Previous Article | Next Article 
Molecular and Cellular Biology, September 1998, p. 5485-5491, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Functional and Physical Interaction between Rad24
and Rfc5 in the Yeast Checkpoint Pathways
Toshiyasu
Shimomura,
Seiko
Ando,
Kunihiro
Matsumoto,* and
Katsunori
Sugimoto
Division of Biological Science, Graduate
School of Science, Nagoya University, Chikusa-ku, Nagoya 464-0814, Japan
Received 24 March 1998/Returned for modification 27 April
1998/Accepted 22 June 1998
 |
ABSTRACT |
The RFC5 gene encodes a small subunit of replication
factor C (RFC) complex in Saccharomyces cerevisiae and has
been shown to be required for the checkpoints which respond to
replication block and DNA damage. Here we describe the isolation of
RAD24, known to play a role in the DNA damage checkpoint,
as a dosage-dependent suppressor of rfc5-1. RAD24
overexpression suppresses the sensitivity of rfc5-1 cells
to DNA-damaging agents and the defect in DNA damage-induced Rad53
phosphorylation. Rad24, like Rfc5, is required for the regulation of
Rad53 phosphorylation in response to DNA damage. The Rad24 protein,
which is structurally related to the RFC subunits, interacts physically
with RFC subunits Rfc2 and Rfc5 and cosediments with Rfc5. Although the
rad24
mutation alone does not cause a defect in the
replication block checkpoint, it does enhance the defect in
rfc5-1 mutants. Furthermore, overexpression of
RAD24 suppresses the rfc5-1 defect in the
replication block checkpoint. Taken together, our results demonstrate a
physical and functional interaction between Rad24 and Rfc5 in the
checkpoint pathways.
 |
INTRODUCTION |
The survival of eucaryotes depends
on the accurate transmission of genetic information from one
generation to the next. Successful mitotic division requires the
events of the cell cycle to be ordered such that the initiation of late
cycle events is dependent on the completion of early events. The
mechanisms that ensure the proper ordering of cell cycle events have
been termed checkpoint controls (7). When DNA replication is
delayed and DNA damage occurs, checkpoint controls activate cell cycle
arrest enough to complete DNA replication and repair DNA damage
(4, 18).
In the budding yeast Saccharomyces cerevisiae, checkpoint
pathways induce cell cycle arrest in G1 or G2/M
and retard S-phase progression in response to DNA damage. Other
checkpoints prevent cells with incompletely replicated DNA from exiting
the S phase. A number of genes that are involved in the DNA damage
checkpoint and/or the replication block checkpoint have been
identified elsewhere (4, 18). These include
RAD9, RAD17, RAD24, POL2,
MEC1/ESR1, RAD53/SPK1/MEC2/SAD1,
RFC5, MEC3, and DDC1. Among these
genes, RAD9, RAD17, RAD24,
MEC3, and DDC1 are involved not only in the G2/M-phase but also in the G1- and S-phase DNA
damage checkpoints (11, 12, 17, 22-24, 31-33).
POL2, encoding a large subunit of DNA polymerase (Pol)
, is required for the checkpoints responding to replication
block and DNA damage in S phase (15, 16). MEC1 and RAD53 are necessary for the checkpoints operating in
response to both DNA damage and incomplete DNA replication (1,
33). RAD53 encodes a dual-specificity protein kinase
(25), and Mec1 belongs to the phosphatidylinositol kinase
family that includes human ataxia-telangiectasia-mutated (ATM) proteins
(9, 21). Rad53 is phosphorylated in response to DNA damage
and DNA replication block in a MEC1-dependent manner
(20, 29).
Replication factor C (RFC) is required for DNA replication and repair
and consists of one large and four small subunits. In S. cerevisiae, the large subunit of RFC is encoded by
RFC1/CDC44 and the four small subunits are
encoded by RFC2, RFC3, RFC4, and RFC5 (3). RFC is a structure-specific DNA-binding
protein complex that recognizes the primer-template junction. RFC loads
proliferating cell nuclear antigen (PCNA) onto the primer terminus and
then Pols
and
bind to the DNA-RFC-PCNA complex to constitute a processive replication complex (2, 10, 30). A
temperature-sensitive mutant of RFC5 whose lethality can be
suppressed by overexpression of the Rad53 kinase has been identified
(28). We have demonstrated that RFC5 is required
for the checkpoints operating in response to DNA replication block and
DNA damage in S phase (26, 28). Phosphorylation of Rad53 is
reduced in rfc5-1 mutants in response to DNA damage during
the S phase, suggesting that RFC5 functions upstream of
RAD53. However, it is not yet known how Rfc5 regulates the
checkpoint pathway.
To identify genes that interact with RFC5 in the checkpoint
pathway, we isolated dosage-dependent suppressors of rfc5-1
mutants. One of the suppressor genes was found to be RAD24,
a gene which has been shown to play a role in the DNA damage
checkpoint. Overexpression of RAD24 suppresses the DNA
damage sensitivity and Rad53 phosphorylation defect in
rfc5-1 mutants. RAD24 encodes a protein
structurally related to subunits of the RFC complex, and the Rad24
protein associates with the components of RFC. Although
rad24
alone does not cause a defect in the replication
block checkpoint, its introduction does exacerbate the defect in
rfc5 mutants. Thus, Rad24 and Rfc5 interact physically and
functionally in the checkpoints responding to DNA damage and
replication block.
 |
MATERIALS AND METHODS |
Strains, media, and general methods.
Yeast strains used in
this study are listed in Table 1. DNA was
manipulated by standard procedures (19). Standard genetic techniques were used for manipulating yeast strains (8).
Media used to maintain selection of TRP1 and URA3
plasmids are synthetic complete media containing 0.5% Casamino Acids
and the appropriate supplements.
Screening of dosage-dependent suppressors of rfc5-1.
To isolate dosage-dependent suppressors of rfc5-1,
rfc5-1 (KSC766) mutants were transformed with an S. cerevisiae YEp13 genomic library. Approximately 40,000 transformants grown at 25°C were replica plated to yeast
extract-peptone-dextrose (YEPD) containing 1 mg of hydroxyurea (HU) per
ml at 37°C. The plasmids were recovered and retransformed into
KSC766 cells. Plasmids that conferred the suppression were subjected to
restriction and partial sequence analysis. After elimination of
plasmids containing the RFC5 gene, four plasmids were
further tested to see whether they suppressed the HU sensitivity of the
rad53 mutant (spk1-101 [28]).
Two of the plasmids did not suppress the spk1-101 phenotype
and were found to contain an overlapping region on chromosome V. Subcloning analysis along with a search of DNA databases localized the
suppressor gene to RAD24.
Plasmids.
A 4-kb KpnI-SpeI fragment
from pRS416 carrying the RAD24 gene (obtained from T. Weinert) was cloned into KpnI-XbaI-digested YEplac112 and YEplac195 (5), creating YEpT-RAD24 and
YEpRAD24, respectively. To create the rad24 disruption
construct, the N-terminal and C-terminal region of the RAD24
gene was amplified by PCR with the primers
R24N-5'(GGGCTCGAGAGATCATCACAATGCG) and
R24N-3'(GCATCTAAAGCTTCTTGTAC) or
R24C-5'(CCCGCATGCGGAAAGGGACAGAAGGCT) and
R24C-3'(GGGCTCGAGGTAATGTGCATAGATTTGTG). The rad24
disruption plasmid was constructed by a three-part ligation of the
XhoI-HindIII-treated PCR-amplified N-terminal
fragment and the SphI-XhoI-treated PCR-amplified
C-terminal fragment with SphI-HindIII-linearized YIplac128
(5). A null allele for RAD24 (rad24
::LEU2) selecting for leucine prototrophy was
obtained after sporulation of diploid cells transformed with
XhoI-digested rad24 disruption plasmid.
