Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 31-45, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Yeast Telomere Length Counting Machinery Is
Sensitive to Sequences at the Telomere-Nontelomere
Junction
Alo
Ray and
Kurt W.
Runge*
Department of Molecular Biology, The Lerner
Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio
44195
Received 24 March 1998/Returned for modification 3 September
1998/Accepted 24 September 1998
 |
ABSTRACT |
Saccharomyces cerevisiae telomeres consist of a
continuous 325 ± 75-bp tract of the heterogeneous repeat
TG1-3 which contains irregularly spaced, high-affinity
sites for the protein Rap1p. Yeast cells monitor or count the number of
telomeric Rap1p molecules in a negative feedback mechanism which
modulates telomere length. To investigate the mechanism by which
Rap1p molecules are counted, the continuous telomeric
TG1-3 sequences were divided into internal TG1-3 sequences and a terminal tract separated by
nontelomeric spacers of different lengths. While all of the
internal sequences were counted as part of the terminal tract across a
38-bp spacer, a 138-bp disruption completely prevented the internal
TG1-3 sequences from being considered part of the
telomere and defined the terminal tract as a discrete entity
separate from the subtelomeric sequences. We also used regularly
spaced arrays of six Rap1p sites internal to the terminal
TG1-3 repeats to show that each Rap1p molecule was counted
as about 19 bp of TG1-3 in vivo and that cells could count
Rap1p molecules with different spacings between tandem sites. As
previous in vitro experiments had shown that telomeric Rap1p sites
occur about once every 18 bp, all Rap1p molecules at the junction of
telomeric and nontelomeric chromatin (the
telomere-nontelomere junction) must participate in telomere
length measurement. The conserved arrangement of these six Rap1p
molecules at the telomere-nontelomere junction in independent
transformants also caused the elongated TG1-3 tracts to be
maintained at nearly identical lengths, showing that sequences at the
telomere-nontelomere junction had an effect on length
regulation. These results can be explained by a model in which
telomeres beyond a threshold length form a folded structure that
links the chromosome terminus to the telomere-nontelomere junction and prevents telomere elongation.
 |
INTRODUCTION |
Telomeres are the nucleoprotein
complexes that make up the ends of eukaryotic chromosomes. In the
majority of organisms examined, telomeres consist of short repeated
DNA sequences and their associated sequence-specific binding proteins
(reviewed in reference 11). In the yeast
Saccharomyces cerevisiae, telomeres consist of the heterogeneous repeat (TG)1-6TG2-3,
abbreviated as TG1-3, which contains irregularly spaced
binding sites for the major yeast telomere binding protein Rap1p
(reviewed in reference 54). The length of the
TG1-3 repeats is regulated, being maintained within a small
range of 325 ± 75 bp (40). Telomeres can be formed on linear yeast plasmids by transformation followed by the addition of
TG1-3 repeats. Sequencing of these linear plasmid repeats
has shown that the precise TG1-3 sequences of independently
formed telomeres are different (48). When individual
telomeres derived from the same formation event are isolated from
different cells, they have different TG1-3 sequences for
the half of the TG1-3 tract nearest the chromosome end.
This sequence heterogeneity is thought to arise from telomeres
going through cycles of telomere shortening followed by the
addition of TG1-3 repeats with a different sequence
(48). This shortening and lengthening by the addition of
different TG1-3 sequences probably also occurs with
chromosomal telomeres because the lengths of individual
telomeres vary between different cell lineages (43). A
direct consequence of this sequence heterogeneity is that the spacing
between individual Rap1p molecules bound to these repeats varies
between different telomeres, and so the heterogeneity of the
telomere DNA sequences causes heterogeneity in telomere
chromatin structure.
The fact that telomere length varies as cells grow but still
remains within a specific length range has led to the hypothesis that
telomere length is regulated by balancing lengthening and shortening mechanisms (11). Presumably, telomere
length is somehow measured, and depending on the result,
telomere lengthening or telomere shortening occurs.
Telomere lengthening occurs primarily via telomerase, a cellular
reverse transcriptase with its own RNA template (11,
24), and can also occur through recombination-dependent mechanisms (36). Telomere shortening occurs by
incomplete replication of the 5' chromosome end, owing to removal
of the RNA primer for DNA synthesis (reviewed in reference
54), and by active degradation (6, 49)
and deletion mechanisms (23). Similar processes occur in
other organisms, including humans (11, 28, 32). How
telomere length is measured and how these processes are controlled are not yet understood.
Telomere binding proteins play an important role in regulating
telomere length. The major yeast telomere binding protein Rap1p can be divided into at least two domains, a large DNA binding domain
(amino acids 361 to 596 [16]) and a large C-terminal domain (amino acids 600 to 827) which contains multiple subdomains involved in telomere length control, transcriptional silencing, and
transcriptional activation (5, 12, 20, 26, 45). Rap1p is
known to play a negative regulatory role by inhibiting telomere
elongation. Missense or deletion mutations in the Rap1p C terminus
cause yeast telomere length to increase (20, 21, 25,
45). These rap1 mutations eliminate interactions
between Rap1p and other proteins important for telomere length
control (13, 52). Overproduction of the Rap1p C-terminal
domain in vivo causes chromosomal telomeres to lengthen (5,
12, 41, 51), presumably because Rap1p-interacting factors are
titrated away from telomeres. Experiments with the Rap1p homolog of
Kluyveromyces lactis indicate that the C termini of
Rap1p molecules bound to the very ends of the chromosome interact with
proteins that inhibit telomere elongation, presumably by inhibiting
the access of telomerase to the chromosome terminus
(19). These data have led to the hypothesis that the Rap1p C
terminus and proteins bound to it inhibit telomere lengthening
(11).
The Rap1p C terminus can also play a positive role in telomere
elongation. The Rap1p C terminus can stimulate the formation of
chromosomal telomeres in a transformation assay, a model system for
the elongation of short telomeres (38). As with the
inhibition of telomere lengthening, the ability of the Rap1p C
terminus to stimulate telomere elongation most likely involves
other proteins that bind to Rap1p.
Several factors that interact with the Rap1p C terminus and regulate
telomere length and transcriptional silencing have been identified.
These factors include Rif1p, Rif2p, and Sir3p (13, 33, 52).
Sir3p forms a complex with Sir2p, Sir4p, and chromatin to silence
transcription of nearby genes, a phenomenon known as telomere
position effect (14, 15, 27, 39, 44). Overproduction of
Rif1p and Rif2p causes telomeres to shorten, deletion of either gene causes telomeres to lengthen by ~200 bp, and simultaneous deletion of both genes causes telomere length to increase from ~325 bp to 2 to 4 kb of TG1-3 (52). The
rif1 rif2 double-mutant phenotype is identical to that of
rap1t mutants which lack the Rap1p C terminus
(20). The 2- to 4-kb TG1-3 repeats in
rap1t and rif1
rif2
cells are
thought to arise by telomere elongation occurring in an unregulated
fashion (20, 21). Thus, Rif1p and Rif2p are important
components for telomere length regulation. Recent work has shown
that yeast normally measure telomere length by counting Rap1p
molecules (29), and Rif1p and Rif2p probably play essential
roles in this process. However, the mechanism by which Rap1p molecules
are counted is unknown.
In measuring telomere length, the cell must determine where the
telomere starts, where it ends, and how many Rap1p molecules are
present in between. How the beginning and the end of a telomeric TG1-3 tract are demarcated is unknown. While in vitro
studies show that Rap1p binds to sites present at an average of about 1 per 18 bp, site spacing is irregular and some sites overlap (7). This variable placement of Rap1p binding sites means
that these telomeric Rap1p molecules are not presented to the cell in a uniform manner. Thus, it is unknown whether all of these Rap1p
molecules are used to measure telomere length in vivo.
