Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 261-273, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Multiple Distinct Splicing Enhancers in the
Protein-Coding Sequences of a Constitutively Spliced Pre-mRNA
Thomas D.
Schaal and
Tom
Maniatis*
Department of Molecular and Cellular Biology,
Harvard University, Cambridge, Massachusetts 02138
Received 29 July 1998/Returned for modification 16 September
1998/Accepted 28 September 1998
 |
ABSTRACT |
We have identified multiple distinct splicing enhancer elements
within protein-coding sequences of the constitutively spliced human
-globin pre-mRNA. Each of these highly conserved sequences is
sufficient to activate the splicing of a heterologous
enhancer-dependent pre-mRNA. One of these enhancers is activated by and
binds to the SR protein SC35, whereas at least two others are activated by the SR protein SF2/ASF. A single base mutation within another enhancer element inactivates the enhancer but does not change the
encoded amino acid. Thus, overlapping protein coding and RNA recognition elements may be coselected during evolution. These studies
provide the first direct evidence that SR protein-specific splicing
enhancers are located within the coding regions of constitutively spliced pre-mRNAs. We propose that these enhancers function as multisite splicing enhancers to specify 3' splice-site selection.
 |
INTRODUCTION |
The precise removal of introns from
pre-messenger RNAs (pre-mRNAs) by splicing is a critical step in the
expression of most metazoan genes. This process requires accurate
recognition and pairing of the correct 5' and 3' splice sites by the
splicing machinery (see references 6 and
35 for recent reviews). Inappropriate pairing of
splice sites results in exon skipping and, consequently, the production
of a nonfunctional protein. Weakly conserved sequence elements within
introns are necessary for the splicing reaction but are not sufficient
for splice-site recognition and pairing (33, 37). In vitro
splicing studies using pre-mRNA substrates with competing 5' or 3'
splice sites revealed that exon sequences play a critical role in
splice-site selection (12, 13, 37). However, specific RNA
sequences required for this function have yet to be identified, and the
mechanism by which exon sequences control splice-site selection is not
understood. Similarly, exon sequences were shown to be required for
correct 5' splice-site choice in vivo, but the specific sequences
required were not identified (41).
A significant advance in understanding splice-site recognition was
provided by the observation that mutations in the 5' splice site of a
downstream intron could affect both the splicing efficiency (38,
44) and recognition of the 3' splice site located in the intron
immediately upstream (16, 23, 25). These observations and
the fact that the average size of metazoan exons is highly conserved
(~300 nucleotides [nt] in length) led Berget and her coworkers to
propose the "exon definition" model of splice-site selection
(5). In this model, initial splice-site recognition occurs
through cross-exon interactions between components bound to the 3' and
5' splice sites located at either end of each exon. As initially
formulated, this model did not explain the role of exon sequences in
splice-site recognition since all of the proposed interactions occurred
between factors bound to the splice sites located within the introns
flanking the exon being defined.
Further insights into this problem were provided by the discovery of
constitutive (51) and regulated (47) exonic
splicing enhancer sequences (for reviews see references 2, 14,
21, 30, 35, and 49). These sequences
strongly promote the use of nearby weak 5' or 3' splice sites, and they
can function when inserted within heterologous pre-mRNAs (45, 46,
48, 51). Although most splicing enhancers function only when
located within 100 nt of the affected intron, the regulated splicing
enhancer from the Drosophila doublesex (dsx)
pre-mRNA can act at a distance of at least 500 nt from the affected
intron (48).
Both constitutive (26, 42, 43) and regulated (47)
splicing enhancers contain binding sites for SR proteins, a family of
modular splicing factors bearing one or more RNA recognition motifs
(RRM) and an arginine/serine (RS)-rich region (54) (for reviews, see references 14 and
30). Mutations in either the RRM or RS domains have
an adverse effect on the activity of SR proteins in constitutive
splicing assays (8, 58). The RRM is required for RNA binding
(for a review, see reference 32), whereas the RS
domain is required for protein-protein interactions (3, 24, 52,
53) and proper subnuclear localization (19). The RS
domains can be functionally exchanged between different SR proteins
(9) and can function as activation domains of
enhancer-dependent splicing when fused to a heterologous RNA binding
protein (18). Mechanistic studies of splicing enhancer
function led to the proposal that SR proteins activate splicing by
binding to enhancers and recruiting the splicing machinery to the
adjacent intron (18, 21, 47, 50, 57).
Although splicing enhancers are required for alternative splicing,
similar mechanisms may be employed to ensure accurate splice-site recognition in constitutively spliced pre-mRNAs containing
multiple introns. In fact, exons from constitutively spliced pre-mRNAs can promote 5' and 3' splice-site activity (37, 50), and SR proteins have been shown to associate with constitutive exon sequences (7, 10, 50). Based on these observations, a model for splice recognition in which cross-exon bridging takes place through multiple weak interactions between factors bound to cis-acting
sequences within and adjacent to the exon was proposed (14,
35). In this model, the U1 70-kDa protein bound at the downstream
5' splice site interacts with SR proteins bound to the upstream exon,
which in turn interacts with splicing factors bound to the upstream 3'
splice site. Although this model is consistent with all of the
available data, direct proof that SR proteins bind to specific sequences in the exons of constitutively spliced pre-mRNAs and function
as splicing activators has not been reported.
In this article, we identify and characterize three evolutionarily
conserved splicing enhancer sequences in exon 2 of
-globin pre-mRNA
and show that two of them can be activated by specific SR proteins. A
third enhancer is highly conserved in evolution, and certain mutations
in the third base position of codons within this sequence adversely
affect splicing enhancer function. We conclude that splice-site
selection in constitutively spliced pre-mRNAs requires multiple SR
protein binding sites within exonic protein coding sequences. Thus,
certain RNA sequences in constitutively spliced exons function both as
protein coding and RNA recognition sequences.
 |
MATERIALS AND METHODS |
RNA and DNA oligonucleotides.
The oligonucleotides used in
this study were as follows: oligonucleotide 1 (wild-type 5'-half PCR
primer), 5' GCATCAGGACGGGAGTACTCATTC 3'; oligonucleotide 2 (mutant 5'-half PCR primer), 5' TCTTCAGGACGGGAGTACTCATTC 3';
oligonucleotide 3 (wild-type cDNA splint), 5'
AGCTTGCCCATAACAGCATCAGGACGGGAG 3'; oligonucleotide 4 (mutant cDNA
splint), 5' AGCTTGCCCATAACATCTTCAGGACGGGAG 3';
oligonucleotide 5 (T7 promoter primer), 5'
TGTAATACGACTCACTATAGGG 3'; and RNA oligonucleotide A (3'-half RNA
oligonucleotide [Oligos, Etc.]), 5' UGUUAUGGGCAAGCU 3'.
DNA constructions.
The human
-globin (h
-globin) 3'
truncations were created by linearizing at the unique restriction sites
located within exon 2 of the wild-type h
-globin IVS1 transcription
template (T7-H
[36]). The unique restriction sites
(except for the BanI site) in exon 2 are at positions +14
(AccI), +24 (AvaII), +53 (BstYI), +120
(BanI), +173 (DraIII), and +202 (PmlI)
relative to the 3' splice site. To generate the chimeric
dsx[h
-globin exon 2] construct, a blunted 197-nt
AccI-BamHI fragment comprising most of
h
-globin exon 2 was subcloned into the
HincII-HindIII (blunted) sites of pdsx(RI/FspI) T7 (construct D16 in reference
48 which contains 84 nt of dsx exon 3, the entire 114-nt IVS3, and 65 nt of exon 4 inserted at the
SmaI site of pGEM-7Zf[
]). The resulting construct contains the
-globin exon 2 nt 13 to 209 at a position 30 nt downstream of the dsx 3' splice site. The 3' truncations for
the dsx[h
-globin exon 2] chimeric transcription
template were generated by using restriction sites in exon 2 unique in
the chimeric construct located at
-globin positions +24
(AvaII), +53 (BstYI), +87 (Bsu36I), +173 (DraIII), and +202 (PmlI).
The smaller fragments of h
-globin exon 2 (see Fig. 2) were subcloned
using a similar cloning strategy. The constructs
dsx[h
-globin 50-120] and dsx[h
-globin
117-162] were created by subcloning a blunted 71-nt
BstYI-BanI fragment and a blunted 46-nt
BanI-BanI fragment, respectively, from
h
-globin exon 2 into the HincII-HindIII (blunted) sites of pdsx(RI/FspI) T7. Both
constructs were digested with BamHI prior to transcription.
The dsx[h
-globin 50-87] pre-mRNA was generated by
digesting dsx[h
-globin 50-120] transcription template
with Bsu36I prior to transcription. A similar strategy was
utilized to construct the dsx[exon 1] chimeric pre-mRNAs. A 135-nt blunted HindIII-FokI fragment from
the h
-globin exon 1 was subcloned downstream from the dsx
intron into the HincII-HindIII (blunted)
sites of pdsx(RI/FspI) T7. The full-length exon 1 chimeric transcription template was linearized with BamHI;
the 5'-half exon 1 chimera transcription template was linearized with
Bsu36I. The 3'-half exon 1 chimeric construct was generated
by subcloning a 63-nt blunted Bsu36I-FokI
fragment into the HincII-HindIII (blunted) sites of pdsx(RI/FspI) T7. The 3'-half chimeric
transcription template was linearized with BamHI. All
constructs were sequenced to confirm the correct orientation and
sequences of the inserts.
The
dsx[h

50-68],
dsx[h

59-78], and
dsx[h

69-87] contain overlapping subfragments of the
dsx[h

-globin 50-87] fragment
and were generated by
subcloning annealed oligonucleotides (see
Fig.
3A) (plus a
HindIII overhang) into the
HincII-
HindIII site
of
p
dsx-(RI/
FspI) T7. Similarly, the wild-type nt 63 to 80 sequence
and the mutants 1, 2, 3, 4, and 5 were generated by
subcloning
annealed oligonucleotides encoding the sequences (see Fig.
3B)
into the
HincII-
HindIII site of
p
dsx(RI/
FspI)T7. The
dsx[h