Disruption for RAD24 was confirmed by Southern blotting. The
rad24
::TRP1 strains were obtained by replacing LEU2 with TRP1 in the
rad24
::LEU2 strains with pLW1 (a gift from M. Shirayama). To construct the rfc5-1 integration plasmid
pIR-1, the HindIII-SmaI fragment from the
recovered rfc5-1 mutation (28) was cloned
into YIplac128 digested with HindIII and
SmaI. The rfc5-1::LEU2 strains were
obtained by transforming pIR-1 into TSY401 cells after treatment with
MluI. The NcoI-SalI fragment from R5HC
(28), whose NcoI site was blunted with Klenow
fragment, was cloned into YIplac128 cleaved with SmaI and
SalI, creating the RFC5-HA integration plasmid
pTS-I5H. The EcoRI-BamHI fragment from pTS-I5H
and the BamHI-HindIII fragment containing DNA
sequences of four Myc epitopes were cloned into YIplac128 cleaved with
EcoRI and HindIII, creating the
RFC5-Myc integration plasmid pTS-I5M. The RFC5-HA
and RFC5-Myc integration strains were obtained by transformation with BglII-digested pTS-I5H and pTS-I5M,
respectively. Precise integration was confirmed by PCR. The
RFC5-HA- and RFC5-Myc-integrated cells, in which
the endogenous RFC5 gene is disrupted, grow as well as do
wild-type cells. To create the RAD24-HA and
RAD24-Myc plasmids (YCpRAD24-HA and
YCpRAD24-Myc), the RAD24 sequence was amplified by
PCR with the 5' primer CTCGAATTCTTTCAGGAATATAACTCT and the
3' primer CTCGGATCCCGAGTATTTCCAGATCTGAAT, creating a
BamHI restriction site at the C-terminal end. The
NcoI-BamHI-digested PCR fragment, together with
the KpnI-NcoI fragment from the RAD24 gene and the BamHI-SalI fragment containing DNA
sequences of two hemagglutinin (HA) epitopes, were subcloned into
YCplac33 (5), creating YCpRAD24-HA. The
NcoI-BamHI-digested PCR fragment, together with
the KpnI-NcoI fragment from the RAD24
gene and the BamHI-HindIII fragments
containing DNA sequences of two HA and four Myc epitopes, were
subcloned into YCplac33 (5), creating YCpRAD24-Myc.
The tagged RAD24 genes complement the sensitivities of
the rad24
mutant to methyl methanesulfonate (MMS) and UV,
indicating that the tagged versions are fully functional.
YCpT-RFC5 was constructed by inserting the
HindIII-SalI fragment of the RFC5
gene into YCplac22 (5). YCpRFC5, YEpPOL30,
YEpT-POL30 and YCp-RAD53-HA were described previously
(26, 28).
Immunoblotting.
Immunoblotting analysis was performed as
previously described (26). Yeast cells were grown in
synthetic complete medium selectable for TRP1 and/or
URA3 plasmids. Cells were then diluted in YEPD and allowed
to grow for 3 h before cells were treated with MMS. Cells were
pelleted, washed with chilled water, and resuspended in sodium dodecyl
sulfate (SDS) sample buffer U. An equal volume of glass beads was
added, and the cells were lysed by vortexing. Extracts were clarified
by 15 min of centrifugation, and 2-mercaptoethanol was added to a final
concentration of 1%. The samples were boiled for 5 min and
fractionated on SDS-polyacrylamide gels. Proteins were then transferred
to nylon membranes; subjected to immunoblot analysis with the mouse
monoclonal anti-HA (BAbCO or Boehringer Mannheim), rat monoclonal
anti-HA (Boehringer Mannheim), rabbit polyclonal anti-HA (MBL), rabbit
polyclonal anti-Myc (MBL), or rabbit anti-Rfc2 serum (a gift from A. Sugino) antibodies, and were detected with the ECL kit (Amersham).
Immunoprecipitation.
Yeast cells were grown in synthetic
complete medium selectable for URA3 plasmids. Cells were
then diluted in YEPD and allowed to grow for 3 h. Cells (20 U of
optical density at 600 nm) were pelleted, washed, and resuspended in
150 µl of lysis buffer (26). An equal volume of glass
beads was added, and the cells were lysed by vortexing. Extracts were
clarified by 15 min of centrifugation at 4°C. The supernatant was
diluted with lysis buffer and incubated at 4°C for 2 h with 30 µl of protein A-Sepharose beads bound with anti-Rfc2, anti-HA, or
anti-Myc antibodies. Protein concentration was determined by the
Bio-Rad protein assay (Bio-Rad). Immunoprecipitates were washed four
times with lysis buffer, twice with another buffer (20 mM HEPES-Na [pH
7.5], 10 mM MgCl2, 4 mM MnCl2), and boiled immediately in 1× SDS-polyacrylamide gel electrophoresis (PAGE) sample
buffer (26). The proteins were detected after immunoblotting with antibodies described above.
Sucrose density gradient centrifugation.
Cells were
pelleted, washed, and resuspended in lysis buffer. An equal volume of
glass beads was added, and the cells were lysed by vortexing. Extracts
were clarified by 15 min of centrifugation at 4°C, and 200 µl of
the supernatant was separated by sucrose density gradient sedimentation
(4 ml of 10 to 40% sucrose gradient in lysis buffer centrifuged in an
SW60 rotor at 40,000 rpm for 12 h at 4°C). The gradients were
fractionated from the top (200 µl/fraction) and subjected to
immunoblotting with antibodies described above.
UV radiation and drug sensitivities.
The UV radiation
sensitivity assay was performed as described previously
(27). Cells grown at 37°C were plated on YEPD and then
irradiated by UV light at 254 nm. After 2 to 3 days of incubation at
37°C, the number of colonies was counted. MMS sensitivity was determined as described elsewhere (27). Cells were incubated with 0 to 0.06% MMS at 37°C for 30 min. Incubation was terminated by
addition of sodium thiosulfate to a final concentration of 5%.
Aliquots were plated on YEPD, and the number of colonies was counted
after incubation at 37°C for 2 to 3 days. The HU sensitivity assay
was performed as described previously (28).
Immunofluorescence microscopic analysis.
Yeast cells were
grown in YEPD medium at 30°C. To examine spindle elongation at
37°C, the culture was synchronized in the G1 phase by
addition of 6 µg of
-factor per ml at 30°C for 1 h. After
1 h,
-factor (6 µg/ml) was subsequently added, and the culture was shifted to 37°C for 1 h. HU was added to a final
concentration of 10 mg/ml to the culture during the last 30 min of
incubation with
-factor. Cells were then washed to remove
-factor
and released into YEPD containing 10 mg of HU per ml at 37°C. To
examine spindle elongation at 30°C, the culture was synchronized in
the G1 phase by addition of 6 µg of
-factor per ml at
30°C for 2 h. HU was added at 10 mg/ml to the culture during the
last 30 min of incubation with
-factor. Cells were then washed to
remove
-factor and released into YEPD containing 10 mg of HU per ml
at 30°C. Aliquots of cells were removed and processed for DNA flow
cytometry analysis, viability assessment, and indirect
immunofluorescence microscopy as described previously (26).
For analysis of suppression of the rfc5-1 checkpoint defect by RAD24 overexpression, yeast cells were grown in
synthetic complete medium selectable for URA3 plasmids,
diluted in YEPD, and allowed to grow at 30°C for 3 h. The
culture was synchronized in G1 with
-factor and released
into YEPD containing 10 mg of HU per ml at 37°C, and aliquots of
cells were removed and processed as described above.
 |
RESULTS |
Isolation of the RAD24 gene as a dosage-dependent
suppressor of rfc5-1.
The rfc5-1 mutation
is defective for the checkpoints responding to DNA damage and
replication block (26, 28). We have shown that the
rfc5-1 mutation confers a growth defect and HU sensitivity at the restrictive temperature. Overexpression of POL30, which encodes PCNA, suppresses the growth defect but
not the HU sensitivity in rfc5-1 mutants (28)
(see Fig. 1). On the other hand, both defects are suppressed by a high
dosage of the checkpoint control gene RAD53 (28).