To investigate the mechanism of telomere length regulation, we
constructed a series of synthetic telomeres with additional Rap1p
molecules internal to the terminal TG1-3 repeats and
determined their effects on telomere length. The goal of this
approach was to mimic a portion of the internal telomere
nucleoprotein complex and determine how changes in this structure alter
length regulation. If the internal sequences are detected by the cell
as part of the telomere, the terminal TG1-3 tract will
be elongated to a length less than that of a natural telomere. We
constructed synthetic telomeres that separated adjacent
TG1-3 tracts with different lengths of nontelomeric DNA
or that contained regularly spaced arrays of Rap1p sites internal to
the terminal TG1-3 tract. As the separation between
adjacent TG1-3 tracts increased in size from 38 to 50 bp,
cells counted smaller portions of the internal TG1-3 tract
as part of the TG1-3 tract. Cells could not accommodate a
138-bp disruption; the internal sequences were not counted, and a new
telomere-nontelomere junction was established. Placing tandem
arrays of regularly spaced Rap1p binding sites just internal to the
TG1-3 repeats showed that yeast cells can accommodate
different spacings of 13 to 35 bp between consecutive Rap1p sites while measuring telomere length and that cells equated one Rap1p molecule with about 19 bp of TG1-3 DNA in vivo. These results
indicate that all of the Rap1p molecules at the
telomere-nontelomere junction participate in telomere
length regulation. The internal tandem Rap1p sites had the unexpected
effect of eliminating the variation in average telomere lengths
normally seen between independently formed telomeres. These data
suggest that the boundaries of the telomere, i.e., the chromosome
terminus and the junction between the Rap1p-containing and
non-Rap1p-containing chromatin (the telomere-nontelomere junction), communicate with one another when telomere length is measured. We therefore propose that telomere length measurement involves forming a folded chromatin structure that is dependent on the
presence of a threshold number of telomeric Rap1p molecules. This
folded structure links the chromosome terminus and the
telomere-nontelomere junction and inhibits telomere lengthening.
 |
MATERIALS AND METHODS |
Strains.
Recombinant DNA manipulations were in
Escherichia coli MC1066 (r
m+ pyrF::Tn5 trpC leuB). S. cerevisiae strains used were KR36-6L (MATa
ade2-1 or 101 ade8-18 ura3-52 trp1
1 leu2-
RC
his3
) (40) and the gal4
strain YM708
(MAT
ade2-101 ura3-52 trp1
-901 his3-200 lys2-801 LEU2
canR gal4-542; from Mark Johnston).
Plasmids.
Plasmid YIpADH35 contains
ADH4-URA3-TG1-3 sequences where the 29-bp
segments of TG1-3 sequences consist of the oligonucleotides GATCCGGGTGTGTGGGTGTGTGGGTGTGGGTGTGC
and
GGCCGCACACCCACACCCACACACCCACACACCCG in pBR322 as described elsewhere (38) (boldfaced
and underlined bases denote Rap1p binding sites). The
HincII-NotI fragment bearing the 256 bp of
TG1-3 was isolated from pCT300 (256 bp of TG1-3 in pVZ-1; from K. Runge, R. Wellinger, J. Wright, and V. Zakian), filled in, and then cloned into the filled-in BamHI site of
YIpADH35 to give YIpADH256-50 with the orientation of the
TG1-3 repeats the same as the terminal 29-bp
TG1-3 repeats (see Fig. 1B and C). This plasmid was
previously called YIpADH-275 (38). This 256-bp tract was
derived from a ~350-bp tract of TG1-3 sequences (as
determined by Southern blotting) cloned by circularization of a yeast
linear plasmid that was directly transformed into yeast (40). Upon rescuing the plasmid into E. coli,
some of the TG1-3 sequences were deleted. Sequencing of
multiple YIpADH256-XX constructions gave the same sequence for the
256-bp insert (Fig. 1C), showing it was stable in bacteria.
YIpADH256-50 has a 50-bp polylinker spacer between the terminal 29 bp
of TG1-3 and 256 bp of TG1-3. YIpADH652-42 has
the 256 bp of TG1-3 repeats in the opposite orientation to
telomere with a 42-bp polylinker spacer between the terminal 29-bp
TG1-3 and 256-bp TG1-3.
To reduce the polylinker spacer, YIpADH256-50 was separately digested
with KpnI or SacI (two sites each are present in
the polylinker [Fig. 1C]) and self-ligated to generate, respectively, the 26- and 38-bp polylinkers between the 29 and 256 bp of
TG1-3 to form YIpADH256-26 and YIpADH256-38. To increase
the length of the polylinker spacer, we cloned 210-bp (bp 10101 to
10310) and 88-bp (bp 10101 to 10188) PCR fragments of lambda phage DNA (described below) into the BamHI site of YIpADH256-50 to
form YIpADH256-266 and YIpADH256-138.
The single BamHI site between URA3 and the
TG1-3 repeats of YIpADH35 was the site of insertion of the
TEF18-6 oligonucleotide, which contains six tandem repeats of the same
sequence with one Rap1p binding site every 18 bp, and the 78-bp TEF13-6
oligonucleotide with six tandem repeats bearing one Rap1p site every 13 bp (Table 1). The renatured,
kinase-treated oligonucleotides were cloned into the BamHI
site of YIpADH35 to form YIpADHTEF18-6TG and YIpADHTEF13-6TG with the
BamHI site closest to the NotI site. Plasmids
with the six TEF oligonucleotides in opposite orientation
(YIpADHTEF18-6CA and YIpADHTEF13-6CA) were also constructed. All
constructions were verified by DNA sequencing. The negative control
plasmid YIpADH
210, YIpADH35 containing a 210-bp insert of
lambda DNA, has already been described (38). Lambda PCR
fragments were also cloned into YIpADH35, with the BamHI
site closest to the NotI site, to generate YIpADH
88 and
YIpADH
108. To form the PCR fragments for the
210,
108, and
88 constructions, PCR primers
-10101 and, respectively,
-10310r,
-10208r, and
-10188r (Table 1) were used with 10 ng
of
DNA (New England Biolabs) and 35 cycles of 94°C-1 min,
55°C-45 s, and 72°C-1 min in a Perkin-Elmer Cetus 9600 PCR machine.
Plasmids bearing six tandem repeats of a 35-bp oligonucleotide bearing
a single Rap1p site in the same (YIpADHTEF35-6TG) or opposite (YIpADHTEF35-6CA) orientation as the terminal 29-bp
TG1-3 tract have been described (YIpADHTEF35-6TG
is the same as YIpADHTEF-35 [38]). The tandem repeats
were constructed in pBRA8, a pBR322 plasmid with the 2.0-kb
BamHI-EcoRI ADE8 fragment cloned into the AvaI site of pBR322, both as blunt-end fragments. The
plasmid was cleaved with BamHI (in the Tetr
gene) and BglII (in ADE8), and the TEF35 A-B
oligonucleotide pair was cloned into this vector. A clone
(pBRA-TEF35-2TG) that contained both BglII and
BamHI sites was selected and sequenced. This clone has two
tandem repeats of the TEF35 oligonucleotide. An
EcoRI-BglII fragment from pBRA-TEF35-2TG was
cloned into the same plasmid cut with EcoRI-BamHI
to convert the double repeat to four head-to-tail repeats. The four
head-to-tail repeats were cloned into pBRA-TEF35-2TG in the same manner
to generate six head-to-tail repeats in pBRA-TEF-6TG. Inserts were
verified by sequencing at each step of the oligomerization process. For
unknown reasons, these repeats could not be oligomerized in vitro and subsequently cloned into high-copy-number bacterial pUC-based vectors,
and these repeats were stable in E. coli MC1066 but not in
Sure or DH10B cells. The six-repeat BamHI-BglII
fragment was then cloned into the BamHI site of
YIpADH35 to generate YIpADHTEF35-6TG and
YIpADHTEF35-6CA.
Telomere formation and integration.
Digestion of all of the
YIpADH plasmids with SalI and NotI
releases a
SalI-ADH4-URA3-insert-TG1-3-NotI
fragment which can replace the left telomere of chromosome VII.
Transformations using 5 µg of SalI- and
NotI-digested plasmid into S. cerevisiae KR36-6L or YM708 were performed as described previously (38). The
relative efficiencies of telomere formation previously noted
(38) were confirmed in these experiments. In most cases, 100 to 200 transformants of each type were picked to a master plate lacking
uracil, grown overnight at 30°C, replica plated to a plate containing
uracil, grown overnight, and assayed for telomere position effect
by testing for growth on YC-Ura and 5-fluoro-orotic acid plates.
Subsequently, several transformants of each type predicted to have a
URA3 telomere were then used for Southern analysis using
a PCR fragment equivalent to the StuI-NsiI 3'
fragment of URA3 as the probe. Integration of
YIpADH256-50 at internal loci (URA3) does not give
detectable levels of telomere position effect (data not shown).
DNA isolation and Southern blotting.
Genomic yeast DNA was
isolated according to the protocol of V. Schulz (42a).
