Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 384-391, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Ribosomal Protein L3 Mutants Alter Translational
Fidelity and Promote Rapid Loss of the Yeast Killer Virus
Stuart W.
Peltz,1
Amy B.
Hammell,2
Ying
Cui,2
Jason
Yasenchak,2
Lara
Puljanowski,2 and
Jonathan D.
Dinman1,2,*
Department of Molecular Genetics and
Microbiology and Graduate Program in Molecular Biosciences at
UMDNJ/Rutgers Universities, Robert Wood Johnson Medical
School-UMDNJ,2 and
The Cancer
Institute of New Jersey,1 Piscataway, New Jersey
08854
Received 23 July 1998/Returned for modification 3 September
1998/Accepted 28 September 1998
 |
ABSTRACT |
Programmed
1 ribosomal frameshifting is utilized by a number of
RNA viruses as a means of ensuring the correct ratio of viral structural to enzymatic proteins available for viral particle assembly.
Altering frameshifting efficiencies upsets this ratio, interfering with
virus propagation. We have previously demonstrated that compounds that
alter the kinetics of the peptidyl-transfer reaction affect programmed
1 ribosomal frameshift efficiencies and interfere with viral
propagation in yeast. Here, the use of a genetic approach lends
further support to the hypothesis that alterations affecting
the ribosome's peptidyltransferase activity lead to changes in
frameshifting efficiency and virus loss. Mutations in the
RPL3 gene, which encodes a ribosomal protein located at the
peptidyltransferase center, promote approximately three- to fourfold
increases in programmed
1 ribosomal frameshift efficiencies and loss of the M1 killer virus of yeast. The
mak8-1 allele of RPL3 contains two adjacent
missense mutations which are predicted to structurally alter the
Mak8-1p. Furthermore, a second allele that encodes the
N-terminal 100 amino acids of L3 (called L3
) exerts a
trans-dominant effect on programmed
1 ribosomal
frameshifting and killer virus maintenance. Taken together, these
results support the hypothesis that alterations in the
peptidyltransferase center affect programmed
1 ribosomal frameshifting.
 |
INTRODUCTION |
Programmed
1 ribosomal
frameshifting is a mode of regulating gene expression used
predominantly by RNA viruses and by a subset of bacterial genes to
induce elongating ribosomes to shift the reading frame in response to
specific mRNA signals (reviewed in references 16, 24,
27, and 30). Many viruses of clinical, veterinary, and agricultural importance utilize programmed
frameshifting for the production of their structural and enzymatic gene
products (reviewed in references 5, 6, 24, 27, 30,
and 51). Thus, ribosomal frameshifting is a unique
target with which to identify and develop antiviral agents (20,
41). Programmed
1 ribosomal frameshifting causes the ribosome
to slip one base in the 5' direction and requires two
cis-acting mRNA signals. The first sequence element is
called the "slippery site," which, in eukaryotic viruses, consists
of a heptamer sequence spanning three amino acid codons, X XXY YYZ (the
gag reading frame is indicated by spaces), where XXX can be
any three identical nucleotides, YYY can be AAA or UUU, and Z is A, U,
or C (8, 17, 21, 31). The second frameshift-promoting signal
is usually a sequence that forms a defined RNA secondary structure,
such as an RNA pseudoknot (7, 17, 36). This element is
located approximately 4 to 8 nucleotides 3' of the slippery site and is
thought to increase the probability that the ribosome will slip from
the original reading frame in the
1 direction, in part by inducing
ribosomes to pause at the slippery site (48, 53).
Based on the repetitive nature of the heptamer slippery sequence
required for efficient programmed
1 ribosomal frameshifting, a
simultaneous slippage model has been proposed to explain how ribosomes
can be induced to change reading frames (31). A translating ribosome in which the A- and P-sites are occupied by tRNAs is forced to
pause over the slippery site as a consequence of the RNA pseudoknot.
The increased pause time over this sequence is thought to give an
opportunity for the ribosome and bound tRNAs to slip 1 base in the 5'
direction. Because of the nature of the slippery site, this still
leaves their non-wobble bases correctly paired with the mRNA in the new
reading frame. Following the slip in the
1 direction, the ribosome
continues translation in the new reading frame, producing the Gag-Pol polyprotein.
Since the simultaneous slippage model of programmed
1 ribosomal
frameshifting requires that both the ribosomal A- and P-sites be
occupied by tRNAs, it is implicit that this mechanism must occur after
insertion of cognate aminoacyl-tRNA into the A-site, but prior to the
translocation step of the translation elongation cycle. Furthermore,
since programmed ribosomal frameshifting is driven by ribosomal pause
events, mutations or agents that would serve to alter the amount of
time that ribosomes are paused with both A- and P-sites occupied by
tRNAs should specifically have an impact on the efficiency of
programmed
1 ribosomal frameshifting. Since the peptidyl-transfer
step in translation occurs while both the ribosomal A- and P-sites are
occupied by tRNAs, we predicted that agents and mutations which alter
the rate of this reaction would promote changes in programmed
1
ribosomal frameshift efficiencies and consequently would have antiviral properties.
In the yeast Saccharomyces cerevisiae, the L-A
double-stranded RNA (dsRNA) virus utilizes a
1 ribosomal frameshift
event for the production of a Gag-Pol fusion protein and has been an excellent model system with which to investigate this process (reviewed
in references 12 and 20).
M1, a satellite dsRNA virus of L-A that encodes a secreted
killer toxin, is encapsidated and replicated by using the Gag and
Gag-Pol gene products synthesized by the L-A virus (reviewed in
reference 58). Maintaining the appropriate ratio of
Gag to Gag-Pol is critical for maintenance of the M1 virus
(21). Alteration of the frameshift process by as little as
two- to threefold promotes rapid loss of M1 (21, 22). Genetic and biochemical analyses have identified a number of
factors involved in determining the efficiency of programmed
1
ribosomal frameshifting (11, 12, 18, 19, 21-23, 34, 44).
Based on this analysis, we have hypothesized that there is a
surveillance complex which functions to monitor the A- and P-sites on
the ribosomes to ensure that translation elongation occurs with high