To identify genes involved in the checkpoint control, we isolated genes
which suppress the HU sensitivity of the rfc5-1 mutant
in a dosage-dependent manner. rfc5-1 mutants were
transformed with an S. cerevisiae YEp13 genomic library, and
transformants grown at 25°C were replica plated to YEPD containing 1 mg of HU per ml at 37°C. In addition to plasmids containing
RFC5, four plasmids which suppressed the
rfc5-1 growth defect on YEPD containing HU at 37°C
were recovered. These plasmids were further tested for whether
they suppressed the HU sensitivity of rad53 mutants.
RAD53 is considered to function downstream of RFC5 in the checkpoint pathway (26, 28). Two
plasmids suppressed the HU sensitivity of rad53 mutants,
while the other two did not (data not shown). The suppressor genes on
the latter plasmids were chosen for more-detailed analysis, since their
function is presumably more closely related to that of RFC5.
Restriction and DNA sequence analysis indicated that the plasmids
contain an overlapping region on chromosome V. Subcloning analysis
and a DNA database search identified the suppressor gene as
RAD24 (6, 14). As shown in Fig.
1, a high-copy-number plasmid
carrying RAD24 (YEpRAD24) suppressed both the
growth defect and HU sensitivity in rfc5-1 mutants.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
RAD24 overexpression suppresses the
rfc5 growth defect. rfc5-1 mutant (KSC766)
cells transformed with the YCpRFC5, YEpPOL30, YEpRAD24, or YEp
vector (YEplac195) were streaked and incubated on YEPD medium at 25°C
or on YEPD medium in the presence or absence of 1 mg of HU per ml at
37°C.
|
|
Effect of RAD24 overexpression on the
rfc5-1 defect in the replication block checkpoint.
We have shown that rfc5-1 mutants are partially
defective for the checkpoint responding to DNA replication block
(26). Since overexpression of RAD24 suppressed
the growth defect of rfc5-1 mutants on HU-containing
medium (Fig. 1), we examined the effect of RAD24
overexpression on the rfc5-1 defect in the replication block checkpoint. rfc5-1 cells carrying the YCpRFC5,
YEpRAD24, or YEp vector were synchronized with
-factor and released
into medium containing HU at 37°C. Flow cytometric analysis showed that DNA replication was efficiently blocked in those cells until 120 min after release into HU (Fig. 2A). Most
(99%) of the RFC5 cells were arrested as large budded cells
with short spindles, and 31% of rfc5-1 mutant cells
exhibited elongated spindles at 120 min after release into HU.
Overexpression of RAD24 decreased the population of
rfc5-1 mutants with elongated spindles; 19% of
rfc5-1 mutants carrying YEpRAD24 showed elongated
spindles at 120 min after release (Fig. 2B). Furthermore, cell survival following HU treatment was higher in rfc5-1 mutants
carrying YEpRAD24 than in those carrying the YEp vector (Fig. 2B).
Thus, high levels of Rad24 can partially suppress the
rfc5-1 checkpoint defect responding to replication
block.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Suppression of spindle elongation and sensitivity of
HU-treated rfc5 mutants by RAD24 overexpression.
(A) Flow cytometric analysis of the DNA content of
G1-synchronized cells released into medium containing HU.
rfc5-1 mutants (TSY601) carrying YCpRFC5, YEpRAD24,
or YEplac195 were synchronized in G1 by -factor
treatment and released into YEPD containing 10 mg of HU per ml at
37°C as described in Materials and Methods. Aliquots of cells were
collected at 0 and 120 min after release from -factor and examined
for DNA content by flow cytometry. Dotted lines indicate the DNA
content of 1C and 2C cells. The top panels represent asynchronous cells
not treated with HU at 30°C and are included as a reference. Typical
data from at least two independent experiments is presented. (B)
Spindle elongation and sensitivity of HU-treated rfc5
mutants. rfc5-1 mutants (TSY601) carrying YCpRFC5,
YEpRAD24, or YEplac195 were synchronized in G1 and released
into YEPD containing 10 mg of HU per ml as described above. Cells were
collected and fixed in formaldehyde at 120 min after release into HU.
Nuclear and microtubular structures were visualized with DAPI
(4',6-diamidino-2-phenylindole) and antitubulin antibodies,
respectively. At least 200 cells were examined. Viabilities were
determined at 120 min after release in HU. Results are means plus or
minus standard errors of at least two independent cultures per
strain.
|
|
rfc5 rad24 double mutants are more defective for the
checkpoint responding to replication block than are single
rfc5 mutants.
Although the rad24
mutant
shows no apparent defect in the replication block checkpoint (14,
33), RAD24 overexpression suppresses the checkpoint
defect in rfc5-1 mutants. To determine whether
RAD24 is involved in the replication block checkpoint, we
examined the effect of the rad24
mutation on the
checkpoint defect in rfc5-1 mutants. DNA content and
spindle elongation were analyzed in rfc5-1 and
rfc5-1 rad24
mutants following the release of
-factor-arrested cells into medium containing HU at 37°C (Fig. 3). If cells are
defective for the replication block checkpoint, HU-treated cells should
enter into mitosis, as evidenced by spindle elongation prior to
completion of DNA replication. Flow cytometric analysis showed that DNA
replication was efficiently blocked in wild-type and
rfc5-1, rad24
, and rfc5-1
rad24
mutant cells until 120 min after release into HU (Fig.
3A). Most (98%) of the wild-type and rad24
cells were
arrested as large budded cells with short spindles, while 30% of
rfc5-1 mutant cells exhibited elongated spindles at 120 min after release into HU. However, 56% of rfc5-1 rad24
mutants showed elongated spindles at 120 min after
release (Fig. 3B and C). Cell survival following HU treatment was lower in rfc5-1 rad24
double mutants than in either single
mutant (Fig. 3B). Thus, rfc5-1 rad24
double mutants
show a more pronounced defect in the replication block checkpoint than
do single rfc5-1 mutants. Since rfc5-1
mutants are defective for DNA replication at 37°C (28),
this exacerbated defect might be a secondary consequence of more
perturbed DNA replication by the rad24
mutation. To
exclude this possibility, we next examined DNA content and spindle
elongation in rfc5-1 rad24
mutants following the
release of
-factor-arrested cells into HU at 30°C (Fig. 3).
rfc5-1 rad24
mutant cells exhibited no apparent
replication defect at 30°C, since they grew as well as did wild-type
cells and did not accumulate in the S phase at 30°C. Flow cytometric
analysis showed that DNA replication was efficiently blocked in cells
until 120 min after release into HU (Fig. 3A). Most of the wild-type,
rfc5-1, and rad24
cells were arrested as
large budded cells with short spindles, while 21% of rfc5-1
rad24
mutant cells exhibited elongated spindles at 120 min
after release into HU. rfc5-1 rad24
mutants became more sensitive to HU treatment even at 30°C (Fig. 3B). These results confirm that the rad24
mutation enhanced the checkpoint
defect in rfc5-1 mutants.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of the rad24 mutation on the
replication block checkpoint in rfc5-1 mutants. (A) Flow
cytometric analysis of the DNA content of G1-synchronized
cells released into medium containing HU. Wild-type (TSY401) and
rfc5-1 (TSY601), rad24 (TSY418), and
rfc5-1 rad24 (TSY602) mutant cells were synchronized
in G1 and released into YEPD containing 10 mg of HU per ml
at 30 or 37°C as described in Materials and Methods. Aliquots of
cells were collected at 0 and 120 min after release into HU and
examined for DNA content by flow cytometry. Dotted lines indicate the
DNA content of 1C and 2C cells. The top panels represent asynchronous
cells not treated with HU at 30°C and are included as a reference.
Typical data from at least two independent experiments is presented.
