albumin (0.05 µg/ml; (Sigma Immuno Chemicals) at 37°C for the times
indicated. Released radioactivity in supernatant fractions (100 µl)
was measured in a scintillation counter. To determine the total amount
of incorporated radioactivity, cells were lysed with 0.1% Triton
X-100.
 |
RESULTS |
Calcium influx results in the downregulation of T1M and in the
strong induction of T1S in mast cells.
To test whether T1 gene
expression is affected by treatments which promote the degranulation of
mast cells, we stimulated BMCMCs with different concentrations of the
calcium ionophore A23187 for 6 h. RNA was extracted and subjected
to Northern blot analysis (Fig. 1A). The
long 5-kb transcript predominates in untreated cells. However, upon
A23187 treatment, the 5-kb mRNA disappears while large amounts of the
2.7-kb T1 mRNA accumulate. The strongest effect was observed at 1 µM
A23187. A23187 concentrations above 3 µM are toxic to mast cells.
This toxicity is the likely cause for the low amount of accumulated T1
mRNA in mast cells which were treated with high concentrations of
A23187.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Northern blot analysis of mast cells stimulated with the
calcium ionophore A23187 or IgE-DNP. (A) Aliquots of 5 µg of total
RNA from BMCMCs incubated for 6 h with the indicated
concentrations of A23187 were analyzed on a Northern blot. The filter
was hybridized with a probe representing the whole T1 open reading
frame of the 2.7-kb mRNA. The positions of long and short T1
transcripts are indicated. The ethidium bromide-stained gel is shown at
the bottom to demonstrate integrity of the RNA and equal loading. (B)
BMCMCs were stimulated for the indicated times (hours) with either 1 µM A23187 or DNP-human serum albumin following preincubation for
24 h with a monoclonal mouse anti-DNP IgE. NIH 3T3 cells were
either exponentially growing (exp.) or serum stimulated (s.-stim.) for
6 h (see Materials and Methods). Total RNA was collected, and 5 µg was subjected to Northern blot analysis with a T1 probe. The
bottom panel depicts the ethidium bromide-stained gel. (C) To control
for efficient Fc RI cross-linking in the experiment represented in
panel B, we measured mast cell degranulation.
3H-serotonin-labeled BMCMCs either were incubated with
monoclonal mouse anti-DNP IgE and subsequently stimulated with
DNP-human serum albumin (HSA) (IgE/DNP) or were treated with A23187.
Release of 3H-serotonin was measured and compared to the
total 3H-serotonin content of cells which was determined in
a Triton X-100 cell lysate. Stimulation with either IgE or DNP-HSA
alone resulted in very low 3H-serotonin secretion.
|
|
Since calcium ionophore treatment can mimic some aspects of the
physiological IgE-dependent activation of mast cells, we next
compared
T1 mRNA levels of BMCMCs which were stimulated either
with A23187 or by
cross-linking their Fc

RI. To this end, BMCMCs
were preincubated with
an IgE MAb directed against the hapten
DNP. The subsequent addition of
DNP-conjugated human serum albumin
mediated Fc

RI cross-linking and
resulted in mast cell degranulation.
As seen earlier, calcium ionophore
stimulation evoked a dramatic
upregulation of the 2.7-kb transcript and
downregulation of the
5-kb mRNA (Fig.
1B). The level of the short T1
transcript in mast
cells exceeded even that in serum-stimulated
fibroblasts and remained
high for at least 16 h. Similarly,
cross-linking of the Fc

RI
resulted in accumulation of the 2.7-kb
mRNA. However, the induction
was weaker and transient in nature.
To confirm that antigen stimulation and Ca
2+ ionophore
treatment indeed activated the BMCMCs, we measured the capacity of
these
cells to release preloaded
3H-serotonin
(
7) in response to these treatments (Fig.
1C).
We measured
the total amount of
3H-serotonin taken up by the mast cells
after lysing the cells
with the detergent Triton X-100. A23187 and
antigen stimulation
released 80 and 47%, respectively, of the total
amount of incorporated
serotonin. Thus, both modes of activation
mediated degranulation.
However, the more efficient stimulation of mast
cells by calcium
ionophore treatment might be partially responsible for
the stronger
upregulation of the short T1 transcript under these
conditions
(Fig.
1B).
We next tested whether the accumulation of the short T1 transcript and
the disappearance of the long T1 transcript in response
to
Ca
2+ ionophore treatment of BMCMCs is reflected by a
corresponding
change in the pattern of T1 protein synthesis and
performed an
immunoprecipitation experiment using the recently
generated T1-specific
MAb DJ8 (
42). From lysates of
unstimulated mast cells, DJ8 but
not the IgG1 isotype control antibody
precipitated the 110- to
120-kDa membrane-associated T1M protein (Fig.
2A). In contrast,
the cell lysates of
A23187-treated mast cells contained barely
detectable amounts of T1M.
No T1 protein was present in the cell-free
supernatant of untreated
BMCMCs. However, the stimulation with
calcium ionophore resulted in
stimulation of T1 synthesis, as
evidenced by the detection of large
amounts of T1S which appear
as a broad band of about 45 to 65 kDa (Fig.
2A). Smaller amounts
of T1S were also detectable in lysates of
A23187-stimulated but
not of unstimulated BMCMCs. This probably
represents the intracellular
pool of T1S in the endoplasmic reticulum
and the Golgi apparatus.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Calcium ionophore stimulation of BMCMCs leads to the
downregulation of T1M and the induction of T1S expression. (A)
Immunoprecipitation. NP-40 cell lysates of BMCMCs which were either
treated with 0.5 µM A23187 for 16 h or left untreated, as well
as cell-free supernatants (SN) of A23187-treated and untreated BMCMCs,
were used for immunoprecipitation. For metabolic radioactive labeling,
cells were grown in the presence of [35S]methionine and
[35S]cysteine. Immunoprecipitations (IPP) were performed
with the anti-T1 MAb DJ8 or an IgG1 isotype control MAb. Precipitated
proteins were separated by SDS-PAGE. Positions of T1M and T1S are
indicated. (B) Increasing concentrations of the calcium ionophore
A23187 induced the downregulation of T1M on BMCMCs in a dose-dependent
manner. BMCMCs were incubated for 16 h with different
concentrations of A23187. Surface expression levels of T1M protein were
determined by flow cytometry after staining with MAb DJ8-FITC. Mean
geometric fluorescence intensities are plotted against the indicated
concentrations of A23187. Background binding of IgG1-FITC isotype
control MAb is shown as a dotted line.
|
|
This finding was further substantiated by flow cytometric analysis
(Fig.
2B). BMCMCs were incubated with increasing concentrations
of the
calcium ionophore A23187, and the surface expression levels
of T1M were
quantified by staining with MAb DJ8. The level of
T1M surface
expression decreased with increasing concentrations
of A23187 in a
dose-dependent fashion. The cells treated with
the highest A23187
concentration (0.5 µM) contained only about
1/10 the amount of T1M
present in the untreated cells. We conclude
that calcium
ionophore-activated mast cells downregulate membrane-associated
T1M
and, correspondingly, secrete large amounts of T1S.
