Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 364-375, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
CA- and Purine-Rich Elements Form a Novel Bipartite
Exon Enhancer Which Governs Inclusion of the Minute Virus of Mice
NS2-Specific Exon in Both Singly and Doubly Spliced mRNAs
Anand
Gersappe and
David J.
Pintel*
Molecular Microbiology and Immunology, School
of Medicine, University of Missouri
Columbia, Columbia, Missouri
65212
Received 18 June 1998/Returned for modification 18 August
1998/Accepted 23 September 1998
 |
ABSTRACT |
The alternatively spliced 290-nucleotide NS2-specific exon of the
parvovirus minute virus of mice (MVM), which is flanked by a large
intron upstream and a small intron downstream, constitutively appears
both in the R1 mRNA as part of a large 5'-terminal exon (where it is
translated in open reading frame 3 [ORF3]), and in the R2 mRNA as an
internal exon (where it is translated in ORF2). We have identified a
novel bipartite exon enhancer element, composed of CA-rich and
purine-rich elements within the 5' and 3' regions of the exon,
respectively, that is required to include NS2-specific exon sequences
in mature spliced mRNA in vivo. These two compositionally different
enhancer elements are somewhat redundant in function: either element
alone can at least partially support exon inclusion. They are also
interchangeable: either element can function at either position. Either
a strong 3' splice site upstream (i.e., the exon 5' terminus) or a
strong 5' splice site downstream (i.e., the exon 3' terminus) is
sufficient to prevent skipping of the NS2-specific exon, and a
functional upstream 3' splice site is required for inclusion of the
NS2-specific exon as an internal exon into the mature, doubly spliced
R2 mRNA. The bipartite enhancer functionally strengthens these termini:
the requirement for both the CA-rich and purine-rich elements can be
overcome by improvements to the polypyrimidine tract of the upstream
intron 3' splice site, and the purine-rich element also supports exon
inclusion mediated through the downstream 5' splice sites. In summary,
a suboptimal large-intron polypyrimidine tract, sequences within the
downstream small intron, and a novel bipartite exonic enhancer operate
together to yield the balanced levels of R1 and R2 observed in vivo. We suggest that the unusual bipartite exonic enhancer functions to mediate
proper levels of inclusion of the NS2-specific exon in both singly
spliced R1 and doubly spliced R2.
 |
INTRODUCTION |
Recent evidence indicates that in
vertebrates, exons rather than introns may be the primary units of
recognition during pre-mRNA splicing. Multiple splicing factors can
bind cooperatively to splice sites flanking the exon and communicate
across the exon (17, 19, 23, 35, 41, 51; reviewed in
references 2, 3, 12, 34, and 50).
Work in a number of laboratories has suggested that a strong downstream
5' splice site can facilitate splicing of an upstream intron by
strengthening its 3' splice site via a network of protein interactions
across the intervening exon (17, 19; reviewed in
references 2 and 3).
Many exons are known to also contain auxiliary splicing elements known
as exonic splicing enhancers (ESEs) (9, 10, 14, 15, 18, 22, 24,
25, 36, 38, 40, 42, 46, 49, 51-54). While most ESEs have been
found in exons that are associated with alternative splicing events,
they can also be found in constitutive exons. ESEs are associated
with introns containing weak flanking splice sites and have been shown
to function by strengthening interactions at upstream 3' splice
sites (4, 24, 38, 40, 44-46, 51-53). The majority of ESEs
that have been identified are purine-rich repeats of the canonical
sequence GARGARGAR; however, non-purine-rich
enhancers have also been identified (9, 11, 43, 44, 49, 51).
Activation of purine-rich ESEs requires the binding of essential
splicing factors called SR proteins (24, 33, 39;
reviewed in references 12 and
26), and protein-protein interactions between SR
proteins and other splicing factors are thought to contribute to the
cooperative assembly of early splicing complexes (2, 12, 26,
34).
Recently, a new class of non-purine-rich enhancers with CA-rich motifs
(called ACEs) was identified by in vivo selection experiments, and
individual selected ACEs were found to enhance splicing both in vivo
and in vitro (9). For example, the well-characterized Drosophila doublesex (dsx) splicing enhancer
(dsxRE) contains a CA-rich motif (25, 44) that
enhances the splicing of a vertebrate exon in vertebrate cells
(9), and an ACE within cTNT exon 16 has recently been shown
to promote the binding of U2AF65 to the upstream 3' splice
site of a heterologous transcript in vitro (51).
The parvovirus minute virus of mice (MVM) is organized into two
overlapping transcription units, which produce three major transcript
classes, R1, R2, and R3 (1, 6, 31) (Fig. 1). mRNAs R1 and R2
are generated from a promoter (P4) at map unit 4 (7, 31) and
encode the viral nonstructural proteins NS1 and NS2, respectively. Both
NS1 and NS2 play essential roles in viral replication and cytotoxicity
(8), and so maintenance of their relative steady-state
levels is critical to the MVM life cycle. P4-generated pre-mRNAs
undergo alternative splicing, which determines the relative steady
state ratios of mRNAs R1 and R2, thereby influencing the relative
ratios of NS1 and NS2, respectively (5, 21, 28). There is
approximately twice as much R2 as R1 present throughout infection of a
wide variety of cell types (8, 55, 57), and all MVM mRNAs
are very stable (37). The constitutive, alternative splicing
of MVM pre-mRNAs must be accomplished solely by the interactions
between cellular factors and viral cis-acting signals,
because no viral proteins participate in this process (32).
There are two types of introns in MVM P4-generated transcripts. An
overlapping downstream small intron, located between nucleotides (nt)
2280 and 2399, is common to both P4-generated transcripts (R1 and R2)
and P38-generated transcripts (R3). This small intron undergoes an
unusual pattern of overlapping alternative splicing by using two donors
(D1 and D2) and two acceptors (A1 and A2) within a region of 120 nt
(28). The determinants governing excision of the small
intron are complex, and the intron appears to be excised by a hybrid of
intron and exon definition mechanisms (16).
An upstream large intron, located between nt 514 and 1989, is also
excised from a subset of P4-generated pre-mRNAs to generate R2 mRNA.
This upstream intron utilizes a nonconsensus donor and has a weak
polypyrimidine tract, as defined by the presence of several
interrupting purines, at its 3' splice site. Excision of this intron
from P4-generated pre-mRNA and the generation of the R2 mRNA require
inclusion of the intervening NS2-specific exon as an internal exon.
The NS2-specific exon is an unusual internal exon in several ways.
First, it occupies an unusual position flanked by a large intron
upstream and a small intron downstream, in contrast to most vertebrate
internal exons, which are flanked by large introns on both sides.
Second, it is 290 nt, i.e., within the upper 5% of vertebrate exon
size limits (2). Finally, the alternatively spliced
NS2-specific exon is translated in two open reading frames (ORFs): when
included in singly spliced R1, this exon is translated in ORF3 to
encode NS1; when included in doubly spliced R2, the exon is translated
in ORF2 to encode NS2.
We have previously shown that efficient excision of the upstream intron
from P4-generated pre-mRNA depends upon the initial presence of
downstream small intron sequences, including at least one downstream 5'
splice site and one downstream 3' splice site, within the pre-mRNA
(55, 57); prior splicing of the small intron, however, is
not necessary. In the absence of both the downstream intron 5' splice
sites (which constitute the 3' terminus of the NS2-specific exon), a
new spliced product (here called the exon-skipped product [ES]) not
seen during viral infection is produced, in which the NS2-specific exon
is skipped and the upstream intron 5' splice site at nt 514 is joined
to a downstream intron 3' splice site (55), predominantly A1
at nt 2377. Improvement of the polypyrimidine tract of the upstream
intron 3' splice site (which constitutes the 5' terminus of the
NS2-specific exon) not only can render its efficient excision
independent of downstream intron sequences but also can suppress exon
skipping caused by deletion of both the small intron donors
(55). Inclusion of the NS2-specific exon also requires
sequences within the exon itself; replacement of the entire exon by a
heterologous exon sequence also results in uniform exon skipping
(56). Finally, multiple determinants that govern excision of
the small intron, including its small size and a G-rich intronic
enhancer sequence, also participate in inclusion of the upstream
NS2-specific exon (16).
In this study, we have performed an extensive mutational analysis of
NS2-specific exon sequences, both at the termini and within the exon.
We have identified a novel bipartite exonic enhancer, consisting of an
unusual combination of CA-rich and purine-rich enhancer elements
located at the 5' and 3' ends of the exon, respectively, that have at
least partially redundant functions and function to mediate the proper
levels of inclusion of the NS2-specific exon in both singly spliced
(R1) and doubly spliced (R2) mRNA.
 |
MATERIALS AND METHODS |
Mutant construction.
Construction of p
D1/2, p4T
D1/2,
p5A, p1989, pEx(
), and pEx(
) has been described previously
(55, 56). The mutants pEx(
) and pEx(
) were
generated by substituting two copies of NS2-specific exonic sequences
from nt 2005 to 2270 in either the forward or reverse orientation,
respectively, between the SmaI (nt 2005) and SmaI
(nt 2270) sites of pEx(
) by standard recombinant DNA techniques.
[RNA generated by the parent construct, pEx(
), which contains two
SmaI sites engineered at nt 2005 and 2270, was spliced identically to that of wild type (13, 56).] All the final mutant clones were sequenced to confirm that only the desired mutations
were introduced.
Mutants p1T
D1/2, p2T
D1/2, and pCSD
D1/2 were constructed by
subcloning fragments containing the 1T, 2T, and CSD mutations, respectively (described previously in references 55
and 57), into p
D1/2 by standard recombinant DNA
techniques and sequenced to ensure that only the desired mutations were introduced.
The parent construct for the p