-globin
20-32] and its mutant derivatives were analogously constructed
from
annealed oligonucleotides (see Fig.
5A). Oligonucleotide
sequences are
available upon request. The correct sequences for
all these constructs
were confirmed by sequencing, and all transcription
templates for the
constructs above were digested with
HindIII
before
transcription. The mutant enhancer sequences used for
dsx[h
63-80] mutants 1 and 2 were modeled after
sequences present in
the inert Sa exonic element described in reference
51 and an
inert polypurine sequence described in
reference
45. The
dsx-PRE
and its
properties have been described previously (
22,
28).
In vitro splicing assays.
The gel-purified pre-mRNAs were
assayed for splicing activity by using complete premixed nuclear
extract splicing reactions or complete premixed S100 complementation
reactions requiring only the addition of the individual pre-mRNA
substrate. For each nuclear extract splicing assay, the nuclear extract
(40% [vol/vol]) plus the basic components of the splicing reaction
were premixed before addition of 10 to 20 fmol of
[32P]UTP-labeled pre-mRNA substrate.
The S100 extracts were prepared essentially as described previously
(
1), but with the following two modifications: PMSF
(phenylmethylsulfonyl fluoride) was omitted from the dialysis
buffer,
and the centrifugation (100,000 ×
g) was performed in
a 70 Ti fixed-angle rotor (Beckman). S100 complementation reactions
were performed essentially as described previously (
54)
using
the following ice-cold reagents: 40% (vol/vol) HeLa cell S100
extract in buffer D (
11), 2.6% (vol/vol) PVA (Sigma
P-8136),
3.2 mM MgCl
2, 20 mM creatine phosphate, 1.5 mM
ATP, and 0.25 U
of rRNasin (Promega) per µl. The order of addition of
the reaction
components was S100 extract premixed with cofactors
followed by
the addition of buffer D or the recombinant SR protein
prediluted
in buffer D. These premixed complementation reactions were
aliquoted
into individual reaction tubes, and the
[
32P]UTP-labeled pre-mRNA (10 to 20 fmol) was added to
complete the
reaction. S100 reactions and nuclear extract reactions
were incubated
for 3 h at 30°C. RNAs were deproteinized,
extracted, and precipitated
before resolving on 10% denaturing
polyacrylamide (19:1)-7 M urea-1×
Tris-borate-EDTA gel so that
lariat-exon 4 intermediates could
be resolved from the spliced product.
RNAs were visualized by
autoradiography.
The recombinant SR proteins SC35 and SF2/ASF were expressed and
purified from baculovirus-infected cell lysates under native
conditions
as described previously (
47). Identities and phosphorylation
states of the SR proteins were confirmed (data not shown) by their
immunoreactivity with anti-SC35 monoclonal antisera (gift of Renate
Gattoni and James Stévenin), anti-SF2/ASF monoclonal antisera
(gift of Adrian Krainer), and the phosphoepitope-specific monoclonal
antibody MAb104 (gift of Mark
Roth).
Generation and crosslinking of pre-mRNAs containing a single
labeled phosphate.
The wild-type and mutant pre-mRNAs containing a
single site-specific label were prepared essentially as described
previously (28). The 3'-half RNA oligo A (5'
UGUUAUGGGCAAGCU 3') was synthesized chemically, 5' end-labeled
with [
-32P]ATP, and gel isolated. Transcription
templates for the wild-type and mutant 5'-half RNAs were generated by
PCR using oligonucleotide 1 or oligonucleotide 2, respectively, in
conjunction with the T7 primer (oligonucleotide 5). The wild-type
(primer 1) and mutant (primer 2) PCR primers were designed to encode
the wild type (UGCUGUU) or mutant
(AGAUGUU) at the 3' end of the
5'-half RNA. The wild-type and mutant 5'-half RNAs were transcribed and
gel purified before ligating to the common 3'-half RNA containing the
labeled phosphate with the wild-type (primer 3) and mutant (primer 4)
cDNA splints, respectively (31). The nuclear extract and
S100 complementation reactions were assembled as described above and
incubated under splicing conditions for 30 min (equilibrium binding
conditions as determined for other SR proteins [28]).
UV cross-linking was performed for 10 min on ice at 254 nm (Ultralum
UVC 515) and was followed by RNase A/T1 digestion for 15 min at 30°C. Adducts were resolved by sodium dodecyl sulfate-13%
polyacrylamide gel electrophoresis, fixed, dried, and visualized by autoradiography.
 |
RESULTS |
Identification of h
-globin exon 2 sequences that function as
SC35- or SF2/ASF-dependent splicing enhancers.
To determine
whether exon 2 of h
-globin pre-mRNA contains sequences that function
as SR protein-dependent splicing enhancers, we carried out in vitro
complementation experiments with recombinant SR proteins in S100
extracts (splicing-deficient extracts lacking SR proteins). A series of
exon truncations of h
-globin pre-mRNA were generated by using unique
restriction sites within exon 2. The exon 2 lengths ranged in size from
14 to 202 nt and are indicated in Fig. 1A
as regions A through H (5' to 3', A-H). Each truncation was tested by
using nuclear extracts, S100 extracts complemented with SC35 (Fig. 1B),
or SF2/ASF (Fig. 1C). Consistent with earlier studies (15,
34), the
-globin pre-mRNA is efficiently spliced in nuclear
extracts even if it contains only 14 nt of exon 2 sequence (region A;
Fig. 1B, lane 1). Splicing of the same truncation is activated only
weakly by SC35 in an S100 assay (Fig. 1B, lanes 2 and 3). Similarly, an
RNA containing regions A-B or A-C was only weakly activated by SC35
(Fig. 1B, lanes 5 and 6 and lanes 8 and 9, respectively). In contrast,
the splicing of RNAs containing regions A-E (Fig. 1B, lanes 11 and 12),
A-G (Fig. 1B, lanes 14 and 15), and A-H (Fig. 1B, lanes 17 and 18) was
strongly activated by SC35. These data show that one or more
SC35-dependent splicing activation sequences are present in the DE
region and may or may not be present in the FG and/or H regions.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of SC35- and SF2/ASF-dependent splicing
activators in h -globin exon 2. (A) The -globin substrate is shown
schematically in white and filled boxes. Exon 1, intron 1, exon 2, the
5' splice site, and the 3' splice site are indicated by E1, IVS1, E2,
GU, and AG, respectively. The unique restriction sites (see Materials
and Methods) in exon 2 are at positions +14 (region A), +24 (region
A-B), +53 (region A-C), +120 (region A-E), +173 (region A-G), and +202
(region A-H) relative to the 3' splice site. (B) S100 complementation
assays were performed with recombinant SC35 and the -globin exon 2 truncation pre-mRNA substrate. The complementation assays were
performed with recombinant SR proteins within the linear range of
complementation activity for each protein as determined by titration
reactions with this or other pre-mRNAs (data not shown). The 3' exon
truncation pre-mRNA substrates, designated by the sequence of
h -globin exon 2 included in the pre-mRNA as regions A-H (5' to 3'),
are indicated above the autoradiogram. The RNAs are resolved on a
denaturing 10% polyacrylamide gel, and the positions of precursors,
intermediates, and spliced products are indicated to the left of the
autoradiogram. Stars indicate the positions of the spliced products in
the nuclear extract reactions, and filled circles indicate the
positions of the lariat-exon 2 intermediates in the nuclear extract
reactions. Plus signs indicate nuclear extract or the following
complementation assay components: the -globin pre-mRNA was spliced
in nuclear extract (lanes 1, 4, 7, 10, 13, 16); S100 extract mixed with
buffer D (lanes 2, 5, 8, 11, 14, 17); or S100 extract complemented with
400 ng of recombinant SC35 (lanes 3, 6, 9, 12, 15, 18). (C) S100
complementation assays were performed with 200 ng of recombinant
SF2/ASF and the -globin exon 2 truncation pre-mRNA substrates. The
autoradiogram is labeled similarly to that in panel B. (D) The chimeric
dsx[ -globin exon 2] substrate is shown schematically
with the dsx portion of the chimera shown as the shaded
boxes, E3 and E4, and the -globin exon 2 portion is shown as in
panel A. The dsx exon 3, dsx intron 3, dsx exon 4/ -globin exon 2 chimeric downstream exon, 5'
splice site, and 3' splice site are indicated by E3, IVS3, E4/E2, GU,
and AG, respectively. The ScaI site is located at +21
relative to the dsx 3' splice site within the 30-nt
dsx exon 4. The -globin numbering system used in panel A
is utilized within the -globin portion of the chimera. Unique
restriction sites (see Materials and Methods) in the -globin exon 2 are at positions +24 (region B), +53 (region B-C), +87 (region B-D),
+173 (region B-G), and +202 (region B-H) relative to the 3' splice
site. (E) S100 complementation assays were performed with recombinant
SC35 and the chimeric dsx[ -globin exon 2] pre-mRNA
substrate. The 3' exon truncation substrates, designated by the
sequence of h -globin exon 2 included in the chimeric pre-mRNA, are
indicated above the autoradiogram. Positions of precursors and spliced
products are indicated to the left of the autoradiogram. Stars indicate
the positions of the spliced products in the nuclear extract reactions.
(F) S100 complementation assays were performed with recombinant SF2/ASF
and the chimeric pre-mRNA substrate. The autoradiogram is labeled
similarly to that in panel E.
|
|
A different pattern of splicing activation was observed when the S100
extracts were complemented with SF2/ASF (Fig.
1C). Little
or no
SF2/ASF-dependent splicing activity was observed with RNAs
containing
the regions A (Fig.
1C, lanes 2 and 3), A-B (lanes
5 and 6), A-C (lanes
8 and 9), and A-E (lanes 11 and 12). By contrast,
SF2/ASF did activate
the splicing of RNAs containing regions A-G
(Fig.
1C, lanes 14 and 15)
and A-H (Fig.
1C, lanes 17 and 18).
Thus, region FG and possibly region
H contain an SF2/ASF-dependent
splicing activation sequence. Comparison
of the data in Fig.
1B
and C reveals that region DE contains a sequence
necessary for
efficient activation by SC35. Strong activation was not
observed
with regions A-E with levels of SF2/ASF that strongly activate
other SF2/ASF-dependent enhancer pre-mRNAs (i.e.,
dsx-PRE
[data
not shown] and two exon 2-derived SF2-dependent splicing
enhancers
[see Fig.
2B, lanes 12 and 16]).
To determine whether the regions of h

-globin exon 2 that are
differentially responsive to SC35 and SF2/ASF in their natural
context
can function as splicing enhancers in a heterologous context,
each

-globin exon 3' truncation was analyzed in the context of
an
enhancer-dependent pre-mRNA containing a weak 3' splice site.
Specifically, the h