fidelity (15, 44). We suspect that this surveillance complex
monitors the ribosome's peptidyltransferase activity to ensure maximal
translational fidelity. Mutations that alter or inactivate the activity
of this complex reduce translational fidelity at the A- and P-sites and
allow increased levels of ribosomal frameshifting to occur. A set of
mof (maintenance of frame) alleles were shown to increase
programmed
1 ribosomal frameshifting efficiencies and promote loss of
the killer virus (22). Furthermore, compounds that bind to
the peptidyltransferase center on the ribosome and reduce translation
fidelity can also modulate ribosomal frameshifting (19).
Anisomycin and sparsomycin were shown to alter programmed
1 ribosomal
frameshifting efficiencies both in cells and in in vitro translation
extracts and to promote loss of the yeast L-A and its satellite dsRNA
virus, M1 (19). Taken together, these results
indicate that modulation of the ribosomal peptidyltransferase center
can alter the efficiency of programmed
1 ribosomal frameshifting and
lead to inefficient virus propagation.
In the current study, we have genetically investigated the role of a
ribosomal protein that is located at the ribosomal peptidyl-transfer center in modulating programmed frameshifting efficiencies. Previous results have shown that the yeast RPL3 gene encoding the
ribosomal protein L3 participates in the formation of the
peptidyltransferase center (reviewed in references
38 and 39). Mutations in the RPL3 gene (called TCM1) were initially identified
by conferring resistance to the peptidyltransferase inhibitors
trichodermin and anisomycin (32, 45). Independently, the
MAK8 gene (MAK, maintenance of killer) was
identified by the inability of mutant alleles to maintain the
M1 satellite virus (59). Subsequent analysis
demonstrated that MAK8 is allelic to RPL3
(60). Thus, a mutation in a ribosomal protein located in the
peptidyltransferase center that cannot maintain the killer virus has
been identified. We hypothesized that the underlying cause of killer
virus loss observed in these cells may be a consequence of increased
programmed
1 ribosomal frameshifting efficiency (i.e., that the
mak8 alleles may demonstrate a Mof
phenotype).
The results presented here demonstrate that strains harboring the
mak8-1 allele have increased programmed frameshifting efficiencies and strongly suggest that the loss of the killer virus is
a due to alteration in translation fidelity. Furthermore, a
trans-dominant RPL3 allele has been identified
that both increases programmed
1 frameshifting and interferes with
the ability of yeast cells to maintain the M1 dsRNA virus.
Taken together, these results support the notion that modulation of the
peptidyltransferase center results in alteration of programmed
1
ribosomal frameshifting efficiencies, promoting loss of the killer virus.
 |
MATERIALS AND METHODS |
Strains, media, enzymes, oligonucleotides, and drugs.
Escherichia coli DH5
and MV1190 were used to amplify
plasmid DNA. The yeast strains used in this study are listed in Table 1. Transformations of yeasts and E. coli were performed as described previously (13). YPAD,
YPG, SD, synthetic complete medium (H
), and 4.7MB plates for testing
the killer phenotype were used as previously reported (22).
Restriction enzymes were obtained from Promega, MBI Fermentas, Bethesda
Research Laboratories, and Boehringer Mannheim. T4 DNA ligase and T4
DNA polymerase were obtained from Boehringer Mannheim, and precision
Taq polymerase was obtained from Stratagene. Radioactive
nucleotides were obtained from NEN. Oligonucleotides used in these
studies were purchased from IDT, and DNA sequence analysis was
performed by the UMDNJ-RWJ DNA synthesis center. Anisomycin was
purchased from Sigma, and sparsomycin was a generous gift from S. Pestka.
Plasmid constructs and programmed ribosomal frameshift
assays.
BlueScript KS plasmid was obtained from Stratagene. The
pRS series of plasmids (10, 47) and pAS134 (1)
have been previously described. Full-length RPL3 and
mak8-1 were amplified from genomic DNA by PCR using the
oligonucleotide primers
300KpnI (5'C
CCCCGGTACCTCACGCACACTGGAATGAAT 3') and +1300SacI
(5' CCCCGAGCGCAACCTCCATTTTGGACTTGG 3') and were cloned into
the pRS300 series (pRS314, pRS315, and pRS316) digested with
KpnI and SacI to make the pRPL3 and the pmak8-1
series of plasmids (Fig. 1A). To
construct an RPL3 gene disruption plasmid, the
KpnI-SacI RPL3 clone was subcloned
into BlueScript KS (KS-RPL3), digested with SphI, the
overhanging ends were filled with deoxynucleoside triphosphates using
T4 DNA polymerase, and the clone was then digested with
XbaI. Subsequently, pAS134 was digested with XbaI and PvuII to liberate the hisG-URA3 cassette,
which was subcloned into the XbaI/blunt-ended KS-RPL3 to
create pJD168 (Fig. 1B).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
(A) The full-length RPL3 gene is located on
chromosome XV in yeast cells and consists of an upstream activation
signal (UAS) at bp 234 through bp 216 relative to the ATG start
codon. The RPL3 coding sequence is 1,164 bp long, and the
gene encodes the 388-amino acid L3 protein. Restriction endonuclease
sites are indicated. Full-length RPL3 and mutant
mak8-1 alleles were cloned into the pRS series of plasmids
by PCR with primers 300KpnI and 1300SacI as described in
Materials and Methods. The sequence of mak8-1 was determined
from three independently isolated clones as described in Materials and
Methods. The mak8-1-specific G765C (encoding a Trp-to-Cys
change at amino acid residue 255) and C769T (encoding a Pro-to-Ser
change at amino acid residue 257, which is a potentially significant
change) mutations are indicated. (B) Map of the
RPL3-hisG-URA3 disruption plasmid. Based on BlueScript KS, a
hisG::URA3 marker was integrated into the RPL3
locus between the XbaI site at 32 and an SphI
site at 1130. (C) Map of the L3 fragment.
L3 contains the 5' noncoding sequence from position 485
plus the first 300 bp of RPL3 (to the Sau3AI
site). L3 was cloned into the pRS series of vectors by
using primers 485BamHI and 300BglII. A
PGK1 terminator sequence is located downstream of the
L3 coding region.
|
|
The original clone (YPF2-9) harboring the
L3
fragment was
obtained as a high-copy suppressor of a
upf2 deletion strain
as
described previously (
13). The active
L3
fragment was amplified
and subcloned into the pRS series of vectors by
using
Taq DNA
polymerase and the