Briefly, stationary-phase cells (5 ml) were washed with water and
resuspended in 250 µl of lysis buffer (100 mM Tris-HCl [pH 8.0], 50 mM EDTA, 1% sodium dodecyl sulfate [SDS]), and acid-washed glass
beads (Sigma type V; diameter of 400 to 500 µm) were added to the
0.5-ml mark. The tube was shaken for 10 min in a Vortex-Genie (VWR
Scientific) with the shaker attachment at top speed, and 150 µl of
7.5 M ammonium acetate was then added. The tube was heated at 65°C
for 15 min and placed on ice for 15 min, and then 500 µl of
CHCl3 was added. After mixing, the tube was spun for 8 min
at top speed in a microcentrifuge. The aqueous phase was added to a
1.5-ml tube with 0.5 ml of room temperature isopropanol and spun at
room temperature for 5 min. The DNA pellet was washed with 70% ethanol
and resuspended in 50 µl of TE (10 mM Tris-HCl [pH 8.0], 1 mM
EDTA). To this preparation, 1.5 µl of RNase A (5 mg/ml) was added,
and the mixture was incubated at 37°C for 15 min; this was followed
by the addition of 1.5 µl of proteinase K (10 mg/ml) and incubation
at 37°C for another 15 min. The solution was brought to 300 µl with
water, extracted once with an equal volume of phenol-CHCl3
(4:1), and extracted once with CHCl3. The DNA was
precipitated by adding 150 µl of 7.5 M ammonium acetate (pH 7) and 1 ml of 95% ethanol at
20°C, spun, and resuspended in 50 µl of TE.
Five microliters was digested for each gel lane. Southern analysis was
done as described in reference 42. Prehybridization
solution contained 6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate), 5× Denhardt's solution, 0.5% SDS, and 100 µg of
denatured, fragmented salmon sperm DNA per ml, and prehybridization was
at 68°C for 2 to 3 h. Denatured probe was added to the filter in
hybridization solution (6× SSC, 0.5% SDS, 100 µg of denatured
salmon sperm DNA per ml), and the filter was hybridized overnight in
a hybridization oven at 68°C. The filters were washed as
described elsewhere (42).
Telomere length measurement.
In the Southern blots used for
these analyses, the molecular size standards at 1.636 and 0.517 kb were
used to construct the standard curve for migration versus molecular
weight and then checked against the migration of the 1.018-kb standard.
In all cases, the derived molecular size of the 1.018-kb standard was within 8 bp of its actual molecular size. In addition, the molecular size of the chromosomal URA3 StuI band was within ±15 bp in
these blots. The amount of TG1-3 equivalent to the TEF35-6,
TEF18-6, or TEF13-6 tandem arrays was determined by subtracting the
size of the YIpADHTEFXX-6 StuI fragment from
the YIpADH
control with the same insert size (e.g.,
YIpADH
210 size
YIpADHTEF35-6 size). For
example, since YIpADH
210 contains an insert which is not counted as TG1-3 whereas YIpADHTEF35-6 contains
an insert that is equivalent to TG1-3, this difference
gives the "equivalent TG1-3 length" of the TEF35-6
tandem array. Two advantages of this approach were that (i) the minor
differences in migration for the YIpADHTEF insert also
occurred for the YIpADH
insert on the same blot, and so
deviations in gel migration for these terminal restriction fragments on
an individual blot are similar, and (ii) only one comparison is
performed, and so errors inherent in each measurement are added
together only once. In addition, each telomere was also cleaved
with StuI plus BamHI to verify that the inserts were still present in vivo and of the correct size. For
YIpADHTEF13-6, the YIpADH
88 telomere was
used as a control. Corrections for the 4- to 6-bp differences between
the insert sizes of the YIpADH
and YIpADHTEF
telomeres were included in these calculations. For Fig. 3C,
length measurements were from the blots in Fig. 3A and B and two
other blots similar to that in Fig. 2B that ran more uniformly (not shown).
PCR.
The terminal portions of the 26- and 38-bp spacers
between the 256- and 29-bp TG1-3 sequences were detected by
a hot-start PCR method with the 5' URA3 StuI and 3'
polylinker primers (Table 1). For this purpose, the primer mix (50 pmol
of both primers in 50 µl of H2O) was heated at 94°C for
10 min, and the remaining components (~2 µg of genomic DNA plus
deoxynucleoside triphosphates, buffer components and Taq DNA
polymerase in 50 µl) were separately heated at 94°C for 2 min.
After these two reaction mixtures were combined, the mixture was
topped with 50 µl of mineral oil and PCR was performed by 5'
denaturation at 94°C for 1 cycle, then 5 cycles of 94°C-1 min,
60°C-1 min, and 72°C-1 min, followed by 30 cycles of 94°C-1
min, 55°C-1 min, and 72°C-1 min, and ending with 72°C-10 min.
The most internal 12 bp of the 50- and 138-bp spacers were detected
with the 5' URA3 StuI primer and primer 1 (Table 1), using 5 to 15 µl of a 1:1,000 dilution of yeast genomic DNA (20 to 45 ng).
DNA was denatured in a partial PCR for 5 min at 94°C in a heating
block, and then each primer, preincubated at 94°C for 5 min, and
Taq polymerase were sequentially added, keeping the reaction
at 94°C between each addition. The reaction was topped with 50 µl
of mineral oil and then transferred to a PCR machine heated to 94°C.
The PCR program was 1 cycle for 5 min at 94°C, then 5 cycles of
94°C-1 min, 68°C-1 min, and 72°C-1 min, followed by 30 cycles of
94°C-1 min, 60°C-1 min, and 72°C-1 min, and ending with 72°C-10
min. The correct 760-bp PCR product was confirmed by NsiI
digestion. Of the 13 long and mixed telomeres and 14 short telomeres tested, most are shown in Fig. 2 (lanes 2, 10, 12, and 14), 3A (lanes 6, 8, 10, 12, 14, and 18), 4B (lanes 4, 5, 6, 8, 9, and
13), and 4C (lanes 6, 8, 10, 11, 13, 16, and 17). All of the long
telomeres from Fig. 4B and C in this sample retained the
BamHI site, showing that these subclones retained the entire spacer.
 |
RESULTS |
Model systems for altering telomere length regulation.
Two
classes of synthetic telomeres were constructed to
investigate the mechanism of telomere length regulation. The first class involved separating an internal 256-bp tract of TG1-3
repeats from a terminal 29-bp TG1-3 tract with a
nontelomeric spacer of various lengths (Fig.
1, the YIpADH256-XX and
YIpADH652-42 telomeres). These nontelomeric
spacers contained no Rap1p binding sites. After transformation into
yeast and conversion of the synthetic telomere to a chromosomal
telomere (Fig. 1A), the 29-bp TG1-3 tract will be
elongated to 325 ± 75 bp of TG1-3 (40) if
the internal tract is not seen as part of the telomere (i.e., not
counted as telomeric TG1-3). However, if the internal
tract is seen as part of the telomere, the 29-bp TG1-3
tract will not be elongated as much. These spacer telomeres allowed
us to determine how a disruption in the continuous TG1-3
tract altered length measurement. These telomeres also tested the
minimum size of the disruption that functionally separated the internal
and terminal TG1-3 sequences to form a new internal
boundary for the telomere. The orientation dependence of the
internal TG1-3 tract on telomere length measurement was
also examined (Fig. 1, YIpADH652-42).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Introduction of synthetic telomeres into yeast. (A)
Replacement of the left telomere of chromosome VII by homologous
integration at the ADH4 locus, using a synthetic
telomere adjacent to URA3. Different inserts, shown in
panel B, were cloned between URA3 and the TG1-3
sequences to attempt to alter telomere length regulation. (B) The
synthetic telomeres used in this work. The nontelomeric spacers
between the TG1-3 tracts are described in Materials and
Methods. The orientation of the TG1-3 repeats is indicated
by arrowheads. YIpADH652-42 has the internal 256-bp
TG1-3 tract in the reverse orientation relative to the
terminal 29-bp tract. The specific YIpADHTEF and
YIpADH telomeres are presented in Fig. 5. (C)
Sequences of the TG1-3 repeats and spacer in the
YIpADH256-50 construction. The sites used to construct the
plasmids in panel B are indicated. The TG1-3 repeats are
from positions 54 to 309 in the 5' KpnI site, and the single
A in the TG1-3 repeats is at position 98.
|
|
The second class of synthetic telomeres, the YIpADHTEF
telomeres (Fig. 1B), consisted of internal tandem arrays of
high-affinity, nontelomeric Rap1p sites derived from the
upstream activation sequence (UAS) of the yeast TEF2 gene
(4) followed by a short 29-bp TG1-3 tract. As
with the first class of telomeres, the 29-bp TG1-3
tract will be elongated to a length that depends on whether the
internal nontelomeric Rap1p sites are counted as part of the telomere. These telomeres were used to define how Rap1p
molecules are counted to measure telomere length. Because Rap1p
sites in natural telomeres are irregularly spaced and overlapping,
it was unknown if all of the bound Rap1p molecules participate in
telomere length control. The YIpADHTEF telomeres
provided a more defined system because the internal Rap1p sites were
regularly spaced at three different intervals and none of the sites overlapped.