SX, p

XP, p

PH, p

HS,
p

Sma-Hinc, and p

Xho-Sac mutants was made by introducing unique
SmaI
(nt 2005) and
SacI (nt 2270) restriction
sites into the wild-type
clone of MVM by M13-based site-directed
mutagenesis (
29), so
that the highly conserved exon
sequences at the 3' splice site
of the upstream large intron and those
for the donor site of the
downstream small intron were left intact. The
deletions were performed
in a pUC19 clone that contains MVM nt 1854 to
2378 with the engineered
SmaI sites at nt 2005 and 2270, using the restriction sites at
nt 2005 (
SmaI), 2072 (
XhoI), 2126 (
PstI), 2178 (
HincII),
and 2270
(
SacI (see Fig.
2A). Fragments containing the
individual mutations
were subcloned back into the plasmid clone of
full-length MVM.
RNA generated by the parent construct containing the
SmaI (nt
2005) and
SacI (nt 2270) sites was
spliced like that of the wild
type (
13). p

SX and p

HS
were combined to generate p

SX+

HS,
pCSD and p

SX+

HS were
combined to generate pCSD

SX+

HS, and p5A
and p

HS were combined
to generate p5A

HS by standard recombinant
DNA techniques.
p4T

SX+

HS was generated by initially cloning
an MVM fragment
containing the

HS deletion into the plasmid clone
of MVM containing
the 4T and
SmaI site (nt 2005) mutations to
generate
p4TSma

HS and subsequently deleting the region between
SmaI (nt 2005) and
XhoI (nt 2270) in this mutant.
All the final
mutant clones were sequenced to confirm that only the
desired
mutations were
introduced.
The mutants pSX1(

) and pHS2(

), as well as those with the smaller
deletions within the SX and HS regions of the exon including
p

SX1
and p

HS2, were constructed by M13-based oligonucleotide
mutagenesis
as previously described (
29). Mutant oligonucleotides
were
homologous to the viral DNA except at the nucleotides which
were to be
altered or deleted. For the changes made in these mutants,
see Fig.
2A
and
3A. pSX1(

) and pHS2(

) were combined to generate
pSX1(

)+HS2(

), and p

SX1 and p

HS2 were combined to generate
p

SX1+

HS2 by standard recombinant DNA techniques. All the final
mutant clones were sequenced to confirm that only the desired
mutations
were introduced. Unlike the larger exon deletions described
above,
pSX1(

), pHS2(

), pSX1(

)+HS2(

), p

SX1, p

HS2, and
p

SX1+

HS2
do not contain
SmaI (nt 2005) and
SacI (nt 2270)
sites.
To generate the mutants pSX1(CA1)+

HS2, pSX1(CA2)+

HS2,
pSX1(AG1)+

HS2, p

SX1+HS2(CA1), p

SX1+HS2(CA2), and
p

SX1+HS2(AG1),
top- and bottom-strand oligonucleotides for
either the CA1, CA2,
or AG1 sequences were annealed and ligated into
unique
Msc1 sites
created by either the

SX1 region or the

HS2 region of p

SX1+

HS2.
For the sequences of the CA1, CA2, and
AG1 oligonucleotides, see
Fig.
4A. To generate the mutants
pSX1(AG2)+

HS2 and p

SX1+HS2(AG2),
an 18-nt spacer region was
inserted into unique
Sma sites created
by either the SX(AG1)
region of pSX1(AG1)+

HS2, or the HS2(AG1)
region of p

SX1+HS(AG1).
The sequences of AG1 and AG2 are identical
except for the mutant
spacers which separate the purine-rich regions
within these
oligonucleotides (the sequence of the 5-nt mutant
spacer in the AG1
oligonucleotide is 5' CCCGG 3', and the sequence
of the 23-nt mutant
spacer in the AG2 nucleotide is 5' CCCGCTCGAATGGCTGGATTCGG
3',
compared to the 22-nt wild-type spacer sequence
5'-CGTGCTTCGGTGCGGAACCGTT
3') (see Fig.
4A). All the final
mutant clones were sequenced
to confirm that only the desired mutations
were
introduced.
Transfection and RNA isolation.
Murine A92L cells, the
normal tissue culture host for MVM(p), were grown as previously
described (31) and transfected with wild-type and mutant MVM
plasmids by using either DEAE-dextran (30) or
Lipofectamine-Plus reagent (as described in the Lipofectamine-Plus reagent kit [Gibco BRL]). RNA was typically isolated 48 h
posttransfection, after lysis in guanidinium thiocyanate, by
centrifugation through CsCl exactly as previously described
(37).
RNA analysis. (i) RNase protection assays.
RNase protection
assays were performed as previously described (37), with an
[
-32P]UTP-labeled, SP6-generated antisense MVM RNA
probe from either MVM nt 385 to 652 (probe A) or nt 1854 to 2378 (probe
B) (Fig. 1). Probe A identifies all P4 products and distinguishes
between R1 and the RNAs that use the nt 514 donor (R2+ES). Probe B
extends from before the 3' splice site of the large intron to within
the small intron common to all MVM RNAs and distinguishes between P4
(R1 and R2) and P38 (R3) species using the large intron 3' splice site
and either of the alternative small-intron donors (designated M for the
major splice donor [D1] at nt 2280 and m for the minor splice donor
[D2] at nt 2317 [37]). Unspliced P4 and unspliced P38 products are designated R1un and R3un, respectively. R1,
R2, and R3 RNAs using D1 at nt 2280 (Fig. 1) are designated R1M, R2M,
and R3M, respectively. R1, R2, and R3 RNAs using D2 at nt 2317 (Fig. 1)
are designated R1m, R2m, and R3m, respectively. Thus, probe B can
distinguish between unspliced, minor, and major forms of both R1 and
R2; however, it cannot detect the ES. For analysis of RNA produced
after transfection with mutants containing mutations within this region
covered by probe B (p
D1/2, p1T
D1/2, p2T
D1/2, and p4T
D1/2),
antisense RNase protection probes homologous to the mutants being
analyzed were used. RNase protection products were analyzed on a
Betagen
-scanning phosphorimage analyzer, and molar ratios of MVM
RNA were determined by standardization to the number of uridines in
each protected fragment.
(ii) Quantitative RT-PCRs.
First-strand cDNA synthesis used
5 µg of total RNA isolated after transfection and oligonucleotide dT
priming by standard techniques (20). PCR detection of R2 and
ES was performed with primers a and b (Fig. 1) as described previously
(56) with minor modifications (6a). The forward
primer (designated a in Fig. 1) was 5'-end labeled with
[
-32P]ATP (as described in reference
27) and added to a 15-cycle PCR mixture (94°C for
1 min, 55°C for 1 min, and 72°C for 1 min, followed by a single
extension at 72°C for 5 min). The ratio of the two products did not
vary detectably over a wide range of dilutions and cycle numbers (15, 20, and 30 cycles). PCR products were run on 6% acrylamide-urea gels
and analyzed on a Betagen
-scanning phosphorimage analyzer, to
calculate molar ratio of R2 to ES and obtain a direct value of percent
R2/(R2+ES) (see Fig. 5A and D).
To demonstrate that our reverse transcription PCR (RT-PCR) assay was
quantitative and accurately reflected the true ratio
of R2 to ES in
total RNA, direct percent R2/(R2+ES) values obtained
from RT-PCR for
several mutants were compared to indirect percent
R2/(R2+ES) values
obtained by using quantitative RNase protection
analyses with probes A
and B. For an example of these analyses,
see Fig.
5. First, RNase
protection probe A (Fig.
1) was used
to
determine the ratio of molecules using the upstream intron
donor at nt
514 (R2+ES) relative to R1 [(R2+ES)/R1; see Fig.
5B
and Table
1]. RNase protection probe B (Fig.
1)
was then used
to establish a quantitative ratio of R2 molecules
relative to
R1 molecules (R2/R1; see Fig.
5C and Table
1). These
analyses
then enabled the indirect determination of the ratio between
R2
and (R2+ES) [indirect percent R2/(R2+ES); Table
1]. Direct percent
R2/(R2+ES) values obtained by quantitative RT-PCR (see Fig.
5D
and
summary in Fig.
5A) varied by no more than 7% from the indirect
percent R2/(R2+ES) values obtained from comparison of quantitative
RNase protection assays (Table
1) when tested multiple times
with a
panel of 15 different mutants with different percent R2/(R2+ES)
values
(
13). For example, compare RT-PCR and RNase protection
values for wild-type p