485
BamHI (5'
ATAGGATCCTTAACCGGCCGGACAGTAATA
3') and
+300
BglII (5'
ATAGGATCCTTGTCATCGTCGTCCTTGTAGTCTCTCAAACCTCTTGGGGT
3')
oligonucleotide primers to create pJD138 (low copy number,
pRS315
based) and pJD139 (high copy number, pRS426 based) (Fig.
1C). The
PGK1 transcriptional terminator was subcloned 3' of the
L3
fragments as previously described (
12).
The plasmids used to monitor programmed ribosomal frameshifting were
previously described (
11,
12,
18,
19,
54).
Briefly, in all
of these plasmids, transcription is driven from
the yeast
PGK1 promoter into an AUG translational start site (Fig.
2). The
E. coli lacZ gene
serves as the reporter, and transcription
termination utilizes the
yeast
PGK1 transcriptional terminator.
In the p0 plasmids,
lacZ is in the 0-frame with respect to the
translational
start site, and measurement of

-galactosidase activity
generated
from cells transformed with these plasmids serves to
represent the
0-frame controls. In the p-1 series,
lacZ is in
the

1
frame with respect to the translational start site and
is 3' of the
L-A-programmed

1 ribosomal frameshift signal, such
that

-galactosidase can only be produced as a consequence of
a programmed

1 ribosomal frameshift. Similarly, in the p+1 series,
lacZ
is in the +1 frame with respect to the translational start
site and is
3' of the Ty
1-programmed +1 ribosomal frameshift signal,
such that

-galactosidase can only be produced as a consequence
of a
programmed +1 ribosomal frameshift. The efficiency of programmed
ribosomal frameshifting is calculated by determining the ratio
of

-galactosidase activity produced by cells harboring either
p

1 or
p+1 divided by the

-galactosidase activity produced by
cells
harboring p0 and multiplying the result by 100%. Measurement
of
programmed