To measure the length of the terminal TG1-3 tract
after conversion of each of these telomeres to chromosomal
telomeres (Fig. 1A), genomic DNAs were digested with either
StuI, which cuts in URA3, or StuI plus
BamHI, which cuts between URA3 and the elongated TG1-3 tract (Fig. 2A). The difference between the lengths
of the StuI and StuI-BamHI fragments
gave the length of the terminal TG1-3 tract and showed how
much elongation occurred in vivo (the question mark in Fig.
2A). The terminal restriction fragment of a single telomere is heterogeneous, giving rise to a disperse band (Fig. 2B, lanes 2, 4, and 6), because it represents a population of molecules which have different TG1-3 sequences at the
very end of the chromosome (48). Therefore, the size
of each telomere was measured at the most intense point of
hybridization in the disperse band, which is the mode (and usually the
average) of the telomere lengths in the band being analyzed. We
shall refer to this telomere size as the modal telomere length.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
Some of the internal TG1-3 sequences are
considered part of the telomere across a 50-bp nontelomeric
spacer. (A) Predicted sizes of the telomere restriction fragments
on Southern blots. Telomere length, i.e., the length of the elongated
terminal TG1-3 tract, was determined by subtracting the
StuI-BamHI fragment length from the
StuI fragment length measured on the same blot. Analysis on
the same blot was important for giving reproducible and accurate length
determination for different control telomeres. With lanes 14 and 15 of B as an example, the length of the elongated terminal
TG1-3 sequences (the ? in the diagram) is 150 bp. (B)
Representative genomic DNAs from cells bearing the
YIpADH256-26, -38, and -50 telomeres and the
YIpADH652-42 telomere were cleaved with StuI
or StuI plus BamHI and analyzed by Southern
blotting using the URA3 fragment in panel A as probe. All
telomeres were formed in yeast strain YM708. The 0 spacer is
YIpADH35. Each pair of lanes (indicated by a bar under the
number) represents an individual transformant. Lane 1, YM708 with no
synthetic telomere; lanes 10 and 11, a YIpADH256-50
transformant with short telomeres; lanes 14 and 15, a
YIpADH256-50 transformant with long telomeres; lanes 12 and 13, a YIpADH256-50 transformant with short and long
telomeres (mixed telomeres). Note that the
YIpADH652-42 construction places the BamHI site
closer to URA3 (Fig. 1B). Telomere fragment sizes were
determined as described in Materials and Methods.
|
|
An internal 256-bp TG1-3 tract can be partially counted
as part of the telomere in both orientations and across a 50-bp
spacer.
As described above, the first class of synthetic
telomeres contained an internal 256-bp tract of TG1-3
sequences (Fig. 1B and C). The synthetic telomeres containing this
sequence were named YIpADH256-XX, where XX is the 26-, 38-, or 50-bp nontelomeric spacer between the 256-bp
tract and the terminal 29-bp tract (Fig. 1B). In these
constructs, the terminal and internal TG1-3 tracts were in
the same orientation. In addition, a telomere with the 256-bp tract
in the opposite orientation followed by a 42-bp spacer and the terminal
29 bp TG1-3 tract, YIpADH652-42 (Fig. 1B),
was also constructed.
Several transformants bearing either the 26- or 38-bp spacer
telomeres were examined for telomere length measurement
(representative transformants are shown in Fig. 2B). The terminal
StuI restriction fragment was indistinguishable in length
from the control YIpADH35 telomeres containing no
disruption in the continuous TG1-3 tract (Fig. 2B, lane 2 versus lanes 4, 6, and 8). Digestion with BamHI collapsed
the heterogeneous band to a sharper one; therefore, the
BamHI site was still present (lane 6 versus lane 7). In
addition, the presence of the BamHI site in the 26- and
38-bp spacer telomeres was also confirmed by PCR (see Materials and
Methods). The StuI-BamHI fragments of the 26- and
38-bp spacer telomeres were slightly more diffuse than expected for
a discrete fragment (lanes 5, 7, and 9). One possible explanation for
this result is that since these spacers were very close to the
chromosome end, the random lengthening and shortening reactions that
occur during cell growth (48) may have eliminated the spacer
and BamHI site in a small subpopulation of cells. However,
since the heterogeneity of the band was reduced by BamHI
digestion, the majority of cells retained the spacer. Thus, the 26- and
38-bp nontelomeric spacers did not prevent the cell from counting
all of the internal 256 bp of TG1-3 sequences as part of
the elongated TG1-3 tract.
The 50-bp spacer telomere gave rise to three types of telomeres
when digested with StuI: short telomeres that were
identical in length to the YIpADH35 telomere, long
telomeres that were ~150 bp longer than the control
YIpADH35 telomeres, and telomeres that contained a
mixture of these two lengths (mixed telomeres) (Fig. 2B and data
not shown). Digestion with StuI and BamHI had no
effect on the short telomeres, caused the long telomeres to
collapse to a compact band, and caused the mixed telomeres to form
a compacted band superimposed on the short telomere band. Thus, the
long telomeres contained the BamHI site and were the
only ones that retained the entire 50-bp spacer (verified below).
Analysis of the long telomeres showed that the 50-bp spacer allowed
~130 bp of the internal 256-bp TG1-3 tract to be counted
since the terminal tract was extended to only ~150 bp, versus the
280-bp extension for the YIpADH35 telomere on this blot
(Fig. 2B). By PCR assay and Southern blotting, the short telomeres
were shown to lack the 50-bp spacer (data not shown; see Materials and
Methods). We show below that the mixed telomeres were from
individual transformants that formed colonies with single cells bearing
either a short or a long telomere. These results show that the
internal TG1-3 tract was counted across a 50-bp spacer but
not as efficiently as across the shorter 26- and 38-bp spacers.
DNA from cells bearing the telomere containing the 256-bp tract in
the opposite orientation with respect to the elongated TG1-3 sequences, YIpADH652-42 (Fig. 1B), gave
StuI restriction fragments that were slightly longer than
the YIpADH35 telomere (Fig. 2B). Of the four
transformants examined, three were ~70 bp longer and one was ~170
bp longer than the YIpADH35 telomere with no spacer (Fig.
2B; isolates that are ~70 [lane 18] and ~170 [lane 16] bp
longer are shown). The average length of the StuI fragment
of the four YIpADH652-42 telomeres was thus 95 bp greater than that of the StuI fragment of the
YIpADH35 telomere. Since the elongated
TG1-3 tract of the YIpADH652-42 telomeres
were not as long as the elongated TG1-3 of the
YIpADH35 telomere, some of the internal TG1-3
sequences were counted as part of the elongated TG1-3
tract. The length of the YIpADH35 telomere averaged
~270 bp on blots used for these measurements (Materials and Methods and data not shown). We therefore concluded that ~175 bp of the internal TG1-3 sequences in the opposite orientation were
counted as part of the elongated TG1-3 tract. Results with
the 50-bp spacer telomere and with the YIpADHTEF
telomeres (described below) suggested that the partial counting of
the internal TG1-3 tract was due to the length of the 42-bp
spacer and not the reverse orientation of the 256-bp tract. Thus,
internal TG1-3 sequences in the reverse orientation were
counted as part of the telomere.
The internal 256-bp TG1-3 tract is not counted as part
of the telomere across a 138-bp spacer.
Because the 50-bp
spacer allowed only ~130 bp of the internal 256 bp
TG1-3 tract to be counted as part of the telomere,
larger spacers were constructed to determine how large a disruption was required to abrogate counting of the internal TG1-3
sequence as part of the TG1-3 tract and establish a new
internal boundary for the telomere (i.e., a
telomere-nontelomere junction). Nontelomeric DNA spacers
of 138 and 266 bp, which did not contain Rap1p sites, were constructed
(Fig. 1B and C) and then introduced into yeast.
The majority of transformants bearing the 138- or 266-bp spacer
telomeres contained both short and long telomeres (Fig.
3A and B). As with the
50-bp spacer, only the long telomeres retained the entire
spacer and BamHI site (Fig. 3; see also below). Therefore, only the long telomeres that retained the BamHI site
were used to determine the effects of 138- and 266-bp spacers on length measurement. Measurement of the long telomeres bearing the 138- or
266-bp spacers (marked with chevron arrows in Fig. 3A and B) revealed
that the elongated TG1-3 tract was only 20 and 10 bp shorter, respectively, than the average TG1-3 tract of
the YIpADH35 control telomeres bearing a continuous
TG1-3 tract. The modal lengths of seven independent
YIpADH35 telomeres (measured at the point of the most
intense hybridization of the telomeric band) were determined and
found to vary with a range of ±30 bp. This range (the gray box in Fig.
