Previous Article | Next Article 
Molecular and Cellular Biology, September 1998, p. 5332-5342, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Specific Mismatch Recognition in Heteroduplex
Intermediates by p53 Suggests a Role in Fidelity Control of
Homologous Recombination
Christine
Dudenhöffer,
Gabor
Rohaly,
Katrin
Will,
Wolfgang
Deppert, and
Lisa
Wiesmüller*
Heinrich-Pette-Institut für
Experimentelle Virologie und Immunologie an der Universität
Hamburg, D-20251 Hamburg, Germany
Received 2 February 1998/Returned for modification 30 March
1998/Accepted 23 June 1998
 |
ABSTRACT |
We demonstrate that wild-type p53 inhibits homologous
recombination. To analyze DNA substrate specificities in this process, we designed recombination experiments such that coinfection of simian
virus 40 mutant pairs generated heteroduplexes with distinctly unpaired
regions. DNA exchanges producing single C-T and A-G mismatches were
inhibited four- to sixfold more effectively than DNA exchanges producing G-T and A-C single-base mispairings or unpaired regions of
three base pairs comprising G-T/A-C mismatches. p53 bound specifically to three-stranded DNA substrates, mimicking early recombination intermediates. The KD values for the
interactions of p53 with three-stranded substrates displaying
differently paired and unpaired regions reflected the mismatch base
specificities observed in recombination assays in a qualitative and
quantitative manner. On the basis of these results, we would like to
advance the hypothesis that p53, like classical mismatch repair
factors, checks the fidelity of homologous recombination processes by
specific mismatch recognition.
 |
INTRODUCTION |
p53 germ line mutations are
associated with a deficit to maintain genomic stability along
with an increase of spontaneous gene amplification rates (17, 52,
93), thereby accelerating the multistep process of tumor
progression (81). This phenotype has been explained by the
loss of p53 cell cycle checkpoint control (38, 39, 46). DNA
damage (38, 39, 60) and suboptimal growth situations, such
as an increase of oxygen radicals (28) or ribonucleotide
depletion (50), are signals for p53-mediated accumulation and functional activation (54, 68). Depending on the cell type, p53 induces cell cycle arrest or apoptosis
predominantly via transcriptional transactivation of genes coding
for the cyclin-dependent kinase inhibitor p21/WAF1/CIP1/SDI1
(21, 23) or the apoptotic factor Bax (56).
As a consequence, cells are unable to replicate their DNA under
conditions which may lead or may have led to chromosome breaks
(3), thereby preventing the manifestation and aggravation of
genomic lesions in S phase.
Strikingly, the same molecular signal triggering the DNA
damage response by p53, namely, DNA strand breaks (60),
also initiates V(D)J recombination (79), meiotic
recombination (27), recombination repair (75),
and gene amplification (19) events. There is evidence for an
at least indirect involvement of p53 in V(D)J recombination, as
irradiation can rescue rearrangement at multiple T-cell receptor loci
by a p53-dependent bypass mechanism in scid mice (2,
12). A role for p53 in meiotic recombination has been postulated
from the observation that p53 mRNA expression in testes of mice is high
and specific for spermatocytes in zygotene to pachytene, the meiotic
stages at which homologous chromosomes synapse for genetic exchange
(65, 69). Intriguingly, the mitotic checkpoint factor Atm,
the product of the gene mutated in patients with ataxia telangiectasia
(66), is also found in spermatocytes of meiosis I. Atm
belongs to the family of phosphatidylinositol 3-kinase-like protein
kinases which, like DNA-dependent kinase DNA-PK, another
phosphatidylinositol 3-kinase family member involved in V(D)J
recombination and so-called end-joining pathways of double-strand break
(DSB) repair (for reviews, see references 36
and 85), are good candidates for signal-amplifying
molecules after sensing DNA aberrations (18). Mutations in
ATM lead to a delay in the response of p53 toward
ionizing radiation, indicating upstream functions within the signaling
response (39, 53).
Further support for the idea that p53 is a cell cycle-regulatory factor
also directly linked to repair and/or recombination processes comes
from a number of reports on physical interactions with proteins
involved in DNA-modifying pathways: replication factor A, a
single-stranded DNA (ssDNA) binding protein participating in DNA
replication, DNA damage recognition, recombination, and nucleotide
excision repair (reference 70 and references
therein); XPB, XPD, and p62, two helicases and one subunit of unknown
function of the dual transcription/excision repair complex TFIIH
(84, 90); and the human RecA homolog Rad51 (73),
which performs homologous DNA pairing and strand exchange reactions
with a polarity opposite that of RecA (10, 26, 74).
Intriguingly, homozygous Rad51 knockouts show early embryonic death,
which can be alleviated by a mutation in p53 (49, 77). In
addition, p53 itself performs biochemical activities, such as DNA
reannealing and strand transfer on short oligonucleotides (4, 15,
61), and 3'-5' exonuclease activity (59), which
suggests active participation in repair processes possibly comprising
homologous recombination. The C-terminal 30 amino acids of p53 seem to
function like a molecular switch regulating the functions of the p53
core domain, as could be demonstrated by C-terminal phosphorylation,
truncation of the protein, or antibody activation (34, 35, 37,
59). The same region on p53 also binds ssDNA sequence
nonspecifically (5), recognizes insertion/deletion-type DNA mismatches, and confers DNA damage sensor functions by
stimulating sequence-specific DNA binding of the central part (37,
47, 63). Strong indications for a direct involvement of p53 in
genetic exchange come from two recent publications showing DNA
conformation-specific recognition of cruciform (42) and
Holliday junction (48) DNAs in vitro.
Favoring the idea of a direct regulatory role of p53 in DNA exchange
processes, we have developed a model system which allows us to quantify
homologous recombination rates between simian virus 40 (SV40)
chromosomes in monkey cells (89) and avoids unwanted effects
originating from p53 responses to nakedly transfected DNA
(68). This assay is based on measuring the recombination rates between two types of SV40 whose genomes were mutated in such a
way that upon double infection of monkey cells, virus particles could
be released only after interchromosomal exchange of genetic material.
By use of this system, we were able to demonstrate suppression of
homologous recombination events by wild-type p53, which could be
alleviated by complexing p53 with SV40 T antigen (T-Ag). Our interpretation of a direct involvement of p53 in the control of homologous recombination has been supported by recent reports describing an increase in spontaneous intrachromosomal homologous recombination upon functional inactivation of wild-type p53
(11, 55).
In this study, we have applied our SV40-based test system to the
analysis of specific heteroduplex DNA substrates, with respect to
the inhibition of homologous recombination events by p53. We demonstrate a preferred inhibition for certain base-base mismatch types in heteroduplexes produced by DNA exchange in living cells, which correlates with the binding of artificial recombination intermediates by p53 in vitro.
 |
MATERIALS AND METHODS |
Mammalian cells and transgenic clones.
Kidney cells from
African green monkey (Cercopithecus aethiops), CV1, TC7, and
rhesus monkey (Macaca mulatta) kidney cells, from
primary isolates (PRK), and from the established cell line LLC-MK2 (33, 82) were grown in Dulbecco modified
Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) at
37°C. LLC-MK2(p53her) cells were established after
calcium phosphate-mediated cotransfection of LLC-MK2 cells
with pSV53her (64) and pM5neo; LLC-MK2(neo) cells were established after transfection with pM5neo only. Clones were
raised in DMEM supplemented with 0.8 mg of G418 (Gibco/BRL) and
10% FCS, stripped by stirring 1 liter with 10 g of charcoal (Norit A; Merck) and 1 g of Dextran 40 (Merck) for 30 min,
centrifuged at 13,000 × g, and passed through
0.2-µm-pore-size filters. For analysis and assays, the cells were
kept in phenol red-free DMEM with charcoal-stripped FCS.
-Estradiol
(Sigma) was added to result in the final concentrations indicated.
Isolated clones were tested for p53her (see Results for description)
expression in total homogenates by Western transfer and
immunodetection.
SV40 and recombination assays.
Genomic SV40 (strain 776 derivative) and SV40-tsB11 (76) DNAs were isolated,
linearized by KpnI, and cloned into the KpnI site
of pBluescript M13+ (Stratagene), using competent Escherichia coli XL1Blue (Stratagene). The complete coding region of VP1 in pBS-SV40-tsB11 was sequenced by using a T7 polymerase kit from Pharmacia. The 273-bp ApaI-BamHI DNA fragment
encompassing the tsVP1(K290T)/A2367C mutation was transferred into the
corresponding sites of pUC-SV40 (89), thereby creating
pUC-SV40-tsVP1(K290T). pBS-SV40-tsVP1(286S)-C2354T was engineered
by in vitro mutagenesis on ssDNA of pBS-SV40 prepared after M13KO7
helper phage (Pharmacia) infection of the corresponding XL1Blue
bacteria. For that purpose, we used the Sculptor in vitro mutagenesis
system (Amersham Buchler) according to the manufacturer's
instructions. The mutagenizing oligonucleotide was
5'-GCAGTGGAAGGGACTTTCCAGATATTTTAAAATTACC-3' (mutating base is underlined). The absence of extra mutations was
excluded by sequencing and ApaI-BamHI
recloning of the mutated fragment into pUC-SV40. DNA-modifying enzymes
were purchased from Boehringer Mannheim, New England Biolabs,
Fermentas, or Pharmacia. Virus generation from recombinant viral DNAs,
virus infection, and determination of virus yields (multiplicity of
infection) via T-Ag immunofluorescence were performed exactly as
described by Wiesmüller et al. (89). Recombination
assays were performed and evaluated accordingly, except that
-estradiol-containing medium was added to
LLC-MK2(p53her) and LLC-MK2(neo) cells
immediately after virus infection.
Extraction of mammalian cells, immunoprecipitation, and Western
blot analysis.
After washing cells three times with
phosphate-buffered saline (PBS), we obtained total cellular homogenates
at 0°C by scraping the cells from the culture dish with a rubber
policeman in 100 µl of 3× sodium dodecyl sulfate (SDS) sample buffer
(65 mM Tris-HCl [pH 6.8], 10% glycerol, 2.3% SDS, 5%
-mercaptoethanol, bromophenol blue) per 106 cells.
Protocols for cell extractions, immunoprecipitations, and Western blot
analyses were performed as described by Wiesmüller et al.
(89). For anti-p53 immunoprecipitations from cell extracts of different LLC-MK2(p53her) and LLC-MK2(neo)
clones untreated or after treatment with 5 µM
-estradiol for
24 h, we used the wild-type p53 conformation-specific
monoclonal antibody Pab1620 (9). For the corresponding virus
infections, we used SV40-dl1066, which encodes T-Ag lacking
the C-terminal host range domain of 38 amino acids, in order to
avoid signal interference in immunoblots, as T-Ag has an apparent
molecular mass of 90 kDa, identical to that of p53her. At 48 h
after infection and culturing in the absence or presence of 5 µM
-estradiol, T-Ag-p53 complexes were isolated by precipitation with
Pab419, which is directed against the N terminus of T-Ag
(88). Proteins separated on an SDS-10% polyacrylamide gel
and transferred to Hybond-C Super membranes (Amersham) were immunodetected by using sheep polyclonal anti-p53 serum (Boehringer Mannheim) and the affinity-purified and peroxidase-conjugated secondary
serum which is goat anti-sheep immunoglobulin IgG (Sigma). Visualization of the immunocomplexed p53 bands was achieved by chemiluminescence enhancement according to the Amersham protocol.