-globin exon 2 sequences were inserted 30
nt
downstream from the regulated female-specific, weak 3' splice
site of
the
Drosophila melanogaster dsx pre-mRNA (Fig.
1D) and
tested for their ability to activate in vitro splicing in a
heterologous
context.
The
dsx pre-RNA lacking human

-globin exon 2 sequences
was not spliced in nuclear extracts (Fig.
1E and F, lane 1). Insertion
of the B or B-C regions of

-globin exon 2 into the
dsx
RNA resulted
in a low level of splicing in nuclear extracts (Fig.
1E
and F;
compare lanes 4 and 7 to lane 1). Similarly, neither SC35 (Fig.
1E, lanes 6 and 9) nor SF2/ASF (Fig.
1F, lanes 6 and 9) significantly
activated the splicing of
dsx RNAs containing the B or B-C
regions.
By contrast, the splicing of
dsx RNA containing the
B-D regions
of exon 2 was activated by SC35 (Fig.
1E, lanes 11 and 12),
but
not by SF2/ASF (Fig.
1F, lanes 11 and 12). Thus, the B-D region
of

-globin exon 2 functions as an SC35-specific splicing enhancer.
Similarly, regions B-G and B-H, which are required for
SF2/ASF-dependent
splicing of

-globin RNA, function as
SF2/ASF-dependent splicing
enhancers in the
dsx pre-mRNA
(Fig.
1F, lanes 15 and 18, respectively).
Thus, the same regions of
exon 2 that are required for SC35- or
SF2/ASF-dependent splicing of

-globin pre-mRNA can function as
SR protein-dependent splicing
enhancers in the
dsx pre-mRNA.
Subregions of the h

-globin exon 2 shown to be necessary for SC35- or
SF2/ASF-dependent splicing in S100 extracts (Fig.
1)
were tested to
determine whether they are sufficient for SC35-
or SF2/ASF-dependent
splicing in a chimeric
dsx pre-mRNA (Fig.
2A). As shown in Fig.
2, region D of

-globin exon 2 functions
as a potent SC35-dependent enhancer but is
not activated by SF2/ASF
(Fig.
2B, lanes 6 to 8). In contrast, region F
of exon 2 (Fig.
2A) can also function as a potent SF2/ASF-dependent
enhancer,
but it is not activated by SC35 (Fig.
2B, lanes 14 to 16).
Intriguingly,
if region DE (Fig.
2A) is tested in conjunction with
region D,
region DE is activated by both SC35 and SF2/ASF (Fig.
2B,
lanes
10 to 12), indicating that region E contains an SF2/ASF-dependent
enhancer. Consistent with two previous studies on multisite splicing
enhancers (
17,
22), a comparison of the splicing kinetics
using the chimeric
dsx pre-mRNA containing region DE with
SC35
alone, with SF2 alone, or with both SC35 and SF2/ASF indicates
an
additive increase in the rate of splicing when both SR proteins
are
present (data not shown). We conclude that

-globin exon 2
contains
distinct, naturally occurring SC35- and SF2/ASF-dependent
splicing
enhancers that may function as multisite splicing enhancers
in their
natural context (see Discussion).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
Characterization of SC35- and SF2/ASF-dependent splicing
enhancers in exon 2 of h -globin pre-mRNA. (A) The small fragments
necessary for specific activation by SC35 or SF2/ASF were inserted 30 nt downstream of the dsx 3' splice site. The chimeras are
indicated schematically using labeling and nomenclature similar to that
in Fig. 1D. Region D comprises h -globin exon 2 nt 50 to 87, region E
comprises nt 50 to 120, and region F comprises nt 117 to 162. The
different numbering of the -globin exon 2 nt from Fig. 1 reflects
the size of the exonic restriction fragment after Klenow reaction (see
Materials and Methods). (B) S100 complementation assays with
recombinant SC35 and SF2/ASF using dsx pre-mRNA substrates
with various small fragments of -globin exon 2. The h -globin
pre-mRNA used as a control is the wild-type substrate containing 209 nt
of exon. Pre-mRNA substrates are indicated above the autoradiogram. The
figure is labeled similarly to Fig. 1.
|
|
Characterization of an exon 2 SC35-dependent splicing
enhancer.
To precisely localize the sequence within region D
required for SC35-dependent splicing activation, three overlapping
subfragments that span the entire region were tested for activation of
dsx pre-mRNA splicing (Fig.
3A). In nuclear extracts, the middle
fragment (nt 59 to 78) strongly activated splicing, the 5' fragment (nt 50 to 68) moderately activated splicing, and the 3' fragment (nt 69 to
87) was inactive in nuclear extracts (Fig. 3C; compare lane 7 to lanes
4 and 10, respectively). In contrast, only the middle fragment in S100
assays was activated by SC35 (Fig. 3C; compare lane 9 to lanes 6 and
12). Thus, the SC35-dependent enhancer was localized to a 20-nt region
between nt 59 to 78 of
-globin exon 2. Importantly, the SC35
complemented the nt 59 to 78 subfragment and the full-length fragment
(nt 50 to 87) to similar extents (Fig. 3C; compare lanes 9 and 3). We
note that the nt 59 to 78 fragment contains the sequence UGCUGUU, which
conforms to a degenerate consensus sequence deduced from SC35-dependent
splicing enhancers characterized from enhancers isolated by in vitro
selection and amplification (39).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
Characterization of an SC35-dependent splicing enhancer
in exon 2. (A) The dsx[h 50-87] derivatives are
overlapping subfragments of the full-length h -globin exon 2 fragment
comprising nt 50 to 87 (see Fig. 1D and 2A for numbering system; see
also Materials and Methods). The chimeras are indicated schematically
and labeled similarly to those in Fig. 2A. Sequences of the -globin
exon subfragments are shown in capital letters and their relative
positions within the dsx[h 50-87] fragment are
indicated. Polylinker sequences contributed by the vector are indicated
in lowercase letters. (B) The dsx[h 63-80] mutants are
substitution mutants of the UGCUGUU sequence. Mutations
within the putative degenerate heptameric SC35 consensus sequence are
indicated by outlined letters. The chimeras are indicated schematically
and labeled similarly to those in Fig. 3A. (C) S100 complementation
assays with recombinant SC35 using dsx pre-mRNA substrates
with various subfragments of -globin exon 2 nt 50-87 fragment and
mutants of the -globin exon 2 nt 63-80 subfragment were subcloned 30 nt downstream of the dsx 3' splice site. The figure is
labeled similarly to Fig. 1.
|
|
A series of mutants of the UGCUGUU sequence were tested in
both nuclear extracts and the SC35 complementation assays (Fig.
3C; see
Fig.
3B for sequences). Surprisingly, five transversion
substitutions
of the five internal nucleotides in the UGCUGUU
sequence to
UCAGCAU (mutant 1) (Fig.
3B) had little effect on
splicing
efficiency in nuclear extracts (Fig.
3C; compare lanes
13 and 16), but
completely abrogated SC35-dependent splicing in
S100 extracts (Fig.
3C;
compare lanes 15 and 18). These substitutions
may therefore have
created a new enhancer element capable of functioning
in nuclear
extracts but unable to respond to SC35. Alternatively
there may be two
splicing enhancers in the nt 63 to 80 fragment
capable of functioning
in nuclear extracts. In contrast, substitution
of seven adenosines
(mutant 2) for the UGCUGUU sequence abrogated
splicing both
in nuclear extracts and SC35-dependent splicing
in S100 extracts (Fig.
3C; compare lanes 22 to 24 to lanes 19
to 21). Thus, two different
block substitutions in the UGCUGUU
sequence abrogate
SC35-dependent
activation.
To more finely map the sequence requirements of this enhancer, a series
of point mutations within the UGCUGUU sequence was
constructed and tested (see Fig.
3B for sequences). The single
(mutant
3; Fig.
3C, lane 25) and double (mutant 4; Fig.
3C, lane
28) point
mutations had little effect on splicing in nuclear extracts,
and a
modest effect was observed with the triple point mutation
(mutant 5;
Fig.
3C, lane 31). The single point mutation (mutant
3; Fig.
3C, lane
27) also had little effect on SC35-dependent
splicing in S100 assays,
but both the double (mutant 4; Fig.
3C,
lane 30) and triple (mutant 5;
Fig.
3C, lane 33) point mutations
dramatically decreased the level of
SC35-dependent splicing. We
conclude that the sequence UGCUGUU is a
naturally occurring SC35-dependent
splicing
enhancer.
Site-specific cross-linking of SC35 to the SC35-dependent splicing
enhancer.
To determine whether SC35 binds directly to the
UGCUGUU sequence, a dsx pre-mRNA substrate was
created in which a single site-specific 32P label was
introduced within wild-type and mutant SC35-dependent enhancer
sequences (Fig. 4A). Only proteins that
cross-link at or near the labeled phosphate should be visualized as
RNA-protein adducts. A crosslinked protein with a relative mobility
corresponding to an apparent molecular mass of 35 kDa was detected in
nuclear extracts with the pre-mRNA containing the wild-type enhancer
(Fig. 4B, lane 1) but not with the mutant enhancer (Fig. 4B, lane 5). This 35-kDa band was also detected with the wild-type pre-mRNA in S100
extracts complemented with SC35 (Fig. 4B, lane 3), but not in S100
extracts complemented with SF2/ASF (Fig. 4B, lane 4) or in S100
extracts complemented with buffer (Fig. 4B, lane 2). A strong 35-kDa
adduct was not detected in any of the S100 complementation assays with
the mutant version of the enhancer (Fig. 4B, lanes 6, 7, and 8). An
approximately 70-kDa band was observed in both nuclear extracts and
S100 extracts containing the mutant enhancer (Fig. 4B, lanes 5 to 8),
indicating that the sequence change led to increased binding of
another, as yet unidentified, protein. Based on previous studies
showing that splicing-inactive H complexes are bound to hnRNP proteins
(4), it seems likely that this 70-kDa band corresponds to an
hnRNP protein. Based on its size, this protein could be hnRNPI/PTB,
and, in fact, the mutant sequence (AGAUGUU) bears a striking
resemblance to one of the sequences obtained in a SELEX performed on
PTB (AGAUGCC; clone 53.4 [40]). These
results indicate that SC35 directly binds to the wild-type UGC*UGUU
sequence, but not to the loss-of-function mutant version, in
nuclear extracts and in S100 extracts supplemented with SC35. Thus, the
ability of SC35 to bind to the UGCUGUU sequence correlates
with its ability to activate splicing in S100 extracts.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 4.
SC35 specifically cross-links to a wild-type but not a
mutant SC35-dependent splicing enhancer. (A) Chimeric dsx
pre-mRNA substrates with the -globin-derived SC35-dependent enhancer
(dsx[h 63-80] wt), or a double point mutant (dsx[h 63-80]
mut4) that abrogates SC35-dependent complementation activity, were
created with a single site-specific label at a common uridine residue
in the middle of the putative consensus sequence. The position of the
site-specific label (generated using the method of Moore and Sharp
[31]) is located 5' to a uridine indicated by a star,
and the two mutated nt are indicated in outlined lettering. (B) The
wild-type and mutant pre-mRNAs each containing a single site-specific
label at position 70 were incubated under splicing conditions for 30 min before crosslinking and RNase A/T1 digestion. Positions
of the high molecular mass protein standards (Bio-Rad) are indicated to
the right of the autoradiogram. The position of an approximately 35-kDa
RNA-protein adduct is indicated by an arrow. The figure is otherwise
labeled similarly to Fig. 1.
|
|
Identification of an additional splicing enhancer within
-globin
exon 2.
An in vitro selection for functional splicing enhancers
identified a strong splicing enhancer (clone dsx 3-36 [39]) that shares homology with h
-globin exon 2 nt
20 to 32 (overlapping regions B and C). Over the region of shared
homology, clone dsx 3-36 and
-globin exon 2 nt 20 to 32 share 12 of a possible 13 consecutive nt (Fig.
5A). In addition, this region is highly
conserved between the mouse (12 of 13), rabbit (13 of 13), and
h
-globin exon 2 sequences (Fig. 5A), although it should be noted
that in each case the codon usage is the preferred one in mammals.
Interestingly, neither the observed sequence variation in the
dsx 3-36 enhancer sequence nor the one in the mouse
-globin exon 2 occurs at "wobble" positions within the coding
sequence of the protein. We hypothesized that the four consecutive
phylogenetically conserved nt at the wobble positions of this sequence
might be important determinants for sequence-specific binding of
proteins involved in activation of splicing. To test this hypothesis,
we designed a series of single and double-point mutants at the wobble
positions and tested the mutants for splicing enhancer function in
nuclear extracts. The mutants were designed to create conservative
transition mutations that would not change the amino acid sequence
whenever possible.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Characterization of a third splicing enhancer sequence
in exon 2. (A) The phylogenetically conserved sequence at h -globin
exon 2 nt 20-32 is characterized by mutagenesis and sequence homology
to other enhancers. A sequence alignment to its mutant derivatives, the
mouse -globin exon 2 nt 20-32 sequence, and the dsx 3-36 clone (isolated by an in vitro selection [39]) are
shown to the left. The rabbit -globin exon 2 nt 20-32 sequence is
identical to the human sequence and therefore is not shown. Positions
of sequence deviation from the wild-type sequence are indicated in
outlined lettering as in Fig. 3B. Each mutant's predicted effect on
the codon usage at the amino acid level is indicated at the right. Trp,
tryptophan; Stop, UGA stop codon; Thr, threonine; Gln, glutamine; Arg,
arginine; Ser, serine; n/a, not applicable. Tryptophan has only a
single codon, so mutating to create a stop codon was unavoidable. (B)
Wild-type h -globin and the dsx chimeras containing
h -globin exon 2 nt 20 to 32 and its mutant derivatives are
functionally characterized by splicing in nuclear extracts. The figure
is labeled similarly to Fig. 1.
|
|
The
dsx chimera containing the