Accumulation of the short T1 mRNA in BMCMCs results from
transcriptional activity and can be partly blocked by the
immunosuppressant cyclosporin A.
The accumulation of the 2.7-kb T1
mRNA in A23187-treated mast cells could be due to an enhanced
transcription rate of the T1 gene or to the stabilization of low
amounts of this transcript that escape detection in untreated cells
(65). We performed a pulse-chase experiment to distinguish
between these two regulatory mechanisms. The 2.7-kb T1 mRNA was allowed
to accumulate in BMCMCs in response to the treatment with A23187 for
3 h. Subsequently, actinomycin D was added to block further
transcription, and the levels of T1 mRNA were measured by Northern blot
analysis in cells that were harvested 1, 3, and 5 h later (Fig.
3, lanes 9 to 11). In parallel, the same
experiment was performed, except that A23187 was removed prior to the
addition of actinomycin D (lanes 12 to 14). The amounts of T1S mRNA
detected were similar in the two groups. The result indicates that the
short T1 transcript is stable in the presence as well as in the absence
of A23187. Thus, it seems unlikely that Ca2+
ionophore-mediated accumulation of the short T1 transcript is caused by
mRNA stabilization. This is concordant with the observation that
actinomycin D pretreatment blocked A23187 mediated increases of T1 mRNA
(lanes 15 and 16). From this, we conclude that the accumulation of the
2.7-kb T1 mRNA in response to Ca2+ ionophore treatment is
the result of transcriptional activation.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
Accumulation of the 2.7-kb T1 transcript in
A23187-treated mast cells requires ongoing transcriptional activity.
BMCMCs were either left untreated (lane 1) or treated for the indicated
times (hours) with A23187 (lanes 2 and 3), actinomycin D (Act.D; lanes
4 and 5), or cyclosporin A (CsA; lanes 6 to 8). Lanes 9 to 14, cells
were pretreated with A23187 for 3 h before the addition of
actinomycin D for 1 h (lane 9), 3 h (lane 10), or 5 h
(lane 11). In parallel, BMCMCs were treated identically except that the
calcium ionophore was removed by washing the cells twice with PBS
before the addition of actinomycin D (lanes 12 to 14). Lanes 15 to 18, mast cells were preincubated for 15 min with actinomycin D (lanes 15 and 16) and cyclosporin A (lanes 17 and 18), followed by calcium
ionophore stimulation for 3 and 6 h. Total RNA was harvested, and
7.5-µg aliquots were subjected to Northern blot analysis using T1
cDNA as the hybridization probe. Bottom panel, ethidium bromide-stained
rRNA.
|
|
Cyclosporin A is an immunosuppressant which operates through the
inhibition of Ca
2+-induced dephosphorylation of proteins
such as NF-AT, I

B, Bcl-2,
and NO synthase by calcineurin (
46,
50). Cyclosporin A partially
blocked A23187-induced accumulation
of the 2.7-kb T1 mRNA (Fig.
3, lanes 17 and 18). Hence, we conclude
that the calcineurin pathway
is involved in the calcium
ionophore-dependent T1 gene expression
in mast cells.
Transcription of both T1 mRNAs is initiated at the distal promoter
in mast cells.
T1 gene expression is initiated at one of two
alternative first exons (Fig. 4A).
Fibroblasts synthesize predominantly the 2.7-kb T1 mRNA, but
substantial amounts of the 5-kb T1 mRNA are observed under some
conditions. Both transcripts are exclusively initiated at the proximal
exon 1 in these cells. In contrast, unstimulated mast cells produce
mainly the 5-kb T1 mRNA, which is initiated at the distal exon 1. As
shown in Fig. 1B, stimulation of these cells with calcium ionophores
evokes a strong upregulation of the short T1 transcript, and we
wondered whether transcriptional initiation still occurred at the
distal promoter. A primer extension experiment was performed to analyze
which of the two alternative exons 1 is used for the synthesis of the
2.7-kb T1 transcript in A23187 stimulated BMCMCs. Oligonucleotide TG2,
which is complementary to the 5' region of exon 2 (Fig. 4A), was
extended on RNA derived from BMCMCs that were either left untreated
(Fig. 4B, lane 1) or stimulated with calcium ionophore (lanes 2 and 3).
The extension product indicative for transcriptional initiation at the
proximal promoter was obtained with RNA from serum-stimulated NIH 3T3
cells (lane 4). Primer extension on all mast cell-derived RNA resulted exclusively in the two extension products characteristic for initiation at the distal promoter (lanes 1 to 3). Thus, transcription of both the
long and short T1 mRNAs is initiated at the distal promoter in mast
cells. Hence, transcription initiation occurs in a strictly cell-type-specific manner at the proximal and distal promoters in
fibroblasts and mast cells, respectively.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Exclusive usage of the distal T1 promoter in mast cells.
(A) Genomic organization of the 5' part of the T1 gene. Only exons 1 to
5 are shown. Empty, striped, and filled boxes represent the distal exon
1 (d1), the proximal exon 1 (p1), and the next four exons,
respectively; the ellipse depicts the enhancer (Enh) (60).
The translation start codon (ATG), the position of the oligonucleotide
used for primer extension (TG2), and the expected products of primer
extension reactions are indicated. (B) Products of primer extension
reactions with oligonucleotide TG2 and 10 µg of total RNA isolated
from serum-stimulated NIH 3T3 fibroblasts (lane 4), untreated BMCMCs
(lane 1), and BMCMCs treated for 3 h (lane 2) and 6 h (lane
3) with 1 µM A23187. A sequencing reaction of an unrelated DNA
fragment was run in parallel on the polyacrylamide gel as a size
marker. Open and filled arrowheads indicate the positions of the
extension products which are characteristic for transcription start at
the proximal and distal promoters, respectively.
|
|
Mast cell-specific T1 gene expression is not dependent on the T1
enhancer and c-Fos.
We have previously characterized an enhancer
element located at a position 3.6 kb upstream of the proximal and 6.9 kb downstream of the distal promoter (60). Within this
enhancer, we have identified a centrally located TRE, a binding site
for transcription factors of the AP-1 family. We demonstrated by
mutational analysis that this sequence motif is essential for T1 gene
expression in fibroblasts. Moreover, elevated levels of c-Fos or FosB
were shown to be sufficient to strongly induce the T1 gene in these
cells.
Calcium ionophore treatment leads to the induction of the
c-
fos and c-
jun genes in many cell systems
(
5). Likewise, we
found that c-
fos and
c-
jun mRNA levels strongly and rapidly increase
in
A23187-treated BMCMCs (Fig.
5A). The
extent of c-
fos and c-
jun mRNA accumulation
exceeds even that in serum-stimulated NIH 3T3
cells. This observation
and the fact that c-Fos regulates T1 gene
expression in fibroblasts
prompted us to investigate whether the
large increase of the short T1
transcript in A23187-induced mast
cells is due to AP-1-mediated
activation of the T1 enhancer. Therefore,
we cloned several T1 gene
fragments into a promoterless reporter
plasmid encoding SEAP (Fig.
5B).