Assay for transcriptional transactivation.
LLC-MK2(p53her) and LLC-MK2(neo) cells were
transiently lipofected with the p53 reporter plasmid pG13-CAT
(40) by use of Lipofectamine (Gibco/BRL). After a recovery
phase of 24 h, the cells from one culture dish each were split,
subjected to a recovery phase of 8 h, and further cultivated for
16 h in the presence or absence of 2 µM
-estradiol. In
parallel, LLC-MK2 cells stably expressing the Gal4-estrogen
receptor fusion protein GalER-VP16 were lipofected with the Gal4
reporter pCAT-4 and estradiol induced correspondingly, resulting in
comparable transactivation activities (16). As a positive
control, LLC-MK2 cells were lipofected with pSV2CAT, which
directs constitutive expression of the chloramphenicol acetyltransferase (CAT) enzyme from the early SV40 promoter. During the
preparation of cell extracts 48 h after lipofection and for the
quantitative determination of CAT in these extracts, we followed the
instructions accompanying the CAT enzyme-linked immunosorbent assay kit
from Boehringer Mannheim. To calculate the specific transcriptional
transactivation activities in the extracts, we measured the protein
contents by use of the bicinchoninic acid protein assay reagent (Pierce
GmbH).
Baculoviral expression and preparation of p53 from insect
cells.
High Five insect cells (Invitrogen) were infected either
with recombinant baculovirus directing the expression of N-terminally histidine-tagged murine wild-type p53, of histidine-tagged
p53Gly168,Ile234 mutant protein from MethA cells (20), or of
human wild-type p53. Cells harvested 48 h after infection were
washed four times with PBS at 4°C and incubated in ice-cold buffer A
(10 mM HEPES [pH 7.4], 1.5 mM MgCl2, 5 mM KCl, 1 mM
dithiothreitol [DTT], protease inhibitors [125 µg of Pefabloc, 5 µg of pepstatin, 5 µg of leupeptin, and 5 µg of aprotinin per ml)
for 60 min. Swollen cells were Dounce homogenized and left on ice for a
further 45 min. Intact nuclei were harvested by centrifugation at
5,000 × g, resuspended in buffer B (10 mM HEPES [pH
9.0], 1.5 mM MgCl2, 5 mM KCl, 10 mM DTT, protease
inhibitors), and extracted for 45 min. After repeated centrifugation,
the pellet was extracted with buffer B containing 200 mM KCl. This
fraction contained the major portion of p53, as verified by immunoblot
analysis. After SDS-polyacrylamide gel electrophoresis (PAGE) and
Coomassie blue staining, the 53-kDa band corresponding to p53
appeared as the dominant band, indicating high enrichment of p53 in the
preparation. p53-containing fractions were aliquoted and stored frozen
at
70°C. The quality of each protein preparation was checked by
electrophoretic mobility shift assays (EMSAs) with double-stranded
oligonucleotides mimicking the wild-type p53-specific ribosomal gene
cluster (RGC) site (40) and with DNA fragments corresponding
to the mutant p53-specific matrix attachment region/scaffold attachment
region (MAR/SAR) elements (58).
Wild-type p53 protein from insect cells was independently purified to
homogeneity via affinity binding of the N-terminal tag consisting of
six histidines to Talon metal resin from Clontech (59). The
second method applied to obtain highly purified wild-type proteins,
Pab421 immunoaffinity purification, differed from the published
procedure by substituting 3.0 M MgCl2 elution for alkaline elution. Subsequently, p53-containing fractions were dialyzed against
20 mM Tris (pH 7.5)-200 mM NaCl-2 mM DTT. The homogeneous p53 protein
preparations (
90% pure) were stored at 4°C and applied to band
shift analysis using three-stranded substrates within 2 days. Protease
inhibitors were purchased from Bayer, Biomol, or Serva.
Preparation of three-stranded intermediates.
Artificial
three-stranded DNA substrate representing the perfectly matching
recombination intermediate at the SV40-tsVP1(290T) locus was
prepared by annealing top
(5'-ACGCTGCCGAA TGGATCCGGTTATCACCGCTTTCTAAGGGTAATTTTAAAATATCTGG GAAGTCCC-3'), central (5'-GACTTCCCAGATATTTTAAAATTACCCTT AGAAAGCGGTCTGTGAAAAACCCCTACCCAATTTCCTT-3'), and bottom (5'-GGAAATTGGGTAGGGGTTTTTCACAGACCGCTTTCTAAGCT GTCTAGAGGATCCGACTATCGA-3')
oligonucleotides simultaneously. For the corresponding C-T mismatch
substrate, central oligonucleotide 5'-GACTT CCCAGATAT TT TACAAT TACCC T TAGAAAGCGGTC TGTGAAAAACC CCTACCCAATTTCCTT-3'
(mispaired base underlined) was used instead. The matching intermediate
at the SV40-tsVP1(286S) locus was mimicked by junction DNAs
consisting of top
(5'-GACGCTGCCGAATGGATCCGGTTAAAGGGT AATTTTAAAATATCTGGGAAGTCCCTTCCACTGCTG-3'), central (5'- GCAGTGGAAGGGACTTCCCAGATATTTTAAAATTACCCTTAGAAA GCGGTCTGTGAAAAACCCCTA-3'), and bottom (5'-GGGGTTTTTCACA GACCGCTTTCTAAGGGTAATTTTAAAGCTGTCTAGAGGATCCGAC TATCGA-3')
oligonucleotides. At the same locus, mismatch substrates were
produced by incorporating top oligonucleotide
5'-GACGCTGCCGAATGGAT CCGGTTAAAGGGTAATTTTAAAATATCTGGAAAGTCCCTTCCACTG CTG-3'
for A-C mispairing, top oligonucleotide
5'-GACGCTGCCGAATGGATCCGGTTAAAGGGTAATTTTAAAATATCTGGTAAGTCCCTTCCACTGCTG-3' for C-T mispairing, central oligonucleotide
5'-GCAGTGGAAGGGAC TTTCCAGATATTTTAAAATTACCCTTAGAAAGCGGTCTGTGAAAAAC CCCTA-3'
for G-T mispairing, central oligonucleotide
5'-GCAGTGGAAGGG ACTTACCAGATATTTTAAAATTACCCTTAGAAAGCGGTCTGTGAAA AACCCCTA-3'
for A-G mispairing, and central oligonucleotide
5'-GCAGTGG AAGGGACTTTCTAGATATTTTAAAATTACCCTTAGAAAGCGGTCTG TGAAAAACCCCTA-3' for G-T/G-T mispairings. In each case, top oligonucleotides were radioactively labeled at the 5' end prior to annealing by use of
[
-32P]ATP and T4 polynucleotide kinase. Labeled
and unlabeled competitor junction DNAs were separated from flayed
duplexes and ssDNAs by native electrophoresis in a TBE (89 mM Tris-HCl
[pH 8.3], 89 mM boric acid, 2.5 mM EDTA)-buffered 6% polyacrylamide
gel, their positions were identified by autoradiography, and they were
eluted from crushed gel pieces under agitation at 4°C for 16 h.
DNA concentrations were measured by using DNA Dipsticks (Invitrogen),
and the resulting values were controlled by scintillation counting of
the corresponding radioactivities.
EMSA and Scatchard analysis.
32P-labeled
junction, flayed duplex, or ssDNAs were mixed with p53 protein at the
concentrations indicated for each figure in 25 mM Tris-HCl (pH 8.0)-5
mM EDTA-1 mM DTT-6% glycerol (shift buffer) in a total volume of 20 µl. In control reactions without p53, the protein storage buffer only
was added. For supershifts, 1 µl of a protein fraction containing 100 ng of p53 from insect cells was mixed with shift buffer, then 100 ng of
the corresponding affinity-purified monoclonal antibody in a
volume of 1 µl of PBS was added, and the mixture was preincubated for
45 min before the addition of DNA. Controls without antibody contained
1 µl of PBS instead. After incubation for 25 min (1 to 20 min for
on-rate studies) on ice, the protein-DNA mixtures were subjected to
PAGE on a native 4% polyacrylamide gel in 6.7 mM Tris-HCl (pH
8.0)-3.3 mM sodium acetate-2 mM EDTA at room temperature. Dried gels
were autoradiographed, and band intensities were quantified by
PhosphorImager analysis. Individual backgrounds were subtracted for
each lane individually. In each gel, the intensities of the bands at
the position of three-stranded DNA from control reactions with input DNAs of known concentrations but lacking protein were used to calculate
the DNA concentrations of bound and free DNAs. The free substrate
concentration was estimated as the product of the fraction of
32P-labeled DNA in the unshifted position and the total
concentration of input DNA. The total bound substrate concentration was
estimated as the product of the fraction of 32P-labeled DNA
in the shifted position and the total concentration of input DNA. The
apparent equilibrium dissociation constant KD and the corresponding standard error were calculated from the Scatchard plot by computational analysis via the program Grafit. Three-stranded substrate concentrations in the final Scatchard analysis
were 44 to 612 pM for match, 15 to 306 pM for C-T and A-G, and 230 to
2,295 pM for G-T, A-C, and G-T/G-T. Off rates of labeled three-stranded
DNAs bound to p53 were determined after addition of either 2 × 102-fold excess of nonlabeled specific DNA or 3 × 105-fold excess of competitor ssDNA.
 |
RESULTS |
Reduction of recombination rates in monkey cells by ectopically
expressed wild-type p53.
For the analysis of p53 functions in
recombination between SV40 chromosomes, we decided to establish an
SV40-infectible monkey cell line which displays wild-type p53
activities conditionally. As a consequence, cultivation should be
possible under permissive conditions despite p53's antiproliferative
effect. To facilitate the interpretation of our data, we chose a monkey
cell line without endogenous wild-type p53, the rhesus monkey cell line
LLC-MK2 (33). This cell line carries mutated p53
lacking amino acids 237 to 239 (p53
237-239) and as a consequence
displays all of the characteristics of a transforming p53 mutant
(82). Prior experiments demonstrated that p53
237-239 had
lost recombination suppressor activities completely (89).
LLC-MK
2 cells were transfected with the construct
pSV53her (
64) for the stable expression of p53her
(human wild-type p53
C-terminally fused to the human estrogen receptor
hormone binding
domain), which allows activation of wild-type p53
functions after
17

-estradiol application. Importantly, within this
chimera, the
C-terminal oligomerization domain of p53 was not expected
to be
accessible to other proteins before estradiol addition, as
hormone
binding by the human estrogen receptor fusion liberates this
peptide
and the neighboring C-terminal regions of p53 from a protein
complex
containing heat shock proteins (
13,
45,
67).