3C) encompassed the small modal length differences between the
elongated TG1-3 tracts of the long 138- and 266-bp spacer
telomeres and the TG1-3 tract of the YIpADH35 telomere (Fig. 3C). Thus, the elongated tracts for the 138- and 266-bp spacer telomeres were indistinguishable in length from control telomeres with no internal 256-bp TG1-3 tract.
We therefore concluded that the 138-bp spacer prevented the internal
TG1-3 tract from being counted as part of the telomere
and so established a new telomere-nontelomere junction and
functionally separated the telomere from the subtelomeric
sequences.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
A 138-bp nontelomeric spacer establishes a new
telomere-nontelomere junction. (A) Individual YM708
transformants bearing the YIpADH256-138 telomere were
analyzed as for Fig. 2. Lanes 6 and 7, a YIpADH256-138
transformant with long telomeres; lanes 10 to 13, transformants
with short telomeres; lanes 8 and 9 and 14 to 19, transformants
with short and long telomeres. The transformant in lanes 8 and 9 had lost the BamHI site in the long telomeres and was
not used for the analysis in panel C. The chevron-headed arrow
indicates the long telomeres, the filled arrowhead indicates the
StuI-BamHI long telomere fragment, and the
hollow arrowhead indicates the short telomeres. Lane 1 contains DNA
from the untransformed strain. (B) Individual transformants bearing the
YIpADH256-266 telomere were analyzed as for Fig. 2. Lanes
10, 11, 14, 15, and 18 show transformants with short telomeres,
while lanes 6 to 9, 12, 13, 16, and 17 show transformants with short
and long telomeres. Arrows are used as in panel A. Lane 1 contains
DNA from the untransformed strain. (C) The amount of the internal
256-bp tract counted as part of the elongated TG1-3 tract
plotted against the length of the nontelomeric spacer. The gray box represents the length heterogeneity due to normal
variation and was calculated by using seven independent
YIpADH35 telomeres. The amount of internal
TG1-3 counted was determined by subtracting the average
length of the terminal TG1-3 tract distal to the
BamHI site for different nontelomeric spacer
telomeres (the ? in Fig. 2A) from the average modal length of
the TG1-3 tract for the control YIpADH35
telomere (Fig. 2A). The standard error of the telomere length
measurements for each spacer telomere was ±10% except for
YIpADH652-42 (±53%).
|
|
Telomere processing may not occur immediately after integration of
the synthetic telomere.
Because some single transformants
contained mixed telomeres (Fig. 2B, 3A, and 3B), it appeared that a
single transformation event had given rise to a colony containing
individual cells with either short or long telomeres. One
hypothesis to explain these data is that integration of the synthetic
telomere construct and its conversion to a chromosomal telomere
by the cellular machinery did not occur in the same cell cycle (Fig.
4A). Yeast telomeres as short as
~30 bp are sufficient for chromosomal maintenance since tel1
hdf1
cells have telomeres in this size range and are viable
(37). After the synthetic telomere was integrated, the
cell may have divided to produce two progeny before altering the length
of the terminal 29-bp TG1-3 tract. In these two progeny cells, one cell may have elongated the 29-bp tract to give rise to the
long telomeres, while the other cell may have degraded the terminal
TG1-3 tract (and thus the BamHI site in the
spacer) and formed a telomere by elongating the internal 256-bp
TG1-3 tract to give rise to the short telomeres. In
this model, the short and long telomeres exist in separate cells
within the colony and are stable once formed after the first few cell
divisions. A second, alternative model is that the telomere is
immediately formed after integration and long telomeres undergo
deletion events during colony growth to form the short telomeres.
In the first model, single-cell subclones derived from the mixed
telomere colonies should have either short telomeres or long
telomeres but not both. Long telomeres should be stable to
subsequent growth, and so transformants with long telomeres should
yield subclones with only long telomeres (Fig. 4A). In the second
model, where the long telomeres undergo deletion events, cells with
long telomeres should frequently give rise to subclones that have
mixed telomeres.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
The transformants with mixed telomeres are colonies
of cells with short or long telomeres. (A) Hypothesis for the
formation of single transformant colonies bearing mixed telomeres
and the predicted outcomes. After integration of the construction, the
cell replicates the telomere and divides prior to either elongating
the terminal 29 bp TG1-3 tract or deleting the terminal
29-bp tract and elongating the internal 256-bp tract. After these
events, the telomeres are stably maintained in separate cells
within the same colony. Subclones derived from single cells from these
individual transformants bearing two types of telomeres should have
either short or long telomeres but never both. (B) Genomic DNAs
from single colonies derived from a single YIpADH256-50
transformant bearing either mixed telomeres (lanes 2 to 11) or only
long telomeres (lanes 12 to 16). DNAs were cleaved with
PstI, which cleaves in URA3 (see panel A) and
analyzed as for Fig. 2. Lane 1 is DNA from a cell transformed with
YIpADH35. (C) Genomic DNAs from a single colony derived from
a single YIpADH256-138 transformant bearing long and short
telomeres (Fig. 3A, lane 14) cleaved with StuI and
analyzed as for Fig. 2 (lanes 2 to 15). Lane 1 is DNA from a cell
transformed with YIpADH35; lanes 16 to 18 are single-cell
subclones of the short telomere transformant in Fig. 3A, lane 12. In panels B and C, the chevron-headed arrows indicate long
telomeres that retain the nontelomeric spacer and hollow arrows
indicate short telomeres that have lost the spacer. All
transformants were in strain YM708.
|
|
Twenty single-cell subclones (ten each isolated from two
YIpADH256-50 colonies that contained mixed telomeres
similar to the transformant in Fig. 2B, lane 12) were examined for
telomere length. The clonal lines derived from the mixed
telomere colonies were of two types: some had only short
telomeres, while others had only long telomeres (10 clones
derived from a single colony are shown in Fig. 4B, lanes 2 to 11). No
clonal line derived from a single cell had either mixed telomeres
or telomeres of intermediate length. In addition, we examined five
single-cell clones derived from a colony with only short telomeres
and five single-cell clones derived from a colony with only long
telomeres. The clonal lines derived from the short-telomere
colony contained only short telomeres (not shown), and the lines
derived from long-telomere colonies contained only long
telomeres (Fig. 4B, lanes 12 to 16). Subclones from cells bearing
long telomeres grown for 40 generations gave rise to cells that had
only long telomeres (data not shown and reference
38), indicating that the long telomeres were
stably maintained. Of 15 long-telomere YIpADH256-50
clones examined, none contained mixed telomeres (Fig. 4B and data
not shown). Therefore, the short telomeres in the
mixed-telomere colonies did not arise from deletion events that
shorten the long telomeres during colony growth. These data agreed
with the first hypothesis (Fig. 4A) and strongly suggested that
telomere formation occurred after integration of the transforming
DNA and cell division.
Formation of mixed telomere colonies also occurred with the
larger 138- and 266-bp spacers (Fig. 3A and B). Four of the seven transformants bearing the 266-bp spacer contained mixed
telomeres, as did four of the seven YIpADH256-138
transformants. The mixed telomeres in these transformants were also
due to single cells containing either short or long telomeres
(shown for YIpADH256-138 in Fig. 4C). No single cells bearing
a mixed telomere or telomere of intermediate length were
isolated. Interestingly, one of the 138-bp spacer telomere mixed
transformants was not cleaved by BamHI (Fig. 3A, lanes 8 and
9) but did retain the spacer (shown below). This unusual transformant
deleted the BamHI site but not the rest of the spacer before
forming the long telomere.
The short telomeres in the mixed transformants could have arisen by
complete deletion of the spacer (Fig. 4A) or deletion of all but
38
bp of the spacer, which would not interfere with counting the internal
TG1-3 sequences (Fig. 2B). To determine if a portion of the
spacer was retained in some of the short telomeres, a PCR method
using a URA3 primer and primer 1, which hybridizes to the
junction of the spacer and the internal 256 bp TG1-3 tract (bases 301 to 318 of Fig. 1C), was developed to test for the presence of the most internal 12 bp of the spacer (Materials and Methods). As
expected, all eight long telomeres tested in this assay (seven bearing the 50-bp spacer and one bearing the 138-bp spacer) and five
mixed telomeres (two bearing the 50-bp spacer and three bearing the
138-bp spacer, including the transformant in Fig. 3A, lane 8) retained
these 12 bp of the spacer. In contrast, none of the 16 short
telomeres tested (2 YIpADH35 telomeres, 6 short
telomeres derived from the 50-bp spacer, and 8 derived from the 138 bp-spacer constructs) retained the internal 12 bp of the spacer. These
short telomeres included eight short telomere subclones derived
from three original transformants bearing mixed telomeres,
indicating that the short telomere in these mixed telomere
colonies lacked the entire spacer. Given that all of the short
telomeres lacking the BamHI site in Fig. 2 and 3 were in
the same size range, the most likely possibility is that all of them
had lost the entire spacer.