D1/2, p1T

D1/2, p2T

D1/2, and p4T

D1/2
constructs (see Fig.
5A and Table
1). RNase protection assays
also
showed that mutant RNAs accumulated to wild-type levels.
Furthermore,
the direct percent R2/(R2+ES) value obtained from
RT-PCR varied by no
more than 4% over a series dilution of template
cDNA and over a range
of 15, 20 or 30 cycles (
13). Such analyses
allowed us to
obtain an indirect percent R2/(R2+ES) value (Table
1) which varied by
no more than 7% from the direct percent R2/(R2+ES)
value obtained by
the RT-PCR assay (Fig.
5A).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic map of MVM. The three major transcript classes
and protein-encoding ORFs are shown. The two promoters (P4 and P38) are
indicated by arrowheads. The large intron, small intron, and
NS2-specific exon are indicated. The nonconsensus donor (ncD) and the
poor polypyrimidine tract [poor (Py)n] of the large intron are also
shown. The bottom diagram shows nucleotide locations, the two probes (A
[nt 385 to 650] and B [nt 1854 to 2378]) used for RNase protection
assays, and the two primers [a (nt 326 to 345) and b (nt 2557 to
2538)] used for RT-PCR, as described fully in Materials and Methods.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Indirect measure of the percent R2 relative to (R2+ES)
molecules in mRNA generated by either wild-type MVM or the mutants
indicated, as determined by RNase protection assays with probes A
and B
|
|
For some of the mutants, the relative amounts of R1, R2, and ES were
also calculated as a percentage of the total P4-generated
product (see
Table
2). These calculations, for all mutants except
p5A

HS, were
done by using the (R2+ES)/R1 ratio (obtained by RNase
protection
analysis with probe A), the R2/R1 ratio (obtained by
RNase protection
analysis with probe B), and the indirect %R2/(R2+ES)
value (obtained
as explained above). For p5A

HS, these calculations
were done by
using the (R2+ES)/R1 ratio (obtained by RNase protection
analysis with
probe A) and the direct percent R2/(R2+ES) value
(obtained from
quantitative RT-PCR).
 |
RESULTS |
A bipartite enhancer within the NS2-specific exon is required for
inclusion of this exon in mature spliced mRNA.
To assess the
relative accumulated levels of the P4-generated R2 and ES, we first
established a quantitative RT-PCR assay, whose results were validated
indirectly by quantitative RNase protection assays as described in
Materials and Methods. We have previously shown that sequences within
the NS2-specific exon are required for its inclusion in mature spliced
mRNA (56). To further define the sequences required for
efficient exon inclusion, RNA generated from mutants containing single
deletions of regions within the exon was examined. Efficient inclusion
of the NS2-specific exon was maintained following deletion of any of
four regions alone (p
SX, p
XP, p
PH, and p
HS [Fig.
2A], as detected by quantitative RT-PCR
in Fig. 2B [summarized in Fig. 2A]). RNase protection analysis confirmed that P4 RNA generated by all these mutants exhibited a
wild-type ratio of R1 to R2 (13). Deletion of the SX and HS regions together (p
SX+
HS, Fig. 2A), however, resulted in
substantial skipping of the NS2-specific exon (Fig. 2A and C). RNase
protection assays showed that p
SX+
HS generated little R1 mRNA
(13), demonstrating that the majority of the P4 product
generated by the p
SX+HS mutant skipped the NS2-specific exon.
Deletions of approximately the same size as (p
Sma-Hinc) or somewhat
larger than (p
Xho-Sac) p
SX+
HS (Fig. 2A), which contain the
HS and SX elements alone, respectively, still allowed substantial exon
inclusion (Fig. 2A and C). These data suggested a model in which the SX
and HS regions function as two essential elements that have
significantly redundant functions in governing the inclusion of the
NS2-specific exon into mature mRNA. The difference in exon inclusion
between p
Sma-Hinc (which retains the HS region) and p
Xho-Sac
(which retains the SX region), however, suggested that at least in the
context of these smaller mutant exons, the HS region plays a more
critical role in exon inclusion, an observation which is further
supported by point mutagenesis of the HS region described below.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
A bipartite enhancer within the NS2-specific exon is
required for inclusion of this exon in mature spliced mRNA. (A) The
restriction sites within the NS2-specific exon (SmaI,
XhoI, PstI, HincII, and
SacI) which divide the exon into four regions (SX, XP, PH,
and HS) and were used to generate the different exon deletion mutants
are indicated ( SX, for example, is a deletion between the
SmaI and XhoI sites [see the text]). The SX1 to
SX3 and HS1 to HS3 regions extend between the following nucleotide
positions: SX1, nt 2002 to 2025; SX2, nt 2019 to 2052; SX3, nt 2050 to
2109; HS1, nt 2177 to 2196; HS2, nt 2196 to 2253; HS3, nt 2252 to 2270 (MVM nucleotide numbers as in reference 1).
Quantitations of the direct percent R2/(R2+ES) ratio obtained by RT-PCR
analysis for various mutants are also shown. All the values are the
average of at least three separate experiments. Standard deviations are
indicated in parentheses. ES values for p D1/2 are shown for
comparison; the mutation is shown in Fig. 5A. (B) RT-PCR analysis of
RNA generated by wild-type MVM (WT), mutants (described in the text),
or mock transfected, as designated at the top of each lane. Samples
were run on a 6% acrylamide urea gel. p D1/2 was used as a control
for amplification of the ES. WT( RT) is a control reaction with
wild-type RNA but excluding reverse transcriptase. An RNase protection
analysis, with probe B, of RNA generated by the wild type was used as a
marker (MARKER; the sizes of the marker bands are shown on the left)
for the sizes of the RT-PCR-amplified bands. Wild-type RNA generated a
658-nt amplified R2 product, while RNA generated by the mutants showed
R2 products of sizes consistent with the sizes of the deletions in
these mutants. As explained in the legend to Fig. 5D, two kinds of
amplified ES, using either A1 or A2, were observed. (C) RT-PCR analysis
of RNA generated by wild-type MVM (WT), mutants (described in the
text), or mock transfected, as designated at the top of each lane.
Samples were run on a 6% acrylamide-urea gel. p D1/2 and WT( RT)
controls, and the marker (MARKER; the sizes of the marker bands are
shown on the right for the sizes of the RT-PCR-amplified bands) are as
in panel B. Wild-type RNA generated a 658-nt amplified R2 product,
while RNA generated by the mutants showed R2 products of sizes
consistent with the sizes of the deletions in these mutants. As
explained in the legend to Fig. 5D, two kinds of amplified ES using
either A1 or A2 were observed.
|
|
The SX and HS elements were each further subdivided into three regions,
designated SX1 to SX3 and HS1 to HS3, respectively
(Fig.
2A). All
single mutants and all possible combinations of
single mutants were
tested, and all permitted near-wild-type levels
of exon inclusion
(
13), except a mutant with both the SX1 and
HS2 regions
deleted (p

SX1+

HS2; Fig.
2A and C). These results
suggested that
the 22-nt SX1 and the 53-nt HS2 regions contained
the elements
important for exon inclusion found in the larger
SX and HS regions,
respectively. The SX1 region contains two CA-rich
elements separated by
6 nt and followed by a purine-rich sequence,
while the HS2 region
contains two purine-rich elements separated
by a 22-nt spacer (see Fig.
3A). The NS2-specific exon was retained
more efficiently in RNA
generated by p

SX1+

HS2 than it was for
p

SX+

HS (Figs.
2A and
C); however, the level of exon inclusion
in RNA generated by
p

SX1+

HS2 was similar to that seen for a
mutant in which both the
SX1 and the complete HS regions were
deleted together (
13).
This suggested either that the larger
SX region contained additional
exon-defining elements or that
in construction of the p

SX1+

HS2
mutant an exon enhancer-like
element was inadvertently created. Upon
inspection, it was noted
that the deletion junction generated in

SX1
formed a new 6-nt
CA-rich motif (CCACTC) that could potentially
function as such
an enhancer
element.
As expected, disruption of the SX1 element alone by point mutation
[pSX1(

); Fig.
3A] sustained efficient
inclusion of the
NS2-specific exon (Fig.
3). Surprisingly, in contrast
to results
seen with deletion of either the complete HS region (p

HS;
Fig.
2A and B) or the HS2 region alone (
13), disruption of
the HS2
element alone by point mutation [pHS2(

); Fig.
3A] resulted
in
inefficient inclusion of the NS2-specific exon (to 34% as seen
in
Fig.
3). Thus, it appeared that the role of the purine-rich
HS2 element
was more significant for inclusion of the wild-type
length exon;
however, the possibility that a negatively acting
element was created
in pHS2(

) cannot be ruled out. It is unlikely
that the deletion
junction in p

HS2 created a positively acting
element, however,
because the exon was similarly included in both
p

HS (Fig.
2) and
p

HS1+p

HS2 (data not shown), which have different
deletion
junctions. Disruption of both the SX1 and HS2 elements
together by
point mutations [pSX1(

)+HS2(

); Fig.
3A] resulted
in NS2-specific
exon skipping (Fig.
3) to levels similar to that
seen with deletion of
the larger SX and HS regions together (p

SX+

HS;
Fig.
2A and B).