These constructs contain 0.3,
2.6, and 6 kb of 5'-flanking promoter
sequence and 16 bp of the
distal exon 1. Constructs pD and pE
additionally harbor a portion
of intron 1 including the enhancer
element and sequences upstream
of the translation initiation site in
exon 2. These plasmids were
transiently introduced into BMCMCs by
electroporation. Promoter
activity was evaluated in untreated and
A23187-stimulated cells
(Fig.
5C). We observed that 310 bp of the 5'
region flanking the
distal exon 1 (pA [Fig.
5B]) was sufficient to
stimulate reporter
gene expression and in particular to mediate calcium
ionophore-triggered
gene upregulation. The longer T1 5'-flanking
sequences in pB and
pC gave rise to stronger gene expression. However,
the extents
of A23187-mediated induction of transcriptional activity
were
similar for all three constructs (Fig.
5C, bottom). Likewise,
the
presence of the enhancer element in the first intron (pD and
pE [Fig.
5B]) influenced neither A23187-mediated T1 reporter gene
expression
nor basal promoter activity.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
The T1 enhancer does not affect transcription from the
distal promoter. (A) Total RNA from BMCMCs and NIH 3T3 cells stimulated
for the indicated times (hours) with 1 µM A23187 and serum,
respectively, was subjected to Northern blot analysis. Two identical
blots were prepared with 7.5 µg of RNA. The filters were
independently hybridized with a c-fos- and a
c-jun-specific probe. Bottom panel, ethidium bromide-stained
rRNA from one of the gels. (B) Genomic organization of the 5' part of
the T1 gene as depicted in Fig. 4A. The seven reporter gene constructs
pA to pG are shown below. Open bars represent T1 sequences fused to
SEAP. The splicing patterns of the distal and proximal exon 1 to exon 2 are depicted for pD to pG. Filled and open ellipses represent the
enhancer (Enh) in its unmutated form and with a mutation in the TRE
(TRE mut), respectively. (C) Mast cells were cotransfected with
equimolar amounts of the empty vector ( ), the T1-SEAP reporter
constructs pA to pE (B), and plasmid CMV-LacZ; 44 h later, the
transfected cells were split into two equal parts and incubated in
fresh medium for an additional 20 h either in the presence or in
the absence of 1 µM A23187. SEAP activity was measured and normalized
for -galactosidase activity to correct for variations in
transfection efficiency. Results are the averages of three independent
experiments, and the standard deviations are given by the error bars.
Fold stimulation in response to Ca2+ ionophore treatment is
shown below the histogram. (D) pF and pG (B) and the empty vector were
transfected into mast cells and NIH 3T3 fibroblasts. A23187 treatment
of BMCMCs and SEAP assays were done as described for panel C; 16 h
after transfection, the fibroblasts were serum starved for 24 h
and subsequently serum stimulated for 24 h. SEAP activity was
determined and normalized for -galactosidase activity. The values
obtained with the stimulated unmutated construct pF were taken as
100%. The results are the averages of at least three independent
experiments.
|
|
To further substantiate the finding that the enhancer does not
influence T1 gene expression in BMCMCs, we generated a reporter
construct which contains both the distal and the proximal first
exons, which allowed us to study the influence of the enhancer
element
in mast cells as well as in fibroblasts (pF [Fig.
5B]).
In
addition, we produced the same construct with an inactivating
TRE
mutation within this enhancer (pG [Fig.
5B]). These two plasmids
were
transiently transfected into BMCMCs and fibroblasts. In accordance
with previous results (
60), we observed that the mutation of
the TRE resulted in a considerable reduction of reporter gene
expression in fibroblasts. In contrast, the TRE mutation affected
basal
gene expression in mast cells only marginally and had no
influence on
calcium ionophore-mediated gene induction (Fig.
5D).
We therefore
conclude that the upregulation of the T1 gene in
response to
Ca
2+ ionophore treatment is not mediated through the
enhancer element.
The enhancer acts cell type and promoter
specifically, exerting
its influence selectively on the proximal
promoter in fibroblasts.
Sequence analysis of the 310-bp minimal T1 distal promoter element
which is sufficient to confer Ca
2+ ionophore stimulation of
the T1 gene revealed the presence of
a sequence element that resembles
a TRE (Fig.
6A). We mutated
this putative
TRE in pC and analyzed the effect of the mutation
in BMCMCs in the
presence or absence of A23187. As shown in Fig.
6B, the mutation
abrogated neither basal nor Ca
2+ ionophore-induced T1
reporter gene expression. Hence, neither
the enhancer-TRE nor this
putative TRE in the 5' region of the
distal exon 1 is involved in
Ca
2+ ionophore-triggered T1 gene stimulation in mast cells.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
c-Fos is not required for T1 gene expression in
A23187-stimulated or unstimulated mast cells. (A) Mutational analysis
of putative transcription factor binding sites in the 5' region of the
distal exon 1. The wild-type (wt) and mutated (mut) putative DNA
binding sequences are depicted (capital letters, core sequences;
lowercase letters, flanking nucleotides; superscript letters, mutated
nucleotides). dGATA, mGATA, and pGATA, distal, medial, and proximal
GATA binding sites; +1, transcription start site. (B) BMCMCs were
transfected with the empty SEAP reporter vector ( ), the T1-SEAP
reporter construct pC (B), and pC with a mutated TRE (A). A23187
stimulation of BMCMCs and SEAP assays were done as described in the
legend to Fig. 5C. The calcium ionophore-induced increases of the SEAP
activity for the three constructs are given. (C) A 5-µg aliquot of
total RNA extracted from BMCMCs which were obtained from a wild-type
mouse (lane 1) and a c-fos / mouse (lanes 2 to 7) was analyzed on a Northern blot. The c-fos knockout
mast cells were calcium ionophore treated for the time periods (hours)
indicated. The filter was hybridized with a T1-specific probe. Bottom
panel, ethidium bromide-stained rRNA.
|
|
If this assumption is correct, the accumulation of the short T1
transcript in A23187-treated BMCMCs derived from c-
fos
knockout
mice should still occur. Such mice are osteopetrotic and have
only a rudimentary bone marrow (
18). Nevertheless, it was
possible
to obtain pure mast cell cultures by incubating suspension
cells
derived from whole meshed femurs in IL-3-containing medium.
Northern
blot analysis revealed that the 2.7-kb T1 mRNA accumulated in
response to A23187 with similar kinetics and to comparable levels
in
c-
fos
/
and in
c-
fos+/+ BMCMCs (compare Fig.
6C and
1B). Hence,
basal as well as A23187-induced
T1 synthesis can occur in the absence
of c-Fos in mast cells.
However, we cannot exclude that another member
of the
fos family
is involved in T1 gene expression in mast
cells.
Taken together, these results lead us to conclude that in contrast to
fibroblasts, neither the enhancer element nor c-Fos
protein influences
T1 synthesis in mast cells.
The mast cell-specific promoter is regulated by GATA transcription
factors.