(B) Spindle elongation and viability of cells in the presence of HU.
Wild-type (TSY401) and rfc5-1 (TSY601),
rad24 (TSY418), and rfc5-1 rad24
(TSY602) mutant cells were synchronized in G1 and released
into YEPD containing 10 mg of HU per ml at 30 or 37°C as described in
Materials and Methods. Cells were collected and fixed in formaldehyde.
Nuclear and microtubular structures at 120 min after release into
medium with HU were visualized with DAPI
(4',6-diamidino-2-phenylindole) and antitubulin antibodies,
respectively. At least 200 cells were examined. Viabilities were
determined at 120 min after release in HU. Results are means plus or
minus standard errors of at least two independent cultures per strain.
(C) Photomicrographs of wild-type and rfc5-1 rad24
mutant cells at 120 min after release from the G1 block
into medium containing HU. Wild-type (TSY401) and rfc5-1 rad24
(TSY602) mutant cells were synchronized in G1 and released
into YEPD containing 10 mg of HU per ml at 37°C. Cells were collected
at 120 min after release and fixed in formaldehyde. Nuclear and
microtubular structures were visualized with DAPI and antitubulin
antibodies, respectively.
|
|
Effects of RAD24 overexpression on the response to DNA
damage in rfc5-1 mutants.
Several lines of
evidence have implicated RAD24 in the DNA damage checkpoint
(17, 22, 32, 33). The rfc5-1 mutation is also
defective for the DNA damage checkpoint and is sensitive to DNA damage
(26). To investigate the relationship between RFC5 and RAD24, we examined the effects of
RAD24 overexpression on the DNA damage sensitivity of
rfc5-1 mutants. Overexpression of POL30
suppresses the growth defect but not the sensitivity to DNA
damage in rfc5-1 mutants (26, 28). We
therefore examined whether RAD24 overexpression would
suppress the DNA damage sensitivity of rfc5-1 mutants
carrying YEpT-POL30. RAD24 overexpression restored the
ability of rfc5-1 cells carrying YEpT-POL30 to survive
exposure to MMS and UV irradiation (Fig.
4).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of RAD24 overexpression on DNA damage
sensitivity in rfc5 mutants. rfc5-1 mutant
(KSC766) cells carrying YEpT-POL30 were transformed with YCpRFC5,
YEpRAD24, or YEplac195. The transformants in log-phase culture grown at
37°C were treated with the indicated concentrations of MMS for 30 min
or irradiated at the indicated doses with UV light. Viability of cells
was estimated as described in Materials and Methods.
|
|
Rad53 is an essential protein kinase that plays a role in the DNA
damage checkpoint pathway (
1). Exposure of cells to
MMS
leads to the phosphorylation of Rad53, resulting in the
accumulation
of a lower-mobility form of Rad53 (
20,
29). We
have shown
that the phosphorylation of Rad53 is reduced in
response to MMS
treatment in
rfc5-1 mutants, providing
evidence that Rfc5 is required
for the DNA damage-induced
phosphorylation of Rad53 (
26). Since
overexpression of
RAD24 can suppress the sensitivity to MMS of
rfc5-1 mutants, we expected that its overexpression
would also
suppress the defect in the MMS-induced Rad53 phosphorylation
of
rfc5-1 mutants. To test this hypothesis, the
phosphorylation state
of Rad53 was examined in vivo by immunoblot
analysis in cells
expressing the Rad53-HA protein. When treated
with MMS at 37°C,
Rad53-HA in wild-type cells became highly
phosphorylated as indicated
by the appearance of isoforms with a
lower electrophoretic mobility.
In contrast, the phosphorylation
of Rad53-HA in
rfc5-1 mutants
was greatly reduced
(Fig.
5). However, the DNA damage-induced
phosphorylation of Rad53 was partially restored in
rfc5-1 mutants
by the introduction of YEpT-RAD24,
as evidenced by the appearance
of smeared,
shifted bands corresponding to Rad53 (Fig.
5). Thus,
suppression of the DNA damage sensitivity of
rfc5-1
mutants by
RAD24 overexpression was correlated with
the modification of Rad53.
These observations suggest that
overexpression of
RAD24 suppresses
the DNA damage
sensitivity of the
rfc5-1 mutation by activating
Rad53.
This is consistent with our earlier observation that
RAD53 overexpression can suppress the DNA damage sensitivity of
rfc5-1 mutants (
26).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of RAD24 overexpression on
modification of Rad53 in rfc5 mutants. rfc5-1
mutant (KSC766) cells were transformed with YCpRAD53-HA and
YCpT-RFC5 (RFC5), YEpT-RAD24 (RAD24), or YEplac112 (vector). The
transformants grown at 25°C were shifted to 37°C for 1 h and
then incubated with YEPD ( ) or YEPD containing 0.1% MMS (M) at
37°C for 2 h. The cells were subjected to immunoblotting
analysis as described in Materials and Methods.
|
|
Since overexpression of
RAD24 restored the DNA
damage-induced phosphorylation of Rad53 in
rfc5-1
mutants, it is possible that
Rad24 is also required for
activation of Rad53 kinase. To examine
this possibility, we tested the
phosphorylation state of Rad53
in
rad24
mutants that
suffered from DNA damage. When wild-type
cells were treated with MMS,
Rad53-HA underwent modification.
In contrast, the MMS-induced
modification of Rad53-HA was reduced
in
rad24
mutants (Fig.
6). This result indicates
that Rad24,
like Rfc5, is required for the DNA damage-induced
phosphorylation
of the Rad53 kinase.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Modification of Rad53 in rad24 mutants.
RAD24 (TSY401) and rad24 (TSY418) mutant cells
carrying YCp-RAD53-HA were grown at 30°C. The cells were
incubated with 0.04% MMS for the indicated time and subjected to
immunoblotting analysis as described in Materials and Methods.
|
|
Rad24 proteins associate with subunits of the RFC complex.
The
coding sequence of the RAD24 gene is 1,977 bp in length,
and the predicted protein consists of 659 amino acids,
corresponding to a molecular mass of 76 kDa, and contains a
nucleoside triphosphate binding motif (6, 14). Rad24
is most homologous to the fission yeast Rad17, and they show a
well-conserved structural organization. Rad24 is also structurally
related to components of the RFC complex (6, 14). RFC
subunits contain eight domains termed the RFC boxes (3).
Rad24 contains homology to RFC boxes II, III (nucleotide binding
motif), and VIII but lacks sequences corresponding to RFC boxes I (the
DNA ligase homology domain), IV, V (DEAD box), VI, and VII.
The genetic interaction presented above and sequence similarities
between the RFC subunits and Rad24 raised the possibility
that Rad24
associates with the RFC complex. To examine the physical
interaction
between Rad24 and the RFC complex, we tagged the
RAD24 gene
with the HA or Myc epitope and analyzed its association with
the RFC subunits Rfc2 and Rfc5. When extracts from cells harboring
a
low-copy-number-tagged
RAD24 plasmid
(YCpRAD24-HA or YCpRAD24-Myc)
were subjected to immunoblot
analysis, we detected an appropriately
sized protein immunoreactive
with the anti-HA or anti-Myc antibody
(data not shown). Isogenic
rad24
cells with or without an integrated
copy of
RFC5-HA (
RFC5-HA rad24
or
RFC5
rad24
cells, respectively)
were transformed with the
YCpRAD24-Myc or YCp vector. Extracts
were prepared from the
transformed cells and subjected to immunoprecipitation
with an
antibody to the HA epitope. The immunoprecipitates were
then
analyzed by immunoblotting with antibodies to the HA epitope,
the Myc epitope, and Rfc2. When immunoblotted with the
anti-HA
antibody, bands migrating at about 40 kDa were detected in the
RFC5-HA cells, while no band was detected by the anti-HA
antibody
in the
RFC5 cells (Fig.