1 ribosomal frameshifting in the presence of anisomycin
and sparsomycin was performed as described previously (
19).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 2.
Vectors used to measure programmed ribosomal
frameshifting efficiencies. The 0-frame control reporter plasmid p0 and
the 1 ribosomal frameshift test plasmid p 1 are described in
references 12 and 17, and the +1
ribosomal frameshift test plasmid p+1 is described in references
3 and 58. In these constructs,
transcription is driven from the constitutive phosphoglycerol kinase 1 (PGK1) promoter. The efficiencies of programmed ribosomal
frameshifting are determined by dividing the -galactosidase
activities produced from the frameshift reporters (p 1 or p+1) by
those produced from the p0 control and multiplying the resulting ratios
by 100%.
|
|
Construction of isogenic mak8-1 and RPL3
strains.
Yeast strains JD100 and JD973 were mated, and the
diploids were transformed with PvuII-linearized pJD168 and
selected on H-Ura medium (22). Disruption of the RPL3 locus
on one chromosome was confirmed by Southern analysis as described
below. Diploids were selected for loss of the chromosomal
URA3 insert by growth on 5-flouroorotic acid (5-FOA).
Ura
cells were transformed with pRPL3-Ura3, sporulated,
and dissected onto YPAD medium. The resulting tetrads are from cross
JD980. rpl3
status was confirmed by the inability of
spore clones to grow in the presence of 5-FOA. To construct isogenic
mak8-1 strains, cells were transformed with pmak8-1-TRP1 and
were subsequently grown in the presence of 5-FOA to select for loss of
the wild-type pRPL3-Ura3 plasmid.
Killer assay.
The killer virus assay was carried out as
previously described (21). Briefly, yeast colonies were
replica plated to 4.7MB plates (22) with a newly seeded lawn
of strain 5X47 (0.5 ml of a suspension at 1 Unit of optical density at
550 nm per ml per plate). After 2 to 3 days at 20°C, killer activity
was observed as a clear zone around the killer colonies. Loss-of-killer
assays were performed with multiple wild-type and mutant strains.
Nucleic acid analyses.
dsRNAs of L-A and M1
viruses were prepared as described previously (25),
separated by electrophoresis through 1.2% agarose gels, denatured in
the gels in two changes of 30 min each of 50% formamide-9.25%
formaldehyde-1 × Tris-acetate-EDTA at room temperature, and
transferred to nitrocellulose in 20× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate). L-A and M1 negative strand RNA
probes were labeled with [
-32P]UTP and hybridized to
blots and washed as described in reference 22. RNase
protection assays to determine the relative abundances of the
lacZ
1 frameshift reporter mRNAs and U3 small nuclear RNA
in the isogenic wild-type, mak8-1, and L3
strains were carried out as described previously (44).
 |
RESULTS |
The mak8-1 allele of RPL3 promotes
increased programmed
1 ribosomal frameshifting efficiencies.
Previous studies have demonstrated that peptidyltransferase inhibitors
specifically affect programmed
1 ribosomal frameshifting efficiencies
(19). Based on these and other observations (11, 14,
15, 43, 44, 55-57), we hypothesized that the surveillance complex monitors the ribosomal peptidyltransferase center and that
mutations that affect either the surveillance complex or the
peptidyltransferase center will affect programmed
1 ribosomal frameshifting efficiencies (19, 44). Thus, we predicted that yeast strains harboring chromosomal mutations affecting the
peptidyltransferase center may also have defects in programmed
1
ribosomal frameshifting and killer virus maintenance. The
mak8-1 allele of ribosomal protein L3 initially presents a
logical candidate with which to test this hypothesis, since strains
harboring this mutation promoted loss of the killer virus. Programmed
ribosomal frameshifting efficiencies were measured in vivo by using a
series of lacZ reporter plasmids as described previously
(12, 17, 19, 54) (see Fig. 2 for constructs). The p0 series
of plasmids serve as the 0-frame controls, since lacZ is in
the 0-frame with respect to the translational start site (Fig. 2). In
the p
1 plasmid series, an L-A-derived programmed
1 ribosomal
frameshift signal is cloned into the polylinker, and the
lacZ gene is in the
1 frame with respect to the
translational start site (Fig. 2). Therefore, in these constructs, the
lacZ gene can only be translated if the ribosome shifts the
frame in the
1 direction. Similarly, the p+1 plasmid series contains
at Ty1 a programmed +1 ribosomal frameshift signal cloned
into the polylinker, and the lacZ gene is in the +1 frame
with respect to the translational start site (Fig. 2). The
Ty1 +1 reporter plasmid is used as a control to determine
the specificity of the effect of the mutation on translation. The
efficiencies of
1 and +1 ribosomal frameshifting are calculated by
determining the ratio of
-galactosidase activities measured in cells
harboring p
1 or p+1 to those harboring p0 and multiplying the result
by 100%.
After cells (strain 1906 [Table
1]) harboring the
mak8-1
allele were transformed with p0, p

1, or p+1, the efficiencies of
programmed ribosomal frameshifting were determined. The results
demonstrated that the programmed