-globin exon 2 nt 20 to 32 was very efficiently spliced in vitro (Fig.
5B, lane 2). Single
transition point mutants at each of the first three wobble positions
(G22A, C25U, and G28A) had little or no effect on either RNA stability
or splicing efficiency (Fig.
5B; compare lanes 3, 4, and 5 to
lane 2).
However, a single transition point mutation (G31A) at
the fourth wobble
position had a dramatic effect on both the stability
and the splicing
efficiency (Fig.
5B; compare lane 6 to lanes
2 to 5). The effect on RNA
stability is probably a direct consequence
of inefficient spliceosome
complex assembly as previous studies
using the
dsx pre-mRNA
have shown that this substrate is relatively
unstable in splicing
assays in the absence of a strong splicing
enhancer complex (see
references
22,
29, and
48; see
also
Fig.
6B, compare lanes 7 and 10),
and SR proteins and splicing
enhancers stimulate E-complex assembly
with this pre-mRNA (
57)
and other enhancer-dependent
pre-mRNAs (
42). Interestingly,
this transition mutant does
not result in a change in codon usage,
as both the wild-type and mutant
enhancer serve as codons for
arginine, but it has a significant effect
on the splicing efficiency.
Thus, a single base substitution at
position 31 would have no
effect on coding capacity but would
essentially eliminate the
activity of a potent enhancer element.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Characterization of SC35-dependent splicing enhancer in
exon 1 of h -globin pre-mRNA. (A) An almost-full-length fragment of
exon 1 and the 5' and 3' halves of exon 1 were subcloned 30 nt
downstream of the dsx 3' splice site. The dsx
RNAs are indicated schematically using labeling and nomenclature
analogous to that in Fig. 2A. The full-length exon 1 (construct B)
consists of nt 147 to 13 relative to the 5' splice site. The
5'-half exon 1 RNA (construct C) consists of nt 147 to 73, and the
3'-half exon 1 RNA (construct D) consists of nt 75 to 13 plus 10 nt
of polylinker sequence. Differential numbering refers to sizes after
Klenow fill-in reaction of each fragment. The h -globin pre-mRNA
(construct A) is the wild-type substrate. (B) S100 complementation
assays with recombinant SC35 using dsx pre-mRNA substrates
with various fragments of -globin exon 1. The wild-type h -globin
pre-mRNA was used as a positive control. Pre-mRNA substrates are
indicated above the autoradiogram. The figure is labeled similarly to
Fig. 1. (C) The exon 1 tandem duplication constructs of Reed and
Maniatis (37) with a common 3' splice site and two competing
5' splice sites are indicated schematically. The internal 5' splice
site has various lengths of adjacent exon 1, whereas the external 5'
splice site always has a full-length adjacent exon 1. The 5' splice
site utilized in each construct is indicated to the right. The 3' half
of exon 1 in panel A (construct D) is 15 nt shorter at the 5' end and 3 nt longer at the 3' end than the length of the internal exon 1 in the
tandem duplication construct 5'D-90 (37). The differential
lengths are not indicated in the figure in the interest of clarity.
|
|
The
dsx chimeric pre-mRNAs containing double point mutations
at two of the wobble positions were tested in parallel with the
single
point mutations. A double point mutation at both the second
and third
wobble positions (C25U and G28A) resulted in a splicing
efficiency
indistinguishable from that of the wild-type enhancer
(Fig.
5B; compare
lane 7 to lane 2). In contrast, double point
mutants at both the first
and fourth wobble positions (G22A, G31A
or G22A, and G31U) resulted in
an even more severe splicing defect
than the single point mutant G31A
alone (Fig.
5B; compare lanes
8 and 9 to lane 6). Intriguingly, both of
the double point mutants
that mutate position 31 have a greater
splicing defect than a
single point mutation at position 31 alone (Fig.
5B; compare lanes
8 and 9 to lane 6), and, importantly, the seemingly
innocuous
transition mutation at position 22 increases the severity of
the
mutation at position 31. These data show that coding and splicing
enhancer sequences overlap and that single base mutations in positions
that do not alter the coding sequence can have profound effects
on
splicing enhancer
activity.
Characterization of an exon 1 SC35-dependent splicing
enhancer.
To address the question of whether additional
SC35-dependent enhancers are present in the h
-globin pre-mRNA, we
constructed dsx pre-mRNAs with h
-globin exon 1 sequences
downstream of the dsx 3' splice site (Fig.
6A, constructs B, C, and D). Sequences comprising most of exon 1 and both the 5' and 3' halves of exon 1 were
tested for splicing enhancer function in dsx activation assays performed in nuclear extracts and S100 extracts complemented with SC35 (Fig. 6B). Exon sequences immediately upstream of the 5'
splice site known to interact with U5 snRNAs were specifically avoided.
The dsx pre-mRNA containing a full-length
-globin exon 1 is efficiently spliced in nuclear extracts and in SC35 complementation assays (Fig. 6B, lanes 4 to 6; construct B). The 5' half of exon 1 consists mostly of 5' untranslated region, and the 3' half of exon 1 is
primarily protein coding sequence. Only the dsx pre-mRNA encoding the 3' half of exon 1 is efficiently spliced in nuclear extracts and SC35 complementation assays (Fig. 6B, lanes 10 to 12;
construct D). The dsx pre-mRNA encoding the 5' half of exon 1 is a poor substrate both in nuclear extracts and SC35 complementation assays (Fig. 6B, lanes 7 to 9; construct C).
Importantly, the 3' half of exon 1 encodes a good match (UGCCGUU)
to the exon 2 SC35-dependent splicing enhancer (UGCUGUU),
and a potent SC35 enhancer characterized by in vitro selection
(clone 6-38; sequence, UGCCGCC [
39]). The
presence of a functional
SC35-dependent splicing enhancer upstream of a
5' splice site
is consistent with two observations: SR proteins
crosslink upstream
of the adenovirus 5' splice site in E complex
(
10), and the
dsx repeats are functionally
interchangeable at both the regulated
5' splice site in the
fruitless pre-mRNA and the regulated 3'
splice site in the
dsx pre-mRNA (
20). The exonic enhancer sequences
in exon 1, which includes the SC35-dependent enhancer, are functionally
significant as they reside in the portion of the exon 1 sufficient
to
switch the splice site utilization in a pre-mRNA substrate
with tandem
duplications of exon 1 sequences (
37) (see Fig.
6C; see also
Discussion). These results suggest both constitutive
splicing enhancers
(this study) and regulated splicing enhancers
involved in alternative
splicing (
20) can regulate both 5' splice
site activation
and 3' splice site activation in a mechanistically
similar
manner.
 |
DISCUSSION |
In this paper, we provide direct evidence that exons of
constitutively spliced h
-globin pre-mRNAs contain multiple distinct splicing enhancer sequences, and we show that two of these can be
activated by specific SR proteins. An SC35-dependent enhancer found in
region D of exon 2 was localized to a 17-nt element containing the
sequence UGCUGUU. This sequence is an excellent match to the sequence UGCNGYY, which is characteristic of SC35-dependent
splicing enhancers identified in a functional screen of a randomized
pool of sequences by in vitro selection and amplification
(39). Mutagenesis of all seven positions in this exon 2 sequence to adenosines, or a double (positions 1 and 3 to adenosines)
or triple mutant (positions 1, 3, and 5 to adenosines) abrogated
SC35-dependent activation in S100 assays. A direct interaction between
this sequence and SC35 is required for splicing activity, since a
double point mutation that inactivates enhancer-dependent splicing also
abrogates the crosslinking of SC35 to a pre-mRNA containing a single,
site-specific label within the enhancer element.
Additional evidence that the UGCUGUU is an SC35-dependent
enhancer is provided by the observation that highly similar or
identical sequences are present in other pre-mRNAs that respond
specifically to SC35 in different splicing assays. For example, SC35
has been shown to commit the immunoglobulin M C3-C4 pre-mRNA to the
splicing pathway (9), and it contains the C4 exon sequences
UGCUGUG at +20 and UGCUGCC at +31 relative to 3'
splice site. The human immunodeficiency virus tat pre-mRNA
is specifically committed to the splicing pathway by SF2/ASF and does
not contain a sequence similar to the SC35 consensus sequence. In
addition, we have shown that a region of the
-globin exon 1, which
can function as an SC35-dependent splicing enhancer, contains a
good match (UGCCGUU) to the degenerate consensus
sequence for SC35 (39). We conclude that the sequence
UGCUGUU is a bona fide SC35-dependent enhancer element.