Sequence analysis of the minimal, 310-bp-long mast
cell-specific T1 promoter revealed the presence of three GATA elements (Fig. 6A). The GATA consensus motif (T/A)GATA(A/G) is the recognition site of GATA transcription factors. GATA-1 (34, 68), GATA-2, and GATA-3 (68) are expressed in several mouse and rat mast cell lines and were shown to be instrumental in mast cell-specific expression of several genes. Hence, GATA factors are possibly involved
in the regulation of the T1 gene transcription in mast cells.
To investigate the role of GATA transcription factors in mast
cell-specific T1 gene expression, we transiently transfected
the T1
reporter constructs pA and pC (Fig.
5B) either alone or
together with a
GATA-1 expression vector or the empty vector pXM
into BMCMCs. GATA-1
overexpression strongly enhanced T1 reporter
gene activity (Fig.
7A). The extents of stimulation were
similar
for pA and pC, indicating that the essential GATA binding sites
are within the 310 bp of the T1 promoter present in pA. Reporter
gene
expression was not influenced by the control vector pXM.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
GATA-1 is a key regulator of the distal promoter. (A)
Cotransfection of the T1-SEAP reporter constructs pA and pC (Fig. 5B)
as well as the empty vector with the expression plasmid pXM-mGATA-1
(encoding the murine GATA-1 transcription factor) or the empty vector
pXM. BMCMCs were electroporated, the medium was changed 44 h
later, and SEAP activity was measured after an additional 20 h.
Plasmid CMV-LacZ was included in each transfection, and
-galactosidase activity was used to correct for variations in
transfection efficiency. Results are the averages of three independent
experiments. Fold induction of promoter strength caused by
cotransfection of the reporter constructs with the expression vector
pXM-mGATA-1 compared with transfection of the reporter constructs alone
is given. (B) Transient transfections of mast cells with the T1-SEAP
reporter construct pC (Fig. 5B) either unmutated or with the indicated
mutations (Fig. 6A). The medium was changed 44 h after
transfection; SEAP activity was determined 20 h later and
normalized as described before. Values are the averages of three
independent experiments. The fold reduction of the distal promoter
strength caused by the individual mutations is shown at the bottom.
|
|
This finding suggests that one or several of the three putative GATA
elements identified in the 310-bp minimal promoter mediate
T1 gene
expression. To evaluate the contribution of each GATA
element, we
introduced point mutations into all three GATA sites
in pC (Fig.
6A).
Analysis of T1 reporter gene expression in transiently
transfected
BMCMCs revealed that a mutation of the middle GATA
element completely
inactivated the distal promoter (Fig.
7B).
Mutations of the distal and
proximal GATA sites reduced promoter
strength as well, although to a
lesser extent. This finding taken
together with the previous
observation of enhanced T1 reporter
gene expression in the presence of
increased GATA-1 levels demonstrates
that mast cell-specific T1 gene
expression is dependent on a GATA
transcription factor(s). Not only
constitutive T1 gene activity
but also calcium ionophore-stimulated T1
gene expression is dependent
on GATA proteins (data not shown).
Others have shown that SP-1, binding in close proximity to GATA
transcription factors, is essential for efficient gene expression.
A
sequence element resembling an SP-1 binding site can be found
centered
at position

251 of the mast cell-specific T1 promoter
(Fig.
6A). We
introduced point mutations to evaluate whether this
element is
necessary for T1 synthesis. The mutation of the putative
SP-1 site
reduced basal T1 gene activity twofold (Fig.
7B). Thus,
the SP-1
element seems to be involved in but not critical for
T1 gene
expression.
GATA-1 expression is not sufficient to activate the mast
cell-specific distal promoter in NIH 3T3 fibroblasts.
In view of
the finding that GATA transcription factors are essential for T1 gene
expression in mast cells, the complete lack of distal promoter usage in
fibroblasts could be explained by the absence of GATA factors in these
cells. To test this hypothesis, we stably introduced the GATA-1
expression plasmid pXM-mGATA-1 (61) into NIH 3T3 cells.
Several transfected cell clones which express the introduced gene under
normal growth conditions at levels comparable to that in BMCMCs were
identified (Fig. 8A). In contrast, no GATA-1 mRNA was found in
untransfected NIH 3T3 cells.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8.
GATA-1 expression in fibroblasts is not sufficient to
activate the mast cell-specific promoter. (A) Northern blot analysis of
different fibroblast cell clones stably transfected with the GATA-1
expression vector (pXM-mGATA-1 [61]). Aliquots of 5 µg of total RNA from transfected cell clones, mast cells, and
exponentially growing (exp.) as well as serum-stimulated (s.stim.) NIH
3T3 cells were analyzed on a Northern blot by subsequent hybridization
with a GATA-1-specific probe and after stripping with a T1-specific
probe. The lower panel depicts the ethidium bromide-stained gel. (B)
The empty vector (pS2/B) and the construct pS-G were transiently
transfected into NIH 3T3 cells and the pXM-mGATA-1-transfected cell
clones 13 and 33. SEAP activities and -galactosidase activities were
measured as described in Materials and Methods. The results are the
averages of three independent experiments. (C) Products of primer
extension reactions with oligonucleotide TG2 (Fig. 4A) and 10 µg of
total RNA isolated from the GATA-1-overexpressing clones 13, 27, and 33 (lanes 1 to 3), from exponentially growing and 6-h serum-stimulated NIH 3T3 cells
(lanes 4 and 5), and from BMCMCs (lane 6). Open and filled arrowheads
mark the positions of the extension products which are characteristic
for initiation of transcription at the proximal and distal promoters,
respectively.
|
|
To ascertain that functional GATA-1 protein is present in these clones,
we transiently transfected two of them as well as
the parental NIH 3T3
cells with a reporter plasmid harboring a
minimal human

-globin
promoter containing a GATA-1 binding site
in front of the SEAP gene
(pS-G). Reporter gene activity was approximately
four times higher in
clones 13 and 33 than in parental NIH 3T3
cells, indicating that
functional GATA-1 protein is present in
these cells (Fig.
8B).
We next performed a primer extension experiment to investigate whether
expression of GATA-1 protein is sufficient to activate
the distal T1
promoter in fibroblasts. The extension products
indicative for
initiation of transcription at the distal promoter
are found only with
RNA from BMCMCs (Fig.
8C, lane 6), whereas
primer extension on all
fibroblast-derived RNA resulted exclusively
in the extension product
characteristic for initiation at the
proximal promoter (lanes 1 to 5).
Thus, no transcription start
occurs at the mast cell-specific promoter
in NIH 3T3 clones expressing
functional GATA-1 protein.
 |
DISCUSSION |
Ca2+ ionophore-induced shift from T1M to T1S in mast
cells.