The hypothesis that explains the mixed telomeres in the
YIpADH256-50, -138, and -266 transformants (Fig. 4A) predicts
that the 26- and 38-bp spacers should also have formed colonies
with mixed telomeres. Of the eight colonies bearing the 26- or
38-bp spacer telomeres examined, two of the four 26-bp spacer and
three of the four 38-bp spacer telomere transformants
had telomeric restriction fragments that did not become less
heterogeneous after digestion with StuI plus
BamHI (data not shown), indicating that the majority of
cells in these four transformants lacked the BamHI site.
However, some cells in each of these transformants had the BamHI site as assayed by PCR. Therefore, the 26- and 38-bp
spacer telomeres also gave rise to mixed colonies in the same way
as the 50-, 138-, and 266-bp spacer telomeres did.
Mixed colonies were not observed in YIpADH652-42
transformants bearing the 42-bp spacer telomere with the 256-bp
tract in the opposite orientation (data not shown). This result may
reflect the observation that telomere sequences in the opposite
orientation are poor substrates for telomere formation
(36), and so degradation past the spacer would not allow
telomere formation and would not yield a viable transformant.
Cells measure one Rap1p molecule as 19 bp of TG1-3
sequences in vivo.
The irregular spacing of Rap1p sites within
yeast telomere sequences makes it unclear whether all Rap1p sites
are counted to monitor telomere length, and no experiments have yet
determined whether all Rap1p molecules are counted in vivo. This
information is particularly important because a model of yeast
telomere length regulation predicts that several Rap1p molecules at
the telomere-nontelomere junction do not participate in length
regulation (3, 8). To determine how many Rap1p
molecules are counted to measure telomere length, we varied the
spacing between six tandem Rap1p sites at the
telomere-nontelomere junction and determined the effect on telomere length. The fact that a 26- or 38-bp nontelomeric
spacer does not disrupt counting (Fig. 2 and 3) indicates that the cell can accommodate variable spacing between Rap1p sites. This
consideration indicates that if six Rap1p molecules are arranged in
regular arrays with different spacing, then they should be counted as a
constant length of TG1-3 sequences even though the total
DNA length of the Rap1p binding site array varies.
Synthetic telomeres containing arrays of six nontelomeric
Rap1p sites spaced once every 35, 18, or 13 bp were
constructed (YIpADHTEF telomeres [Fig.
5A]). Each repeat in the array contained a high-affinity, 13-bp Rap1p site from the TEF2 UAS
(4) (Materials and Methods). The 1-site-per-35-bp spacing
was chosen to match the frequency of exact matches to the Rap1p
consensus in TG1-3 sequences (48), the
1-site-per-18-bp spacing was chosen to match the frequency of in vitro
Rap1p binding to TG1-3 sequences (7), and the
1-site-per-13-bp spacing was chosen because molecular model
building based on the crystal structure of the Rap1p DNA binding
domain suggests that Rap1p molecules can bind as closely as once every
11 to 12 bp (17). The spacing between the 3' end and 5'
start of each Rap1p binding site in the phased arrays was 22, 5, or 0 bp for the sites spaced every 35, 18, or 13 bp, respectively. Since
these spacings were shorter than the 26-bp spacer that did not affect
the counting of internal TG1-3 sequences (Fig. 2B), the
nontelomeric DNA between the Rap1p sites should not affect counting
of Rap1p molecules. Cells bearing control telomeres with no insert
(the YIpADH35 telomeres [Fig. 1B]) or telomeres
containing lambda DNA inserts the same size as the TEF inserts, (the
YIpADH
telomeres [Fig. 5A]) were also constructed.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
Cells count one Rap1p molecule as ~19 bp of
TG1-3. (A) Telomere constructions contained either phased
arrays of Rap1p sites internal to the 29 bp TG1-3 tract or
the same-size fragment of DNA. The orientation of the Rap1p site
array is indicated by the arrowheads as in Fig. 1. The locations of the
BamHI site and the URA3 fragment used to probe
the Southern blots are shown. (B) Genomic Southern analysis of
telomeres bearing six Rap1p sites spaced one site every 18 bp in
strain KR36-6L. DNAs were digested with StuI or
StuI plus BamHI and analyzed by Southern blotting
using the URA3 probe shown in panel A. Two
YIpADH 108 telomeres were included as negative controls
for telomeres bearing inserts of equal size with no Rap1p sites.
The leftmost lane of B and C is DNA from the untransformed KR36-6L
strain; 35 denotes YIpADH35 (Fig. 1B). (C) Genomic Southern
analysis of telomeres bearing six Rap1p sites spaced one site every
35 bp in strain KR36-6L analyzed as for panel B (reprinted from
reference 38 with permission). A
YIpADH 210 telomere was included as a negative control
for an insert of equal size with no Rap1p sites. (D) Genomic Southern
analysis of telomeres in strain KR36-6L bearing six Rap1p sites
spaced one site every 35 bp. All DNAs were digested with
StuI. All lanes are from the same gel. (E) Genomic Southern
analysis of telomeres in strain KR36-6L bearing six Rap1p sites
spaced one site every 13 bp. A YIpADH 88 telomere was
included as a negative control for an insert of nearly equal size with
no Rap1p sites.
|
|
If the cell considers the TEF insert as part of the telomere and
the Rap1p site spacing in the TEF insert is close to the spacing of the
counted Rap1p molecules in the TG1-3 repeats, then the
sizes of the elongated YIpADH35 and YIpADHTEF
telomeric StuI fragments will be the same. If Rap1p
molecules alone are insufficient for the cell to consider the TEF
inserts as part of the telomere, then the sizes of the
elongated YIpADHTEF and elongated YIpADH
StuI fragments will be the same.
These synthetic telomeres (Fig. 5A) were transformed into yeast,
and Southern blot analysis of at least two independent transformants of
each type was performed to determine telomere length. In all cases,
the YIpADHTEF StuI fragments were shorter than the
control YIpADH
StuI fragments (Fig. 5B to E).
Thus, the array of nontelomeric Rap1p sites reduced the length of
the elongated TG1-3 tract when present in either
orientation, and so Rap1p molecules bound to non-TG1-3
sequences were counted in both orientations as part of the
telomere. Therefore, Rap1p molecules, and not TG1-3
sequences, served as the metric for telomere length regulation.
The StuI terminal restriction fragments of
YIpADH35 and YIpADHTEF18-6TG and
YIpADHTEF18-6CA were nearly identical in length (Fig. 5B).
Therefore, the 108-bp array of six nontelomeric Rap1p sites spaced
one every 18 bp functionally replaced the same length of
TG1-3 sequences. The length (in base pairs) of
TG1-3 that the cell equated with the array of Rap1p
molecules could be determined by comparing the modal telomere
length of the elongated TEF telomere to the modal length of the
negative control telomere. The lengths of the TEF and
telomeres were determined by measuring the point of most intense
hybridization. The difference between the average length of the
YIpADHTEF18-6 StuI fragments (which contained an insert counted by the cell as TG1-3 repeats) and the
average length of the YIpADH
108 StuI
fragments (which contained an insert not counted by the cell as
TG1-3) revealed the length in base pairs of
TG1-3 that the cell equated with the six Rap1p molecules.
The Rap1p arrays were counted as 114 bp (YIpADHTEF18-6TG) or
90 bp (YIpADHTEF18-6CA) of TG1-3 (Table
2). Thus, one Rap1p molecule was counted
as either 19.0 or 15.0 bp of TG1-3 DNA for these
telomeres.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Differently spaced, tandem Rap1p sites are counted
as similar lengths of TG1-3 sequences in the
YIpADHTEF telomeres
|
|
The YIpADHTEF35-6TG and -CA telomeres also possessed
elongated, terminal TG1-3 tracts that were shorter than the
control YIpADH35 terminal TG1-3 tract (Fig. 5C
and D). In these cases, the length of the array of Rap1p sites was 210 bp but was counted as 124 bp (TG orientation) or 128 bp (CA
orientation) of TG1-3 in comparison to the
YIpADH
210 telomere (Fig. 5C and D; Table 2). These
values indicate that one Rap1p molecule was counted as 20.7 or 21.3 bp of TG1-3 in the TEF35-6 telomeres. These data show that
when the cell measures telomere length, it can efficiently
compensate for variations in spacing between Rap1p sites that exceed
the equivalent number of base pairs of TG1-3 per Rap1p molecule.