View larger version (18K):
[in this window]
[in a new window]

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Point mutations within the bipartite enhancer result in
exon skipping. (A) The sequences of the wild-type and mutant SX1 and
HS2 regions are shown underneath their appropriate map positions (with
deviations from the wild-type sequence underlined), together with
quantitations of the direct percent R2/(R2+ES) ratio obtained by RT-PCR
analysis for each mutant. The CA-rich sequences in the SX1 region and
the purine-rich sequences in the HS2 region are boxed and in boldface
type. All the values are the average of at least three separate
experiments. Standard deviations are indicated in parentheses. ES
values for p D1/2 are shown for comparison; the mutation is shown in
Fig. 5A. wt, wild type sequence. (B) RT-PCR analysis of RNA generated
by wild-type MVM (WT), mutants (described in the text), or mock
transfected, as designated at the top of each lane. Samples were run on
a 6% acrylamide-urea gel. p D1/2 and WT( RT) controls and MARKER
(the sizes of the marker bands are shown on the right) are as described
in the legend to Fig. 2B. RNAs generated by either the wild type or the
point mutants showed a 658-nt amplified R2 product. As explained in the
legend to Fig. 5D, two kinds of amplified ES, using either A1 or A2,
were observed.
|
|
A CA-rich element and a purine-rich element together constitute the
bipartite enhancer of the NS2-specific exon.
To determine which
sequences within the SX1 and HS2 regions were the exon-defining motifs,
we added both wild-type and mutant variants of the CA-rich element (CA1
and CA2, Fig. 4A) or the purine-rich
element (AG1 and AG2; Fig. 4A) back to a mutant in which the SX1 and
HS2 regions had been deleted (p
SX1+
HS2; Fig. 4A). Replacement of
either the SX1 or HS2 regions of p
SX1+
HS2 with an oligonucleotide
containing the two native CA-rich motifs separated by a 6-nt mutant
spacer (CA2) [pSX1(CA2)+
HS2, p
SX1+HS2(CA2); Fig. 4A]
restored exon inclusion to the parent construct (as shown by
quantitative RT-PCR [Fig. 4]) to the same level as achieved by
replacement with the authentic wild-type CA-rich element (CA1) [pSX1(CA1)+
HS2 (Fig. 4); p
SX1+HS2(CA1)
(13)]. These results demonstrate that the CA-rich motifs
within the SX1 region (and not the linker region) confer enhancer
activity and that these sequences can function at either enhancer
position, independent of the local sequence environment.

View larger version (25K):
[in this window]
[in a new window]

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
A CA-rich element and a purine-rich element together
constitute the bipartite enhancer of the NS2-specific exon. (A) The
sequences of the CA-rich and AG-rich oligonucleotides that were tested
(deviations from the wild-type sequence are underlined; the sequences
of the wild-type spacer in HS1 or the mutant spacers in AG1 and AG2 are
described in Materials and Methods), and the positions at which they
were replaced into p SX1+ HS2 are indicated (see the text for
details). The CA-rich sequences in the SX1 region and the purine-rich
sequences in the HS2 region are boxed and in boldface type.
Quantitations of the direct percent R2/(R2+ES) ratio obtained by RT-PCR
analysis for each mutant are also shown. All the values are the average
of at least three separate experiments. Standard deviations are
indicated in parentheses. WT, wild-type sequence. , deletion. (B)
RT-PCR analysis of RNA generated by wild-type MVM (WT), mutants
(described in the text), or mock transfected, as designated at the top
of each lane. Samples were run on a 6% acrylamide urea gel. p D1/2
and WT( RT) controls and MARKER (the sizes of the marker bands are
shown on the left) are as described in the legend to Fig. 2B. RNA
generated by WT showed a 658-nt amplified R2 product, while RNA
generated by the mutants showed R2 products of sizes consistent with
the sizes of the deletions and/or substitutions in these mutants. As
explained in the legend to Fig. 5D, two kinds of amplified ES, using
either A1 or A2, were observed.
|
|
Replacement of the 3' HS2 region of p

SX1+

HS2 with
oligonucleotides containing the native purine-rich sequences separated
by a mutant spacer of the native length (AG2) or a shortened 5-nt
mutant spacer (AG1) [p

SX1+HS2(AG2) and p

SX1+HS2(AG1)
respectively;
Fig.
4A] also resulted in efficient exon inclusion (Fig.
4), demonstrating
that the purine-rich motifs within the HS2 element
can confer
enhancer activity. The correctly spaced purine rich element
(AG2)
was also capable of restoring efficient exon inclusion when it
replaced the 5' SX1 region in p

SX1+

HS2 [pSX1(AG2)+

HS; Fig.
4]. Replacement of the SX1 region with the purine-rich sequence
with a
short spacer (AG1) [pSX1(AG1)+