With the help of recently generated MAbs directed against
the extracellular domain of T1, we have previously investigated the
expression pattern of T1M (42, 43). These studies revealed that mast cells are the only cells which express T1M within the hematopoietic system. The present study was undertaken to analyze the
molecular mechanism of T1 gene expression in mast cells and to test
whether the activation of mast cells influences T1 gene activity. We
observed that Ca2+ ionophore treatment, which mimics some
aspects of antigen-mediated mast cell activation and leads to efficient
degranulation, results in the depletion of T1M and secretion of the
soluble receptor. Recently, we and others have observed that the
proinflammatory cytokines IL-1 and TNF-
stimulate the synthesis and
secretion of T1S in fibroblasts (27, 29). It is interesting
that mast cells store in their granules TNF-
which is released upon
activation. Similarly, they synthesize and secrete IL-1 in response to
stimulation. The release of these proinflammatory cytokines by
activated mast cells could possibly trigger the secretion of soluble T1
from neighboring fibroblasts. Thus, mast cell activation might result in the local accumulation of T1S and the disappearance of T1M from mast
cells. We assume that T1S acts antagonistically to cell-bound T1 by
binding the ligand without inducing intracellular signaling. Our
studies do not provide evidence that T1 is functionally involved in
mast cell stimulation. However, they lead to the speculation that T1
signaling needs to be dampened after the onset of mast cell activation.
This is reminiscent of the IL-1 system, where several mechanisms have
evolved to counteract ligand stimulation (35). A decoy IL-1R
which binds IL-1
and IL-1
without stimulating intracellular
signaling exists in membrane-anchored and secreted forms. Moreover,
many cells produce and secrete the IL-1 antagonist IL-1ra, which binds
with high affinity to the IL-1R type I but does not stimulate
signaling. Vaccinia viruses secrete an IL-1R-like protein which binds
IL-1
with high affinity and presumably acts as a ligand sink. This
results in a diminished systemic acute-phase response to infection and
modulates the severity of the disease (1, 55).
Accumulation of the 2.7-kb mRNA in response to enhanced
intracellular Ca2+ is independent of c-Fos and the enhancer
and is sensitive to cyclosporin A.
We have investigated whether
Ca2+ ionophore-mediated T1 gene upregulation is a
consequence of elevated c-Fos levels. We considered this mode of T1
gene activation likely because we and others have previously observed
that the murine T1 gene and its rat homolog fit-1 are
subject to regulation by c-Fos (2, 23) and because Ca2+ ionophore stimulation results in strongly enhanced
c-Fos levels. However, we found that the TRE within the T1 enhancer
which is essential for gene activation in fibroblasts as well as a
putative AP-1 binding site in the minimal mast cell-specific promoter
are not required for T1 gene upregulation in response to
Ca2+ ionophore treatment. This is in line with the finding
that T1 gene expression in mast cells is not altered in
c-fos
/
mice.
One of the enzymes activated by elevated cytoplasmatic Ca
2+
is the Ca
2+-calmodulin-dependent phosphatase calcineurin, a
primary target
of the immunosuppressive drug cyclosporin A
(
46). Activated
calcineurin dephosphorylates the
transcription factor NF-AT and
thereby allows its translocation into
the nucleus, where it recognizes
specific DNA sequence elements and
triggers gene activation. We
found that cyclosporin A reduced
Ca
2+ ionophore-mediated T1 gene activation. There is no
sequence motif
in the mast cell-specific promoter which resembles a
classical
binding site for NF-AT. However, we cannot exclude that NF-AT
in a heteromultimeric complex with other transcription factors
recognizes a novel sequence motif in the T1 promoter. Thus, further
mutational analyses are needed to determine whether NF-AT is involved
in T1 gene expression.
Differential 3' processing is not dependent on promoter usage.
Unstimulated mast cells almost exclusively produce the 5-kb T1
transcript, whereas fibroblasts predominantly synthesize the 2.7-kb T1
mRNA. Studying the expression of the rat T1 gene homolog, fit-1, Bergers et al. proposed the interesting model that
transcript size, i.e., poly(A) site selection, correlates with
transcription initiation at the mast cell- or fibroblast-specific
promoters (2). We have recently questioned this model by
showing that in fibroblasts, both the 2.7-kb T1 mRNA which predominates
in these cells and the 5-kb T1 transcript which accumulates under certain conditions are initiated exclusively at the proximal, fibroblast-specific promoter (13). Here, we have further
substantiated this finding by demonstrating that the 5-kb T1 transcript
which predominates in untreated mast cells as well as the 2.7-kb T1 mRNA which is the only form of the T1 transcript in long-term Ca2+ ionophore-treated mast cells are initiated at the
distal, mast cell-specific promoter. Thus, at least in mice, we find no
correlation between transcript size and the site of transcription
initiation.
The 2.7-kb T1 mRNA arises by transcription termination after exon 8. In
untreated mast cells, this poly(A) site is ignored
and transcription
proceeds efficiently past exon 9, which results
in splicing within exon
8. Differential poly(A) site usage has
been well studied in the
B-lymphocyte lineage, where a switch
from the membrane-anchored to the
secreted form of Igs is dictated
by poly(A) site selection. The
regulatory component in this system
is the polyadenylation factor
CstF-64, whose level of expression
determines the choice of poly(A)
site usage (
56). Another regulatory
mechanism has recently
been described. U1 snRNP binding to a splice
site adjacent to the late
polyadenylation site of bovine papillomavirus
inhibits RNA processing
at this site and thereby represses late
gene expression at early times
of infection (
19). We have shown
here that the choice of T1
gene poly(A) site usage can be easily
manipulated in mast cells. T1
gene expression in these cells therefore
represents an attractive model
system to study the regulatory
mechanisms of differential poly(A) site
selection.
GATA proteins are required for T1 gene expression in mast
cells.
GATA-1 overexpression in mast cells resulted in enhanced T1
gene expression. The complete inactivation of the T1 promoter through
the introduction of a point mutation in the middle GATA sequence
element further demonstrated that a GATA transcription factor is
crucial for T1 gene expression in mast cells. GATA proteins are key
regulators of hematopoiesis and play an important role in the control
of gene expression in erythrocytes, megakaryocytes, and mast cells
(62). Among the GATA transcription factors, GATA-1 and
GATA-2 are abundantly expressed in mast cells (34, 68) and
are critical for the expression of the genes encoding carboxypeptidase A (68), IL-4 (21), and baboon chymase
(31) in mast cells. The promoter regions of other mast
cell-specific genes such as those encoding mouse mast cell proteases
and IgE receptor
chain contain putative GATA binding sites, but
their importance in tissue-specific expression has not yet been
demonstrated. The observation that the experimental overexpression of
GATA-1 results in enhanced T1 gene expression suggests that the level
of GATA-1 limits the extent of T1 promoter activity in untreated mast
cells. T1 gene upregulation in response to Ca2+ ionophore
treatment is unlikely due to increased GATA-1 levels, as we have not
observed an elevation of GATA-1 mRNA amounts under these conditions
(data not shown). However, we cannot exclude the possibility that
calcium ionophore treatment results in elevated GATA-1 protein levels
in the nucleus due to increased protein stability or enhanced nuclear
translocation.
Ectopic expression of GATA-1 in fibroblasts is insufficient to redirect
transcription initiation to the mast cell-specific
promoter. Several
mechanisms could explain this finding. Additional
transcription factors
might be required which are present in mast
cells but not in
fibroblasts. Alternatively, a specific repressor
might prevent distal
promoter usage in fibroblasts.