The functional significance of the presence of this sequence in exon 2 is suggested by the observation that it is highly conserved among
mammalian
-globin genes. A statistical analysis of the conservation
of the UGCUG sequence in globin genes from 12 different mammalian
organisms revealed a high level of conservation of the sequence at
positions 67 to 71 (55). The mouse
-globin gene has the
sequence UGCUAUC beginning at
position 67, and the rabbit
-globin gene is identical to the
h
-globin exon 2 beginning at position 67 (UGCUGUU).
Although mammalian
-globin coding sequences are highly
conserved in general, the conservation of the UGCUG sequence is
statistically significant relative to other coding sequences in exon 2 (55). If the UGCUGUU is indeed an SC35-dependent splicing enhancer, a prediction would be that this sequence (or degenerate versions of this sequence) would be preferentially found in
exonic sequences relative to intronic sequences. In fact, in a recent
statistical analysis of the most frequently occurring hexameric
sequence motifs found in exon coding sequences (high G + C
content) relative to intron sequences, three of the 20 most frequently
occurring sequence motifs found preferentially in exons were good
matches to the degenerate SC35 consensus sequence UGCNGYY (i.e., [C]UGCAG, [C]UGCUG, and UGCUGC
[56]).
We also detected at least two SF2/ASF-dependent enhancers in the
-globin exon 2 sequences. One of these sequences, present in region
F of exon 2, was localized to a short region that includes the sequence
GGACAA (data not shown). Previous studies showed that
SF2/ASF can cross-link to the Drosophila dsx pre-mRNA
splicing enhancer, dsx-PRE, containing a single
site-specific label at the guanosine residue (marked by the asterisk)
in the sequence AAAG*GACAAA (28). This sequence
has been shown to site-specifically cross-link to SF2/ASF and to be an
SF2-dependent enhancer in two different contexts (22, 39).
Thus, the sequence GGACAA in region F of exon 2 is likely to
be part of an SF2/ASF-dependent splicing enhancer and is in good
agreement with a recently identified degenerate consensus SF2/ASF
sequence isolated in a functional selection for SR-specific splicing
enhancers (27). The putative SF2/ASF binding site
GGACAA shows a significant phylogenetic conservation within
-globin exon 2 sequences; at the analogous position in exon 2, the
mouse
-globin gene sequence is GGACAG, and
the rabbit
-globin gene is a perfect match to the human
-globin sequence.
A third class of splicing enhancer sequence was identified in exon 2 by
its close similarity to a sequence obtained in an in vitro splicing
enhancer selection. The exon 2 sequence, UGGACCCAGAGGU, is
identical in 12 of 13 positions to both the in vitro selected enhancer
3-36 (39) and the corresponding sequence in the mouse
-globin gene. This sequence is identical to the corresponding sequence in the rabbit
-globin gene and is highly conserved in general among mammalian
-globin genes. At present, we have not identified the SR protein(s)-trans-acting factor(s) that
interacts with and activates this splicing enhancer.
It is important to note that identification of the enhancers summarized
in Fig. 7A provides only a minimal estimate of splicing enhancer
sequences present in exon 2. For example, in Fig. 1, we showed that
regions A, B, and C of exon 2 do not contain an SC35- or
SF2/ASF-dependent enhancer, but the A, A-B, and A-C sequences all
function as splicing enhancers in total nuclear extracts. Thus, it is
likely that a number of other splicing enhancers that are specifically
activated by other SR proteins are present in exon 2. We have also
shown that exon 1 of
-globin pre-mRNA can function as a splicing
enhancer downstream of the dsx 3' splice site, and that an
SC35-dependent enhancer resides in the protein coding region of exon 1. Thus, it is likely that the presence of SR protein-specific splicing
enhancers is a general feature of exon sequences.
The role of specific exon sequences in splice site selection.
The results of this study as well as two studies on multisite enhancers
(17, 22) provide a framework for understanding the results
of the cis-competition assays in which the effect of exon 2 deletions on splice-site selection was examined (37). In
this assay, tandem duplications of essentially identical 3' splice
sites and their adjacent exons were tested in cis with a
single 5' splice site (Fig. 7B). Each
precursor contained the normal, full-length exon adjacent to the
external 3' splice site and the normal length exon or various
truncations thereof adjacent to the internal 3' splice site. An
internal exon length of 55 nt resulted in the exclusive use of the
external 3' splice site utilization; a full-length internal exon 2 resulted in exclusive use of the internal 3' splice site (Fig. 7B,
construct 3'D-55). An internal exon length of 115 nt resulted in
predominantly internal 3' splice-site activation (Fig. 7B, construct
3'D-115). Thus, sequences between nt 56 and 115 are necessary to switch
the 3' splice-site utilization from exclusively external to
predominantly internal. Here we have shown this region includes both
the SC35-dependent enhancer and one of the two SF2/ASF-dependent
enhancers. The inclusion of the remainder of exonic sequence in the
internal exon (i.e., to make it full length), including another strong
SF2/ASF-dependent enhancer, results in exclusively internal 3'
splice-site activation (Fig. 7B, construct 3'D-205). Additionally, it
should be noted that the region of exon 2 that contains the strong
splicing enhancer located at nt 20 to 32 is not sufficient to
out-compete the full-length external exon 2 in the
cis-competition assay. Taken together, the results of the
cis-competition assay and this study suggest that naturally
occurring exons require multiple splicing enhancer elements whose
inclusion or exclusion can drastically affect splice-site utilization.
Additionally, the graduated response of internal splice-site activation
in the cis competition (37) as an increasing number of splicing enhancers are included is consistent with the recent
proposal that the function of multisite enhancer elements is to
increase the probability of an interaction between the splicing enhancer complex and the splicing machinery (22).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
The role of -globin exon 2 sequences in accurate
splice-site selection. (A) The constitutively spliced internal exon 2 in the three-exon, two-intron human -globin pre-mRNA is shown. The
hypothetical factor(s) X is shown bound to the phylogenetically
conserved element at nt 20 to 32, SC35 is shown bound to nt 67 to 73, and the two SF2/ASF-dependent enhancers are shown including the one at
nt 145 to 150 (data not shown) which have some homology with a repeated
motif in the PRE (22, 28). Positions of site-specific labels
utilized to demonstrate specific SC35 (this study) and SF2/ASF
(28) cross-linking are indicated with stars. (B) The exon 2 tandem duplication constructs of Reed and Maniatis (37) with
a common 5' splice site and two competing 3' splice sites are indicated
schematically. The internal 3' splice site has various lengths of
adjacent exon 2, whereas the external 3' splice site always has a
full-length adjacent exon 2. The 3' splice site utilized in each
construct is indicated to the right. Positions of the phylogenetically
conserved splicing enhancer (and its hypothetical
trans-acting factor[s] X) at position 20 to 32, the
SC35-dependent enhancer at 67 to 73, and the two SF2/ASF enhancers
found between nt 88 to 120 (region E in Fig. 1) and 117 to 162 (region
F in Fig. 1) are shown relative to the tandem duplication constructs.
The results of this paper, Reed and Maniatis (37), Hertel
and Maniatis (22), and Graveley et al. (17) are
consistent with a role for multisite splicing enhancers within exon 2 influencing splice site selection decisions by increasing the
probability of recruiting the splicing machinery to the exon 2 adjacent
to the 3' splice site to be activated.
|
|
Implications for the exon definition model of splice site
selection.
The data presented here are consistent with a model for
initial splice-site recognition in which multiple protein-RNA and protein-protein interactions between factors bound to the exon and the
5' and 3' splice sites led to the formation of a stable complex.
Although previous studies have shown that SR proteins can interact with
constitutively spliced exon sequences in functional splicing complexes
(10) and in total nuclear extracts (7, 50), none
of these studies demonstrated that these interactions are functional.
Here we identify multiple distinct splicing enhancer sequences in an
exon consisting entirely of protein coding sequences (Fig. 7A). The SR