7A). When immunoblotted with the anti-Myc
antibody, bands corresponding to Rad24-Myc were observed in the
immunocomplex from the cells coexpressing Rfc5-HA and Rad24-Myc,
while Rad24-Myc proteins were absent in the immunocomplex from
the
cells expressing only Rad24-Myc or Rfc5-HA (Fig.
7A). Consistent
with
the previous finding that Rfc2 and Rfc5 are subunits of the
RFC complex
(
3,
28), immunoblotting with the anti-Rfc2 antibody
revealed
that Rfc5-HA coprecipitated with Rfc2 (Fig.
7A).
Extracts
were also prepared from
rad24
mutants carrying
YCpRAD24-Myc or
the YCp vector and subjected to
immunoprecipitation with anti-Rfc2
or control serum. The
immunoprecipitates were then analyzed by
immunoblotting with antibodies
against the Myc epitope and Rfc2.
A signal corresponding to
the Rad24-Myc proteins was observed
in extracts from cells
carrying YCpRAD24-Myc after immunoprecipitation
with the
anti-Rfc2 antibody (Fig.
7B). We next examined
coimmunoprecipitation
of Rfc2 and Rfc5 with Rad24 in the
reciprocal experiment.
RFC5-Myc rad24
or
RFC5
rad24
cells were transformed with the YCpRAD24-HA
or
YCp vector. Extracts were prepared from the transformed cells
and
subjected to immunoprecipitation with an antibody to the HA
epitope. The immunoprecipitates were then analyzed by
immunoblotting
with antibodies against the HA epitope, the Myc
epitope, and Rfc2.
Rfc5-Myc was observed in the immunoprecipitates
from cells coexpressing
Rfc5-Myc and Rad24-HA. Rfc2 was found to
coprecipitate with Rad24-HA
in a tagged-Rad24-specific manner (Fig.
7C). These results show
that the Rad24 protein interacts physically
with components of
the RFC complex.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
Association of Rad24 with subunits of RFC. (A)
Coimmunoprecipitation of Rad24 and Rfc2 with Rfc5. Cell extracts
prepared from RFC5 rad24 (TSY418) and RFC5-HA
rad24 (TSY535) cells carrying YCpRAD24-Myc (+) or
YCplac33 ( ) were immunoprecipitated (IP) with anti-HA antibody.
The immunocomplexes were separated by SDS-PAGE and immunoblotted with
anti-HA antibody (top), anti-Myc antibody (middle), or anti-Rfc2 serum
(bottom). (B) Coimmunoprecipitation of Rad24 with Rfc2. Cell extracts
prepared from rad24 (TSY418) cells carrying
YCpRAD24-Myc (+) or YCplac33 ( ) were immunoprecipitated (IP)
with preimmune control serum (c.s.) or anti-Rfc2 serum. The
immunocomplexes were separated by SDS-PAGE and immunoblotted with
anti-Rfc2 serum (top) or anti-Myc antibody (bottom). (C)
Coimmunoprecipitation of Rfc2 and Rfc5 with Rad24. Cell extracts
prepared from RFC5 rad24 (TSY437) and RFC5-Myc
rad24 (TSY612) cells carrying YCpRAD24-HA (+) or
YCplac33 ( ) were immunoprecipitated (IP) with anti-HA antibody.
The immunocomplexes were separated by SDS-PAGE and immunoblotted with
anti-HA antibody (top), anti-Myc antibody (middle), or anti-Rfc2 serum
(bottom).
|
|
We investigated whether Rad24 associates with the RFC complex or
with RFC proteins in smaller complexes. Extracts from cells
coexpressing Rfc5-HA and Rad24-Myc were fractionated by sucrose
density
gradient centrifugation and subjected to immunoblotting
with the
anti-HA and anti-Myc antibodies. As shown in Fig.
8,
Rad24-Myc cosedimented with Rfc5-HA as
a 10S particle. It has
been shown that the purified yeast RFC complex
sediments as an
8.7S particle (
34). Altogether, these
results strongly suggest
that Rad24 proteins associate with the RFC
complex.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Cosedimentation of Rfc5 and Rad24. A cell extract
prepared from RFC5-HA rad24 (TSY535) cells carrying
YCpRAD24-Myc was separated in a 10 to 40% sucrose gradient, and
the load on the gradient (L) and fractions (removed from the top of the
gradient) were analyzed by immunoblotting with anti-HA (upper panel)
and anti-Myc (lower panel) antibodies. Bovine serum albumin (4.5S) and
thyroglobulin (16.5-19S) were separated simultaneously in an
independent gradient as markers. The upper band marked with an asterisk
is a protein other than Rad24-Myc, which is recognized by the anti-Myc
antibody. The lower bands marked with an asterisk are likely
proteolytic products of Rad24-Myc.
|
|
 |
DISCUSSION |
In this paper, we provide evidence demonstrating that the
interaction between RFC5 and RAD24 is linked with
the checkpoint control in the budding yeast. First, RAD24
overexpression suppressed the rfc5-1 defect in the
replication block checkpoint. Second, rfc5-1
rad24
mutants showed a more pronounced defect in the
replication block checkpoint than did single rfc5-1
mutants. Third, RAD24 overexpression suppressed the DNA
damage sensitivity and restored the DNA damage-induced phosphorylation
of Rad53 in rfc5-1 mutants. Fourth, Rad24, like Rfc5,
was required for MMS-induced Rad53 phosphorylation. Finally, Rad24
proteins were found to interact physically with components of the
RFC complex, Rfc2 and Rfc5, and to cosediment with Rfc5. Taken
together, these findings strongly support a model in which Rfc5 and
Rad24 interact physically and functionally in the checkpoint pathways.
The budding yeast RFC has been purified to homogeneity by assaying
replication activity in vitro. The purified RFC complex is composed of
five different subunits, each of which is encoded by an essential gene
(3). The amino acid sequence of Rad24 has similarities with
those of the five subunits of RFC in three of the eight domains termed
the RFC boxes. The RAD24 gene encodes a predicted protein of
659 amino acids with a molecular mass of 76 kDa. Although the peptide
corresponding to Rad24 is not detected in highly purified fractions of
yeast RFC (3), we demonstrated the association of Rad24 with
Rfc2 and Rfc5 by immunoblot analysis following immunoprecipitation and
the cosedimentation of Rad24 with Rfc5 in sucrose density gradient
centrifugation. One likely explanation for these results is that Rad24
proteins may bind unstably or indirectly to the RFC complex and
therefore dissociate during the purification steps. Thus, Rad24 appears
to associate with the RFC complex but not with RFC proteins in smaller
complexes. The physical interaction between Rfc5 and Rad24 was not
affected by treatment with MMS or arrest with nocodazole in M phase
(data not shown). Therefore, the checkpoint or DNA replication status does not appear to regulate the interaction but rather
the other properties, for example, the activity of the
Rad24-RFC complex. The RFC complex possesses a
structure-specific DNA binding activity, displaying a preference for
DNA molecules mimicking DNA replication substrate, and an ATPase
activity that is stimulated by DNA (10, 30). The fact that
Rad24 contains a nucleotide binding motif raises the possibility that
Rad24, like RFC proteins, may possess ATP binding activity. It will be
interesting to see whether ATPase activity of the RFC-Rad24 complex
can be stimulated by recognizing the primer terminus or aberrant
structures resulting from DNA damage and replication delay.
RAD24 overexpression appears to suppress the
rfc5-1 mutation through the physical interaction between
Rad24 and Rfc5, although we cannot exclude the other possibilities, for
instance, that high levels of Rad24 could activate checkpoint pathways
independently of RFC5.
RAD24 has been suggested to have a role in DNA replication
and/or repair, because overexpression of RAD24 strongly
reduces the growth rate of mutants that are defective in the DNA
replication-repair proteins Rfc1, Pol
, and Pol
(14).