Accordingly,
mutant p53

237-239 should exist predominantly within
homo-oligomers
in the absence of

-estradiol. Therefore, dominant
negative effects
of p53

237-239 via hetero-oligomerization with
p53her after estradiol
induction can largely be excluded. Another
advantage of ectopic
p53her expression in view of the SV40-based
recombination assay
was the fact that significant amounts of this
wild-type p53 fusion
protein would be active before T-Ag synthesis and
complex formation
of p53her after SV40 infection (
89).
When we examined cells from different LLC-MK
2(p53her)
clones for de novo synthesis and steady-state levels of p53her (data
not shown), the hybrid protein with an apparent molecular mass
of 90 kDa in SDS gels was found to be maximally expressed in clones
17 and
29; therefore, we selected these clones for more detailed
analysis and
most of the subsequent recombination studies. According
to
computer-assisted quantitative evaluation of autoradiographs,
the level
of p53her protein was in the physiological range of
endogenous
wild-type p53 from primary rhesus monkey or TC7 cells
and threefold
below the level of endogenous p53

237-239 in LLC-MK
2 cells, both of which did not change after application of 10 µM

-estradiol for 4 h (Fig.
1A). As
depicted in Fig.
1B, p53her
was immunoprecipitated by the wild-type p53
conformation-specific
monoclonal antibody Pab1620 (
9).
Immunoprecipitations with
Pab419 (
88) directed against the
T-Ag gave evidence for complex
formation of p53her and SV40 T-Ag
48 h after SV40 infection (Fig.
1C). Treatment of cells with 5 µM

-estradiol raised the fraction
of p53her protein accessible to
Pab1620 and T-Ag three- and twofold,
respectively. However, Fig.
1B and
C also demonstrate reactivity
to p53her before estradiol addition,
reflecting the basal level
of active p53 protein due to residual
estrogens in phenol red-free
and hormone-stripped culture medium. The
existence of functional
wild-type p53 before hormone induction can also
be deduced from
the prolonged generation time of 27 h for
LLC-MK
2(p53her) cells
versus 21 h for
LLC-MK
2(neo) cells. Transcriptional transactivation
via the
p53-responsive RGC element (
40) has been demonstrated
for
p53her by others (
64). Here, the production of the CAT
reporter
protein after transient lipofection of
LLC-MK
2(p53her) cells with
pG13-CAT containing 13 RGC
elements was stimulated sixfold by
incubation with 2 µM estradiol for
16 h (data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Western analysis of total and functionally inducible
p53her. (A) Green monkey (TC7), primary rhesus monkey (PRK),
neomycin-resistant control rhesus monkey [LLC-MK2(neo)]
and p53her-expressing rhesus monkey kidney cells
[LLC-MK2(p53her)] were cultivated in the absence ( ) or
presence (+) of 10 µM -estadiol for 4 h. Total homogenates of
105 cells each were subjected to SDS-PAGE and Western
transfer, and p53 protein was detected by sheep anti-p53 serum,
anti-sheep immunoglobulin G-peroxidase conjugate, and chemiluminescent
peroxidase substrate. After incubation of
LLC-MK2(p53her)-17 cells for 24 h (B) or for 48 h
after SV40 infection (C) with or without 5 µM -estradiol, p53her
was immunoprecipitated with Pab1620 or in complex with T-Ag via Pab419,
respectively. Precipitates from 5 × 105 cells each
were treated for immunoblot analysis as described above.
|
|
Having established that p53her displays bona fide wild-type p53
features in LLC-MK
2(p53her) cells, we applied our
SV40-based
recombination assay system to LLC-MK
2(p53her)-17
cells and LLC-MK
2(neo)
control cells (
89). This
system relies on differently mutated
SV40 variants, which display a
temperature-sensitive (ts) phenotype,
such that production of
virus particles is still possible at 32°C.
After coinfection of
monkey cells at the restrictive temperature
of 39°C with two
distinct SV40-tsVP1 mutants, virus particles
can be generated
only after exchange of genetic material and reconstitution
of the
wild-type genome. The results from five independent experiments
using
SV40-tsVP1(196Y) and SV40-tsVP1(286S) for coinfections
showed
that recombination frequencies in LLC-MK
2(p53her)-17
cells before
([3.5 ± 1.0] × 10
5) and after
([2.1 ± 0.9] × 10
5)

-estradiol addition did
not change significantly, as was expected
from the high basal level of
wild-type p53 functions. Therefore,
in the following experiments we
decided to compare only recombination
rates after wild-type p53
activation in LLC-MK
2(p53her) cells
in the presence of

-estradiol and after the same treatment of
control cells.
LLC-MK
2(neo) cells allowed genetic exchange at
a rate
of (7.5 ± 2.1) × 10
5 in the presence of estradiol
(five different experiments). To
exclude false interpretations
originating from clonal differences,
we performed
recombination measurements for LLC-MK
2(p53her)-17,
LLC-MK
2(p53her)-29, and
LLC-MK
2(p53her)-25 cells and cells from
two independent
LLC-MK
2(neo) clones and obtained comparable values
(2 × 10
5, 4 × 10
5,
10
5, 8 × 10
5, and 8 × 10
5, respectively). On average, we saw a fourfold
inhibition of homologous
recombination events between SV40 chromosomes
after expression
and functional induction of wild-type p53 in monkey
cells carrying
a mutationally inactivated endogenous p53.
Recombination-regulating activities of p53 are influenced by
certain mismatch types in heteroduplexes.
From closer examination
of the exchange process provoked by use of the virus combination
SV40-tsVP1(196Y) and SV40-tsVP1(286S), it
becomes clear that heteroduplexes formed between the two genomes comprise two unpaired regions, which are separated by 269 perfectly complementary base pairs (89). Within the two possible
heteroduplexes, a single-base mismatch of the A-C or G-T type would be
predicted at the VP1(196Y) locus, and two A-C or two G-T mismatches
interrupted by one matching base pair would be predicted at the
VP1(286S) locus (Fig. 2). Thus, both
mutations C2084T [tsVP1(196Y)] and C2354T,C2356T
[tsVP1(286S)] cause mismatches of the same base-base combination in recombination intermediates. To study the possible influence of a different mismatch type, we introduced the mutation A2367C in the immediate neighborhood of the VP1(286S) locus within the coding region for the late viral protein VP1 of SV40. This gives
rise to A-G/C-T mismatches in heteroduplexes with the
corresponding wild-type sequence in
SV40-tsVP1(196Y). Like tsVP1(286S), this mutation, tsVP1(290T), causes a ts phenotype with respect
to virus production and again does not allow cross-complementation with SV40-tsVP1(196Y) in trans (89),
enabling us to utilize SV40-tsVP1(290T) for our
infection-based recombination assay. As shown in Fig. 2, DNA
exchange between SV40-tsVP1(196Y) and
SV40-tsVP1(290T) genomes in
LLC-MK2(neo) were 36-fold as frequent as for the
SV40-tsVP1(196Y)/SV40-tsVP1(286S) pair. In
LLC-MK2(p53her)-17, the cells we chose for measuring the
recombination rates with different virus combinations, this high rate
was reduced 21-fold after activation of p53her by 2 to 5 µM
-estradiol. In comparison to the fourfold suppression with
SV40-tsVP1(196Y)/SV40-tsVP1(286S), this
finding indicates that p53 inhibits recombination in a heteroduplex
substrate-specific manner and strongly suggests a critical role of
A-G/C-T mismatches in this process. The double mutation
C2354T,C2356T in SV40-tsVP1(286S) will result in an
unpaired region of three base pairs in recombination intermediates with
SV40-tsVP1(196Y) DNA, whereas mutation A2367C in
SV40-tsVP1(290T) will generate a single-base mismatch. To
distinguish between possible influences of the base-base mismatch
type and the size of the unpaired region, an SV40 mutant
generating G-T/A-C single mismatches had to be analyzed. The mutation
C2354T responsible for the codon alteration P286S lacking the silent
C2356T exchange served this purpose and preserved the possibility of
ts virus production. In recombination assays, this
SV40-tsVP1(286S)-C2354T variant, showed similar exchange
frequencies as SV40-tsVP1(286S) in both estradiol-treated
LLC-MK2(neo) and LLC-MK2(p53her) cells, resulting in a fivefold inhibition by p53her. The fact that
the two tsVP1(286S) variants caused similar degrees of
inhibition of recombination rates in estradiol-induced p53her cells
excluded the possibility that the length of the unpaired region,
namely, 1 bp in heteroduplexes with
SV40-tsVP1(290T)-C2354T and 3 bp with SV40-tsVP1(286S) DNAs, would have a major effect on p53
recombination-regulating activities.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Testing p53-regulated recombination for a dependency on
distinct heteroduplex types. Recombination assays using
SV40-tsVP1(196Y) in different SV40 combinations were
performed to provoke distinct mismatches in the two possible
heteroduplexes upon exchange of either strand of the viral genome.
Italic letters indicate mutant information; capital letters indicate
mutated nucleotides which cause the ts phenotype of the virus.
Recombination rates in LLC-MK2(neo) and
LLC-MK2(p53her)-17 cells were measured in the presence
of 2 to 5 µM -estradiol with SV40-tsVP1(286S) in five
independent experiments, with SV40-tsVP1(286S)-C2354 in
four assays, and with SV40-tsVP1(290T) in three assays.
Standard errors were calculated for the mean values as indicated.
|
|
tsB11 virus (
76), which had originally been isolated
after nitrosoguanidine mutagenesis due to the ts phenotype caused
by
the same A2367C nucleotide exchange artificially created in
SV40-tsVP1(290T),
undergoes genomic exchange at a rate of
(3.8 ± 1.7) × 10
5 (
n = 3) in
LLC-MK
2(neo) cells. This 71-fold decrease
compared
to the recombinant SV40-tsVP1(290T) can
easily be explained by
the existence of 0.5% overall sequence
divergence in tsB11 versus
wild-type viral genomes, as we
extrapolated from the sequence
analysis of the VP1 coding region.
Possibly even more detrimental
to the success of DNA exchange was the
fact that the silent mutation
T2239G in tsB11 cuts the homologous
region between the indicator
mutations at positions 2084 and 2367 down
to segments below the
minimal homologous region described for mammalian
cells (
83).
The maintenance of low recombination rates in
the absence of functional
wild-type p53 must be attributed to
p53-independent factors engaged
in the avoidance or dissolution of
sequence divergence in recombination
intermediates. Nevertheless,
p53her inhibited recombination activities
further by at least a factor
of 4, to <8 × 10
6, where we reach the detection
limit for LLC-MK
2(p53her) cells.
Wild-type p53 specifically recognizes three-stranded DNA
junctions.