proteins that recognize these enhancers could bind independently and/or
cooperatively (28). As recently demonstrated (22), the presence of multiple enhancers would increase the probability of an interaction between the bound SR proteins and splicing components bound to the intron.
Coevolution of RNA splicing enhancer and protein coding
sequences?
The fact that the same RNA sequences can function as
codons in protein synthesis and as SR protein-dependent splicing
enhancers suggests that the two functions may have coevolved. However,
the high degree of conservation of
-globin amino acid sequences and strong biases for the use of certain codons in mammals make it difficult to critically evaluate this possibility. An additional problem with the evolutionary conservation model is that the binding specificity of individual SR proteins is not well understood. Although
specific SR protein binding sites have been identified, individual SR
proteins are capable of recognizing a broad spectrum of weakly related
sequences (27, 39). Given these observations and the fact
that exon 2 clearly contains multiple splicing enhancers suggests that
the evolutionary constraints on SR protein binding may be less than
those imposed on coding sequences. A model that is consistent with all
of the data available is that exons must provide a minimal level of
splicing enhancer activity to insure correct splice-site selection, and
this is accomplished by multiple SR protein binding sites. Most single
base mutations would have little effect on the overall splicing
activity, and some could even be compensated for by creating a site now
recognized by another member of the SR protein family. Thus, numerous
base changes that alter the protein coding sequence could occur without
decreasing the level of splicing activity below the critical threshold.
 |
ACKNOWLEDGMENTS |
We thank Brenton Graveley, Klemens Hertel, Bhavin Parekh,
Christopher Sears, Jinghua Yang, and other members of Maniatis lab; and
Kevin Jarrell (Boston University School of Medicine), Kristen W. Lynch
(University of California, San Francisco), Robin Reed (Harvard Medical
School), and Ming Tian (Harvard Medical School) for helpful
discussions, encouragement, and critical comments on the
manuscript. We are grateful to Jim Bruzik (Case Western Reserve
University) for his S100 extract preparation protocol; Renate Gattoni
and James Stévenin (CNRS, Strasbourg, France), Adrian Krainer
(Cold Spring Harbor Laboratory), and Mark Roth (Fred Hutchinson Cancer
Research Center) for monoclonal antibodies/hybridomas; Michael Zhang
(Cold Spring Harbor Laboratory) for communicating unpublished data; and
Dave Smith (Harvard University Biological Laboratories Imaging Center)
for help with figure preparation.
This work was supported by National Institutes of Health grant GM42231
to T.M.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Cellular Biology, Harvard University, 7 Divinity Ave., Cambridge, MA 02138. Phone: (617) 495-1811. Fax: (617) 495-3537. E-mail: maniatis{at}biohp.harvard.edu.
 |
REFERENCES |
| 1.
|
Abmayr, S. M., and J. L. Workman.
1987.
Preparation of nuclear and cytoplasmic extracts from mammalian cells.
In
F. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 2. Greene Publishing Associates and Wiley-Interscience, New York, N.Y.
|
| 2.
|
Adams, M. D.,
D. Z. Rudner, and D. C. Rio.
1996.
Biochemistry and regulation of pre-mRNA splicing.
Curr. Opin. Cell Biol.
8:331-339[Medline].
|
| 3.
|
Amrein, H.,
M. L. Hedley, and T. Maniatis.
1994.
The role of specific protein-RNA and protein-protein interactions in positive and negative control of pre-mRNA splicing by Transformer 2.
Cell
76:735-746[Medline].
|
| 4.
|
Bennett, M.,
S. Pinol-Roma,
D. Staknis,
G. Dreyfuss, and R. Reed.
1992.
Differential binding of heterogeneous nuclear ribonucleoproteins to mRNA precursors prior to spliceosome assembly in vitro.
Mol. Cell. Biol.
12:3165-3175[Abstract/Free Full Text].
|
| 5.
|
Berget, S. M.
1995.
Exon recognition in vertebrate splicing.
J. Biol. Chem.
270:2411-2414[Free Full Text].
|
| 6.
|
Black, D. L.
1995.
Finding splice sites within a wilderness of RNA.
RNA
1:763-771[Medline].
|
| 7.
|
Blencowe, B. J.,
J. A. Nickerson,
R. Issner,
S. Penman, and P. A. Sharp.
1994.
Association of nuclear matrix antigens with exon-containing splicing complexes.
J. Cell Biol.
127:593-607[Abstract/Free Full Text].
|
| 8.
|
Caceres, J. F., and A. R. Krainer.
1993.
Functional analysis of pre-mRNA splicing factor SF2/ASF structural domains.
EMBO J.
12:4715-4726[Medline].
|
| 9.
|
Chandler, S. D.,
A. Mayeda,
J. M. Yeakley,
A. R. Krainer, and X. D. Fu.
1997.
RNA splicing specificity determined by the coordinated action of RNA recognition motifs in SR proteins.
Proc. Natl. Acad. Sci. USA
94:3596-3601[Abstract/Free Full Text].
|
| 10.
|
Chiara, M.D.,
O. Gozani,
M. Bennett,
P. Champion-Arnaud,
L. Palandjian, and R. Reed.
1996.
Identification of proteins that interact with exon sequences, splice sites, and the branchpoint sequence during each stage of spliceosome assembly.
Mol. Cell. Biol.
16:3317-3326[Abstract].
|
| 11.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 12.
|
Dominski, Z., and R. Kole.
1994.
Identification of exon sequences involved in splice site selection.
J. Biol. Chem.
269:23590-23596[Abstract/Free Full Text].
|
| 13.
|
Dominski, Z., and R. Kole.
1991.
Selection of splice sites in pre-mRNAs with short internal exons.
Mol. Cell. Biol.
11:6075-6083[Abstract/Free Full Text].
|
| 14.
|
Fu, X. D.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 15.
|
Furdon, P. J., and R. Kole.
1988.
The length of the downstream exon and the substitution of specific sequences affect pre-mRNA splicing in vitro.
Mol. Cell. Biol.
8:860-866[Abstract/Free Full Text].
|
| 16.
|
Grabowski, P. J.,
F. H. Nasim,
H.-C. Kuo, and R. Burch.
1991.
Combinatorial splicing of exon pairs by two-site binding of U1 small nuclear ribonucleoprotein particle.
Mol. Cell. Biol.
11:5919-5928[Abstract/Free Full Text].
|
| 17.
| Graveley, B., K. Hertel, and T. Maniatis. A
systematic analysis of the factors that determine the strength of
pre-mRNA splicing enhancers. EMBO J., in press.
|
| 18.
|
Graveley, B. R., and T. Maniatis.
1998.
Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing.
Mol. Cell.
1:765-771[Medline].
|
| 19.
|
Hedley, M. L.,
H. Amrein, and T. Maniatis.
1995.
An amino acid sequence motif sufficient for subnuclear localization of an arginine/serine-rich splicing factor.
Proc. Natl. Acad. Sci. USA
92:11524-11528[Abstract/Free Full Text].
|
| 20.
|
Heinrichs, V.,
L. C. Ryner, and B. S. Baker.
1998.
Regulation of sex-specific selection of fruitless 5' sites by transformer and transformer-2.
Mol. Cell. Biol.
18:450-458[Abstract/Free Full Text].
|
| 21.
|
Hertel, K. J.,
K. W. Lynch, and T. Maniatis.
1997.
Common themes in the function of transcription and splicing enhancers.
Curr. Opin. Cell Biol.
9:350-357[Medline].
|
| 22.
|
Hertel, K. J., and T. Maniatis.
1998.
The function of multisite splicing enhancers.
Mol. Cell
1:449-455[Medline].
|
| 23.
|
Hoffman, B. E., and P. J. Grabowski.
1992.
snRNP targets an essential splicing factor, U2AF65, to the 3' splice site by a network of interactions spanning the exon.
Genes Dev.
6:2554-2568[Abstract/Free Full Text].
|
| 24.
|
Kohtz, J. D.,
S. F. Jamison,
C. L. Will,
P. Zuo,
R. Lührmann,
M. A. Garcia-Blanco, and J. L. Manley.
1994.
Protein-protein interactions and 5'-splice-site recognition in mammalian mRNA precursors.
Nature
368:119-124[Medline].
|
| 25.
|
Kuo, H. C.,
F. H. Nasim, and P. J. Grabowski.
1991.
Control of alternative splicing by the differential binding of U1 small nuclear ribonucleoprotein particle.
Science
251:1045-1050[Abstract/Free Full Text].
|
| 26.
|
Lavigueur, A.,
H. La Branche,
A. R. Kornblihtt, and B. Chabot.
1993.
A splicing enhancer in the human fibronectin alternate ED1 exon interacts with SR proteins and stimulates U2 snRNP binding.
Genes Dev.
7:2405-2417[Abstract/Free Full Text].
|
| 27.
|
Liu, H. X.,
M. Zhang, and A. R. Krainer.
1998.
Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins.
Genes Dev.
12:1998-2012[Abstract/Free Full Text].
|
| 28.
|
Lynch, K. W., and T. Maniatis.
1996.
Assembly of specific SR protein complexes on distinct regulatory elements of the Drosophila doublesex splicing enhancer.
Genes Dev.
10:2089-2101[Abstract/Free Full Text].
|
| 29.
|
Lynch, K. W., and T. Maniatis.
1995.
Synergistic interactions between two distinct elements of a regulated splicing enhancer.
Genes Dev.
9:284-293[Abstract/Free Full Text].
|
| 30.
|
Manley, J. L., and R. Tacke.
1996.
SR proteins and splicing control.
Genes Dev.
10:1569-1579[Free Full Text].
|
| 31.
|
Moore, M. J., and P. A. Sharp.
1992.
Site-specific modification of pre-mRNA: the 2'-hydroxyl groups at the splice sites.