1 frameshifting efficiency in
the
mak8-1 strain was 5.2%, approximately threefold greater
than
the 1.7 to 2.0% normally observed in wild-type strains (Table
2). To confirm that the change in
programmed

1 ribosomal frameshifting
efficiency was solely due to the
mak8-1 allele, isogenic wild-type
and
mak8-1
strains were constructed, and programmed

1 frameshifting
in these
cells was determined as described above (cross JD980
[Table
1]). In
isogenic backgrounds, the
mak8-1 allele of
RPL3 promotes an approximately 2.5-fold increase in programmed

1 ribosomal
frameshift efficiency (

4.9% in
mak8-1 compared to

1.9% in the
isogenic wild-type strain [Table
2]). The
mak8-1 allele was also
unable to maintain the M
1
killer virus (Table
2). However,
mak8-1 had no effect
on programmed +1 ribosomal frameshifting (Table
2). Taken together,
these results demonstrate that the
mak8-1 allele causes an
alteration in programmed

1 ribosomal frameshift
efficiencies. Thus,
the
mak8-1 allele is also a
mof mutant, in
that these strains demonstrate increased programmed

1 ribosomal
frameshifting efficiencies and loss of the killer virus (
11,
12).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Assays of programmed 1 ribosomal frameshifting and the
killer phenotype in yeast cells harboring the wild-type
RPL3 gene or the mak8-1 allele
|
|
Characterization of the mak8-1 lesion.
The
mak8-1 allele was amplified by PCR from genomic DNA
harvested from strain 1906, and the DNA sequence was obtained from three independently isolated clones (see Materials and Methods). The
results demonstrated that the mak8-1 allele harbors two
separate mutations spaced four nucleotides apart (Fig. 1A). The G765C
mutation encodes a Trp-to-Cys change at amino acid residue 255. The
C769T mutation changes a proline at residue 257 to serine, a
potentially significant structural change.
Strains harboring the mak8-1 allele are resistant to
the effects of peptidyltransferase inhibitors on programmed
1
ribosomal frameshifting.
We previously demonstrated that
peptidyltransferase inhibitors specifically alter programmed
1
ribosomal frameshifting efficiencies (19). It has been
previously demonstrated that cells harboring mutant alleles of
rpl3 are resistant to the cytotoxic effects of
peptidyltransferase inhibitors (28, 32, 45, 60). These include strains harboring the mak8 and the tcm1
classes of RPL3 alleles. Thus, we asked whether members of
this class of agents affect programmed
1 ribosomal frameshifting in
strains harboring mak8-1. To examine this, mak8-1
and wild-type cells harboring either p0 or p
1 frameshift indicator
plasmids were grown in the presence of various concentrations of either
anisomycin or sparsomycin for 4 h, and programmed ribosomal
frameshifting efficiencies were determined as described above. The
results demonstrated that both anisomycin and sparsomycin altered
ribosomal frameshifting in wild-type cells (Fig.
3). In contrast, neither anisomycin nor sparsomycin had any further effect on programmed
1 ribosomal frameshifting in mak8-1 strains (Fig. 3). These results
provide strong evidence that a defect affecting the peptidyltransferase center is responsible for the observed increase in programmed
1
ribosomal frameshifting in mak8-1 cells.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Programmed 1 ribosomal frameshifting ( 1 RFS) in a
mak8-1 strain is not further affected by peptidyltransferase
inhibitors. Isogenic wild-type and mak8-1 cells harboring
either p0 or p 1 frameshift indicator plasmids were grown in the
presence of the indicated concentrations of sparsomycin (A) or
anisomycin (B) for 4 h, after which programmed 1 ribosomal
frameshifting efficiencies were determined as described in Materials
and Methods. In the absence of drugs, wild-type cells promote
approximately 2% efficiency of programmed 1 ribosomal frameshifting,
whereas this value is approximately 5% in cells harboring the
mak8-1 allele. The fold changes in programmed 1 ribosomal
frameshifting efficiencies are plotted on the y axis.
|
|
Episomal expression of the N-terminal 100 amino acids of ribosomal
protein L3 increases programmed frameshifting and loss of the killer
virus.
We have recently identified a second RPL3 allele
that affects both programmed
1 ribosomal frameshifting and virus
maintenance. This allele was isolated by its ability to abrogate the
capability of cells harboring the upf2-1 allele to allow the
expression of nonsense-containing mRNAs (13). Previous
results have demonstrated that mutations in the UPF1,
UPF2, and UPF3 genes can affect several aspects
of translational fidelity (12, 15, 44, 55, 56). In
particular, a specific mutation in the UPF1 gene
(mof4-1) and a deletion of the UPF3 gene both
increase programmed
1 ribosomal frameshifting efficiencies and lead
to loss of the killer virus (12, 44). Characterization of
the antisuppressor of upf2-1, YPF2-9, demonstrated that it
encodes the N-terminal 100 amino acids of the RPL3 (see
Materials and Methods). This allele was renamed L3
(Fig.
1C). Based on this connection between the upf mutants and
L3, we examined the effect of episomal expression of L3
on programmed ribosomal frameshifting. Episomal expression of
L3
protein in wild-type cells from either low- or
high-copy plasmids promoted an approximately threefold increase in the
efficiency of programmed
1 ribosomal frameshifting, but had no effect
on programmed +1 ribosomal frameshifting (Fig.
4A). Expression of L3
in
wild-type cells also promoted high rates of killer phenotype loss (Fig.
4B). RNA hybridization analysis revealed that loss of the killer
phenotype was a consequence of failure to maintain the M1
satellite dsRNA virus (Fig. 4C).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 4.
The L3 allele of RPL3 confers a
dominant-negative Mof phenotype. (A) Wild-type cells were
transformed with L3 cloned into either low-copy-number
(YCp) or high-copy-number (YEp) vectors, and programmed 1 and +1
ribosomal frameshifting efficiencies were monitored with the following
results: programmed 1 ribosomal frameshifting, YCp = 2.63% ± 0.34%, YCpL3 = 7.22% ± 1.13%, YEp = 2.74% ± 0.64%, and
YEpL3 = 7.42% ± 1.13%; programmed +1 ribosomal frameshifting,
YCp = 4.52% ± 0.29%, YCpL3 = 4.60% ± 0.14%, YEp = 4.42% ± 0.18%, and YEpL3 = 4.53% ± 0.22%. (B) Killer
phenotypes of wild-type cells (JD890) transformed with YCpL3 or
vector. (C) Total nucleic acids were extracted from cells transformed
with vector alone ( ) or from cells transformed with YCpL3 (+), and
RNA was transferred to nitrocellulose and hybridized with L-A- and
M1-specific negative-strand probes. L-A- and
M1-hybridizing bands are indicated.
|
|
Although the +1 frameshift and killer loss data strongly suggest that
programmed