GATA proteins were shown to cooperate with other transcription factors,
including SP-1 and AP-1, in promoter activation (
17,
30,
37,
39). Putative binding sites for these two transcription
factors
were found near the GATA sites in the mast cell-specific
T1 promoter.
However, point mutations within the putative TRE
had no effect on
promoter strength, and mutations within the putative
SP-1 site reduced
promoter activity only slightly.
We have previously identified a TRE and three E boxes within the
enhancer element which are essential for T1 gene expression
in
fibroblasts (
23,
60). Our present study revealed that this
enhancer is not required in mast cells. Thus, T1 gene activity
in
fibroblasts and mast cells at a proximal and a distal promoter,
respectively, is regulated very differently. c-Fos is an important
mediator of T1 gene expression in fibroblasts but not in mast
cells,
whereas a GATA transcription factor is essential for T1
gene activity
in mast cells but not in fibroblasts.
 |
ACKNOWLEDGMENTS |
We thank S. H. Orkin for the pXM-mGATA-1 expression vector
and the reporter plasmid pM1
-GH, M. Schürmann for the pTZ-jun expression plasmid, W. Hofstettler for the
c-fos
/
mast cells, H. Hirsch for the
IL-3-secreting X63-mIL-3 myeloma cell line, N. Wey and H. Nef for
expert help with artwork and photography, and A. Hajnal for critical
reading of the manuscript.
This work was supported by the Swiss National Science Foundation (grant
3100-041 905.94 to R.K.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Cancer Research, Department of Pathology, University Hospital,
Schmelzbergstrasse 12, CH-8091 Zürich, Switzerland. Phone:
41-12553931. Fax: 41-12554508. E-mail:
roman.klemenz{at}pty.usz.ch.
Present address: Department of Cardiovascular Research, Genentech,
Inc., South San Francisco, CA 94080.
 |
REFERENCES |
| 1.
|
Alcami, A., and G. L. Smith.
1992.
A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection.
Cell
71:153-167[Medline].
|
| 2.
|
Bergers, G.,
A. Reikerstorfer,
S. Braselmann,
P. Graninger, and M. Busslinger.
1994.
Alternative promoter usage of the Fos-responsive gene Fit-1 generates mRNA isoforms coding for either secreted or membrane-bound proteins related to the IL-1 receptor.
EMBO J.
13:1176-1188[Medline].
|
| 3.
|
Bocek, P., Jr.,
M. D. Guthmann, and I. Pecht.
1997.
Analysis of the genes encoding the mast cell function-associated antigen and its alternatively spliced transcripts.
J. Immunol.
158:3235-3243[Abstract].
|
| 4.
|
Bochner, B. S., and L. M. Lichtenstein.
1991.
Anaphylaxis.
N. Engl. J. Med.
324:1785-1790[Medline].
|
| 5.
|
Chen, C. Y.,
L. W. Forman, and D. V. Faller.
1996.
Calcium-dependent immediate-early gene induction in lymphocytes is negatively regulated by p21Ha-ras.
Mol. Cell. Biol.
16:6582-6592[Abstract].
|
| 6.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 7.
|
Coleman, J. W.,
M. G. Buckley,
M. R. Holliday, and A. G. Morris.
1991.
Interferon-gamma inhibits serotonin release from mouse peritoneal mast cells.
Eur. J. Immunol.
21:2559-2564[Medline].
|
| 8.
|
Curran, T.,
G. Peters,
C. Van Beveren,
N. M. Teich, and I. M. Verma.
1982.
FBJ murine osteosarcoma virus: identification and molecular cloning of biologically active proviral DNA.
J. Virol.
44:674-682[Abstract/Free Full Text].
|
| 9.
|
Echtenacher, B.,
D. N. Mannel, and L. Hultner.
1996.
Critical protective role of mast cells in a model of acute septic peritonitis.
Nature
381:75-77[Medline].
|
| 10.
|
Feinberg, A. P., and B. Vogelstein.
1983.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[Medline].
|
| 11.
|
Feinberg, A. P., and B. Vogelstein.
1984.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Addendum.
Anal. Biochem.
137:266-267[Medline].
|
| 12.
|
Fung Leung, W. P.,
J. De Sousa Hitzler,
A. Ishaque,
L. Zhou,
J. Pang,
K. Ngo,
J. A. Panakos,
E. Chourmouzis,
F. T. Liu, and C. Y. Lau.
1996.
Transgenic mice expressing the human high-affinity immunoglobulin (Ig) E receptor alpha chain respond to human IgE in mast cell degranulation and in allergic reactions.
J. Exp. Med.
183:49-56[Abstract/Free Full Text].
|
| 13.
|
Gachter, T.,
A. K. Werenskiold, and R. Klemenz.
1996.
Transcription of the interleukin-1 receptor-related T1 gene is initiated at different promoters in mast cells and fibroblasts.
J. Biol. Chem.
271:124-129[Abstract/Free Full Text].
|
| 14.
|
Galli, S. J.
1993.
New concepts about the mast cell.
N. Engl. J. Med.
328:257-265[Free Full Text].
|
| 15.
|
Galli, S. J., and B. K. Wershil.
1996.
The two faces of the mast cell.
Nature
381:21-22[Medline].
|
| 16.
|
Gayle, M. A.,
J. L. Slack,
T. P. Bonnert,
B. R. Renshaw,
G. Sonoda,
T. Taguchi,
J. R. Testa,
S. K. Dower, and J. E. Sims.
1996.
Cloning of a putative ligand for the T1/ST2 receptor.
J. Biol. Chem.
271:5784-5789[Abstract/Free Full Text].
|
| 17.
|
Gong, Q., and A. Dean.
1993.
Enhancer-dependent transcription of the epsilon-globin promoter requires promoter-bound GATA-1 and enhancer-bound AP-1/NF-E2.
Mol. Cell. Biol.
13:911-917[Abstract/Free Full Text].
|
| 18.
|
Grigoriadis, A. E.,
Z. Q. Wang, and E. F. Wagner.
1995.
Fos and bone cell development: lessons from a nuclear oncogene.
Trends Genet.
11:436-441[Medline].
|
| 19.
|
Gunderson, S. I.,
M. Polycarpou-Schwarz, and I. W. Mattai.
1998.
U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase.
Mol. Cell.
1:255-264[Medline].
|
| 20.
|
Hatfield, S. M., and N. W. Roehm.
1992.
Cyclosporine and FK506 inhibition of murine mast cell cytokine production.
J. Pharmacol. Exp. Ther.
260:680-688[Abstract/Free Full Text].
|
| 21.
|
Henkel, G., and M. A. Brown.
1994.
PU.1 and GATA: components of a mast cell-specific interleukin 4 intronic enhancer.
Proc. Natl. Acad. Sci. USA
91:7737-7741[Abstract/Free Full Text].
|
| 22.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 23.
|
Kalousek, M. B.,
T. Trub,
M. Schuermann, and R. Klemenz.
1994.
T1 is a c-Fos- and FosB-responsive gene which is induced by growth factors through multiple signal transduction pathways.
J. Biol. Chem.
269:6866-6873[Abstract/Free Full Text].
|
| 24.
|
Karasuyama, H., and F. Melchers.