Our observation that wild-type p53 displays mismatch
substrate specificities in the recombination control of living cells prompted us to test the possibility of direct mismatch recognition within recombination intermediates. p53 was reported to recognize extrahelical loop mismatches on double-stranded DNAs in vitro (47). For our purposes, we produced radioactively labeled
three-stranded recombination intermediates in vitro, using 63- to
67-mer oligonucleotides, according to a method which has been
successfully applied to the functional analysis of well-known
recombination factors (87). The sequence environment was
chosen such that the nucleotide sequence of the central oligonucleotide
represented exactly the wild-type SV40 genome 18 bp upstream to 48 bp
downstream of the VP1(290T) mutation at position 2367. The top
oligonucleotide was complementary only to the first 39 nucleotides at
its 3' end; the bottom oligonucleotide was complementary only to the
last 38 nucleotides at its 5' end, which produces a flexible junction
in the middle by shared homologies of 12 nucleotides (Fig.
3). Aside from this three-stranded match, a three-stranded C-T mismatch substrate was produced by use of a
central oligonucleotide altered only at the position corresponding to
bp 2367 in SV40. This design for the analysis of mismatch recognition during or shortly after heteroduplex formation took into consideration the polarity of Rad51-mediated strand transfer initiating at the 5' end
of the complementary strand in the duplex (10, 74).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 3.
Specificity of binding to three-stranded junction DNAs
by wild-type p53 (wtp53). Radioactively labeled top oligonucleotide
(1s), flayed duplexes (2s C-T), and junction DNAs (3s and 3s C-T) were
prepared, purified, and quantified as described in Materials and
Methods. C-T mismatches in 2s C-T and 3s C-T substrates are positioned
at the tsVP1(K290T)/A2367C corresponding locus and surrounded
by the corresponding SV40 sequences. Substrates at 200 pM each and
protein preparations enriched for wild-type or MethA mutant p53 protein
(25 nM p53 tetramers) were mixed, incubated for 25 min on ice, and
electrophoresed on a 4% polyacrylamide gel. The positions in the
autoradiograph of substrate bands and of the major band shift
containing p53 tetramers are indicated by arrows and schematic
illustrations.
|
|
When these three-stranded substrates were incubated with protein
fractions highly enriched for murine wild-type p53 overproduced
in insect cells and the mixture was subjected to PAGE, the band
containing the radioactively labeled substrate was completely
shifted
to a discrete upper position, indicative of the DNA substrate
being
tightly complexed with p53 tetramers (
48,
71,
72).
In
addition, a minor band was seen with even more slowly migrating
complexes, probably containing octameric forms of p53 (Fig.
3),
as
identified for sequence-specific binding (
71). This picture
did not emerge when wild-type p53 fractions were mixed with the
corresponding two-stranded C-T mismatch substrate with flayed
ends or
the labeled top oligonucleotide at identical concentrations.
Equal
amounts of p53 MethA mutant protein (
20) prepared in
parallel
did not retard any of the substrates to a discrete position in
the gel. The protein interacted with DNA heterogeneously, as reflected
by a smear along all four lanes. We noted the appearance of a
new
species of ssDNA migrating at the same position as double-stranded
DNA
after incubation with wild-type p53 fractions and much more
pronounced
with MethA p53. This phenomenon might be related to
DNA-bending
activities by wild-type p53 (
8), which were also
postulated
for mutant p53 on A/T-rich DNA sequences (
58), and
will be
discussed separately. Proof for the fully active state
of each p53
protein was provided by testing the same protein fractions
for
sequence-specific DNA binding in the case of wild-type p53
(reviewed in
reference
80) and MAR/SAR element binding in the
case of MethA mutant protein (
58,
86) (data not shown).
To prove the active participation of p53 in binding the three-stranded
match and C-T mismatch substrates, we performed supershift
analyses.
Preincubation of protein fractions containing 0.5 pmol
of wild-type p53
tetramers with 0.6 pmol of Pab246, specific for
p53 in the wild-type
conformation (
92), resulted in the retardation
of
DNA-protein bands (Fig.
4A). Pab240,
specific for p53 in the
mutant conformation (
24), had no
effect. Consistent with an
exclusive role of p53 in binding to the
artificial recombination
intermediates, His-tagged wild-type proteins
purified from insect
cells with the aid of Talon affinity
chromatography or via Pab421
immunoaffinity to

90% homogeneity were
each found to be fully
active in substrate targeting (Fig.
4B). DNA
binding was performed
by p53 independently of the protein preparation,
but differences
between individual preparations were observed with
respect to
the multimerization state of p53 during binding. However, as
can
be seen in a protein dilution series (Fig.
4C), higher oligomeric
forms of p53 in complex with three-stranded substrate can be
obtained
simply by increasing the protein concentrations.
Comparable binding
of three-stranded DNAs was performed by
p53 from human origin
(data not shown). In summary, our data
allow us to draw the conclusion
that wild-type p53 or a protein complex
containing wild-type p53,
but not the conformation-mutant MethA p53,
recognizes imitations
of early recombination intermediates strongly,
specifically, and
in distinct oligomeric complexes.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of wild-type p53 complexes in band shifts with
three-stranded DNAs. Three-stranded substrates, as defined in the
legend to Fig. 3, were applied to supershift analyses with monoclonal
antibodies Pab246, specific for wild-type p53 (wtp53), and Pab240,
specific for mutant p53 (A). Thin black arrows indicate the band shifts
of p53-DNA complexes; thick shaded arrows indicate the supershifts.
Homogeneous preparations of wild-type p53 after Talon or immunoaffinity
purification were compared with p53-enriched protein preparations
(standard) in EMSAs (B). Wild-type p53 was diluted in steps (50, 25, 12, and 6 nM calculated for the tetramer) in three-stranded DNA binding
assays to examine the classes of multimeric complexes formed (C). If
not indicated otherwise, p53 protein concentrations were 25 nM in the
reaction mixtures with 200 pM junction DNAs in panel A, 100 pM in panel
C, and 100 pM match substrate in panel B.
|
|
Different affinities of p53 to three-stranded intermediates are
related to the type of integrated mismatch.
For a more detailed
analysis of the binding characteristics, we measured affinities to
several three-stranded DNA species differing only in their base-base
mismatch type within the same sequence environment. To imitate the
situation encountered in our preceding recombination assays as closely
as possible, we used three-stranded junctions representing
intermediates at the VP1(286S) locus, at which we had provoked
mispairings in heteroduplexes by coinfection with different mutant
virus pairs. So far, our in vitro experiments had demonstrated
complete titration of three-stranded match and mismatch DNA inputs at
concentrations of 200 pM by excess wild-type p53. To obtain equilibrium
binding data for the determination of dissociation constants, DNA
ligand concentrations were varied within the range optimized for each
substrate, while the protein concentration was kept at 12 nM with
respect to p53 tetramers. Under these conditions, the binding analysis
showed that indeed three-stranded junctions were bound by p53 with a
high affinity of 10
10 to 10
11 M at a single
binding site, as listed in Table 1 and
illustrated in Fig. 5 by first-order binding curves and by the
transformation of data into linear Scatchard plots. Perfectly matching
oligonucleotides were bound comparably strong as was the
substrate containing two G-T mismatches interrupted only by a single
base pair, reflecting exactly the configuration generated in
heteroduplexes with SV40-tsVP1(286S) DNA. Only minor
deviations from these values were found with G-T or A-C mismatch
substrates. In contrast, by measuring 12- to 15-fold-lower KD values, we clearly discriminated interactions
of p53 and three-stranded DNAs with the unpaired bases C-T or A-G, the
mismatches produced by DNA exchange between
SV40-tsVP1(290T) and SV40-tsVP1(196Y) genomes. Consistent with the finding of higher affinities
toward A-G and C-T mismatch-containing substrates, we estimated faster on rates in these cases, as complete targeting of these DNAs at 100 pM
was achieved within less than 2 min, whereas match substrates were
maximally bound after 4 to 8 min (data not shown). Off rates appeared
to be the same for both junction DNA types within our detection limits,
and in agreement with data of Lee et al. (48), they
indicated >80% substrate release within 1 min after addition of
excess competitor DNA (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Scatchard analysis of three-stranded match and A-G
mismatch DNA binding. Three-stranded DNA junctions (see the legend to
Fig. 3) consisted of SV40 sequences with mismatches introduced at the
locus corresponding to VP1(P286S)/C2354. EMSA reactions were
performed with constant p53 concentrations (12 nM for the tetramer) and
increasing concentrations of radioactively labeled DNA substrate.
Polyacrylamide gels were evaluated by PhosphorImager quantitation.
Dissociation constants and standard errors were calculated from
Scatchard plots, applying computational analysis by the program Grafit.
(A) Graphic presentation of bound versus total substrate DNA results.
(B) The dissociation constants calculated from the Scatchard plot for
wild-type p53 are 256 × 10 12 with match substrate
and 17 × 10 12 with A-G mismatch substrate. b/f,
bound/free.
|
|
DNA damage in the form of ssDNA or mismatch is recognized by the
C-terminal end of p53 (
5,
37,
47,
63). To understand
if
binding of three-stranded match and mismatch DNAs is related
to this
damage-sensing function, we performed comparative competition
studies
with increasing concentrations of match and A-G mismatch
DNA junctions,
single-stranded top oligonucleotide, and the antibody
Pab421 directed
to the extreme C-terminal end (
30,
34). Under
conditions of
equilibrium binding with saturating protein concentrations,
labeled
match and A-G mismatch substrates were completely bound
and were
competed equally well by unlabeled three-stranded match
competitor
(Fig.
6). Under the same conditions,
mismatch competitor
was slightly more effective, as can be deduced from
the release
of free probe at a concentration of 1 nM three-stranded A-G
competitor
and the disappearance of octameric p53-DNA complexes at 0.5 nM.
Interestingly, we observed stabilization of protein-DNA complexes
in the presence of single-stranded top oligonucleotide, as reflected
by
the constant proportion of double-tetramer forms, which became
especially apparent with labeled match substrate and 120 nM
competitor
oligonucleotide. The three-stranded substrates could
be displaced
only at ssDNA concentrations above 120 nM. This
experiment also
showed that junction DNAs represent 300-fold-better
competitors
than ssDNAs. From this fact, we could exclude the
possibility
that the high affinity toward three-stranded match and
mismatch
DNAs can be explained simply by binding to the 25- to
37-nucleotide
single-strand overhangs of the top and bottom
oligonucleotides.
Pab421 had a dual effect on the binding of
artificial recombination
intermediates: p53 tetramers were supershifted
at concentrations
equimolar and higher than the p53 tetramer input.
However, the
same antibody also competed with substrate binding, as
seen best
with mismatch-containing DNA.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 6.
Competitor studies for three-stranded match and A-G
mismatch substrates. Radioactively labeled three-stranded junctions
(see the legend to Fig. 3) without (A) or with (B) an A-G mispair at
the position corresponding to the VP1(P286S)/C2354T locus (50 pM,
final concentration) together with unlabeled specific competitors (3s
or 3s A-G) at increasing concentrations from 0.5 to 8 nM were incubated
for 25 min on ice with protein fractions enriched for wild-type p53
(wtp53) (25 nM tetramers). Unlabeled top oligonucleotide (1s) was used
as the competitor at concentrations ranging from 1.2 to 12,000 nM, and
the monoclonal antibody Pab421 directed to the C-terminal 30 amino
acids was used at 3 to 300 nM.
|
|
 |
DISCUSSION |
Effect of p53her on homologous recombination.