Although it remains possible that an increased dosage of
RAD24 could rescue the rfc5-1 defect in DNA
replication or DNA repair, the strongest evidence for a functional
interaction between RFC5 and RAD24 in the
checkpoint comes from the analysis of double mutants. rfc5-1
rad24
mutants were more defective for the replication block
checkpoint than were single rfc5-1 mutants. Of
particular note, at a temperature that does not affect DNA replication,
neither single mutant exhibited the checkpoint defect, yet the double
mutant was defective for the checkpoint. It is therefore less possible
that the observed checkpoint defect results from a general
disturbance of the whole DNA replication apparatus.
One plausible explanation of the RFC5-RAD24 interaction is
that these two genes function redundantly in the same checkpoint pathways but that the function of RAD24 is modest
relative to that of RFC5 in the replication block
checkpoint. The additive defect in the replication block checkpoint in
the double mutants suggests that rfc5-1 mutants may
still have some residual checkpoint activity at the restrictive
temperature due to the leakiness of the conditional mutation. Another
explanation of the RFC5-RAD24 interaction is that
RAD24 and RFC5 function in different but
overlapping checkpoint pathways and that an increased dosage of
RAD24 can compensate for loss of function of
RFC5. For example, the signal that induces the
RFC5-mediated checkpoint pathway differs from the signal
that induces the RAD24-mediated checkpoint pathway; RFC5 may be involved primarily in recognizing the primer
terminus and monitoring stalled DNA replication, whereas
RAD24 might be required for recognizing the aberrant
DNA structures resulting from DNA replication delay.
RAD24 has been shown to play a role in all known DNA damage
checkpoint controls in the G1, S, and G2/M
phases. It has been demonstrated that the Rad53 protein kinase is
phosphorylated in response to DNA damage, and thus, this
biochemical modification correlates with the activation of the
checkpoint pathway. We have shown that rfc5-1 mutants
are sensitive to DNA damage and defective for the phosphorylation of
Rad53 in response to DNA damage. Similar to rfc5-1,
rad24
was defective for the phosphorylation of Rad53 in
response to DNA damage. Overexpression of RAD24 partially
suppressed the DNA damage sensitivity and restored the phosphorylation
of Rad53 in rfc5-1 mutants. These observations are
consistent with our finding that Rfc5 and Rad24 interact physically and
regulate the DNA damage checkpoint pathway. Lydall and Weinert
(13) showed that the functions of RAD17,
RAD24, and MEC3 in response to DNA damage are
genetically indistinguishable and proposed that these genes play
similar roles in DNA damage processing directly linked to
the checkpoint control in S. cerevisiae. We are
now examining the interaction of RFC5 with RAD17
and MEC3 in the checkpoint control.
The observations presented here provide evidence indicating that the
interaction between RFC5 and RAD24 is linked with
the checkpoint pathway in the budding yeast. However, it remains to be
precisely determined how RFC5 and RAD24 are
involved in the checkpoint signal transduction. Further experiments
will be aimed at elucidating the biochemical properties of the
RFC-Rad24 complex and its interaction with the other components in the
checkpoint pathway.
 |
ACKNOWLEDGMENTS |
We thank A. Sugino and T. Weinert for materials and H. Araki, C. Brenner, A. Carr, T. Enoch, M. Lamphier, Y. Nakaseko,
and R. Ruggieri for helpful discussions and suggestions. K.S. is
especially indebted to Kay Sullivan, who passed away during this work,
for encouragement and advice.
This work was supported by a Grant-in-Aid for Scientific Research on
Priority Areas and General Research from the Ministry of Education,
Science, Sports and Culture of Japan (to K.M. and K.S.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Biological Science, Graduate School of Science, Nagoya University,
Chikusa-ku, Nagoya 464-0814, Japan. Phone: 81-52-789-2593. Fax:
81-52-789-2589. E-mail:
g44177a{at}nucc.cc.nagoya-u.ac.up.
 |
REFERENCES |
| 1.
|
Allen, J. B.,
Z. Zhou,
W. Siede,
E. C. Friedberg, and S. J. Elledge.
1994.
The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast.
Genes Dev.
8:2416-2428[Abstract/Free Full Text].
|
| 2.
|
Burgers, P. M. J.
1991.
Saccharomyces cerevisiae replication factor C. II. Formation and activity of complexes with the proliferating cell nuclear antigen and with DNA polymerase and .
J. Biol. Chem.
266:22698-22706[Abstract/Free Full Text].
|
| 3.
|
Cullmann, G.,
K. Fien,
R. Kobayashi, and B. Stillman.
1995.
Characterization of the five replication factor C genes of Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:4661-4671[Abstract].
|
| 4.
|
Elledge, S. J.
1996.
Cell cycle checkpoints: preventing an identity crisis.
Science
274:1664-1672[Abstract/Free Full Text].
|
| 5.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[Medline].
|
| 6.
|
Griffiths, J. F.,
N. C. Barbet,
S. McCready,
A. R. Lehmann, and A. M. Carr.
1995.
Fission yeast rad17; a homologue of budding yeast RAD24 that shares regions of sequence similarity with DNA polymerase accessory proteins.
EMBO J.
14:5812-5823[Medline].
|
| 7.
|
Hartwell, L. H., and T. A. Weinert.
1989.
Checkpoints: controls that ensure the order of cell cycle events.
Science
246:229-234.
|
| 8.
|
Kaiser, C.,
S. Michaelis, and A. Mitchell.
1994.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 9.
|
Kato, R., and H. Ogawa.
1994.
An essential gene, ESR1, is required for mitotic cell growth, DNA repair, and meiotic recombination in Saccharomyces cerevisiae.
Nucleic Acids Res.
22:3104-3112[Abstract/Free Full Text].
|
| 10.
|
Lee, S.-H.,
A. D. Kwong,
Z.-Q. Pan, and J. Hurwitz.
1991.
Studies on the activator 1 protein complex, an accessory factor for proliferating cell nuclear antigen-dependent DNA polymerase .
J. Biol. Chem.
266:594-602[Abstract/Free Full Text].
|
| 11.
|
Longhese, M. P.,
R. Fraschini,
P. Plevani, and G. Lucchini.
1996.
Yeast pip3/mec3 mutants fail to delay entry into S phase and to slow down DNA replication in response to DNA damage, and they define a functional link between Mec3 and DNA primase.
Mol. Cell. Biol.
16:3235-3244[Abstract].
|
| 12.
|
Longhese, M. P.,
V. Paciotti,
R. Fraschini,
R. Zaccarini,
P. Plevani, and G. Lucchini.
1997.
The novel DNA damage checkpoint protein Ddc1p is phosphorylated periodically during the cell cycle and in response to DNA damage in budding yeast.
EMBO J.
17:5216-5226.
|
| 13.
|
Lydall, D., and T. Weinert.
1995.
Yeast checkpoint genes in DNA damage processing: implications for repair and arrest.
Science
270:1488-1491[Abstract/Free Full Text].
|
| 14.
|
Lydall, D., and T. Weinert.
1997.
G2/M checkpoint genes of Saccharomyces cerevisiae: further evidence for roles in DNA replication and/or repair.
Mol. Gen. Genet.
256:638-651[Medline].
|
| 15.
|
Navas, T. A.,
Y. Sanchez, and S. J. Elledge.
1996.
RAD9 and DNA polymerase form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae.
Genes Dev.
10:2632-2643[Abstract/Free Full Text].
|
| 16.
|
Navas, T. A.,
Z. Zhou, and S. J. Elledge.
1995.
DNA polymerase links the DNA replication machinery to the S phase checkpoint.
Cell
80:29-39[Medline].
|
| 17.
|
Paulovich, A. G.,
R. U. Margulies,
B. M. Garvik, and L. H. Hartwell.
1997.
RAD9, RAD17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage.
Genetics
145:45-62[Abstract].
|
| 18.
|
Paulovich, A. G.,
D. P. Toczyski, and L. H. Harwell.
1997.
When checkpoints fail.