HS; Fig.
4A], however, resulted
in
an even greater loss of exon inclusion (Fig.
4), suggesting
that
perhaps the native configuration was required to function
at a location
previously occupied by a CA-rich
element.
These results demonstrated that the compositionally different CA and
purine-rich elements were at least partially redundant
and were able to
function in a heterologous sequence context.
These elements could
functionally substitute for each other in
inclusion of the NS2-specific
exon at either their original locations
or each other's locations in a
manner independent of the local
sequence
environment.
The requirement of either the downstream 5' splice sites or the
bipartite exonic enhancer for exon inclusion can be overcome by
improvement of the upstream 3'-splice-site polypyrimidine tract.
The native NS2-specific exon is flanked upstream by a poor 3' splice
site (the exon 5' terminus) and downstream by an overlapping small
intron with fairly consensus, although closely spaced, 5' splice sites
(the exon 3' terminus). Deletion of the two downstream 5' splice sites,
which leaves the NS2-specific exon without a strong terminus at either
end, resulted in almost uniform skipping of this exon. This skipping
could be suppressed by making even subtle improvements of the upstream
3'-splice-site polypyrimidine tract (p
D1/2, p2Tppt
D1/2,
p4Tppt
D1/2 [Fig. 5A]; shown by
quantitative RT-PCR analysis and comparative RNase protection analysis
in Fig. 5 and Table 1, as explained above) but not by changing the
upstream 5' splice site to consensus (pCSD
D1/2 [Fig. 5A]; shown by
RT-PCR analysis in Fig. 5A and D]. When the downstream 5'
splice sites were disabled, a cryptic donor within the NS2-specific
exon was used (R2cryptic; Fig. 5C). Improvement of the
upstream 3'-splice-site polypyrimidine tract also substantially
restored exon inclusion in RNA generated by a mutant lacking the
bipartite exon enhancer (p4T
SX+
HS [Fig.
6A]; shown by RT-PCR analysis in Fig. 6A
and C), and increased utilization of the cryptic donor
(R2cryptic; Fig. 5C and D), while improvement of the
upstream 5' splice site in the same mutant (pCSD
SX+
HS; Fig. 6A)
again had no effect (shown by RT-PCR analysis in Fig. 6A and C). RNase
protection analyses with probe A (which detects all P4 products)
revealed that the majority of the P4 product in p4T
SX+
HS were R2
mRNAs (13). Thus, the requirement for the bipartite exon
enhancer, as well as for the downstream 5' splice site, could be
overcome by improving the upstream 3'-splice-site polypyrimidine tract, perhaps by strengthening interactions at this weak polypyrimidine tract.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
The NS2-specific exon of MVM requires only one strong
exon terminus (upstream 3' splice site or downstream 5' splice site) to
prevent exclusion from mature spliced mRNA. (A) The sequences of the
large-intron 5'-splice-site and 3'-splice-site polypyrimidine tract and
cleavage site in wild-type MVM and mutants are shown underneath their
appropriate map positions (deviations from the wild-type sequence are
underlined), with quantitations of the direct percent R2/(R2+ES) ratio
obtained by quantitative RT-PCR (described fully in Materials and
Methods). The presence or absence of the small-intron 5' splice sites
in these constructs is indicated by either wt (presence) or (absence). All the values are the average of at least three separate
experiments. Standard deviations are indicated in parentheses. wt, wild
type sequence. , deletion. (B) The two panels show RNase protection
analyses with probe A (Fig. 1) of RNA generated by wild-type MVM (WT),
mutants (as described in the text), or mock transfected, as designated
at the top of each lane. The identities of the protected bands are
shown on the left (in the left panel) and on the right (in the right
panel). The larger species (R1) represents mRNA R1, while the major
smaller species (R2+ES) represents RNA that uses the upstream
large-intron 5' splice site at nt 514 (i.e., mRNA R2 plus the ES). The
identities of the bands designated * and ** are unknown; however,
they are probably breakdown products of the probe since they are not
reproducibly seen and occasionally appear in lanes of mock-infected RNA
(data not shown). (C) RNase protection analysis with probe B (Fig. 1),
of RNA generated by wild-type MVM (WT), mutants (as described in the
text), or mock transfected, as designated at the top of each lane. The
identities of the protected bands for the wild type are shown on the
left. The mutants were protected with versions of probe B homologous to
the mutant region of the upstream intron 3'-splice-site polypyrimidine
tract but nonhomologous in the region of D1 and D2, and therefore the
RNA generated by these mutants shows fragments shorter than those
generated by wild-type RNA. These mutants produce R1, R2, and R3
products that are unspliced across the small intron (designated R1un,
R2un, and R3un, respectively) due to the loss of the two downstream
small intron 5' splice sites, as well as R2 and R3 products that are
spliced across the downstream small intron (designated
R2cryptic and R3cryptic, respectively) by using
a cryptic donor within the NS2-specific exon (see Discussion).
Improvements of the upstream intron 3'-splice-site polypyrimidine tract
disrupted the P38 promoter, resulting in decreased production of
R3cryptic as well as R3un. *, undigested probe B. (D)
RT-PCR analysis of RNA generated by wild-type MVM (WT), mutants (as
described in the text), or mock transfected, as designated at the top
of each lane, with primers a and b as shown in Fig. 1 and performed as
explained in Materials and Methods. Samples were run on a 6%
acrylamide-urea gel. WT( RT) is a control reaction with wild-type RNA
but excluding reverse transcriptase. An RNase protection analysis with
probe B of RNA generated by the wild type was used as a marker (MARKER;
the sizes of the marker bands are shown on the right) for the sizes of
the RT-PCR-amplified bands. WT RNA generated a 658-nt amplified R2
product. RNA generated by the mutants showed two kinds of amplified ES,
both of which were considered in the quantitations: a larger (368-nt)
product and a smaller (346-nt) product which represent exon skipping to
3' splice sites A1 and A2, respectively, of the downstream small
intron. RNAs generated by p D1/2, p1T D1/2, p2T D1/2, and
p4T D1/2 also show two kinds of amplified R2 products, which were
considered in the quantitations; the largest of these is unspliced
across the small intron, and the smaller two products (designated *)
probably utilized a donor within the NS2-specific exon (see
Discussion). RNAs generated by p5A and p1989 also showed the smaller R2
product that probably utilized a donor within the exon. The ES has
previously been sequenced across the splice junction to confirm its
identity (56).
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 6.
Improvement of the upstream intron 3'-splice-site
polypyrimidine tract can overcome exon skipping caused by deletion of
the bipartite exon enhancer. (A) The restriction sites within the
NS2-specific exon (SmaI, XhoI, PstI,
HincII, and SacI) which were used to generate the
exon deletion mutants and the sequences of the large-intron
5'-splice-site and 3'-splice-site polypyrimidine tract and cleavage
site in the wild type and mutants are shown underneath their
appropriate map positions (deviations from the wild-type sequence are
underlined), together with quantitations of the direct percent
R2/(R2+ES) ratio obtained by RT-PCR analysis for each mutant. All the
values are the averages of at least three separate experiments.
Standard deviations are indicated in parentheses. ES values for
p D1/2 are shown for comparison; the mutation is shown in Fig. 5A.
wt, wild-type sequence. , deletion. (B) RNase protection analyses
with probe A (Fig. 1) of RNA generated by wild-type MVM (WT), mutants
(as described in the text), or mock transfected, as designated at the
top of each lane. The identities of the protected bands are shown on
the left and explained in the legend to Fig. 5B. (C) RT-PCR analysis of
RNA generated by wild-type MVM (WT), mutants (as described in the
text), or mock transfected, as designated at the top of each lane.
Samples were run on a 6% acrylamide-urea gel. p D1/2 and WT( RT)
controls and MARKER (the sizes of the marker bands are shown on the
left) are as described in the legend to Fig. 2B. RNA generated by the
wild type showed a 658-nt amplified R2 product, while RNA generated by
the mutants showed R2 products of sizes consistent with the sizes of
the deletions in these mutants. As explained in the legend to Fig. 5D,
two kinds of amplified ES, using either A1 or A2, were observed.
|
|
Surprisingly, however, when the already poor upstream 3' splice site
was completely disabled by mutation of either its cleavage
site (p1989;
Fig.
5A) or polypyrimidine tract (p5Appt; Fig.
5A),
leaving the
downstream 5' splice sites intact, almost all the
steady-state
P4-generated mRNAs were R1 molecules, which included
the NS2-specific
exon but from which the large intron was not
excised. Very little of
either R2 or ES was generated (quantitative
RT-PCR [Fig.
5A and B and
6A and C] and RNase protection analyses
[Fig.
5B and Table
1]
allowed the determination of the relative
amounts of R1, R2 and ES
product as a percentage of the total
P4 product [Table
2], as explained in Materials and
Methods).
These results suggested that while either a strong upstream
3'
splice site or downstream 5' splice site was sufficient to prevent
skipping of the NS2-specific exon, a functional upstream intron
3'
splice site was required for inclusion as an internal exon
into mature,
doubly spliced R2 mRNA.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Relative amounts of R1, R2, and ES as a percentage of
total P4-generated product, calculated from RNase protection analysis
(with probes A and B) of RNA generated by either wild-type MVM or
the mutants indicated, as described in Materials and Methods
|
|
Interestingly, however, when the purine-rich element was deleted from a
mutant in which the upstream 3'-splice-site polypyrimidine
tract had
been disabled (p5A

HS; Fig.
6A), the NS2-specific exon
was
substantially skipped, as was the case for RNA generated by
the exon
enhancer double mutant p

SX+

HS (quantitative RT-PCR
[Fig.
6A and
C] and RNase protection analysis [Fig.
6B] allowed
the determination
of the relative amounts of R1, R2 and ES as
a percentage of total P4
product [Table
2], as explained in Materials
and
Methods).
That P4 RNAs generated by p5A included NS2-specific exon sequences as
R1 (Table
2) while P4 RNAs generated by p5A

HS predominantly
skipped
the NS2-specific exon (Table
2) suggested further that
the purine-rich
element could also functionally strengthen the
downstream 5' splice
site and thereby prevent exon skipping when
the upstream 3' splice site
was disabled (p5A). Disabling of both
the HS element and the
upstream 3' splice site (p5A

HS) resulted
in loss of inclusion,
presumably due to a functional inactivation
of both exon
termini.
Surprisingly, when the NS2-specific exon was doubled in length by
inserting two copies of the wild-type exon between engineered
SmaI sites at nt 2005 and 2270, [pEx(


); Fig.
7A], the larger
exon was still included
to 70% of wild-type levels (Fig.
7). Thus,
inclusion of the
NS2-specific exon was less sensitive to a dramatic
increase in its
length than might be expected for an internal
exon.