1 ribosomal frameshifting is elevated in
cells harboring
the
mak8-1 and
L3
alleles, the formal
possibility
exists that specific stabilization of the LacZ

1
mRNA relative
to the 0-frame control mRNA may account for an apparent
increase
in programmed

1 ribosomal frameshift efficiencies and that
M
1 loss is a consequence of some other defect. The level of
the LacZ

1 frameshift reporter mRNA was not affected either by cells
harboring
the
mak8-1 allele or by expression of
L3
(data not shown). These
data are consistent with
previous results demonstrating that expression
of
L3
(YPF2-9) did not affect the levels of a nonsense-containing
Cyh2
precursor mRNA in a
upf2-1 strain (
13). Thus,
L3
also
behaves like a
mof mutant in that it
inhibits virus propagation
as a consequence of increased programmed

1
ribosomal
frameshifting.
L3
is dominant to the ski mutants.
The L-A and M1 mRNAs present poor translational substrates
because they do not possess either the 5' m7G5'ppp5'Xp cap or 3' poly(A) tails (9, 52). The lack of these structures does not
prevent their expression in wild-type cells, but does make their
expression sensitive to mutations which affect translation (e.g., the
mak mutants) (4, 35, 40). Conversely, L-A and M1 copy numbers are increased in cells harboring mutations
in chromosomal genes which are involved in recognition of 5' caps or 3'
poly(A) tails and in the degradation of mRNAs lacking these structures
(2, 4, 35). However, since the ratio of Gag to Gag-Pol is
critical for viral particle morphogenesis, we predicted that mutations
which change this ratio by altering frameshift efficiencies should be
dominant to the effects of the ski mutants, because although
the L-A and M1 mRNAs are either stabilized or translated
more efficiently by the ski mutations, the ratios of Gag to
Gag-Pol should still be altered as a consequence of the mof mutations.
To test this hypothesis, a plasmid harboring the
L3
allele was introduced into cells harboring mutations in a series of
SKI genes. These included the
SKI1/XRN1 gene,
which encodes the major
5'

3' exoribonuclease that degrades uncapped
RNAs (
29,
33,
37,
49,
50), the
SKI2 and
SKI6 genes, which play a role
in ribosome biogenesis, and
which are both required for efficient
translation of poly(A) mRNAs, and
the 3'