Science
256:992-997[Abstract/Free Full Text].
|
| 32.
|
Moras, D., and A. Poterszman.
1995.
RNA-protein interactions. Diverse modes of recognition.
Curr. Biol.
5:249-251[Medline].
|
| 33.
|
Nelson, K. K., and M. R. Green.
1988.
Splice site selection and ribonucleoprotein complex assembly during in vitro pre-mRNA splicing.
Genes Dev.
2:319-329[Abstract/Free Full Text].
|
| 34.
|
Parent, A.,
S. Zeitlin, and A. Efstratiadis.
1987.
Minimal exon sequence requirements for efficient in vitro splicing of mono-intronic nuclear pre-mRNA.
J. Biol. Chem.
262:11284-11291[Abstract/Free Full Text].
|
| 35.
|
Reed, R.
1996.
Initial splice-site recognition and pairing during pre-mRNA splicing.
Curr. Opin. Genet. Dev.
6:215-220[Medline].
|
| 36.
|
Reed, R.,
J. Griffith, and T. Maniatis.
1988.
Purification and visualization of native spliceosomes.
Cell
53:949-961[Medline].
|
| 37.
|
Reed, R., and T. Maniatis.
1986.
A role for exon sequences and splice-site proximity in splice-site selection.
Cell
46:681-690[Medline].
|
| 38.
|
Robberson, B. L.,
G. J. Cote, and S. M. Berget.
1990.
Exon definition may facilitate splice site selection in RNAs with multiple exons.
Mol. Cell. Biol.
10:84-94[Abstract/Free Full Text].
|
| 39.
| Schaal, T. D., and T. Maniatis. Unpublished
data.
|
| 40.
|
Singh, R.,
J. Valcarcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 41.
|
Somasekhar, M. B., and J. E. Mertz.
1985.
Exon mutations that affect the choice of splice sites used in processing the SV40 late transcripts.
Nucleic Acids Res.
13:5591-5609[Abstract/Free Full Text].
|
| 42.
|
Staknis, D., and R. Reed.
1994.
SR proteins promote the first specific recognition of pre-mRNA and are present together with the U1 small nuclear ribonucleoprotein particle in a general splicing enhancer complex.
Mol. Cell. Biol.
14:7670-7682[Abstract/Free Full Text].
|
| 43.
|
Sun, Q.,
A. Mayeda,
R. K. Hampson,
A. R. Krainer, and F. M. Rottman.
1993.
General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer.
Genes Dev.
7:2598-2608[Abstract/Free Full Text].
|
| 44.
|
Talerico, M., and S. M. Berget.
1990.
Effect of 5' splice site mutations on splicing of the preceding intron.
Mol. Cell. Biol.
10:6299-6305[Abstract/Free Full Text].
|
| 45.
|
Tanaka, K.,
A. Watakabe, and Y. Shimura.
1994.
Polypurine sequences within a downstream exon function as a splicing enhancer.
Mol. Cell. Biol.
14:1347-1354[Abstract/Free Full Text].
|
| 46.
|
Tian, M., and T. Maniatis.
1992.
Positive control of pre-mRNA splicing in vitro.
Science
256:237-240[Abstract/Free Full Text].
|
| 47.
|
Tian, M., and T. Maniatis.
1993.
A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA.
Cell
74:105-114[Medline].
|
| 48.
|
Tian, M., and T. Maniatis.
1994.
A splicing enhancer exhibits both constitutive and regulated activities.
Genes Dev.
8:1703-1712[Abstract/Free Full Text].
|
| 49.
|
Wang, J., and J. L. Manley.
1997.
Regulation of pre-mRNA splicing in metazoa.
Curr. Opin. Genet. Dev.
7:205-211[Medline].
|
| 50.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 51.
|
Watakabe, A.,
K. Tanaka, and Y. Shimura.
1993.
The role of exon sequences in splice site selection.
Genes Dev.
7:407-418[Abstract/Free Full Text].
|
| 52.
|
Wu, J. Y., and T. Maniatis.
1993.
Specific interactions between proteins implicated in splice site selection and regulated alternative splicing.
Cell
75:1061-1070[Medline].
|
| 53.
|
Xiao, S. H., and J. L. Manley.
1997.
Phosphorylation of the ASF/SF2 RS domain affects both protein-protein and protein-RNA interactions and is necessary for splicing.
Genes Dev.
11:334-344[Abstract/Free Full Text].
|
| 54.
|
Zahler, A. M.,
W. S. Lane,
J. A. Stolk, and M. B. Roth.
1992.
SR proteins: a conserved family of pre-mRNA splicing factors.
Genes Dev.
6:837-847[Abstract/Free Full Text].
|
| 55.
| Zhang, M. Q. Personal communication.
|
| 56.
|
Zhang, M. Q.
1998.
Statistical features of human exons and their flanking regions.
Hum. Mol. Genet.
7:919-932[Abstract/Free Full Text].
|
| 57.
|
Zuo, P., and T. Maniatis.
1996.
The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing.
Genes Dev.
10:1356-1368[Abstract/Free Full Text].
|
| 58.
|
Zuo, P., and J. L. Manley.
1993.
Functional domains of the human splicing factor ASF/SF2.
EMBO J.
12:4727-4737[Medline].
|
Molecular and Cellular Biology, January 1999, p. 261-273, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Seli, E., Yaba, A., Guzeloglu-Kayisli, O., Lalioti, M. D.
(2008). Alternative splicing of the mouse embryonic poly(A) binding protein (Epab) mRNA is regulated by an exonic splicing enhancer: a model for post-transcriptional control of gene expression in the oocyte. Mol Hum Reprod
14: 393-398
[Abstract]
[Full Text]
-
Wang, Z., Burge, C. B.
(2008). Splicing regulation: From a parts list of regulatory elements to an integrated splicing code. RNA
14: 802-813
[Abstract]
[Full Text]
-
Hertel, K. J.
(2008). Combinatorial Control of Exon Recognition. J. Biol. Chem.
283: 1211-1215
[Abstract]
[Full Text]
-
Raponi, M., Baralle, F. E., Pagani, F.
(2007). Reduced splicing efficiency induced by synonymous substitutions may generate a substrate for natural selection of new splicing isoforms: the case of CFTR exon 12. Nucleic Acids Res
35: 606-613
[Abstract]
[Full Text]
-
Sciabica, K. S., Hertel, K. J.
(2006). The splicing regulators Tra and Tra2 are unusually potent activators of pre-mRNA splicing. Nucleic Acids Res
34: 6612-6620
[Abstract]
[Full Text]
-
Szeszel-Fedorowicz, W., Talukdar, I., Griffith, B. N., Walsh, C. M., Salati, L. M.
(2006). An Exonic Splicing Silencer Is Involved in the Regulated Splicing of Glucose 6-Phosphate Dehydrogenase mRNA. J. Biol. Chem.
281: 34146-34158
[Abstract]
[Full Text]
-
Smith, P. J., Zhang, C., Wang, J., Chew, S. L., Zhang, M. Q., Krainer, A. R.
(2006). An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet
15: 2490-2508
[Abstract]
[Full Text]
-
Watermann, D. O., Tang, Y., zur Hausen, A., Jager, M., Stamm, S., Stickeler, E.
(2006). Splicing Factor Tra2-{beta}1 Is Specifically Induced in Breast Cancer and Regulates Alternative Splicing of the CD44 Gene.. Cancer Res.
66: 4774-4780
[Abstract]
[Full Text]
-
LENASI, T., PETERLIN, B. M., DOVC, P.
(2006). Distal regulation of alternative splicing by splicing enhancer in equine {beta}-casein intron 1. RNA
12: 498-507
[Abstract]
[Full Text]
-
McVety, S, Li, L, Gordon, P H, Chong, G, Foulkes, W D
(2006). Disruption of an exon splicing enhancer in exon 3 of MLH1 is the cause of HNPCC in a Quebec family. J. Med. Genet.
43: 153-156
[Abstract]
[Full Text]
-
Xu, D.-Q., Mattox, W.
(2006). Identification of a splicing enhancer in MLH1 using COMPARE, a new assay for determination of relative RNA splicing efficiencies. Hum Mol Genet
15: 329-336
[Abstract]
[Full Text]
-
Isshiki, M., Tsumoto, A., Shimamoto, K.
(2006). The Serine/Arginine-Rich Protein Family in Rice Plays Important Roles in Constitutive and Alternative Splicing of Pre-mRNA. Plant Cell
18: 146-158
[Abstract]
[Full Text]
-
Tong, A., Nguyen, J., Lynch, K. W.
(2005). Differential Expression of CD45 Isoforms Is Controlled by the Combined Activity of Basal and Inducible Splicing-regulatory Elements in Each of the Variable Exons. J. Biol. Chem.
280: 38297-38304
[Abstract]
[Full Text]
-
Siegel, T. N., Tan, K. S. W., Cross, G. A. M.
(2005). Systematic Study of Sequence Motifs for RNA trans Splicing in Trypanosoma brucei. Mol. Cell. Biol.
25: 9586-9594
[Abstract]
[Full Text]
-
Cebrian, A., Lesueur, F., Martin, S., Leyland, J., Ahmed, S., Luccarini, C., Smith, P. L., Luben, R., Whittaker, J., Pharoah, P. D., Dunning, A. M., Ponder, B. A. J.
(2005). Polymorphisms in the Initiators of RET (Rearranged during Transfection) Signaling Pathway and Susceptibility to Sporadic Medullary Thyroid Carcinoma. J. Clin. Endocrinol. Metab.
90: 6268-6274
[Abstract]
[Full Text]
-
McAlinden, A., Havlioglu, N., Liang, L., Davies, S. R., Sandell, L. J.
(2005). Alternative Splicing of Type II Procollagen Exon 2 Is Regulated by the Combination of a Weak 5' Splice Site and an Adjacent Intronic Stem-loop Cis Element. J. Biol. Chem.
280: 32700-32711
[Abstract]
[Full Text]
-
Wang, J., Smith, P. J., Krainer, A. R., Zhang, M. Q.
(2005). Distribution of SR protein exonic splicing enhancer motifs in human protein-coding genes. Nucleic Acids Res
33: 5053-5062
[Abstract]
[Full Text]
-
Baek, D., Green, P.
(2005). Sequence conservation, relative isoform frequencies, and nonsense-mediated decay in evolutionarily conserved alternative splicing. Proc. Natl. Acad. Sci. USA
102: 12813-12818
[Abstract]
[Full Text]
-
Zhang, X. H.-F., Kangsamaksin, T., Chao, M. S. P., Banerjee, J. K., Chasin, L. A.
(2005). Exon Inclusion Is Dependent on Predictable Exonic Splicing Enhancers. Mol. Cell. Biol.
25: 7323-7332
[Abstract]
[Full Text]
-