1988.
Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors.
Eur. J. Immunol.
18:97-104[Medline].
|
| 25.
|
Klemenz, R.,
S. Hoffmann, and A. K. Werenskiold.
1989.
Serum- and oncoprotein-mediated induction of a gene with sequence similarity to the gene encoding carcinoembryonic antigen.
Proc. Natl. Acad. Sci. USA
86:5708-5712[Abstract/Free Full Text].
|
| 26.
|
Kumar, S.,
M. D. Minnich, and P. R. Young.
1995.
ST2/T1 protein functionally binds to two secreted proteins from Balb/c 3T3 and human umbilical vein endothelial cells but does not bind interleukin 1.
J. Biol. Chem.
270:27905-27913[Abstract/Free Full Text].
|
| 27.
|
Kumar, S.,
M. N. Tzimas,
D. E. Griswold, and P. R. Young.
1997.
Expression of ST2, an interleukin-1 receptor homologue, is induced by proinflammatory stimuli.
Biochem. Biophys. Res. Commun.
235:474-478[Medline].
|
| 28.
|
Lanahan, A.,
J. B. Williams,
L. K. Sanders, and D. Nathans.
1992.
Growth factor-induced delayed early response genes.
Mol. Cell. Biol.
12:3919-3929[Abstract/Free Full Text].
|
| 29.
|
Laursen, N. B.,
R. Kessler,
E. Frohli, and R. Klemenz.
1998.
Effects of ras transformation on the induction of the IL-1 receptor related T1 gene in response to mitogens, anisomycin, IL-1 and TNF alpha.
Oncogene
16:575-586[Medline].
|
| 30.
|
Lecointe, N.,
O. Bernard,
K. Naert,
V. Joulin,
C. J. Larsen,
P. H. Romeo, and M. D. Mathieu.
1994.
GATA- and SP1-binding sites are required for the full activity of the tissue-specific promoter of the tal-1 gene.
Oncogene
9:2623-2632[Medline].
|
| 31.
|
Liao, Y. B.,
T. L. Yi,
B. D. Hoit,
R. A. Walsh,
S. S. Karnik, and A. Husain.
1997.
Selective reporter expression in mast cells using a chymase promoter.
J. Biol. Chem.
272:2969-2976[Abstract/Free Full Text].
|
| 32.
|
Malaviya, R.,
T. Ikeda,
E. Ross, and S. N. Abraham.
1996.
Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-alpha.
Nature
381:77-80[Medline].
|
| 33.
|
Martin, D. I., and S. H. Orkin.
1990.
Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1.
Genes Dev.
4:1886-1898[Abstract/Free Full Text].
|
| 34.
|
Martin, D. I.,
L. I. Zon,
G. Mutter, and S. H. Orkin.
1990.
Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages.
Nature
344:444-447[Medline].
|
| 35.
|
Martin, M. U., and W. Falk.
1997.
The interleukin-1 receptor complex and interleukin-1 signal transduction.
Eur. Cytokine Netw.
8:5-17[Medline].
|
| 36.
|
Matsuda, H.,
N. Watanabe,
Y. Kiso,
S. Hirota,
H. Ushio,
Y. Kannan,
M. Azuma,
H. Koyama, and Y. Kitamura.
1990.
Necessity of IgE antibodies and mast cells for manifestation of resistance against larval Haemaphysalis longicornis ticks in mice.
J. Immunol.
144:259-262[Abstract].
|
| 37.
|
Max, A. I.,
J. F. Eleouet, and P. H. Romeo.
1993.
Transcriptional regulation of the pyruvate kinase erythroid-specific promoter.
J. Biol. Chem.
268:5431-5437[Abstract/Free Full Text].
|
| 38.
|
McMaster, G. K., and G. G. Carmichael.
1977.
Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange.
Proc. Natl. Acad. Sci. USA
74:4835-4838[Abstract/Free Full Text].
|
| 39.
|
Merika, M., and S. H. Orkin.
1995.
Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Krüppel family proteins Sp1 and EKLF.
Mol. Cell. Biol.
15:2437-2447[Abstract].
|
| 40.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Mitcham, J. L.,
P. Parnet,
T. P. Bonnert,
K. E. Garka,
M. J. Gerhart,
J. L. Slack,
M. A. Gayle,
S. K. Dower, and J. E. Sims.
1996.
T1/ST2 signaling establishes it as a member of an expanding interleukin-1 receptor family.
J. Biol. Chem.
271:5777-5783[Abstract/Free Full Text].
|
| 42.
|
Moritz, D. R.,
J. Gheyselinck, and R. Klemenz.
1998.
Expression analysis of the soluble and membrane-associated forms of the interleukin-1 receptor-related T1 protein in primary mast cells and fibroblasts.
Hybridoma
17:107-116[Medline].
|
| 43.
| Moritz, D. R., H. Rodewald, J. Gheyselinck, and R. Klemenz. The interleukin-1 receptor-related T1 antigen is
expressed on immature and mature mast cells and on fetal blood mast
cell progenitors. J. Immunol., in press.
|
| 44.
|
Orkin, S. H.
1992.
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575-581[Free Full Text].
|
| 45.
|
Parnet, P.,
K. E. Garka,
T. P. Bonnert,
S. K. Dower, and J. E. Sims.
1996.
IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP.
J. Biol. Chem.
271:3967-3970[Abstract/Free Full Text].
|
| 46.
|
Rao, A.
1994.
NF-ATp: a transcription factor required for the co-ordinate induction of several cytokine genes.
Immunol. Today
15:274-281[Medline].
|
| 47.
|
Reikerstorfer, A.,
H. Holz,
H. G. Stunnenberg, and M. Busslinger.
1995.
Low affinity binding of interleukin-1 beta and intracellular signaling via NF-kappa B identify Fit-1 as a distant member of the interleukin-1 receptor family.
J. Biol. Chem.
270:17645-17648[Abstract/Free Full Text].
|
| 48.
|
Rossler, U.,
A. C. Andres,
E. Reichmann,
W. Schmahl, and A. K. Werenskiold.
1993.
T1, an immunoglobulin superfamily member, is expressed in H-ras-dependent epithelial tumours of mammary cells.
Oncogene
8:609-617[Medline].
|
| 49.
|
Rossler, U.,
E. Thomassen,
L. Hultner,
S. Baier,
J. Danescu, and A. K. Werenskiold.
1995.
Secreted and membrane-bound isoforms of T1, an orphan receptor related to IL-1 binding proteins, are differently expressed in vivo.
Dev. Biol.
168:86-97[Medline].
|
| 50.
|
Ruhlmann, A., and A. Nordheim.
1997.
Effects of the immunosuppressive drugs CsA and FK506 on intracellular signaling and gene regulation.
Immunobiology
198:192-206[Medline].
|
| 51.
|
Schwartz, L. B.
1994.
Mast cells: function and contents.
Curr. Opin. Immunol.
6:91-97[Medline].
|
| 52.
|
Shivdasani, R. A., and S. H. Orkin.
1996.
The transcriptional control of hematopoiesis.