5' exonuclease activity
of the exosome (
2,
4,
35),
SKI4, and
SKI7 (
42). The
results
demonstrated that episomal expression of
L3
promoted
rapid loss of the killer phenotype, which was due to loss of the
M
1 virus (Fig.
4C).
 |
DISCUSSION |
Mutations affecting ribosomal protein L3 promote loss of the
M1 killer virus by altering the efficiency of programmed
1 ribosomal frameshifting.
The mechanism governing
programmed
1 ribosomal frameshifting suggests that drugs and
mutations which affect the peptidyl-transfer reaction may alter
programmed
1 ribosomal frameshift efficiencies and have antiviral
effects (19). We previously used peptidyltransferase inhibitors to demonstrate the validity of this model (19).
The results presented here have shown that two alleles encoding mutant forms of ribosomal protein L3, which was previously implicated in
formation of the peptidyltransferase center, also alter programmed
1
ribosomal frameshift efficiencies and have antiviral effects. Taken
together, these results support the hypothesis that the peptidyltransferase center may present a novel target for
antiretroviral therapeutic agents.
It has long been known that cells harboring
mak8 alleles
cannot propagate the M
1 satellite virus (
59).
Additional alleles
of
RPL3, named
tcm1, were also
characterized based on their resistance
to the peptidyltransferase
inhibitor trichodermin (
26,
28,
32,
45,
46). These alleles
also have the Mak

phenotype (
60). However, the
precise mechanism responsible
for killer virus loss in this class of
mutants was not determined.
Previous results suggested that
mak8-1 did not affect programmed

1 ribosomal frameshifting
efficiencies (
22). However, the interpretation
of those
results was incorrect in that only changes in overall

-galactosidase
activities generated from a frameshift reporter
construct by using
sister spore clones were examined. The present
study rectifies those
defects by directly measuring programmed
ribosomal frameshifting
efficiencies in isogenic strains. The
results presented here
demonstrate that alterations in programmed

1 ribosomal frameshifting
efficiencies are responsible for the
inability of cells harboring this
mutation to maintain the M
1 dsRNA virus. Given the previous
demonstration that peptidyltransferase
inhibitors promote virus loss by
altering programmed

1 ribosomal
frameshift efficiencies, as well as
the role of the L3 protein
in peptidyltransferase center formation, our
results indicating
that mutations in
RPL3 affect programmed

1 ribosomal frameshifting
are consistent with the view that
alteration of peptidyl-transfer
activity affects this process. In
addition, the finding that episomal
expression of the
L3
allele confers a dominant negative Mof

phenotype provides
a novel tool that can be used to probe the
contribution of L3 to
translational fidelity. The
trans-dominance
of the L3
peptide illuminates the importance of programmed

1
ribosomal
frameshifting in the viral life cycle. The fact that
L3
is dominant to the
ski mutants demonstrates that even when
viral RNAs and proteins are in excess, these mutants cannot overcome
the imbalance in the ratio of Gag to Gag-Pol proteins as a consequence
of altered programmed

1 ribosomal frameshifting efficiency. Thus,
the
trans-dominance of the
L3
allele with respect
to the
ski mutants supports the hypothesis that the
efficiency of programmed
ribosomal frameshifting plays a critical role
in the viral particle
morphogenetic process by ensuring the correct
ratio of viral structural
to enzymatic
proteins.
We envision two models to explain the role of the L3 protein in
programmed

1 ribosomal frameshifting. In one, we suggest
that the
incorporation of defective L3 protein (either Mak8-1p
or L3

p) into
ribosomes would result in suboptimal L3 function,
yielding the observed
translational fidelity defect. Alternatively,
it is possible that
expression of these alleles results in a subpopulation
of L3-deficient
ribosomes. Since it is thought that the large
rRNA is responsible for
peptidyltransferase activity (
38,
61),
these L3-deficient
ribosomes would retain a small amount of peptidyltransferase
activity.
In both scenarios, defects in peptidyltransferase activity
are
predicted to slow the rate of translation elongation while
both the
ribosomal A- and P-sites are occupied. In the context
of frameshifting,
this would result in a longer ribosomal pause
at the programmed

1
ribosomal frameshift signal, increasing the
likelihood of a successful
frameshift. If this model is true,
then the observed increases in
programmed

1 ribosomal frameshifting
efficiencies promoted by these
alleles should represent the sum
of programmed frameshifting promoted
by normal plus defective
ribosomes.
In sum, we have demonstrated that two genetically defined alleles
encoding L3, a ribosomal protein which has been demonstrated
to
participate in formation of the peptidyltransferase center,
both affect
the efficiency of programmed

1 ribosomal frameshifting
and promote
loss of the killer virus. These studies are consistent
with our
pharmacologically based observations that peptidyltransferase
inhibitors specifically affect programmed