The arrays of six Rap1p molecules spaced one every 13 bp in the
YIpADHTEF13-6TG and -CA telomeres were counted as either
106 bp (TG orientation) or 103 bp (CA orientation) of TG1-3
(Fig. 5E; Table 2). These results suggested that one Rap1p was
equivalent to 17.7 or 17.2 bp of TG1-3 DNA in these
telomeres. In this case, even though the molecules were more
closely spaced than the average spacing of Rap1p binding sites in
TG1-3 determined in vitro (7), the cell counted
the six Rap1p molecules as nearly the same length of TG1-3
DNA as when the Rap1p sites were spaced one every 18 or 35 bp.
Taken together, these data show that the cell can accommodate a
variable spacing of Rap1p molecules to measure a given length of
telomeric DNA. In all cases, the elongated tract of
TG1-3 sequences was shorter by 106 to 124 bp when the TEF
array was in the same orientation as the TG1-3 repeats and
90 to 128 bp when the TEF array was in the opposite orientation (Table
2), even though the size of the TEF array varied (from 78 to 210 bp).
The average number of bp of TG1-3 the cell equated with one
Rap1p molecule was 19.2 bp for sites in the correct orientation, 17.8 bp for sites in the opposite orientation, and 18.5 bp for all
sites tested here. These data indicate that for the six Rap1p
molecules at the telomere-nontelomere junction, each Rap1p
molecule was counted as ~19 bp of TG1-3.
Regularly spaced arrays of internal Rap1p sites
eliminate telomere length heterogeneity between
individual transformants.
The terminal chromosome
restriction fragment gives a dispersed band on Southern blots because
the length of a specific telomere fragment in individual cells
differs. An internal restriction fragment gives a sharp band because it
is the same length in all cells (e.g., the telomeric
StuI restriction fragments versus the StuI-BamHI fragments in Fig. 5). This terminal
restriction fragment length heterogeneity is due to sequence
differences between the terminal TG1-3 tracts of different
telomeres (48). An additional heterogeneity is observed
between telomeres formed in independent transformants, because when
new synthetic telomeres are formed, the sequence of all but the
first 11 bp of TG1-3 added is random (18, 48)
(Fig. 6A).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Phased arrays of Rap1p sites eliminate the length
variation between transformants. (A) Structures of steady-state
telomeres in independent transformants derived from the
YIpADH35 (35) and YIpADHTEF (TEF)
constructions. When telomeres are formed with YIpADH35,
90% of the telomere consists of newly synthesized
TG1-3 repeats. Since the TG1-3 sequences added
after the first 11 bp are random (18), each of the
independent YIpADH35 transformants will have a different
telomere sequence near the telomere-nontelomere junction.
In contrast, all of the YIpADHTEF telomeres retain the
same nontelomeric Rap1p sites at the junction. The terminal
120 to 150 bp of TG1-3 sequences for both the
YIpADH35 and YIpADHTEF telomeres are randomized
during cell growth (48), and so the only
differences between the YIpADH35 and YIpADHTEF
telomeres are the sequences near their telomere-nontelomere
junctions. (B) Genomic DNAs digested with StuI from seven
independent YIpADH35 transformants, five independent
YIpADHTEF35-6TG transformants, and four independent
YIpADHTEF35-6CA transformants (all in strain KR36-6L)
were analyzed by Southern blotting as for Fig. 5. All lanes are from
the same gel. The length of each telomere was measured at the point
indicated by the small white bar in each lane, which is the point of
most intense hybridization (the modal telomere length). The lengths
of the YIpADH35 telomeres varied over a ~60-bp range,
while the lengths of most of the YIpADHTEF35-6 telomeres
were within a ~10-bp range (see text). (C) The same DNAs as in panel
B were digested with StuI and BamHI to show that
the length heterogeneity between the independently formed telomeres
was due to different lengths of the terminal TG1-3
sequences.
|
|
To examine modal length variation in telomeres where almost all of
the TG1-3 sequences came from new synthesis,
telomeres from seven independent YIpADH35 transformants
were compared on the same blot. The size of the most intensely
hybridizing portion of these terminal restriction fragments, i.e., the
modal length, varied over a ~60-bp range (Fig. 6B; similar length
differences can also be observed in Fig. 5D). This heterogeneity
was due to variation in the length of the TG1-3
sequences because the length of the internal URA3
StuI-BamHI fragment was the same in all
YIpADH35 transformants (Fig. 6C).
In contrast to the YIpADH35 results, the array of six
internal Rap1p molecules eliminated much of the variation in modal
telomere lengths between individual transformants. All five of the
YIpADHTEF35-6TG telomeres and three of four
YIpADHTEF35-6CA telomeres had lengths that only varied
over an ~10-bp range (Fig. 6B). The length of the fourth
YIpADHTEF35-6CA telomere (Fig. 6B, lane 16) was within ~20 bp of the average TEF35-6 StuI fragment length. This
elimination of modal telomere length variation was significant
given that the elongated TG1-3 repeats on each of the
independently formed TEF telomeres should have a different terminal
TG1-3 sequence, because the sequence of the added
TG1-3 repeats should have been random (18) and
changed as the colony grew (48) while the internal sequences
were maintained (Fig. 6C). A similar lack of modal telomere
length heterogeneity was also observed among eight individual
YIpADHTEF18-6 transformants and among eight individual YIpADHTEF13-6 transformants (Fig. 5B and E and data not
shown). Thus, the modal telomere length heterogeneity between
individual YIpADHTEF transformants, each bearing the same
sequences at the telomere-nontelomere junction, was
significantly reduced compared to the length heterogeneity of
YIpADH35 telomeres, each bearing different
TG1-3 sequences at the junction. These results showed that
the conserved spacing of six Rap1p molecules at the
telomere-nontelomere junction in different transformants
had a significant effect on steady-state telomere length.
These results indicate that the change in modal telomere length was
due to TG1-3 sequences near the
telomere-nontelomere junction whereas the disperse nature of
the terminal restriction fragment was due to sequence variation in the
terminal TG1-3 repeats.
 |
DISCUSSION |
The placement of TG1-3 sequences or nontelomeric
Rap1p sites adjacent to the telomeric TG1-3 tract
caused yeast cells to maintain the TG1-3 tract at a shorter
equilibrium telomere length. These results indicated that yeast
measure telomere length by counting Rap1p molecules instead of
TG1-3 sequences. Yeast detected internal TG1-3
sequences as part of the telomere, or counted the internal sequences, across a 50-bp spacer. However, only part of the internal TG1-3 tract was counted across a spacer larger than 38 bp, and a 138-bp nontelomeric spacer was sufficient to establish a
new internal boundary and separate the telomere from the
subtelomeric sequences. Cells counted each of the six telomeric
Rap1p molecules in the TEF telomeres as ~19 bp of
TG1-3 in vivo. Interestingly, the conserved spacing of
Rap1p molecules near the telomerenontelomere junction in different
transformants eliminated the modal length heterogeneity commonly
observed between independent telomere formation events.
Cells transformed with the YIpADH256-XX telomere formed
colonies containing individual cells bearing either short or long telomeres (Fig. 2 to 4), and these telomere lengths were stably maintained over many divisions (Fig. 4; data not shown; reference 38). The mixed transformants occurred at high
frequency and with all nontelomeric spacers, suggesting that the
events that gave rise to them are normal cellular processes. A
hypothesis consistent with these findings is that after integration,
the original telomere construct was transiently stable for one or more cell divisions before either the terminal 29-bp TG1-3
tract was elongated or the terminal 29-bp TG1-3 tract was
deleted and the internal 256-bp tract was lengthened (see Results and
Fig. 4A). The high frequency of mixed transformants in the
YIpADH256-138 and -266 telomeres (Fig. 3A and B) suggests
that most integration events can give rise to a mixed transformant.
Therefore, these results strongly suggest that telomere formation
was not completed in the first cell cycle after integration.
The phased array of Rap1p sites at the telomere-nontelomere
junction in the YIpADHTEF telomeres showed that the
spacing between the six internal Rap1p molecules could be varied
widely and still be counted as nearly the same length of
TG1-3 sequences, such that 78 to 210 bp of
nontelomeric Rap1p sites was counted as 90 to 128 bp of
TG1-3. The results presented here indicate that yeast equated each Rap1p molecule with ~19 bp of TG1-3 (Table
2). In vitro experiments by others have shown that Rap1p bound to
cloned telomeric sequences at a frequency of slightly greater than
one molecule per 18 bp of TG1-3 (7). The fact
that the frequency of Rap1p binding sites in vitro and the equivalence
of Rap1p for a given amount of TG1-3 sequences in vivo is
so close indicates all of the Rap1p molecules near the telomere
DNA-nontelomere DNA junction participate in telomere length measurement.