In this
study, we successfully applied our SV40-based recombination
assay (89) to monkey cells specifically designed for the
analysis of in vivo p53 functions in this process. By ectopic expression of the p53her protein at physiological levels, the growth-inhibitory effects described for wild-type p53 could be minimized before wild-type p53 induction by
-estradiol. p53her was
functionally active, as demonstrated most clearly by strong and
estradiol-dependent transcriptional transactivation via
p53-specific DNA elements. At this point, we cannot exclude
indirect effects of p53her-dependent growth delay or
transcriptional transactivation on recombination processes in
LLC-MK2(p53her) cells. However, replication of the
template, i.e., SV40 DNA, and production of the indicator,
i.e., wild-type virus particles, displayed maxima at the same time
points after infection of LLC-MK2(p53her) and LLC-MK2(neo) cells (data not shown). Most
importantly in support of a more direct involvement in recombination,
we collected data with the LLC-MK2(p53her) cells and
different tsVP1 variants, indicating that p53 inhibits
interchromosomal homologous recombination events in a
heteroduplex-dependent manner with evidence for mismatch-specific responses by p53.
p53 may have a role in early events in recombination.
Wild-type virus generation from two genomes mutated differently at a
distance of 270 to 283 nucleotides as detected by our recombination
assay system requires that the underlying mechanisms be complex events
comprising either double crossover, two separate gene
conversion events, or reciprocal exchange accompanied by a gene
conversion event. Reciprocal exchange processes are less frequent
than gene conversion events, with double crossovers being even
more rare. From the proximity of recombination markers, coconversion events rather than independent correction by two gene conversion events
affecting opposite DNA strands would be predicted (51). Favoring the third possible interpretation of DNA exchange between SV40-tsVP1 pairs, a mechanistic association between reciprocal and nonreciprocal exchanges was postulated (14). For yeast, the occurrence of coupled recombination processes was attributed to the
effects of heteroduplex repair initiated by double-strand cutting at
mismatches during the initial recombination event (31).
It is well established that after DSB formation the alignment of two
homologous DNA molecules in register precedes the exchange
process and
that already at these early stages mitotic or meiotic
checkpoint
systems are involved in monitoring the status of recombination
(
91). On the basis of their studies of murine cells, Waldman
and Liskay (
83) favored a model whereby certain factors
would
scan the recombination intermediate for the minimal length of
perfect homology to allow recombination to proceed further. In
this
context, it was also proposed that an initial branch migration
process
immediately after strand invasion would be very sensitive
to
mismatches. p53 has been linked physically (
73) and
genetically
(
49,
77) to Rad51, which performs the initial
pairing and
strand transfer steps in eukaryotes (
10,
26,
74). In addition,
we have demonstrated here that p53 recognizes
artificial three-stranded
DNA structures which allow some movement at
the junction point
very analogous to the situation in early
recombination intermediates
or in DNA joints during branch migration.
We also accumulated
evidence for an increased binding affinity in
vitro, when p53
encounters distinct mismatches in these
structures. Our measurements
of 71-fold-lower
recombination frequencies with the
SV40-tsVP1(196Y)/SV40-tsB11
versus
SV40-tsVP1(196Y)/SV40-tsVP1(290T) pair must
be attributed
to heterologies in the environment of the two
phenotypically relevant
loci. As wild-type p53 down-regulates
recombination processes
even further from this low level, it must play
a regulatory role
in a surveillance pathway, which cannot act upstream
or as the
downstream effector but rather acts in parallel to the
postulated
early mismatch scanning system responsible for the
monitoring
of uninterrupted homologies in heteroduplexes.
Extensive studies of sequence-specific DNA binding by p53 have led to
the identification of numerous target genes, among which
at least six
seem to be relevant for the execution of cell cycle
regulation and
apoptosis after DNA damage (reviewed in reference
43). Analysis of the affinity for the p53 response
element in
the gene coding for the cyclin-dependent kinase inhibitor
WAF1
with the bacterially expressed central core domain indicated a
strong cooperativity for binding of four molecules and the importance
of bending or flexibility in the DNA substrate (
8). The
KD value of 8 × 10
8 for the
p53-WAF1 promoter interaction is lower than those determined
for other
transcription factors (
41,
78), although for the
whole
versus the truncated p53 molecule, one must expect an enhancement
due
to the contribution of the oligomerization domain and to activating
p53
modifications (
32,
35). From the data presented here,
it
becomes clear that p53 is targeted to recombination intermediate-like
DNA extremely specifically (
KD = 10
10 to 10
11 M), implying that important
functions are performed by p53 during
DSB repair and during mitotic
and meiotic recombination. Intriguingly,
mutant p53 binds
MAR/SAR DNA elements with a similar affinity
(
86),
and again this type of DNA recognition seems to be coupled
to the
structural characteristics of bends (
58). It has been
reported that p53 adopts a mutant-like conformation upon DNA binding
(
29), but the supershifts shown here indicate that p53
remains
wild type with respect to Pab246 immunoreactivity when bound to
three-stranded DNAs. Although mismatches contribute to localized
flexibilities, which is an important factor for DNA interactions
of
proteins actively bending DNA (
25), we consider this
unlikely
to be the sole explanation for the increased affinities
to mismatch-comprising
three-stranded DNAs, since the same
unpaired region in flayed
duplexes failed as a substrate and since
preferences became apparent
only for distinct base-base mismatches. In
accordance with our
data, Lee and colleagues (
47) presented
evidence for binding
of unpaired bases by p53 and interpreted this
activity as important
for DNA damage sensing. Mismatch recognition
within recombination
intermediates might implicate the active
participation in surveillance
mechanisms.
Possible role of mismatch binding activity of p53 in minimizing
homologous recombination.
Here, we provide evidence that mismatch
specificities of p53 correlate with recombination-regulating
activities. It remains unknown whether and how the exchange process is
attenuated when p53 encounters A-G or C-T nucleotide in the strands
aligned in heteroduplexes. From the exonuclease activity intrinsic to
p53 (59), one can envision degradation and repair of the
unpaired site within the intermediate, as performed by bacterial
exonucleases during postreplicative mismatch repair initiated by the
MutS/L/H system (reviewed in references 44 and
57). Mismatch repair activities on recombination
intermediates are known for the yeast mismatch repair factors MSH2,
MLH1, and PMS1, thereby causing gene conversion. In contrast, we
find p53 to inhibit recombination processes which most probably
comprise gene conversion. In our assay system, we detect successful
recombination events by wild-type SV40 production from two mutant
templates identical except for two to three base pairs. From our data
obtained with cells lacking functional wild-type p53, preferential
conversion of the mutant information to wild-type information in
the case of
SV40-tsVP1(196Y)/SV40-tsVP1(290T) compared to SV40-tsVP1(196Y)/SV40-tsVP1(286S)
pairs would imply mismatch-type-specific repair acting upon the
mispairing at 290T. If this were true for our assay setup, p53 would
have to inhibit elevated gene conversion at the 290T locus by
suppressing the preferential excision of mutant T opposite wild-type C
nucleotides or A opposite G. Preferential recognition of A-G or
C-T versus G-T or A-C single-base mispairings has not yet been
described for human cells with respect to either MSH2-dependent or
MSH2-independent binding (62).
Alternatively, according to the DSB repair model (
75) of
genetic recombination, unilateral DNA exchange, as detected here
by
wild-type virus production, could arise from degradation of
the mutant
strand followed by recombination repair DNA synthesis
of the gap with
wild-type DNA as the template. In this scenario,
p53 would have to
either inhibit nucleolytic degradation of the
mutant strand or promote
degradation of wild-type DNA, suppress
initiation of recombination by
strand invasion, inhibit repair
replication, or cause a bias in repair
replication toward the
mutated sequence. Further experiments are
necessary to determine
whether p53's exonucleolytic activity plays a
role in suppressing
recombination. To distinguish between the remaining
possible mechanisms
underlying recombination inhibition by p53, we
consider it crucial
that our in vitro DNA binding data demonstrate high
specificities
for three-stranded junctions compared to those for
double-stranded
fork structures emerging during replication, which is
the reason
why we favor a role of mismatch recognition by p53 during
the
early strand invasion process.
In addition to their well-known role in repair, mismatch repair
components were also described to prevent the detrimental
effects
of genetic exchange between divergent sequences by inhibiting
the
completion of recombination (reviewed in references
44 and
57). Some ideas on the
mechanism underlying this type of inhibition
of homologous strand
transfer can be drawn from in vitro experiments
with bacterial MutS.
MutS binds Holliday junctions and inhibits
RecA-induced strand exchange
and branch migration upon encountering
mismatches in the heteroduplex.
In analogy, it is conceivable
that p53's interaction with Rad51
(
73) serves to enzymatically
inactivate Rad51 and that this
is triggered or enhanced by high-affinity
mismatch recognition in the
nascent heteroduplex. Alternatively,
p53 could be envisioned to either
recruit destabilizing helicases,
such as XPB and XPD (
84,
90), or actively dissolve intermediates
comprising A-G or C-T
mispairs. Thus, by promoting reverse branch
migration via its
reannealing or strand transfer activity (
4,
15,
61), p53
might attempt to reconstitute the matching templates,
a subject of our
further investigations. It is interesting that
p53 binding to
mismatch-containing three-stranded intermediates
is sensitive to
competition by the antibody Pab421, the antibody
known to inhibit
strand transfer (
63).
High affinities accompanied by fast on and off rates for p53
interactions with three-stranded structures point to a dynamic
process,
such as reiterative binding within a homology scanning
mechanism.
Stabilization of these protein-DNA complexes might
be achieved
under certain conditions in vivo, for which multimerization
would be a
good candidate. p53 was described to form double tetramers
by
interactions via the central domain, a mechanism suggested
to result in
DNA loop formation (
72). In comparison to tetramerization
via the oligomerization domain, double-tetramer formation
might
require protein units within the tetramers not bound to DNA
internally,
as competition with three-stranded junctions causes
disappearance
of double versus single tetramers at four- to
eightfold-lower
concentrations. In competition experiments with
complementary
ssDNA, we observed p53 to stay in both DNA-bound
tetrameric forms,
as long as the concentrations of the competitor
oligonucleotide
were below or approximating the concentrations of p53
monomers
in the solution. We believe that interaction of p53 with
ssDNAs,
presumably via its C terminus (
5), stabilizes
the DNA-bound
protein oligomers cooperatively. This phenomenon might be
related
to the stimulatory effect of single-stranded oligonucleotides
on sequence-specific binding by p53 (
37). Therefore, similar
to the role of PMS2 and MLH1 during chromosome synapsis in meiosis
(
6,
7,
22), p53 as part of double-tetramer complexes might
stabilize and examine nascent heteroduplexes, thereby causing
a delay
of homologous recombination processes in general and blockage
of
homologous exchange upon encountering mismatches.
 |
ACKNOWLEDGMENTS |
We thank Thierry Soussi (University P. et M. Curie, Paris,
France) for expert advice with respect to p53 purification from insect
cell nuclei, B. Vogelstein (Johns Hopkins Oncology Center, Baltimore,
Md.) for the generous gift of plasmid pG13-CAT, J. M. Pipas
(University of Pittsburgh) for pBR-SV40dl1066, Klaus Roemer (Institut
für Mikrobiologie, Homburg, Germany) for pSV53her, and C. Stocking (Heinrich-Pette-Institut, Hamburg, Germany) for pM5neo. Special thanks go to Heiko Maacke for establishing the first wild-type p53her clone, Stefan Heinrich for preparing
immunoaffinity-purified wild-type p53, Marion Kurth for performing the
CAT quantifications, and Doris Weidemann for the photographic
documentation.