Cell
88:315-321[Medline].
|
| 19.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 20.
|
Sanchez, Y.,
B. A. Desany,
W. J. Jones,
Q. Liu,
B. Wang, and S. J. Elledge.
1996.
Regulation of RAD53 by the ATM-like kinase MEC1 and TEL1 in yeast cell cycle checkpoint pathways.
Science
271:357-360[Abstract].
|
| 21.
|
Savitsky, K.,
A. Bar-Shira,
S. Gilad,
G. Rotman,
Y. Ziv,
L. Vanagaite,
D. A. Tagle,
S. Smith,
T. Uziel,
S. Sfez,
M. Ashkenazi,
I. Pecker,
M. Frydman,
R. Harnik,
S. R. Patanajali,
A. Simmons,
G. A. Clines,
A. Sartiel,
R. A. Gatti,
L. Chessa,
O. Sanal,
M. F. Lavin,
N. G. J. Jaspers,
A. M. R. Taylor,
C. F. Arlett,
T. Miki,
S. M. Weissman,
M. Lovett,
F. S. Collins, and Y. Shiloh.
1995.
A single ataxia telangiectasia gene with a product similar to PI-3 kinase.
Science
268:1749-1753[Abstract/Free Full Text].
|
| 22.
|
Siede, W.,
A. S. Friedberg,
I. Dianova, and E. C. Friedberg.
1994.
Characterization of G1 checkpoint control in the yeast Saccharomyces cerevisiae following exposure to DNA-damaging agent.
Genetics
138:271-281[Abstract].
|
| 23.
|
Siede, W.,
A. S. Friedberg, and E. C. Friedberg.
1993.
RAD9-dependent G1 arrest defines a second checkpoint for damaged DNA in the cell cycle of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
90:7985-7989[Abstract/Free Full Text].
|
| 24.
|
Siede, W.,
G. Nusspaumer,
V. Portillo,
R. Rodriguez, and E. C. Friedberg.
1996.
Cloning and characterization of RAD17, a gene controlling cell cycle responses to DNA damage in Saccharomyces cerevisiae.
Nucleic Acids Res.
24:1669-1675[Abstract/Free Full Text].
|
| 25.
|
Stern, D. F.,
P. Zheng,
D. R. Beidler, and C. Zerillo.
1991.
Spk1, a new kinase from Saccharomyces cerevisiae, phosphorylates proteins on serine, threonine, and tyrosine.
Mol. Cell. Biol.
13:3744-3755[Abstract/Free Full Text].
|
| 26.
|
Sugimoto, K.,
S. Ando,
T. Shimomura, and K. Matsumoto.
1997.
Rfc5, replication factor C component, is required for regulation of Rad53 protein kinase in the yeast checkpoint pathway.
Mol. Cell. Biol.
17:5905-5914[Abstract].
|
| 27.
|
Sugimoto, K.,
Y. Sakamoto,
O. Takahashi, and K. Matsumoto.
1995.
HYS2, an essential gene required for DNA replication in Saccharomyces cerevisiae.
Nucleic Acids Res.
23:3493-3500[Abstract/Free Full Text].
|
| 28.
|
Sugimoto, K.,
T. Shimomura,
K. Hashimoto,
H. Araki,
A. Sugino, and K. Matsumoto.
1996.
Rfc5, a small subunit of replication factor C complex, couples DNA replication and mitosis in budding yeast.
Proc. Natl. Acad. Sci. USA
93:7048-7052[Abstract/Free Full Text].
|
| 29.
|
Sun, Z.,
D. S. Fay,
F. Marini,
M. Foiani, and D. F. Stern.
1996.
Spk1/Rad53 is regulated by Mec1-dependent protein phosphorylation in DNA replication and damage checkpoint pathways.
Genes Dev.
10:395-406[Abstract/Free Full Text].
|
| 30.
|
Tsurimoto, T., and B. Stillman.
1991.
Replication factors required for SV40 DNA replication in vitro. I. DNA structure specific recognition of a primer-template junction by eucaryotic DNA polymerases and their accessory factors.
J. Biol. Chem.
266:1950-1960[Abstract/Free Full Text].
|
| 31.
|
Weinert, T. A., and L. H. Hartwell.
1988.
The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae.
Science
241:317-322[Abstract/Free Full Text].
|
| 32.
|
Weinert, T. A., and L. H. Hartwell.
1993.
Cell cycle arrest of cdc mutants and specificity of the RAD9 checkpoint.
Genetics
134:63-80[Abstract].
|
| 33.
|
Weinert, T. A.,
G. L. Kiser, and L. H. Hartwell.
1994.
Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair.
Genes Dev.
8:652-665[Abstract/Free Full Text].
|
| 34.
|
Yoder, B. L., and P. M. Burgers.
1991.
Saccharomyces cerevisiae replication factor C. I. Purification and characterization of its ATPase activity.
J. Biol. Chem.
266:22689-22697[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 1998, p. 5485-5491, Vol. 18, No. 9
0270-7306/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Komata, M., Bando, M., Araki, H., Shirahige, K.
(2009). The Direct Binding of Mrc1, a Checkpoint Mediator, to Mcm6, a Replication Helicase, Is Essential for the Replication Checkpoint against Methyl Methanesulfonate-Induced Stress. Mol. Cell. Biol.
29: 5008-5019
[Abstract]
[Full Text]
-
Celic, I., Verreault, A., Boeke, J. D.
(2008). Histone H3 K56 Hyperacetylation Perturbs Replisomes and Causes DNA Damage. Genetics
179: 1769-1784
[Abstract]
[Full Text]
-
Yao, N. Y., Johnson, A., Bowman, G. D., Kuriyan, J., O'Donnell, M.
(2006). Mechanism of Proliferating Cell Nuclear Antigen Clamp Opening by Replication Factor C. J. Biol. Chem.
281: 17528-17539
[Abstract]
[Full Text]
-
Kim, J., Robertson, K., Mylonas, K. J. L., Gray, F. C., Charapitsa, I., MacNeill, S. A.
(2005). Contrasting effects of Elg1-RFC and Ctf18-RFC inactivation in the absence of fully functional RFC in fission yeast. Nucleic Acids Res
33: 4078-4089
[Abstract]
[Full Text]
-
Munshi, A., Cannella, D., Brickner, H., Salles-Passador, I., Podust, V., Fotedar, R., Fotedar, A.
(2003). Cell Cycle-dependent Phosphorylation of the Large Subunit of Replication Factor C (RF-C) Leads to Its Dissociation from the RF-C Complex. J. Biol. Chem.
278: 48467-48473
[Abstract]
[Full Text]
-
Jones, R. E., Chapman, J. R., Puligilla, C., Murray, J. M., Car, A. M., Ford, C. C., Lindsay, H. D.
(2003). XRad17 Is Required for the Activation of XChk1 But Not XCds1 during Checkpoint Signaling in Xenopus. Mol. Biol. Cell
14: 3898-3910
[Abstract]
[Full Text]
-
Kenna, M. A., Skibbens, R. V.
(2003). Mechanical Link between Cohesion Establishment and DNA Replication: Ctf7p/Eco1p, a Cohesion Establishment Factor, Associates with Three Different Replication Factor C Complexes. Mol. Cell. Biol.
23: 2999-3007
[Abstract]
[Full Text]
-
Majka, J., Burgers, P. M. J.
(2003). Yeast Rad17/Mec3/Ddc1: A sliding clamp for the DNA damage checkpoint. Proc. Natl. Acad. Sci. USA
100: 2249-2254
[Abstract]
[Full Text]
-
IJpma, A. S., Greider, C. W.
(2003). Short Telomeres Induce a DNA Damage Response in Saccharomyces cerevisiae. Mol. Biol. Cell
14: 987-1001
[Abstract]
[Full Text]
-
Stokes, M. P., Van Hatten, R., Lindsay, H. D., Michael, W. M.