View larger version (10K):
[in this window]
[in a new window]

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Inclusion of the NS2-specific exon tolerates doubling
its length. (A) Quantitations of the direct percent R2/(R2+ES) ratio
obtained by RT-PCR analysis for each mutant are shown. Construction of
the mutants is explained in Materials and Methods. All the values are
the average of at least three separate experiments. Standard deviations
are indicated in parentheses. (B) RT-PCR analysis of RNA generated by
wild-type MVM (WT), mutants (as described in the text), or mock
transfected, as designated at the top of each lane. Samples were run on
a 6% acrylamide-urea gel. MARKER is as described in the legend to
Fig. 2B (the sizes of the marker bands are shown on the left).
(Ex )-RT is a control reaction with p(Ex )-generated RNA but
excluding reverse transcriptase. RNA generated by the wild type showed
a 658-nt amplified R2 product, while RNA generated by the mutants
showed R2 products of sizes consistent with the sizes of the
substitutions in these mutants. As explained in the legend to Fig. 5D,
two kinds of amplified ES, using either A1 or A2, were observed. The
parent mutant bearing only the Sma sites at nt 2005 and 2270 [pEx( )] is indistinguishable from the wild type with respect to
splicing of the upstream intron and inclusion of the NS2-specific exon
(56). Inclusion of the exon that is doubled in length still
required wild-type exon sequences; when either one copy or two copies
of the exon in the reverse orientation were inserted between the Sma
sites [pEx( ) and pEx( ), respectively (56)], the
exon was almost uniformly skipped.
|
|
 |
DISCUSSION |
Identification and characterization of a partially redundant
bipartite enhancer within the NS2-specific exon.
The NS2-specific
exon bipartite enhancer was first identified by deletion and point
mutagenesis (Fig. 2 and 3). This analysis indicated that the enhancer
was composed of CA-rich and purine-rich elements within the 5' and 3'
regions of the exon, respectively. Addition of both wild-type and
mutant motifs to an exon mutant lacking the 5' and 3' enhancer regions
resulted in reinclusion of the mutant exon (Fig. 4). These experiments
demonstrated that the critical sequences within the upstream enhancer
were two 5-nt CA-rich motifs separated by a 6-nt spacer and that the
critical sequences within the downstream enhancer were two purine-rich motifs separated by a 22-nt spacer (Fig. 4A). These experiments also
demonstrated that the CA-rich and purine-rich elements were able to
function in a heterologous sequence context, i.e., at each other's
positions within the exon, to efficiently include the NS2-specific
exon. This confirmed that these two elements were bona fide ESEs which
could function independently of the local sequence environment and also
implied that these elements did not form critical secondary structures
with the other exon sequences. Experiments to determine whether the
CA-rich and purine-rich enhancer elements might stimulate the splicing
of other heterologous 3' splice sites and to determine which cellular
factors they interact with are in progress. The sequences of the
NS2-specific exon enhancer elements are very highly conserved among the
rodent parvoviruses, and these viruses have a wide host range
(8). This suggests that these enhancer sequences may
interact with prevalent cellular factors. It has been previously shown
that tissue-specific alternative splicing of exon 4 of the calcitonin
gene in thyroid C cells is also governed by both purine-rich and
non-purine-rich exon enhancer elements (49).
Analysis of deletion mutants in which one of the two enhancer elements
was left intact, together with the add-back experiments
described
above, suggested that the CA-rich and purine-rich elements
were
significantly redundant in the context of an exon of less
than
wild-type length. In the context of the full-length exon,
however,
while point mutagenesis of the CA-rich element alone
permitted
wild-type exon inclusion by the purine-rich element,
point mutagenesis
of the purine-rich element alone resulted in
significant exon skipping
(Fig.
3). These results suggested that
the two elements are not fully
redundant in function and that
the purine-rich element, which may play
a more dominant role under
native conditions, may not be as strictly
required in a smaller
exon that permits more efficient exon bridging.
An alternative
interpretation would be that the HS2(

) mutation
created a negatively
acting element, which would then imply that the
HS2 region is
also significantly redundant in the wild-type-length
exon, as
suggested by deletion
analysis.
In the context of wild-type virus, the CA-rich region may have a
modifying effect on the more dominant purine-rich region;
however, the
importance of the CA-rich element was underscored
by the observations
that the CA-rich motif alone was shown to
support significant exon
inclusion in a mutant with the HS region
deleted (p

HS; Fig.
2) and
that replacement of the 3' HS2 region
in p

SX1+

HS2 with a CA-rich
motif recovered exon inclusion to
near-wild-type levels
[p

SX1+HS2(CA2); Fig.
4]. That the CA-rich
and purine-rich elements
are partially redundant and show significant
position independence
suggests that they may bind a common subset
of cellular proteins. It
has been previously determined that a
CA-rich enhancer substrate as
well as the cTNT purine-rich enhancer
substrate can titrate factors
required for CA-rich enhancer activity
in vitro, suggesting that at
least one of the factors that binds
to the purine-rich enhancer is
required for CA-rich enhancer activity
(
9).
The spacer sequence within the purine-rich element contains two
potential 5' splice donor sites. When both the downstream
small intron
donors (3' terminus of the exon) were disabled, one
of these sites was,
in fact, used as a cryptic donor to splice
out the small intron
(R2
cryptic generated [Fig.
5C]). Perhaps
one consequence
of this arrangement of the purine-rich motifs
is to prevent the U1
small nuclear ribonucleoprotein (U1snRNP)
and other splicing factors
from assembling at these cryptic
donors.
The NS2-specific exon is unusual in that it is flanked by a large
intron upstream that has both a nonconsensus 5' splice site
and a poor
3' splice site and by a small overlapping intron downstream.
This exon
requires both a bipartite exonic enhancer as well as
a downstream 5'
splice site for efficient exon inclusion, suggesting
that the
NS2-specific exonic enhancer requires exon bridging involving
the
downstream 5' splice site in order to function efficiently
in vivo. The
existence of multiple exon bridging interactions
between the two
exon-defining elements at both ends of the exon,
as well as the
downstream small intron, may also be reflected
in the observation that
the NS2-specific exon is less sensitive
to a doubling of its length
than might be expected for an internal
exon.
Improvement of the upstream intron 3' splice site
polypyrimidine tract substantially restored exon inclusion to a
mutant in
which both enhancer elements had been deleted (Fig.
6) and to
a mutant in which both downstream intron 5' splice sites had been
deleted (Fig.
5). The simplest explanation for this observation
is that
both the bipartite enhancer and the downstream 5' splice
sites
strengthen interactions at the upstream 3'-splice-site polypyrimidine
tract. This explanation was supported by the observation that
when the
3' purine-rich element was absent, either disabling the
upstream 3'
splice site polypyrimidine tract or deleting the CA-rich
element had
similar effects (i.e., exon skipping), suggesting
that one function of
the CA-rich element was to strengthen interactions
at the upstream
3'-splice-site polypyrimidine
tract.
Disabling the upstream 3' splice site of the NS2-specific exon does
not result in exon skipping.
It has been reported that mutations
of the AG dinucleotide at 3' splice sites disrupt downstream exon
inclusion, leading either to the utilization of a downstream AG or to
skipping of the exon following the mutation, as predicted by the exon
definition model (47, 48 reviewed in references
2 and 3). Surprisingly, when the
already poor 3' splice site upstream of the NS2-specific exon was
completely disabled, by mutation of either its cleavage site (p1989) or
its polypyrimidine tract (p5A), almost all the steady-state
P4-generated mRNAs were R1 molecules which included the NS2-specific
exon but from which the large intron was not excised. Very little of
either R2 or ES was generated (see Results and Table 2). Perhaps this
is related to the presence of the exon-defining elements at each exon
terminus and strong downstream 5' splice sites which together function
to include the NS2-specific exon in such a way that it can be included
at required levels in both R1 and R2.
The observation that the NS2-specific exon was included as R1 in P4
RNAs generated by p5A but was skipped in RNAs generated
by p5A

HS
(see Results and Table
2) is consistent with a model
in which the HS
element also functioned downstream to improve
the downstream 5' splice
sites. Deletion of the HS element in
p5A (p5A