This work was supported by Deutsche Forschungsgemeinschaft grants
Wi 1376/1-2 and De212/8-2 and by grant W92/94/De from the Dr. Mildred Scheel Stiftung (Deutsche Krebshilfe). The
Heinrich-Pette-Institut is supported by the Freie und Hansestadt
Hamburg and by the Bundesministerium für Gesundheit.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Heinrich-Pette-Institut, Martinistrasse 52, 20251 Hamburg, Germany.
Phone: 49-40-48051-234. Fax: 49-40-48051-117. E-mail:
wiesmuel{at}plexus.uke.uni-hamburg.de.
 |
REFERENCES |
| 1.
|
Alani, E.,
S. Lee,
M. F. Kane,
J. Griffith, and R. D. Kolodner.
1997.
Saccharomyces cerevisiae MSH2, a mispaired base recognition protein, also recognizes Holliday junctions in DNA.
J. Mol. Biol.
265:289-301[Medline].
|
| 2.
|
Aloni-Grinstein, R.,
D. Schwartz, and V. Rotter.
1995.
Accumulation of wild-type p53 protein upon -irradiation induces a G2 arrest-dependent immunoglobulin light chain gene expression.
EMBO J.
14:1392-1401[Medline].
|
| 3.
|
Ayusawa, D.,
K. Shimizu,
H. Koyama,
K. Takeishi, and T. Seno.
1983.
Accumulation of DNA strand breaks during thymineless death in thymidylate synthase-negative mutants of mouse FM3A cells.
J. Biol. Chem.
258:12448-12454[Abstract/Free Full Text].
|
| 4.
|
Bakalkin, G.,
T. Yakovleva,
G. Selivanova,
K. P. Magnusson,
L. Szekely,
E. Kiseleva,
G. Klein,
L. Terenius, and K. G. Wiman.
1994.
p53 binds single-stranded DNA ends and catalyzes DNA renaturation and strand transfer.
Proc. Natl. Acad. Sci. USA
91:413-417[Abstract/Free Full Text].
|
| 5.
|
Bakalkin, G.,
G. Selivanova,
T. Yakovleva,
E. Kiseleva,
E. Kashuba,
K. P. Magnusson,
L. Szekely,
G. Klein,
L. Terenius, and K. G. Wiman.
1995.
p53 binds single-stranded DNA ends through the C-terminal domain and internal DNA segments via the middle domain.
Nucleic Acids Res.
23:362-369[Abstract/Free Full Text].
|
| 6.
|
Baker, S. M.,
C. E. Bronner,
L. Zhang,
A. W. Plug,
M. Robatzek,
G. Warren,
E. A. Elliott,
J. Yu,
T. Ashley,
N. Arnheim,
R. A. Flavell, and R. M. Liskay.
1995.
Male mice defective in the mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis.
Cell
82:309-319[Medline].
|
| 7.
|
Baker, S. M.,
A. W. Plug,
T. A. Prolla,
C. E. Bronner,
A. C. Harris,
X. Yao,
D.-M. Christie,
C. Monell,
N. Arnheim,
A. Bradley,
T. Ashley, and R. M. Liskay.
1996.
Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over.
Nat. Gen.
13:336-342[Medline].
|
| 8.
|
Balagurumoorthy, P.,
H. Sakamoto,
M. S. Lewis,
N. Zambrano,
G. M. Clore,
A. M. Gronenborn,
E. Appella, and R. E. Harrington.
1995.
Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA.
Biochemistry
92:8591-8595.
|
| 9.
|
Bartek, J.,
R. Iggo, and D. P. Lane.
1990.
Genetic and immunochemical analysis of mutant p53 in human breast cancer cell lines.
Oncogene
5:893-899[Medline].
|
| 10.
|
Baumann, P.,
F. E. Benson, and S. C. West.
1996.
Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro.
Cell
87:757-766[Medline].
|
| 11.
|
Bertrand, P.,
D. Rouillard,
A. Boulet,
C. Levalois,
T. Soussi, and B. S. Lopez.
1997.
Increase of spontaneous intrachromosomal homologous recombination in mammalian cells expressing a mutant p53 protein.
Oncogene
14:1117-1122[Medline].
|
| 12.
|
Bogue, M. A.,
C. Zhu,
E. Aguilar-Cordova,
L. A. Donehower, and D. B. Roth.
1996.
p53 is required for both radiation-induced differentiation and rescue of V(D)J rearrangement in scid mouse thymocytes.
Genes Dev.
10:553-565[Abstract/Free Full Text].
|
| 13.
|
Bohen, S. P., and K. R. Yamamoto.
1993.
Isolation of Hsp90 mutants by screening for decreased steroid receptor function.
Proc. Natl. Acad. Sci. USA
90:11424-11428[Abstract/Free Full Text].
|
| 14.
|
Bollag, R. J., and R. M. Liskay.
1988.
Conservative intrachromosomal recombination between inverted repeats in mouse cells: association between reciprocal exchange and gene conversion.
Genetics
119:161-169[Abstract/Free Full Text].
|
| 15.
|
Brain, R., and J. R. Jenkins.
1994.
Human p53 directs DNA strand reassociation and is photolabeled by 8-azido ATP.
Oncogene
9:1775-1780[Medline].
|
| 16.
|
Braselmann, S.,
P. Graninger, and M. Busslinger.
1993.
A selective transcriptional induction system for mammalian cells based on Gal4-estrogen receptor fusion proteins.
Proc. Natl. Acad. Sci. USA
90:1657-1661[Abstract/Free Full Text].
|
| 17.
|
Carder, P.,
A. H. Wyllie,
C. A. Purdie,
R. G. Morris,
S. White,
J. Piris, and C. C. Bird.
1993.
Stabilised p53 facilitates aneuploid clonal divergence in colorectal cancer.
Oncogene
8:1397-1401[Medline].
|
| 18.
|
Carr, A. M.
1996.
Checkpoints take the next step.
Science
271:314-315[Medline].
|
| 19.
|
Coquelle, A.,
E. Pipiras,
F. Toledo,
G. Buttin, and M. Debatisse.
1997.
Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons.
Cell
89:215-225[Medline].
|
| 20.
|
DeLeo, A. B.,
H. Shiku,
T. Takahashi,
M. John, and L. J. Old.
1977.
Cell surface antigens of chemically induced sarcomas of the mouse. I. Murine leukemia virus-related antigens and alloantigens on cultured fibroblasts and sarcoma cells: description of a unique antigen on BALB/c MethA sarcoma.
J. Exp. Med.
146:720-734[Abstract/Free Full Text].
|
| 21.
|
Dulic, V.,
W. K. Kaufmann,
S. J. Wilson,
T. D. Tlsty,
E. Lees,
J. W. Harper,
S. J. Elledge, and S. I. Reed.
1994.
p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest.
Cell
76:1013-1023[Medline].
|
| 22.
|
Edelmann, W.,
P. E. Cohen,
M. Kane,
K. Lau,
B. Morrow,
S. Bennett,
A. Umar,
T. Kunkel,
G. Cattoretti,
R. Chaganti,
J. W. Pollard,
R. D. Kolodner, and R. Kucherlapati.
1996.
Meiotic pachytene arrest in MLH1-deficient mice.
Cell
85:1125-1134[Medline].
|
| 23.
|
El-Deiry, W. S.,
T. Tokino,
V. E. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
W. E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[Medline].
|
| 24.
|
Gannon, J. V.,
R. Graeves,
R. Iggo, and D. P. Lane.
1990.
Activating mutations in p53 produce a common conformational effect. A monoclonal antibody specific for the mutant form.
EMBO J.
9:1595-1602[Medline].
|
| 25.
|
Grove, A.,
A. Galeone,
L. Mayol, and E. P. Geiduschek.
1996.
Localized DNA flexibility contributes to target site selection by DNA-bending proteins.
J. Mol. Biol.
260:120-125[Medline].
|
| 26.
|
Gupta, R. C.,
L. R. Bazemore,
E. I. Golub, and C. M. Radding.
1997.
Activities of human recombination protein Rad51.
Proc. Natl. Acad. Sci. USA
94:463-468[Abstract/Free Full Text].
|
| 27.
|
Haber, J. E.
1997.
A super new twist on the initiation of meiotic recombination.
Cell
89:163-166[Medline].
|
| 28.
|
Hainaut, P., and J. Milner.
1993.
Redox modulation of p53 conformation and sequence-specific DNA binding in vitro.
Cancer Res.
53:4469-4473[Abstract/Free Full Text].
|
| 29.
|
Halazonetis, T. D.,
L. J. Davis, and A. N. Kandil.
1993.
Wild-type p53 adopts a `mutant'-like conformation when bound to DNA.
EMBO J.
12:1021-1028[Medline].
|
| 30.
|
Harlow, E.,
D. C. Pim, and L. V. Crawford.
1981.
Complex of simian virus 40 large-T antigen and host 53,000-molecular-weight protein in monkey cells.
J. Virol.
37:564-573[Abstract/Free Full Text].
|
| 31.
|
Hastings, P. J.
1984.
Measurement of restoration and conversion: its meaning for the mismatch repair hypothesis of conversion.
Cold Spring Harbor Symp. Quant. Biol.
49:49-53[Abstract/Free Full Text].
|
| 32.
|
Hecker, D.,
G. Page,
M. Lohrum,
S. Weiland, and K. H. Scheidtmann.
1996.
Complex regulation of the DNA-binding activity of p53 by phosphorylation: differential effects of individual phosphorylation sites on the interaction with different binding motifs.
Oncogene
12:953-961[Medline].
|
| 33.
|
Hull, R. N.,
W. R. Cherry, and J. S. Johnson.
1956.
The adaptation and maintenance of mammalian cells to continuous growth in tissue culture.
Anat. Rec.
124:490.
|
| 34.
|
Hupp, T. R.,
D. W. Meek,
C. A. Midgley, and D. P. Lane.
1992.
Regulation of the specific DNA binding function of p53.
Cell
71:875-886[Medline].
|
| 35.
|
Hupp, T. R., and D. P. Lane.
1994.
Regulation of the cryptic sequence-specific DNA binding function of p53 by protein kinases.
Cold Spring Harbor Symp. Quant. Biol.
59:195-206[Abstract/Free Full Text].
|
| 36.
|
Jackson, S. P., and P. A. Jeggo.