Lewandowska, M. A., Stuani, C., Parvizpur, A., Baralle, F. E., Pagani, F.
(2005). Functional studies on the ATM intronic splicing processing element. Nucleic Acids Res
33: 4007-4015
[Abstract]
[Full Text]
-
Zhang, X. H-F., Leslie, C. S., Chasin, L. A.
(2005). Dichotomous splicing signals in exon flanks. Genome Res
15: 768-779
[Abstract]
[Full Text]
-
Pagani, F., Raponi, M., Baralle, F. E.
(2005). Synonymous mutations in CFTR exon 12 affect splicing and are not neutral in evolution. Proc. Natl. Acad. Sci. USA
102: 6368-6372
[Abstract]
[Full Text]
-
Black, D. L.
(2005). A simple answer for a splicing conundrum. Proc. Natl. Acad. Sci. USA
102: 4927-4928
[Full Text]
-
Ibrahim, E. C., Schaal, T. D., Hertel, K. J., Reed, R., Maniatis, T.
(2005). From the Cover: Serine/arginine-rich protein-dependent suppression of exon skipping by exonic splicing enhancers. Proc. Natl. Acad. Sci. USA
102: 5002-5007
[Abstract]
[Full Text]
-
Yang, G., Huang, S.-C., Wu, J. Y., Benz, E. J. Jr
(2005). An erythroid differentiation-specific splicing switch in protein 4.1R mediated by the interaction of SF2/ASF with an exonic splicing enhancer. Blood
105: 2146-2153
[Abstract]
[Full Text]
-
Webb, C. J., Romfo, C. M., van Heeckeren, W. J., Wise, J. A.
(2005). Exonic splicing enhancers in fission yeast: functional conservation demonstrates an early evolutionary origin. Genes Dev.
19: 242-254
[Abstract]
[Full Text]
-
Arrisi-Mercado, P., Romano, M., Muro, A. F., Baralle, F. E.
(2004). An Exonic Splicing Enhancer Offsets the Atypical GU-rich 3' Splice Site of Human Apolipoprotein A-II Exon 3. J. Biol. Chem.
279: 39331-39339
[Abstract]
[Full Text]
-
Conde, L., Vaquerizas, J. M., Santoyo, J., Al-Shahrour, F., Ruiz-Llorente, S., Robledo, M., Dopazo, J.
(2004). PupaSNP Finder: a web tool for finding SNPs with putative effect at transcriptional level. Nucleic Acids Res
32: W242-W248
[Abstract]
[Full Text]
-
Zhang, X. H-F., Chasin, L. A.
(2004). Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev.
18: 1241-1250
[Abstract]
[Full Text]
-
Zeniou, M., Gattoni, R., Hanauer, A., Stevenin, J.
(2004). Delineation of the mechanisms of aberrant splicing caused by two unusual intronic mutations in the RSK2 gene involved in Coffin-Lowry syndrome. Nucleic Acids Res
32: 1214-1223
[Abstract]
[Full Text]
-
Soret, J., Gabut, M., Dupon, C., Kohlhagen, G., Stevenin, J., Pommier, Y., Tazi, J.
(2003). Altered Serine/Arginine-Rich Protein Phosphorylation and Exonic Enhancer-Dependent Splicing in Mammalian Cells Lacking Topoisomerase I. Cancer Res.
63: 8203-8211
[Abstract]
[Full Text]
-
Zhang, X. H-F., Heller, K. A., Hefter, I., Leslie, C. S., Chasin, L. A.
(2003). Sequence Information for the Splicing of Human Pre-mRNA Identified by Support Vector Machine Classification. Genome Res
13: 2637-2650
[Abstract]
[Full Text]
-
Philipps, D., Celotto, A. M., Wang, Q.-Q., Tarng, R. S., Graveley, B. R.
(2003). Arginine/serine repeats are sufficient to constitute a splicing activation domain. Nucleic Acids Res
31: 6502-6508
[Abstract]
[Full Text]
-
Chandler, D. S., Qi, J., Mattox, W.
(2003). Direct Repression of Splicing by transformer-2. Mol. Cell. Biol.
23: 5174-5185
[Abstract]
[Full Text]
-
Aartsma-Rus, A., Janson, A. A.M., Kaman, W. E., Bremmer-Bout, M., den Dunnen, J. T., Baas, F., van Ommen, G.-J. B., van Deutekom, J. C.T.
(2003). Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet
12: 907-914
[Abstract]
[Full Text]
-
Li, B., Wachtel, C., Miriami, E., Yahalom, G., Friedlander, G., Sharon, G., Sperling, R., Sperling, J.
(2002). Stop codons affect 5' splice site selection by surveillance of splicing. Proc. Natl. Acad. Sci. USA
99: 5277-5282
[Abstract]
[Full Text]
-
Woerfel, G., Bindereif, A.
(2001). In vitro selection of exonic splicing enhancer sequences: identification of novel CD44 enhancers. Nucleic Acids Res
29: 3204-3211
[Abstract]
[Full Text]
-
Caudevilla, C., Codony, C., Serra, D., Plasencia, G., Roman, R., Graessmann, A., Asins, G., Bach-Elias, M., Hegardt, F. G.
(2001). Localization of an exonic splicing enhancer responsible for mammalian natural trans-splicing. Nucleic Acids Res
29: 3108-3115
[Abstract]
[Full Text]
-
Zhu, J., Krainer, A. R.
(2000). Pre-mRNA splicing in the absence of an SR protein RS domain. Genes Dev.
14: 3166-3178
[Abstract]
[Full Text]
-
Eperon, I. C., Makarova, O. V., Mayeda, A., Munroe, S. H., Cáceres, J. F., Hayward, D. G., Krainer, A. R.
(2000). Selection of Alternative 5' Splice Sites: Role of U1 snRNP and Models for the Antagonistic Effects of SF2/ASF and hnRNP A1. Mol. Cell. Biol.
20: 8303-8318
[Abstract]
[Full Text]
-
Fairbrother, W. G., Chasin, L. A.
(2000). Human Genomic Sequences That Inhibit Splicing. Mol. Cell. Biol.
20: 6816-6825
[Abstract]
[Full Text]
-
Sun, H., Chasin, L. A.
(2000). Multiple Splicing Defects in an Intronic False Exon. Mol. Cell. Biol.
20: 6414-6425
[Abstract]
[Full Text]
-
Karras, J. G., McKay, R. A., Dean, N. M., Monia, B. P.
(2000). Deletion of Individual Exons and Induction of Soluble Murine Interleukin-5 Receptor-alpha Chain Expression through Antisense Oligonucleotide-Mediated Redirection of Pre-mRNA Splicing. Mol. Pharmacol.
58: 380-387
[Abstract]
[Full Text]
-
Zheng, Z.-M., Quintero, J., Reid, E. S., Gocke, C., Baker, C. C.
(2000). Optimization of a Weak 3' Splice Site Counteracts the Function of a Bovine Papillomavirus Type 1 Exonic Splicing Suppressor In Vitro and In Vivo. J. Virol.
74: 5902-5910
[Abstract]
[Full Text]
-
Davies, R. C., Bratt, E., Hastie, N. D.
(2000). Did nucleotides or amino acids drive evolutionary conservation of the WT1 {+/-}KTS alternative splice?. Hum Mol Genet
9: 1177-1183
[Abstract]
[Full Text]
-
Venables, J.P., Elliott, D.J., Makarova, O.V., Makarov, E.M., Cooke, H.J., Eperon, I.C.
(2000). RBMY, a probable human spermatogenesis factor, and other hnRNP G proteins interact with Tra2{beta} and affect splicing. Hum Mol Genet
9: 685-694
[Abstract]
[Full Text]
-
Liu, H.-X., Chew, S. L., Cartegni, L., Zhang, M. Q., Krainer, A. R.
(2000). Exonic Splicing Enhancer Motif Recognized by Human SC35 under Splicing Conditions. Mol. Cell. Biol.
20: 1063-1071
[Abstract]
[Full Text]
-
Chew, S. L., Baginsky, L., Eperon, I. C.
(2000). An exonic splicing silencer in the testes-specific DNA ligase III {beta} exon. Nucleic Acids Res
28: 402-410
[Abstract]
[Full Text]
-
Stover, C. M., Thiel, S., Lynch, N. J., Schwaeble, W. J.
(1999). The Rat and Mouse Homologues of MASP-2 and MAp19, components of the Lectin Activation Pathway of Complement. J. Immunol.
163: 6848-6859
[Abstract]
[Full Text]
-
Sun, L., Goodman, P. A., Wood, C. M., Crotty, M.-L., Sensel, M., Sather, H., Navara, C., Nachman, J., Steinherz, P. G., Gaynon, P. S., Seibel, N., Vassilev, A., Juran, B. D., Reaman, G. H., Uckun, F. M.
(1999). Expression of Aberrantly Spliced Oncogenic Ikaros Isoforms in Childhood Acute Lymphoblastic Leukemia. JCO
17: 3753-3766
[Abstract]
[Full Text]
-
Bourgeois, C. F., Popielarz, M., Hildwein, G., Stevenin, J.
(1999). Identification of a Bidirectional Splicing Enhancer: Differential Involvement of SR Proteins in 5' or 3' Splice Site Activation. Mol. Cell. Biol.
19: 7347-7356
[Abstract]
[Full Text]
-
Fortes, P., Bilbao-Cortés, D., Fornerod, M., Rigaut, G., Raymond, W., Séraphin, B., Mattaj, I. W.
(1999). Luc7p, a novel yeast U1 snRNP protein with a role in 5' splice site recognition. Genes Dev.
13: 2425-2438
[Abstract]
[Full Text]
-
Chew, S. L., Liu, H.-X., Mayeda, A., Krainer, A. R.
(1999). Evidence for the function of an exonic splicing enhancer after the first catalytic step of pre-mRNA splicing. Proc. Natl. Acad. Sci. USA
96: 10655-10660
[Abstract]
[Full Text]
-
Hertel, K. J., Maniatis, T.
(1999). Serine-arginine (SR)-rich splicing factors have an exon-independent function in pre-mRNA splicing. Proc. Natl. Acad. Sci. USA
96: 2651-2655
[Abstract]
[Full Text]
-
Schaal, T. D., Maniatis, T.
(1999). Selection and Characterization of Pre-mRNA Splicing Enhancers: Identification of Novel SR Protein-Specific Enhancer Sequences. Mol. Cell. Biol.
19: 1705-1719
[Abstract]
[Full Text]
-
Lejeune, F., Cavaloc, Y., Stevenin, J.
(2001). Alternative Splicing of Intron 3 of the Serine/Arginine-rich Protein 9G8 Gene. IDENTIFICATION OF FLANKING EXONIC SPLICING ENHANCERS AND INVOLVEMENT OF 9G8 AS A TRANS-ACTING FACTOR. J. Biol. Chem.
276: 7850-7858
[Abstract]
[Full Text]
-
Lynch, K. W., Weiss, A.
(2001). A CD45 Polymorphism Associated with Multiple Sclerosis Disrupts an Exonic Splicing Silencer. J. Biol. Chem.
276: 24341-24347
[Abstract]
[Full Text]
-
Jacquenet, S., Mereau, A., Bilodeau, P. S., Damier, L., Stoltzfus, C. M., Branlant, C.
(2001). A Second Exon Splicing Silencer within Human Immunodeficiency Virus Type 1 tat Exon 2 Represses Splicing of Tat mRNA and Binds Protein hnRNP H. J. Biol. Chem.
276: 40464-40475
[Abstract]
[Full Text]