(2002). DNA replication is required for the checkpoint response to damaged DNA in Xenopus egg extracts. JCB
158: 863-872
[Abstract]
[Full Text]
-
Unsal-Kacmaz, K., Makhov, A. M., Griffith, J. D., Sancar, A.
(2002). Preferential binding of ATR protein to UV-damaged DNA. Proc. Natl. Acad. Sci. USA
99: 6673-6678
[Abstract]
[Full Text]
-
Griffith, J. D., Lindsey-Boltz, L. A., Sancar, A.
(2002). Structures of the Human Rad17-Replication Factor C and Checkpoint Rad 9-1-1 Complexes Visualized by Glycerol Spray/Low Voltage Microscopy. J. Biol. Chem.
277: 15233-15236
[Abstract]
[Full Text]
-
Myung, K., Kolodner, R. D.
(2002). Inaugural Article: Suppression of genome instability by redundant S-phase checkpoint pathways in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
99: 4500-4507
[Abstract]
[Full Text]
-
Kondo, T., Wakayama, T., Naiki, T., Matsumoto, K., Sugimoto, K.
(2001). Recruitment of Mec1 and Ddc1 Checkpoint Proteins to Double-Strand Breaks Through Distinct Mechanisms. Science
294: 867-870
[Abstract]
[Full Text]
-
Wang, X., Wang, L., Callister, M. D., Putnam, J. B., Mao, L., Li, L.
(2001). Human Rad17 Is Phosphorylated upon DNA Damage and also Overexpressed in Primary Non-Small Cell Lung Cancer Tissues. Cancer Res.
61: 7417-7421
[Abstract]
[Full Text]
-
Lindsey-Boltz, L. A., Bermudez, V. P., Hurwitz, J., Sancar, A.
(2001). Purification and characterization of human DNA damage checkpoint Rad complexes. Proc. Natl. Acad. Sci. USA
98: 11236-11241
[Abstract]
[Full Text]
-
Naiki, T., Kondo, T., Nakada, D., Matsumoto, K., Sugimoto, K.
(2001). Chl12 (Ctf18) Forms a Novel Replication Factor C-Related Complex and Functions Redundantly with Rad24 in the DNA Replication Checkpoint Pathway. Mol. Cell. Biol.
21: 5838-5845
[Abstract]
[Full Text]
-
Krause, S. A., Loupart, M.-L., Vass, S., Schoenfelder, S., Harrison, S., Heck, M. M. S.
(2001). Loss of Cell Cycle Checkpoint Control in Drosophila Rfc4 Mutants. Mol. Cell. Biol.
21: 5156-5168
[Abstract]
[Full Text]
-
Kim, H.-S., Brill, S. J.
(2001). Rfc4 Interacts with Rpal and Is Required for Both DNA Replication and DNA Damage Checkpoints in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 3725-3737
[Abstract]
[Full Text]
-
Kai, M., Tanaka, H., Wang, T. S.-F.
(2001). Fission Yeast Rad17 Associates with Chromatin in Response to Aberrant Genomic Structures. Mol. Cell. Biol.
21: 3289-3301
[Abstract]
[Full Text]
-
Hanna, J. S., Kroll, E. S., Lundblad, V., Spencer, F. A.
(2001). Saccharomyces cerevisiae CTF18 and CTF4 Are Required for Sister Chromatid Cohesion. Mol. Cell. Biol.
21: 3144-3158
[Abstract]
[Full Text]
-
Wakayama, T., Kondo, T., Ando, S., Matsumoto, K., Sugimoto, K.
(2001). Pie1, a Protein Interacting with Mec1, Controls Cell Growth and Checkpoint Responses in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 755-764
[Abstract]
[Full Text]
-
Naiki, T., Shimomura, T., Kondo, T., Matsumoto, K., Sugimoto, K.
(2000). Rfc5, in Cooperation with Rad24, Controls DNA Damage Checkpoints throughout the Cell Cycle in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 5888-5896
[Abstract]
[Full Text]
-
Gomes, X. V., Gary, S. L., Burgers, P. M. J.
(2000). Overproduction in Escherichia coli and Characterization of Yeast Replication Factor C Lacking the Ligase Homology Domain. J. Biol. Chem.
275: 14541-14549
[Abstract]
[Full Text]
-
Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S. J., Qin, J.
(2000). BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev.
14: 927-939
[Abstract]
[Full Text]
-
Caspari, T., Dahlen, M., Kanter-Smoler, G., Lindsay, H. D., Hofmann, K., Papadimitriou, K., Sunnerhagen, P., Carr, A. M.
(2000). Characterization of Schizosaccharomyces pombe Hus1: a PCNA-Related Protein That Associates with Rad1 and Rad9. Mol. Cell. Biol.
20: 1254-1262
[Abstract]
[Full Text]
-
Griffiths, D, Uchiyama, M, Nurse, P, Wang, T.
(2000). A novel mutant allele of the chromatin-bound fission yeast checkpoint protein Rad17 separates the DNA structure checkpoints. J. Cell Sci.
113: 1075-1088
[Abstract]
-
WEINERT, T., LITTLE, E., SHANKS, L., ADMIRE, A., GARDNER, R., PUTNAM, C., MICHELSON, R., NYBERG, K., SUNDARESHAN, P.
(2000). Details and Concerns Regarding the G2/M DNA Damage Checkpoint in Budding Yeast. Cold Spring Harb Symp Quant Biol
65: 433-442
[Abstract]
-
WEISS, R.S., LEDER, P., ENOCH, T.
(2000). A Conserved Role for the Hus1 Checkpoint Protein in Eukaryotic Genome Maintenance. Cold Spring Harb Symp Quant Biol
65: 457-466
[Abstract]
-
Amin, N. S., Tuffo, K. M., Holm, C.
(1999). Dominant Mutations in Three Different Subunits of Replication Factor C Suppress Replication Defects in Yeast PCNA Mutants. Genetics
153: 1617-1628
[Abstract]
[Full Text]
-
Shimada, M., Okuzaki, D., Tanaka, S., Tougan, T., Tamai, K. K., Shimoda, C., Nojima, H.
(1999). Replication Factor C3 of Schizosaccharomyces pombe, a Small Subunit of Replication Factor C Complex, Plays a Role in Both Replication and Damage Checkpoints. Mol. Biol. Cell
10: 3991-4003
[Abstract]
[Full Text]
-
Kondo, T., Matsumoto, K., Sugimoto, K.
(1999). Role of a Complex Containing Rad17, Mec3, and Ddc1 in the Yeast DNA Damage Checkpoint Pathway. Mol. Cell. Biol.
19: 1136-1143
[Abstract]
[Full Text]
-
Xia, Z., Morales, J. C., Dunphy, W. G., Carpenter, P. B.
(2001). Negative Cell Cycle Regulation and DNA Damage-inducible Phosphorylation of the BRCT Protein 53BP1. J. Biol. Chem.
276: 2708-2718
[Abstract]
[Full Text]
-
Schmidt, S. L. G., Pautz, A. L., Burgers, P. M. J.
(2001). ATP Utilization by Yeast Replication Factor C. IV. RFC ATP-BINDING MUTANTS SHOW DEFECTS IN DNA REPLICATION, DNA REPAIR, AND CHECKPOINT REGULATION. J. Biol. Chem.
276: 34792-34800
[Abstract]
[Full Text]
-
Zhang, H., Zhu, Z., Vidanes, G., Mbangkollo, D., Liu, Y., Siede, W.
(2001). Characterization of DNA Damage-stimulated Self-interaction of Saccharomyces cerevisiae Checkpoint Protein Rad17p. J. Biol. Chem.
276: 26715-26723
[Abstract]
[Full Text]
-
Myung, K., Kolodner, R. D.
(2002). Inaugural Article: Suppression of genome instability by redundant S-phase checkpoint pathways in Saccharomycescerevisiae. Proc. Natl. Acad. Sci. USA
99: 4500-4507
[Abstract]
[Full Text]