1995.
DNA double-strand break repair and V(D)J recombination: involvement of DNA-PK.
Trends Biochem.
20:412-415[Medline].
|
| 37.
|
Jayaraman, L., and C. Prives.
1995.
Activation of p53 sequence-specific DNA binding by short single strands of DNA requires the C-terminus.
Cell
81:1021-1029[Medline].
|
| 38.
|
Kastan, M. B.,
O Onyekwere,
D. Sidransky,
B. Vogelstein, and R. W. Craig.
1991.
Participation of p53 protein in the cellular response to DNA damage.
Cancer Res.
51:6304-6311[Abstract/Free Full Text].
|
| 39.
|
Kastan, M. B.,
Q. Zhan,
W. S. El-Deiry,
F. Carrier,
T. Jacks,
W. V. Walsh,
B. S. Plunkett,
B. Vogelstein, and A. J. Fornace.
1992.
A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia.
Cell
71:587-597[Medline].
|
| 40.
|
Kern, S. E.,
J. A. Pietenpol,
S. Thiagalingam,
A. Seymour,
K. W. Kinzler, and B. Vogelstein.
1992.
Oncogenic forms of p53 inhibit p53-regulated gene expression.
Science
256:827-830[Abstract/Free Full Text].
|
| 41.
|
Kim, C. G., and M. Sheffery.
1990.
Physical characterization of the purified CCAAT transcription factor, alpha-CP1.
J. Biol. Chem.
265:13362-13369[Abstract/Free Full Text].
|
| 42.
|
Kim, E.,
N. Albrechtsen, and W. Deppert.
1997.
DNA-conformation is an important determinant of sequence-specific DNA binding by tumor suppressor p53.
Oncogene
15:857-869[Medline].
|
| 43.
|
Ko, J. L., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-1072[Free Full Text].
|
| 44.
|
Kolodner, R. D.
1995.
Mismatch repair: mechanisms and relationship to cancer susceptibility.
Trends Biol. Sci.
20:397-401.
|
| 45.
|
Landel, C. C.,
P. J. Kushner, and G. L. Greene.
1994.
The interaction of human estrogen receptor with DNA is modulated by receptor-associated proteins.
Mol. Endocrinol.
8:1407-1419[Abstract/Free Full Text].
|
| 46.
|
Lane, D. P.
1992.
p53, guardian of the genome.
Nature
358:15-16[Medline].
|
| 47.
|
Lee, S.,
B. Elenbaas,
A. J. Levine, and J. Griffith.
1995.
p53 and its 14 kDa C-terminal domain recognize primary DNA damage in the form of insertion/deletion mismatches.
Cell
81:1013-1020[Medline].
|
| 48.
|
Lee, S.,
L. Cavallo, and J. Griffith.
1997.
Human p53 binds holliday junctions strongly and facilitates their cleavage.
J. Biol. Chem.
272:7532-7539[Abstract/Free Full Text].
|
| 49.
|
Lim, D.-S., and P. Hasty.
1996.
A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53.
Mol. Cell. Biol.
16:7133-7143[Abstract].
|
| 50.
|
Linke, S. P.,
K. C. Clarkin,
A. Di Leonardo,
A. Tsou, and G. M. Wahl.
1996.
A reversible, p53-dependent G0/G1 cell cycle arrest induced by ribonucleotide depletion in the absence of detectable DNA damage.
Genes Dev.
10:934-947[Abstract/Free Full Text].
|
| 51.
|
Liskay, R. M., and J. L. Stachelek.
1986.
Information transfer between duplicated chromosomal sequences in mammalian cells involves contiguous regions of DNA.
Proc. Natl. Acad. Sci. USA
83:1802-1806[Abstract/Free Full Text].
|
| 52.
|
Livingstone, L. R.,
A. White,
J. Sprouse,
E. Livanos,
T. Jacks, and T. D. Tlsty.
1992.
Altered cell cycle arrest and gene amplification potential accompany loss of wild-type p53.
Cell
70:923-935[Medline].
|
| 53.
|
Lu, X., and D. P. Lane.
1993.
Differential induction of transcriptionally active p53 following UV or ionizing radiation: defects in chromosome instability syndromes?
Cell
75:765-778[Medline].
|
| 54.
|
Lutzker, S. G., and A. J. Levine.
1996.
A functionally inactive p53 protein in teratocarcinoma cells is activated by either DNA damage or cellular differentiation.
Nat. Med.
2:804-810[Medline].
|
| 55.
|
Mekeel, K. L.,
W. Tang,
L. A. Kachnic,
C.-M. Luo,
J. S. DeFrank, and S. N. Powell.
1997.
Inactivation of p53 results in high rates of homologous recombination.
Oncogene
14:1847-1857[Medline].
|
| 56.
|
Miyashita, T., and J. C. Reed.
1995.
Tumor suppressor p53 is a direct transcriptional activator of the human bax gene.
Cell
80:293-299[Medline].
|
| 57.
|
Modrich, P., and R. Lahue.
1996.
Mismatch repair in replication fidelity, genetic recombination, and cancer biology.
Annu. Rev. Biochem.
65:101-133[Medline].
|
| 58.
|
Müller, B. F.,
D. Paulsen, and W. Deppert.
1996.
Specific binding of MAR/SAR DNA-elements by mutant p53.
Oncogene
12:1941-1952[Medline].
|
| 59.
|
Mummenbrauer, T.,
F. Janus,
B. Müller,
L. Wiesmüller,
W. Deppert, and F. Große.
1996.
p53 protein exhibits 3'- to -5' exonuclease activity.
Cell
85:1089-1099[Medline].
|
| 60.
|
Nelson, W. G., and M. B. Kastan.
1994.
DNA strand breaks: the DNA template alterations that trigger p53-dependent DNA damage response pathways.
Mol. Cell. Biol.
14:1815-1823[Abstract/Free Full Text].
|
| 61.
|
Oberosler, P.,
P. Hloch,
U. Ramsperger, and H. Stahl.
1993.
p53-catalyzed annealing of complementary single-stranded nucleic acids.
EMBO J.
12:2389-2396[Medline].
|
| 62.
|
O'Regan, N. E.,
P. Branch,
P. MacPherson, and P. Karran.
1996.
hMSH2-independent DNA mismatch recognition by human proteins.
J. Biol. Chem.
271:1789-1796[Abstract/Free Full Text].
|
| 63.
|
Reed, M.,
B. Woelker,
P. Wang,
Y. Wang,
M. E. Anderson, and P. Tegtmeyer.
1995.
The C-terminal domain of p53 recognizes DNA damaged by ionizing radiation.
Proc. Natl. Acad. Sci. USA
92:9455-9459[Abstract/Free Full Text].
|
| 64.
|
Roemer, K., and T. Friedmann.
1993.
Modulation of cell proliferation and gene expression by a p53-estrogen receptor hybrid protein.
Proc. Natl. Acad. Sci. USA
90:9252-9256[Abstract/Free Full Text].
|
| 65.
|
Rotter, V.,
D. Schwartz,
E. Alman,
N. Goldfinger,
A. Kapon,
A. Meshorer,
L. A. Donehower, and A. J. Levine.
1993.
Mice with reduced levels of p53 protein exhibit the testicular giant-cell degenerative syndrome.
Proc. Natl. Acad. Sci. USA
90:9075-9079[Abstract/Free Full Text].
|
| 66.
|
Savitsky, A.,
A. Bar-Shira,
S. Gilad,
G. Rotman,
Y. Ziv,
L. Vanagaite,
D. A. Tagle,
S. Smith,
T. Uziel,
S. Sfez,
M. Ashekenazi,
I. Pecker,
M. Frydman,
R. Harnik,
S. R. Pantanjali,
A. Simmons,
G. A. Clines,
A. Sartiel,
R. A. Gatti,
L. Chessa,
O. Sanal,
M. F. Lavin,
N. G. J. Jaspers,
A. M. R. Taylor,
C. F. Arlett,
T. Miki,
S. M. Weissman,
M. Lovett,
F. S. Collins, and Y. Shiloh.
1995.
A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science
268:1749-1753[Abstract/Free Full Text].
|
| 67.
|
Scherrer, L. C.,
D. Picard,
E. Massa,
J. M. Harmon,
S. J. Simons,
K. R. Yamamoto, and W. B. Pratt.
1993.
Evidence that the hormone binding domain of steroid receptors confers hormonal control on chimeric proteins by determining their hormone-regulated binding to heat-shock protein 90.
Biochemistry
32:5381-5386[Medline].
|
| 68.
|
Siegel, J.,
M. Fritsche,
S. Mai,
G. Brandner, and R. D. Hess.
1995.
Enhanced p53 activity and accumulation in response to DNA damage upon DNA transfection.
Oncogene
11:1363-1370[Medline].
|
| 69.
|
Sjöblom, T., and J. Lähdetie.
1996.
Expression of p53 in normal and -irradiated rat testis suggests a role for p53 in meiotic recombination and repair.
Oncogene
12:2499-2505[Medline].
|
| 70.
|
Smith, J., and R. Rothstein.
1995.
A mutation in the gene encoding the Saccharomyces cerevisiae single-stranded DNA-binding protein Rfa1 stimulates a RAD52-independent pathway for direct-repeat recombination.
Mol. Cell. Biol.
15:1632-1641[Abstract].
|
| 71.
|
Stenger, J. E.,
G. A. Mayr,
K. Mann, and P. Tegtmeyer.
1992.
Formation of stable p53 homotetramers and multiples of tetramers.
Mol. Carcinog.
5:102-106[Medline].
|
| 72.
|
Stenger, J. E.,
P. Tegtmeyer,
G. A. Mayr,
M. Reed,
Y. Wang,
P. Wang,
P. V. C. Hough, and I. A. Mastrangelo.
1994.
p53 oligomerization and DNA looping are linked with transcriptional activation.
EMBO J.
13:6011-6020[Medline].
|
| 73.
|
Stürzbecher, H.-W.,
B. Donzelmann,
W. Henning,
U. Knippschild, and S. Buchhop.
1996.
p53 is linked directly to homologous recombination processes via RAD51/RecA protein interaction.
EMBO J.
15:1992-2002[Medline].
|
| 74.
|
Sung, P., and D. L. Robberson.
1995.
DNA strand exchange mediated by a RAD51-ssDNA nucleoprotein filament with polarity opposite to that of RecA.
Cell
82:453-461[Medline].
|
| 75.
|
Szostak, J. W.,
T. L. Orr-Weaver,
R. J. Rothstein, and F. W. Stahl.
1983.
The double-strand break repair model.
Cell
33:25-35[Medline].
|
| 76.
|
Tegtmeyer, P., and H. L. Ozer.
1971.
Temperature-sensitive mutants of simian virus 40: infection of permissive cells.
J. Virol.
8:516-524[Abstract/Free Full Text].
|
| 77.
|
Tsuzuki, T.,
Y. Fujii,
K. Sakumi,
Y. Tominaga,
K. Nakao,
M. Sekiguchi,
A. Matsushiro,
Y. Yoshimura, and T. Morita.
1996.