All three arrays eliminated the modal length heterogeneity between
individual transformants (Fig. 5 and 6). Thus, all three arrays had
similar overall effects on the cellular telomere length measurement
apparatus in that the most internal Rap1p molecules can affect the
lengthening and shortening reactions that occur at the chromosome end.
These data indicate that the chromosome end and
telomere-nontelomere junction must somehow communicate when
telomere length is measured.
While this work was in progress, Marcand et al. showed that internal
TG1-3 sequences or fusion proteins containing the Gal4p DNA
binding domain and the Rap1p C terminus tethered internal to the
terminal TG1-3 tract could cause telomeres to be
maintained at a shorter equilibrium length (29). They
concluded that telomere length is regulated by a negative feedback
mechanism that counts Rap1p molecules. Their data and ours are
consistent with a wide variety of previous genetic experiments that
showed that titration of telomere components from chromosome ends
altered telomere length regulation (40) and that the
Rap1p C terminus tethers these components to telomeres (5, 13,
19, 20, 25, 51, 52). The use of the Gal4p-Rap1p fusion by Marcand
et al. required that only low levels of the protein be produced because
overexpression of the Rap1p C terminus causes telomere lengthening
(5, 12), most likely by titrating away negative telomere
length regulatory components (13, 52). Otherwise,
telomere lengthening caused by overproduction of the Rap1p C
terminus would mask the telomere shortening caused by tethering
Rap1p C termini to telomeric sites. This low level of fusion
protein raised the possibility that the Gal4p binding sites were not
completely occupied (footnote 18 in reference 29),
preventing quantitative analysis of the number of bp of
TG1-3 that the cell equates with one Rap1p. In
contrast, our approach was quantitative because the
nontelomeric Rap1p sites in this work did not perturb
the cellular levels of telomere length regulatory components.
Thus, the length change of these telomeres (Fig. 5) was due only to
the arrangement of Rap1p molecules at the telomere-nontelomere
junction. In addition, comparing the modal lengths of the
YIpADHTEF telomeres with the control YIpADH
telomeres allowed us to determine that the cell equates one Rap1p molecule with ~19 bp of TG1-3 in vivo (Table 2). Since
the spacing of Rap1p sites is one per 18 bp of TG1-3 in
vitro (7), our results indicate that all six of the arrayed
Rap1p molecules at the telomere-nontelomere junction
participated in telomere length measurement.
Models for telomere length measurement in yeast need to account for
the partial counting of the internal 256-bp TG1-3 tract across the 42- and 50-bp spacers (Fig. 2B), for a 138-bp
nontelomeric spacer establishing a new internal
telomere-nontelomere junction (Fig. 3A and C), for all
Rap1p molecules near the telomere-nontelomere junction
participating in telomere length measurement, and for the effect of
these Rap1p molecules on telomere length (Fig. 5 and 6). In
addition, a wide variety of studies in S. cerevisiae and
K. lactis indicate that the Rap1p C terminus at the ends of established telomeres plays an important role in limiting
telomere elongation (5, 12, 19, 20, 25). Finally, the
Rap1p C terminus at the telomere-nontelomere junction plays a
role in the transcriptional silencing of genes near the telomere by
nucleating a complex of proteins that then spreads internally by
coating chromatin with Sir3p (15, 27, 39, 44). Thus, a model
for yeast telomere length regulation must accommodate these
different functions.
One current model for telomere structure suggests that the
telomere is divided into counted and uncounted regions where the uncounted region consists of Rap1p molecules near the
telomere-nontelomere junction bound by Sir3p and Sir4p (3,
8). This model is inconsistent with our data showing that all
Rap1p molecules at the telomere-nontelomere junction are
counted by the cell. The recent data of Marcand et al. (29)
are also inconsistent with this model. Their studies showed that
tethering just two Rap1p C termini at the telomere-nontelomere
junction can cause the elongated TG1-3 tract to be
maintained at a length ~30 bp shorter than that of control
telomeres (29), indicating that at least one or possibly both of these Rap1p C termini participate in telomere length
measurement. Given our results that each Rap1p molecule at the
telomere-nontelomere junction is counted as ~19 bp of
TG1-3 (Table 2), both of these Gal4-Rap1p fusions must have
participated in telomere length measurement. However, data from
several labs indicate that the Sir3p-Rap1p interaction is required to
establish silencing of genes near telomeres (15, 27, 33,
44). A simple explanation to accommodate these two distinct Rap1p
functions is to propose that they are temporally separated, occurring
at different times in the cell cycle.
Our working model for telomere length measurement is that after
telomeres have been replicated, Rap1p molecules are counted by the
formation of a folded telomere structure that is dependent on many
weak interactions between Rap1p and negative regulators of telomere
length (Fig. 7). This model of the yeast
telomere as a highly folded structure is consistent with previous
studies showing that the chromatin that includes yeast
TG1-3 repeats is a single unit as defined by micrococcal
nuclease digestion (53). In addition, Rap1p binding causes a
90° to 100° bend in DNA in vitro (7), and ~18 Rap1p
molecules should be present in a 325-bp telomere, giving rise to a
highly folded structure. We hypothesize that many interactions between
Rap1p and other proteins constrain the folding of the TG1-3
sequences so that the chromosome end is brought close to the
telomere-nontelomere junction (Fig. 7). Formation of this
structure then blocks telomere elongation because the structure
itself blocks telomerase access to the chromosome end, or the
structure recruits an inhibitory complex that blocks telomerase
access. If the structure is not formed, telomere elongation by
telomerase may occur. We propose that subsequent to structure formation and elongation of short telomeres (Fig. 7), the yeast Ku
proteins may rebind to the chromosome terminus (10) and
recruit Sir proteins (46) to form the heterochromatin
complex of Sir proteins and Rap1p involved in telomeric
silencing. Once silencing is established, genes would then become
refractory to transcriptional activation by transactivators.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 7.
A working model for telomere length regulation.
Telomere length is monitored by counting Rap1p molecules to keep
telomeres within a set range of lengths. We propose that Rap1p
molecules are counted by the formation of a transient, highly folded
three-dimensional structure stabilized by many weak interactions
between Rap1p molecules and negative regulators of telomere length
(drawn here as a hairpin for simplicity). When the newly replicated
TG1-3 repeats are 325 ± 75 bp, a highly folded
structure that links the telomere-nontelomere junction to the
chromosome terminus forms. This structure blocks telomerase access
to the chromosome terminus, and thus telomere elongation, either by
sequestering the end or by recruiting an inhibitory complex (e.g., a
complex formed between the Rap1p C terminus, Cdc13p, and Stn1p
[9, 34]). When telomeres are short, the structure
is not formed, no inhibition occurs, and telomeres are elongated.
Lengthening of short telomeres would be enhanced by the Rap1p
molecules which are no longer sequestered by the folded structure
(38). Subsequent to these events, telomeric
heterochromatin is formed and maintained until the next S phase. A
simpler model that linked the telomere-nontelomere junction to
the chromosome terminus without counting the intervening sequences had
been previously proposed for K. lactis telomeres
(31).
|
|
A number of observations regarding yeast telomere function support
our model in limiting telomere length measurement and possible telomere elongation to a period late in S phase that is temporally separated from the establishment of telomere position effect or silencing. Telomere position effect can switch between
transcriptionally repressed and active states, and the repressed state
can be overcome by transcriptional activators only in S phase
(1), indicating that telomeric gene silencing is not
stably established at this point in the cell cycle. Late in S phase is
when telomeric DNA is replicated (30) and a 50- to
150-bp 3' extension of the TG1-3 strand is formed
(50); therefore, the telomere repeats are undergoing length changes at this time. Slow passage through S phase increases telomeric silencing (22), which is consistent with this
hypothesis (Fig. 7) because an increased amount of time after
telomere length measurement would allow assembly of telomeric
heterochromatin before the chromosome is refolded and the cell cycle
proceeds. So the hypothesis that length regulation occurs only in late
S phase just after telomeres are replicated, and that afterwards a
stable, transcriptionally silenced heterochromatin structure is
established and maintained until the next S phase, is consistent with
the current data on telomere replication and telomeric silencing.
Our model for telomere length regulation (Fig. 7) can explain all
of the results presented here. First, the slight counting differences
observed between the different TEF arrays (Table 2) would be due to one
set of arrays (e.g., TEF35-6) allowing more efficient structure
formation than another (e.g., TEF13-6) because the presentation of
Rap1p molecules is slightly different for each array. The more compact
Rap1p spacing in the TEF13-6 telomeres may make fewer
protein-protein interactions required to form the structure and block
telomerase access. As a result, a slightly longer terminal
TG1-3 tract is required to introduce an additional Rap1p
molecule to stabilize the structure. Second, all TEF telomeres have
nearly the same modal telomere length because the positioning of
the six Rap1p molecules at the telomere-nonte