HS) resulted in a loss
of exon inclusion, presumably
because both exon termini were disabled.
The NS2-specific exon
sequences in R1 mRNA are part of a very long
(2,300-nt) 5'-terminal
exon, which may necessitate the presence of an
exon-defining element
(HS) at the 3' end of this exon. Since the
CA-rich enhancer probably
functions to strengthen the upstream 3'
splice site whereas the
purine-rich enhancer probably functions to
strengthen both the
upstream 3' splice site and the downstream 5'
splice sites, we
suggest that these two enhancer elements may function
to control,
in a constitutive manner, the relative efficiency with
which the
NS2-specific exon sequences are included in both R1 and R2
and
thereby govern the appropriate relative steady-state levels of
R1
and R2 that accumulate during viral
infection.
 |
ACKNOWLEDGMENTS |
This work was supported by PHS grant RO1 AI21302 from NIAID and a
grant from the Council for Tobacco Research. A.G. was partially supported by the University of Missouri Molecular Biology Program during a portion of this work.
We thank members of our laboratory for helpful discussions, especially
Don Haut for a critical review of the manuscript. We thank Lisa Burger
for expert technical assistance. We are grateful to Tom Cooper and
Andrew McCullough for help in developing our quantitative RT-PCR assay.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Microbiology and Immunology, School of Medicine, University of
Missouri
Columbia, Columbia, MO 65212. Phone: (573) 882-3920. Fax:
(573) 882-4287. E-mail: pinteld{at}missouri.edu.
 |
REFERENCES |
| 1.
|
Astell, C. R.,
E. M. Gardiner, and P. Tattersall.
1986.
DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and comparison with the DNA sequence of the fibrotropic prototype strain.
J. Virol.
57:656-669[Abstract/Free Full Text].
|
| 2.
|
Berget, S. M.
1995.
Exon recognition in vertebrate splicing.
J. Biol. Chem.
270:2411-2444[Free Full Text].
|
| 3.
|
Black, D. L.
1995.
Finding splice sites within a wilderness of RNA.
RNA
1:763-771[Medline].
|
| 4.
|
Buvoli, M.,
S. A. Mayer, and J. G. Patton.
1997.
Functional crosstalk between exon enhancers, polypyrimidine tracts and branchpoint sequences.
EMBO J.
16:7174-7183[Medline].
|
| 5.
|
Clemens, K. E.,
D. R. Cerutis,
L. R. Burger,
G. Q. Yang, and D. Pintel.
1990.
Cloning of minute virus of mice cDNAs and preliminary analysis of individual viral proteins expressed in murine cells.
J. Virol.
64:3967-3973[Abstract/Free Full Text].
|
| 6.
|
Clemens, K. E., and D. J. Pintel.
1987.
Minute virus of mice (MVM) mRNAs predominantly polyadenylate at a single site.
Virology
160:511-514[Medline].
|
| 6a.
| Cooper, T. Personal communication.
|
| 7.
|
Cotmore, S. F., and P. Tattersall.
1986.
Organization of nonstructural genes of the autonomous parvovirus minute virus of mice.
J. Virol.
58:724-732[Abstract/Free Full Text].
|
| 8.
|
Cotmore, S. F., and P. Tattersall.
1987.
The autonomously replicating parvoviruses of vertebrates.
Adv. Virus Res.
33:91-174[Medline].
|
| 9.
|
Coulter, L. R.,
M. A. Landree, and T. A. Cooper.
1997.
Identification of a new class of exonic splicing enhancers by in vivo selection.
Mol. Cell. Biol.
17:2143-2150[Abstract].
|
| 10.
|
Dirksen, W. P.,
R. K. Hampson,
Q. Sun, and F. M. Rottman.
1994.
A purine-rich exon sequence enhances alternative splicing of bovine growth hormone pre-mRNA.
J. Biol. Chem.
269:6431-6436[Abstract/Free Full Text].
|
| 11.
|
Dominski, Z., and R. Kole.
1994.
Identification of exon sequences involved in splice site selection.
J. Biol. Chem.
269:23590-23596[Abstract/Free Full Text].
|
| 12.
|
Fu, X. D.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 13.
| Gersappe, A., and D. J. Pintel. 1998. Unpublished data
|
| 14.
|
Gontarek, R. R., and D. Derse.
1996.
Interactions among SR proteins, an exonic splicing enhancer, and a lentivirus Rev protein regulate alternative splicing.
Mol. Cell. Biol.
16:2325-2331[Abstract].
|
| 15.
|
Graham, I. R.,
M. Hamshere, and I. C. Eperon.
1992.
Alternative splicing of a human -tropomyosin muscle-specific exon: identification of determining sequences.
Mol. Cell. Biol.
12:3872-3882[Abstract/Free Full Text].
|
| 16.
|
Haut, D. D., and D. J. Pintel.
1998.
Intron definition is required for excision of the minute virus of mice small intron and definition of the upstream exon.
J. Virol.
72:1834-1843[Abstract/Free Full Text].
|
| 17.
|
Hoffman, B. E., and P. J. Grabowski.
1992.
U1 snRNP targets an essential splicing factor, U2AF65, to the 3' splice site by a network of interactions spanning the exon.
Genes Dev.
6:2554-2568[Abstract/Free Full Text].
|
| 18.
|
Humphrey, M. D.,
J. Bryan,
T. A. Cooper, and S. M. Berget.
1995.
A 32-nucleotide exon-splicing enhancer regulates usage of competing 5' splice sites in a differential internal exon.
Mol. Cell. Biol.
15:3979-3988[Abstract].
|
| 19.
|
Hwang, D. Y., and J. B. Cohen.
1996.
Base pairing at the 5' splice site with U1 small nuclear RNA promotes splicing of the upstream intron but may be dispensable for splicing of the downstream intron.
Mol. Cell. Biol.
16:3012-3022[Abstract].
|
| 20.
|
Innis, M. A.,
D. H. GelFand,
J. J. Sninski, and T. J. White.
1990.
PCR protocols: a guide to methods and applications.
Academic Press, Inc., San Diego, Calif.
|
| 21.
|
Jongeneel, C. V.,
R. Sahli,
G. K. McMaster, and B. Hirt.
1986.
A precise map of splice junctions in the mRNAs of minute virus of mice, an autonomous parvovirus.
J. Virol.
59:564-573[Abstract/Free Full Text].
|
| 22.
|
Katz, R. A., and A. M. Skalka.
1990.
Control of retroviral RNA splicing through maintenance of suboptimal processing signals.
Mol. Cell. Biol.
10:696-704[Abstract/Free Full Text].
|
| 23.
|
Kuo, H. C.,
F. H. Nasim, and P. J. Grabowski.
1991.
Control of alternative splicing by the differential binding of U1 small nuclear ribonucleoprotein particle.
Science
251:1045-1051[Abstract/Free Full Text].
|
| 24.
|
Lavigueur, A.,
H. La Branche,
A. R. Kornblihtt, and B. Chabot.
1993.
A splicing enhancer in the human fibronectin alternate ED1 exon interacts with SR proteins and stimulates U2 snRNP binding.
Genes Dev.
7:2405-2417[Abstract/Free Full Text].
|
| 25.
|
Lynch, K. W., and T. Maniatis.
1995.
Synergistic interactions between two distinct elements of a regulated splicing enhancer.
Genes Dev.
9:284-293[Abstract/Free Full Text].
|
| 26.
|
Manley, J. L., and R. Tacke.
1996.
SR proteins and splicing control.
Genes Dev.
10:1569-1579[Free Full Text].
|
| 27.
|
McCullough, A. J., and S. M. Berget.
1997.
G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection.
Mol. Cell. Biol.
17:4562-4571[Abstract].
|
| 28.
|
Morgan, W. R., and D. C. Ward.
1986.
Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs.
J. Virol.
60:1170-1174[Abstract/Free Full Text].
|
| 29.
|
Naeger, L. K.,
J. Cater, and D. J. Pintel.
1990.
The small nonstructural protein (NS2) of MVM is required for efficient DNA replication and infectious virus production in a cell-type specific manner.
J. Virol.
64:6166-6175[Abstract/Free Full Text].
|
| 30.
|
Naeger, L. K.,
R. V. Schoborg,
Q. Zhao,
G. E. Tullis, and D. J. Pintel.
1992.
Nonsense mutation inhibit splicing of MVM RNA in cis when they interrupt the reading frame of either exon of the final spliced product.
Genes Dev.
6:1107-1111[Abstract/Free Full Text].
|
| 31.
|
Pintel, D. J.,
D. Dadachanji,
C. R. Astell, and D. C. Ward.
1983.
The genome of minute virus of mice, an autonomous parvovirus, encodes two overlapping transcription units.
Nucleic Acids Res.
11:1019-1038[Abstract/Free Full Text].
|
| 32.
|
Pintel, D. J.,
A. Gersappe,
D. Haut, and J. Pearson.
1995.
Determinants that govern alternative splicing of parvovirus pre-mRNAs.
Semin. Virol.
6:283-290.
|
| 33.
|
Ramchatesingh, J.,
A. M. Zahler,
K. M. Neugebauer,
M. B. Roth, and T. A. Cooper.
1995.
A subset of SR proteins activates splicing of the cardiac troponin T alternative exon by direct interactions with an exonic enhancer.