Targeted disruption of the Rad51 gene leads to lethality in embryonic mice.
Proc. Natl. Acad. Sci. USA
93:6236-6240[Abstract/Free Full Text].
|
| 78.
|
Urban, M. B., and P. A. Baeuerle.
1990.
The 65-kDa subunit of NF-kappa B is a receptor for I kappa B and a modulator of DNA-binding specificity.
Genes Dev.
4:1975-1984[Abstract/Free Full Text].
|
| 79.
|
Van Gent, D. C.,
J. F. McBlane,
D. A. Ramsden,
M. J. Sadofsky,
J. E. Hesse, and M. Gellert.
1995.
Initiation of V(D)J recombination in a cell-free system.
Cell
81:925-934[Medline].
|
| 80.
|
Vogelstein, B., and K. W. Kinzler.
1992.
p53 function and dysfunction.
Cell
70:523-526[Medline].
|
| 81.
|
Vogelstein, B., and K. W. Kinzler.
1993.
The multistep nature of cancer.
Trends Genet.
9:138-141[Medline].
|
| 82.
|
Von der Weth, A., and W. Deppert.
1993.
Wild-type p53 is not a negative regulator of simian virus 40 DNA replication in infected monkey cells.
J. Virol.
67:886-893[Abstract/Free Full Text].
|
| 83.
|
Waldman, A. S., and M. Liskay.
1988.
Dependence of intrachromosomal recombination in mammalian cells on interrupted homology.
Mol. Cell. Biol.
8:5350-5357[Abstract/Free Full Text].
|
| 84.
|
Wang, X. W.,
H. Yeh,
L. Schaeffer,
R. Roy,
V. Moncollin,
J.-M. Egly,
Z. Wang,
E. C. Friedberg,
M. K. Evans,
B. G. Taffe,
V. A. Bohr,
G. Weeda,
J. H. J. Hoeijmakers,
K. Forrester, and C. C. Harris.
1995.
p53 modulation of THIIH-associated nucleotide excision repair activity.
Nat. Genet.
10:188-193[Medline].
|
| 85.
|
Weaver, D. T.
1995.
What to do at an end: DNA double-strand-break repair.
Trends Genet.
11:388-392[Medline].
|
| 86.
|
Weißker, S. N.,
B. F. Müller,
A. Homfeld, and W. Deppert.
1992.
Specific and complex interactions of murine p53 with DNA.
Oncogene
7:1921-1932[Medline].
|
| 87.
|
Whitby, M. C., and R. G. Lloyd.
1995.
Branch migration of three-stranded recombination intermediates by RecG, a possible pathway for securing exchanges initiated by 3'-tailed duplex DNA.
EMBO J.
14:3302-3310[Medline].
|
| 88.
|
Whittaker, L.,
A. Fuks, and R. Hand.
1985.
Plasma membrane orientation of simian virus 40 T antigen in three transformed cell lines mapped with monoclonal antibodies.
J. Virol.
53:366-373[Abstract/Free Full Text].
|
| 89.
|
Wiesmüller, L.,
J. Cammenga, and W. W. Deppert.
1996.
In vivo assay of p53 function in homologous recombination between simian virus 40 chromosomes.
J. Virol.
70:737-744[Abstract].
|
| 90.
|
Xiao, H.,
A. Pearson,
B. Coulombe,
R. Truant,
S. Zhang,
J. L. Regier,
S. J. Triezenberg,
D. Reinberg,
O. Flores,
C. J. Ingles, and J. Greenblatt.
1994.
Binding of basal transcription factor TFIIH to the acidic activation domains of VP16 and p53.
Mol. Cell. Biol.
14:7013-7024[Abstract/Free Full Text].
|
| 91.
|
Xu, L.,
B. M. Weiner, and N. Kleckner.
1997.
Meiotic cells monitor the status of the interhomolog recombination complex.
Genes Dev.
11:106-118[Abstract/Free Full Text].
|
| 92.
|
Yewdell, J. W.,
J. V. Gannon, and D. P. Lane.
1986.
Monoclonal antibody analysis of p53 expression in normal and transformed cells.
J. Virol.
59:444-452[Abstract/Free Full Text].
|
| 93.
|
Yin, Y.,
M. A. Tainsky,
F. Z. Bischoff,
L. C. Strong, and G. M. Wahl.
1992.
Wild-type p53 restores cell cycle control and inhibits gene amplification in cells with mutant p53 alleles.
Cell
70:937-948[Medline].
|
Molecular and Cellular Biology, September 1998, p. 5332-5342, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Keimling, M., Wiesmuller, L.
(2009). DNA double-strand break repair activities in mammary epithelial cells--influence of endogenous p53 variants. Carcinogenesis
30: 1260-1268
[Abstract]
[Full Text]
-
Youds, J. L., O'Neil, N. J., Rose, A. M.
(2006). Homologous Recombination Is Required for Genome Stability in the Absence of DOG-1 in Caenorhabditis elegans. Genetics
173: 697-708
[Abstract]
[Full Text]
-
Baumann, C., Boehden, G. S., Burkle, A., Wiesmuller, L.
(2006). Poly(ADP-RIBOSE) polymerase-1 (Parp-1) antagonizes topoisomerase I-dependent recombination stimulation by P53. Nucleic Acids Res
34: 1036-1049
[Abstract]
[Full Text]
-
Walter, K., Warnecke, G., Bowater, R., Deppert, W., Kim, E.
(2005). Tumor Suppressor p53 Binds with High Affinity to CTG{middle dot}CAG Trinucleotide Repeats and Induces Topological Alterations in Mismatched Duplexes. J. Biol. Chem.
280: 42497-42507
[Abstract]
[Full Text]
-
Yun, S., Lie-A-Cheong, C., Porter, A. C. G.
(2004). Discriminatory suppression of homologous recombination by p53. Nucleic Acids Res
32: 6479-6489
[Abstract]
[Full Text]
-
Del Carratore, R., Petrucci, A., Simili, M., Fronza, G., Galli, A.
(2004). Involvement of human p53 in induced intrachromosomal recombination in Saccharomyces cerevisiae. Mutagenesis
19: 333-339
[Abstract]
[Full Text]
-
Boehden, G. S., Restle, A., Marschalek, R., Stocking, C., Wiesmuller, L.
(2004). Recombination at chromosomal sequences involved in leukaemogenic rearrangements is differentially regulated by p53. Carcinogenesis
25: 1305-1313
[Abstract]
[Full Text]
-
Razak, Z. R. A., Varkonyi, R. J., Kulp-McEliece, M., Caslini, C., Testa, J. R., Murphy, M. E., Broccoli, D.
(2004). p53 Differentially Inhibits Cell Growth Depending on the Mechanism of Telomere Maintenance. Mol. Cell. Biol.
24: 5967-5977
[Abstract]
[Full Text]
-
Susse, S., Scholz, C.-J., Burkle, A., Wiesmuller, L.
(2004). Poly(ADP-ribose) polymerase (PARP-1) and p53 independently function in regulating double-strand break repair in primate cells. Nucleic Acids Res
32: 669-680
[Abstract]
[Full Text]
-
Wolcke, J., Reimann, M., Klumpp, M., Gohler, T., Kim, E., Deppert, W.
(2003). Analysis of p53 "Latency" and "Activation" by Fluorescence Correlation Spectroscopy: EVIDENCE FOR DIFFERENT MODES OF HIGH AFFINITY DNA BINDING. J. Biol. Chem.
278: 32587-32595
[Abstract]
[Full Text]
-
Slebos, R. J. C., Oh, D. S., Umbach, D. M., Taylor, J. A.
(2002). Mutations in Tetranucleotide Repeats following DNA Damage Depend on Repeat Sequence and Carcinogenic Agent. Cancer Res.
62: 6052-6060
[Abstract]
[Full Text]
-
Gohler, T., Reimann, M., Cherny, D., Walter, K., Warnecke, G., Kim, E., Deppert, W.
(2002). Specific Interaction of p53 with Target Binding Sites Is Determined by DNA Conformation and Is Regulated by the C-terminal Domain. J. Biol. Chem.
277: 41192-41203
[Abstract]
[Full Text]
-
McKinney, K., Prives, C.
(2002). Efficient Specific DNA Binding by p53 Requires both Its Central and C-Terminal Domains as Revealed by Studies with High-Mobility Group 1 Protein. Mol. Cell. Biol.
22: 6797-6808
[Abstract]
[Full Text]
-
Akyuz, N., Boehden, G. S., Susse, S., Rimek, A., Preuss, U., Scheidtmann, K.-H., Wiesmuller, L.
(2002). DNA Substrate Dependence of p53-Mediated Regulation of Double-Strand Break Repair. Mol. Cell. Biol.
22: 6306-6317
[Abstract]
[Full Text]
-
Subramanian, D., Griffith, J. D.
(2002). Interactions between p53, hMSH2-hMSH6 and HMG I(Y) on Holliday junctions and bulged bases. Nucleic Acids Res
30: 2427-2434
[Abstract]
[Full Text]
-
Okorokov, A. L., Warnock, L., Milner, J.
(2002). Effect of wild-type, S15D and R175H p53 proteins on DNA end joining in vitro: potential mechanism of DNA double-strand break repair modulation. Carcinogenesis
23: 549-557
[Abstract]
[Full Text]
-
Vasquez, K. M., Marburger, K., Intody, Z., Wilson, J. H.
(2001). Manipulating the mammalian genome by homologous recombination. Proc. Natl. Acad. Sci. USA
98: 8403-8410
[Abstract]
[Full Text]
-
Liu, Y., Kulesz-Martin, M.
(2001). p53 protein at the hub of cellular DNA damage response pathways through sequence-specific and non-sequence-specific DNA binding. Carcinogenesis
22: 851-860
[Abstract]
[Full Text]
-
Zotchev, S. B., Protopopova, M., Selivanova, G.
(2000). p53 C-terminal interaction with DNA ends and gaps has opposing effect on specific DNA binding by the core. Nucleic Acids Res
28: 4005-4012
[Abstract]
[Full Text]
-
Baechtold, H., Kuroda, M., Sok, J., Ron, D., Lopez, B. S., Akhmedov, A. T.
(1999). Human 75-kDa DNA-pairing Protein Is Identical to the Pro-oncoprotein TLS/FUS and Is Able to Promote D-loop Formation. J. Biol. Chem.
274: 34337-34342
[Abstract]
[Full Text]
-
Janus, F., Albrechtsen, N., Knippschild, U., Wiesmuller, L., Grosse, F., Deppert, W.
(1999). Different Regulation of the p53 Core Domain Activities 3'-to-5' Exonuclease and Sequence-Specific DNA Binding. Mol. Cell. Biol.
19: 2155-2168
[Abstract]
[Full Text]
-
Degtyareva, N., Subramanian, D., Griffith, J. D.
(2001). Analysis of the Binding of p53 to DNAs Containing Mismatched and Bulged Bases. J. Biol. Chem.
276: 8778-8784
[Abstract]
[Full Text]