Blood
87:4025-4039[Free Full Text].
|
| 53.
|
Sims, J. E.,
S. L. Painter, and I. R. Gow.
1995.
Genomic organization of the type I and type II IL-1 receptors.
Cytokine
7:483-490[Medline].
|
| 54.
|
Southern, P. J., and P. Berg.
1982.
Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter.
J. Mol. Appl. Genet.
1:327-341[Medline].
|
| 55.
|
Spriggs, M. K.,
D. E. Hruby,
C. R. Maliszewski,
D. J. Pickup,
J. E. Sims,
R. M. Buller, and J. VanSlyke.
1992.
Vaccinia and cowpox viruses encode a novel secreted interleukin-1-binding protein.
Cell
71:145-152[Medline].
|
| 56.
|
Takagaki, Y.,
R. L. Seipelt,
M. L. Peterson, and J. L. Manley.
1996.
The polyadenylation factor CstF-64 regulates alternative processing of IgM heavy chain pre-mRNA during B cell differentiation.
Cell
87:941-952[Medline].
|
| 57.
|
Tominaga, S.
1989.
A putative protein of a growth specific cDNA from BALB/c-3T3 cells is highly similar to the extracellular portion of mouse interleukin 1 receptor.
FEBS Lett.
258:301-304[Medline].
|
| 58.
|
Tominaga, S.,
J. Inazawa, and S. Tsuji.
1996.
Assignment of the human ST2 gene to chromosome 2 at q11.2.
Hum. Genet.
97:561-563[Medline].
|
| 59.
|
Tominaga, S.,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland, and T. Tetsuka.
1991.
Molecular cloning of the murine ST2 gene. Characterization and chromosomal mapping.
Biochim. Biophys. Acta
1090:1-8[Medline].
|
| 60.
|
Trub, T.,
M. B. Kalousek,
E. Frohli, and R. Klemenz.
1994.
Growth factor-mediated induction of the delayed early gene T1 depends on a 12-O-tetradecanoylphorbol 13-acetate-responsive element located 3.6 kb upstream of the transcription initiation site.
Proc. Natl. Acad. Sci. USA
91:3896-3900[Abstract/Free Full Text].
|
| 61.
|
Tsai, S. F.,
D. I. Martin,
L. I. Zon,
A. D. D'Andrea,
G. G. Wong, and S. H. Orkin.
1989.
Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells.
Nature
339:446-451[Medline].
|
| 62.
|
Weiss, M. J., and S. H. Orkin.
1995.
GATA transcription factors: key regulators of hematopoiesis.
Exp. Hematol.
23:99-107[Medline].
|
| 63.
|
Werenskiold, A. K.,
S. Hoffmann, and R. Klemenz.
1989.
Induction of a mitogen-responsive gene after expression of the Ha-ras oncogene in NIH 3T3 fibroblasts.
Mol. Cell. Biol.
9:5207-5214[Abstract/Free Full Text].
|
| 64.
|
Wigler, M.,
R. Sweet,
G. K. Sim,
B. Wold,
A. Pellicer,
E. Lacy,
T. Maniatis,
S. Silverstein, and R. Axel.
1979.
Transformation of mammalian cells with genes from procaryotes and eucaryotes.
Cell
16:777-785[Medline].
|
| 65.
|
Wodnar, F. A., and C. Moroni.
1990.
Regulation of interleukin 3 mRNA expression in mast cells occurs at the posttranscriptional level and is mediated by calcium ions.
Proc. Natl. Acad. Sci. USA
87:777-781[Abstract/Free Full Text].
|
| 66.
|
Yamaguchi, M.,
C. S. Lantz,
H. C. Oettgen,
I. M. Katona,
T. Fleming,
I. Miyajima,
J. P. Kinet, and S. J. Galli.
1997.
IgE enhances mouse mast cell Fc(epsilon)RI expression in vitro and in vivo: evidence for a novel amplification mechanism in IgE-dependent reactions.
J. Exp. Med.
185:663-672[Abstract/Free Full Text].
|
| 67.
|
Yanagisawa, K.,
T. Takagi,
T. Tsukamoto,
T. Tetsuka, and S. Tominaga.
1993.
Presence of a novel primary response gene ST2L, encoding a product highly similar to the interleukin 1 receptor type 1.
FEBS Lett.
318:83-87[Medline].
|
| 68.
|
Zon, L. I.,
M. F. Gurish,
R. L. Stevens,
C. Mather,
D. S. Reynolds,
K. F. Austen, and S. H. Orkin.
1991.
GATA-binding transcription factors in mast cells regulate the promoter of the mast cell carboxypeptidase A gene.
J. Biol. Chem.
266:22948-22953[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 1998, p. 5320-5331, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Smithgall, M. D., Comeau, M. R., Park Yoon, B.-R., Kaufman, D., Armitage, R., Smith, D. E.
(2008). IL-33 amplifies both Th1- and Th2-type responses through its activity on human basophils, allergen-reactive Th2 cells, iNKT and NK Cells. Int Immunol
20: 1019-1030
[Abstract]
[Full Text]
-
Migliaccio, A. R., Rana, R. A., Sanchez, M., Lorenzini, R., Centurione, L., Bianchi, L., Vannucchi, A. M., Migliaccio, G., Orkin, S. H.
(2003). GATA-1 as a Regulator of Mast Cell Differentiation Revealed by the Phenotype of the GATA-1low Mouse Mutant. JEM
197: 281-296
[Abstract]
[Full Text]
-
Brint, E. K., Fitzgerald, K. A., Smith, P., Coyle, A. J., Gutierrez-Ramos, J.-C., Fallon, P. G., O'Neill, L. A. J.
(2002). Characterization of Signaling Pathways Activated by the Interleukin 1 (IL-1) Receptor Homologue T1/ST2. A ROLE FOR JUN N-TERMINAL KINASE IN IL-4 INDUCTION. J. Biol. Chem.
277: 49205-49211
[Abstract]
[Full Text]
-
Nawijn, M. C., Dingjan, G. M., Ferreira, R., Lambrecht, B. N., Karis, A., Grosveld, F., Savelkoul, H., Hendriks, R. W.
(2001). Enforced Expression of GATA-3 in Transgenic Mice Inhibits Th1 Differentiation and Induces the Formation of a T1/ST2-Expressing Th2-Committed T Cell Compartment In Vivo. J. Immunol.
167: 724-732
[Abstract]
[Full Text]
-
Suzuki-Ishigaki, S., Numayama-Tsuruta, K., Kuramasu, A., Sakurai, E., Makabe, Y., Shimura, S., Shirato, K., Igarashi, K., Watanabe, T., Ohtsu, H.
(2000). The mouse L-histidine decarboxylase gene: structure and transcriptional regulation by CpG methylation in the promoter region. Nucleic Acids Res
28: 2627-2633
[Abstract]
[Full Text]
-
Townsend, M. J., Fallon, P. G., Matthews, D. J., Jolin, H. E., McKenzie, A. N.J.
(2000). T1/ST2-deficient Mice Demonstrate the Importance of T1/ST2 in Developing Primary T Helper Cell Type 2 Responses. JEM
191: 1069-1076
[Abstract]
[Full Text]