Mol. Cell. Biol.
15:4898-4907[Abstract].
|
| 34.
|
Reed, R.
1996.
Initial splice-site recognition and pairing during pre-mRNA splicing.
Curr. Opin. Genet. Dev.
6:215-220[Medline].
|
| 35.
|
Robberson, B. L.,
G. J. Cote, and S. M. Berget.
1990.
Exon definition may facilitate splice site selection in RNAs with multiple exons.
Mol. Cell. Biol.
10:84-94[Abstract/Free Full Text].
|
| 36.
|
Ryan, K. J., and T. A. Cooper.
1996.
Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle.
Mol. Cell. Biol.
16:4014-4023[Abstract].
|
| 37.
|
Schoborg, R. V., and D. J. Pintel.
1991.
Accumulation of MVM gene products is differentially regulated by transcription initiation, RNA processing and protein stability.
Virology
181:22-34[Medline].
|
| 38.
|
Staffa, A., and A. Cochrane.
1995.
Identification of positive and negative splicing regulatory elements within the terminal tat-rev exon of human immunodeficiency virus type 1.
Mol. Cell. Biol.
15:4597-4605[Abstract].
|
| 39.
|
Staknis, D., and R. Reed.
1994.
SR proteins promote the first specific recognition of pre-mRNA and are present together with the U1 small nuclear ribonucleoprotein particle in a general splicing enhancer complex.
Mol. Cell. Biol.
14:7670-7682[Abstract/Free Full Text].
|
| 40.
|
Sun, Q.,
A. Mayeda,
R. K. Hampson,
A. R. Krainer, and F. M. Rottman.
1993.
General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer.
Genes Dev.
7:2598-2608[Abstract/Free Full Text].
|
| 41.
|
Talerico, M., and S. M. Berget.
1990.
Effect of 5' splice site mutations on splicing of the preceding intron.
Mol. Cell. Biol.
10:6299-6305[Abstract/Free Full Text].
|
| 42.
|
Tanaka, K.,
A. Watakabe, and Y. Shimura.
1994.
Polypurine sequences within a downstream exon function as a splicing enhancer.
Mol. Cell. Biol.
14:1347-1354[Abstract/Free Full Text].
|
| 43.
|
Tian, H., and R. Kole.
1995.
Selection of novel exon recognition elements from a pool of random sequences.
Mol. Cell. Biol.
15:6291-6298[Abstract].
|
| 44.
|
Tian, M., and T. Maniatis.
1992.
Positive control of pre-mRNA splicing in vitro.
Science
256:237-240[Abstract/Free Full Text].
|
| 45.
|
Tian, M., and T. Maniatis.
1993.
A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA.
Cell
74:105-114[Medline].
|
| 46.
|
Tian, M., and T. Maniatis.
1994.
A splicing enhancer exhibits both constitutive and regulated activities.
Genes Dev.
8:1703-1712[Abstract/Free Full Text].
|
| 47.
|
Tromp, G., and D. J. Prockop.
1988.
Single base mutation in the proalpha2(I) collagen gene that causes efficient splicing of RNA from exon 27 to exon 29 and synthesis of a shortened but in-frame proalpha2(I) chain.
Proc. Natl. Acad. Sci. USA
85:5254-5258[Abstract/Free Full Text].
|
| 48.
|
Ulfendahl, J. P.,
J. Kreivi, and G. Askujarvi.
1989.
Role of the branch/3'-splice site region in adenovirus-2 EIA pre-mRNA alternative splicing: evidence for 5' and 3'-splice site cooperation.
Nucleic Acids Res.
17:925-938[Abstract/Free Full Text].
|
| 49.
|
van Oers, C. C. M.,
G. J. Adema,
H. Zandberg,
T. C. Moen, and P. D. Baas.
1994.
Two different sequence elements within exon 4 are necessary for calcitonin-specific splicing of the human calcitonin/calcitonin gene-related peptide I pre-mRNA.
Mol. Cell. Biol.
14:951-960[Abstract/Free Full Text].
|
| 50.
|
Wang, J., and J. L. Manley.
1997.
Regulation of pre-mRNA splicing in metazoa.
Curr. Opin. Genet. Dev.
7:205-211[Medline].
|
| 51.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 52.
|
Watakabe, A.,
K. Tanaka, and Y. Shimura.
1993.
The role of exon sequences in splice site selection.
Genes Dev.
7:407-418[Abstract/Free Full Text].
|
| 53.
|
Xu, R.,
J. Teng, and T. A. Cooper.
1993.
The cardiac troponin T alternative exon contains a novel purine-rich positive splicing element.
Mol. Cell. Biol.
13:3660-3674[Abstract/Free Full Text].
|
| 54.
|
Yeakley, J. M.,
F. Hedjran,
J.-P. Morfin,
N. Merillat,
M. G. Rosenfeld, and R. B. Emeson.
1993.
Control of calcitonin/calcitonin gene-related peptide pre-mRNA processing by constitutive intron and exon elements.
Mol. Cell. Biol.
13:5999-6011[Abstract/Free Full Text].
|
| 55.
|
Zhao, Q.,
A. Gersappe, and D. J. Pintel.
1995.
Efficient excision of the upstream large intron from P4-generated pre-mRNA of the parvovirus minute virus of mice requires at least one donor and the 3' splice site of the small downstream intron.
J. Virol.
69:6170-6179[Abstract].
|
| 56.
|
Zhao, Q.,
S. Mathur,
L. R. Burger, and D. J. Pintel.
1995.
Sequences within the parvovirus minute virus of mice NS2-specific exon are required for inclusion of this exon into spliced steady-state RNA.
J. Virol.
69:5864-5868[Abstract].
|
| 57.
|
Zhao, Q.,
R. V. Schoborg, and D. J. Pintel.
1994.
Alternative splicing of pre-mRNAs encoding the nonstructural proteins of minute virus of mice is facilitated by sequences within the downstream intron.
J. Virol.
68:2849-2859[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 1999, p. 364-375, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Choi, E.-Y., Pintel, D.
(2009). Splicing of the Large Intron Present in the Nonstructural Gene of Minute Virus of Mice Is Governed by TIA-1/TIAR Binding Downstream of the Nonconsensus Donor. J. Virol.
83: 6306-6311
[Abstract]
[Full Text]
-
Choi, E.-Y., Newman, A. E., Burger, L., Pintel, D.
(2005). Replication of Minute Virus of Mice DNA Is Critically Dependent on Accumulated Levels of NS2. J. Virol.
79: 12375-12381
[Abstract]
[Full Text]
-
Rush, M., Zhao, X., Schwartz, S.
(2005). A Splicing Enhancer in the E4 Coding Region of Human Papillomavirus Type 16 Is Required for Early mRNA Splicing and Polyadenylation as Well as Inhibition of Premature Late Gene Expression. J. Virol.
79: 12002-12015
[Abstract]
[Full Text]
-
Gorbunova, V., Seluanov, A., Dion, V., Sandor, Z., Meservy, J. L., Wilson, J. H.
(2003). Selectable System for Monitoring the Instability of CTG/CAG Triplet Repeats in Mammalian Cells. Mol. Cell. Biol.
23: 4485-4493
[Abstract]
[Full Text]
-
Eichwald, V., Daeffler, L., Klein, M., Rommelaere, J., Salome, N.
(2002). The NS2 Proteins of Parvovirus Minute Virus of Mice Are Required for Efficient Nuclear Egress of Progeny Virions in Mouse Cells. J. Virol.
76: 10307-10319
[Abstract]
[Full Text]
-
Söderlund-Venermo, M., Riley, L. K., Pintel, D. J.
(2001). Construction and initial characterization of an infectious plasmid clone of a newly identified hamster parvovirus. J. Gen. Virol.
82: 919-927
[Abstract]
[Full Text]
-
Standiford, D. M., Sun, W. T., Davis, M. B., Emerson, C. P. , Jr.
(2001). Positive and Negative Intronic Regulatory Elements Control Muscle-Specific Alternative Exon Splicing of Drosophila Myosin Heavy Chain Transcripts. Genetics
157: 259-271
[Abstract]
[Full Text]
-
Zheng, Z.-M., Reid, E. S., Baker, C. C.
(2000). Utilization of the Bovine Papillomavirus Type 1 Late-Stage-Specific Nucleotide 3605 3' Splice Site Is Modulated by a Novel Exonic Bipartite Regulator but Not by an Intronic Purine-Rich Element. J. Virol.
74: 10612-10622
[Abstract]
[Full Text]
-
Lorson, C. L., Androphy, E. J.
(2000). An exonic enhancer is required for inclusion of an essential exon in the SMA-determining gene SMN. Hum Mol Genet
9: 259-265
[Abstract]
[Full Text]
-
Gersappe, A., Burger, L., Pintel, D. J.
(1999). A Premature Termination Codon in Either Exon of Minute Virus of Mice P4 Promoter-generated Pre-mRNA Can Inhibit Nuclear Splicing of the Intervening Intron in an Open Reading Frame-dependent Manner. J. Biol. Chem.
274: 22452-22458
[Abstract]
[Full Text]
-
Gersappe, A., Pintel, D. J.
(1999). A Premature Termination Codon Interferes with the Nuclear Function of an Exon Splicing Enhancer in an Open Reading Frame-Dependent Manner. Mol. Cell. Biol.
19: 1640-1650
[Abstract]
[Full Text]
-
Cote, J., Dupuis, S., Wu, J. Y.
(2001). Polypyrimidine Track-binding Protein Binding Downstream of Caspase-2 Alternative Exon 9 Represses Its Inclusion. J. Biol. Chem.
276: 8535-8543
[Abstract]
[Full Text]