1 ribosomal frameshifting
efficiencies and demonstrate the utility of using programmed ribosomal
frameshifting as an assay to probe the mechanisms which regulate
the
process of protein
translation.
 |
ACKNOWLEDGMENTS |
We thank Reed Wickner for strain 1906 and Michael Leibowitz for
helpful discussions.
This work was supported by grants to J.D.D. by the Foundation of UMDNJ
(#16-98), the New Jersey Commission on Cancer Research (97-60-CCR), and
the National Science Foundation (MCB-9807890) and to S.W.P. by the
National Institutes of Health (GM48631). S.W.P. was also supported by
an American Heart Established Investigator Award. A.B.H. was supported
in part by a training grant from the National Institutes of Health (T32
AI07403-07), and L.P. was supported in part by the Henry Rutgers
Scholars Program (RPO 6183).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics and Microbiology and Graduate Program in Molecular Biosciences at UMDNJ/Rutgers Universities, 675 Hoes Lane, Piscataway, NJ 08854. Phone: (732) 235-4670. Fax: (732) 235-5223. E-mail: dinmanjd{at}umdnj.edu.
 |
REFERENCES |
| 1.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 2.
|
Anderson, J. S. J., and R. Parker.
1998.
The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex.
EMBO J.
17:1497-1506[Medline].
|
| 3.
|
Balasundaram, D.,
J. D. Dinman,
R. B. Wickner,
C. W. Tabor, and H. Tabor.
1994.
Spermidine deficiency increases +1 ribosomal frameshifting efficiency and inhibits Ty1 retrotransposition in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:172-176[Abstract/Free Full Text].
|
| 4.
|
Benard, L.,
K. Carroll,
R. C. P. Valle, and R. B. Wickner.
1998.
Ski6p is a homolog of RNA-processing enzymes that affects translation of non-poly(A) mRNAs and 60S ribosomal subunit biogenesis.
Mol. Cell. Biol.
18:2688-2696[Abstract/Free Full Text].
|
| 5.
|
Bishop, J. M.
1978.
Retroviruses.
Annu. Rev. Biochem.
47:35-88[Medline].
|
| 6.
|
Brierley, I.
1995.
Ribosomal frameshifting on viral RNAs.
J. Gen. Virol.
76:1885-1892[Abstract/Free Full Text].
|
| 7.
|
Brierley, I. A.,
P. Dingard, and S. C. Inglis.
1989.
Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot.
Cell
57:537-547[Medline].
|
| 8.
|
Brierley, I. A.,
A. J. Jenner, and S. C. Inglis.
1992.
Mutational analysis of the "slippery sequence" component of a coronavirus ribosomal frameshifting signal.
J. Mol. Biol.
227:463-479[Medline].
|
| 9.
|
Bruenn, J., and B. Keitz.
1976.
The 5' ends of yeast killer factor RNAs are pppGp.
Nucleic Acids Res.
3:2427-2436.
|
| 10.
|
Christianson, T. W.,
R. S. Sikorski,
M. Dante,
J. H. Shero, and P. Hieter.
1992.
Multifunctional yeast high-copy-number shuttle vectors.
Yeast
110:119-122.
|
| 11.
|
Cui, Y.,
J. D. Dinman,
T. G. Kinzy, and S. W. Peltz.
1998.
The Mof2/Sui1 protein is a general monitor of translational accuracy.
Mol. Cell. Biol.
18:1506-1516[Abstract/Free Full Text].
|
| 12.
|
Cui, Y.,
J. D. Dinman, and S. W. Peltz.
1996.
mof4-1 is an allele of the UPF1/IFS2 gene which affects both mRNA turnover and 1 ribosomal frameshifting efficiency.
EMBO J.
15:5726-5736[Medline].
|
| 13.
|
Cui, Y.,
K. W. Hagan,
S. Zhang, and S. W. Peltz.
1995.
Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination codon.
Genes Dev.
9:423-436[Abstract/Free Full Text].
|
| 14.
| Cui, Y., T. G. Kinzy, J. D. Dinman, and
S. W. Peltz. Unpublished data.
|
| 15.
|
Czaplinski, K.,
M. J. Ruiz-Echevarria,
S. V. Paushkin,
Y. Weng,
H. A. Perlick,
H. C. Dietz,
M. D. Ter-Avanesyan, and S. W. Peltz.
1998.
The surveillance complex interacts with the translation release factors to enhance termination and degrade aberrant mRNAs.
Genes Dev.
12:1665-1667[Abstract/Free Full Text].
|
| 16.
|
Dinman, J. D.
1995.
Ribosomal frameshifting in yeast viruses.
Yeast
11:1115-1127[Medline].
|
| 17.
|
Dinman, J. D.,
T. Icho, and R. B. Wickner.
1991.
A 1 ribosomal frameshift in a double-stranded RNA virus forms a Gag-pol fusion protein.
Proc. Natl. Acad. Sci. USA
88:174-178[Abstract/Free Full Text].
|
| 18.
|
Dinman, J. D., and T. G. Kinzy.
1997.
Translational misreading: mutations in translation elongation factor 1 differentially affect programmed ribosomal frameshifting and drug sensitivity.
RNA
3:870-881[Abstract].
|
| 19.
|
Dinman, J. D.,
M. J. Ruiz-Echevarria,
K. Czaplinski, and S. W. Peltz.
1997.
Peptidyl transferase inhibitors have antiviral properties by altering programmed 1 ribosomal frameshifting efficiencies: development of model systems.
Proc. Natl. Acad. Sci. USA
94:6606-6611[Abstract/Free Full Text].
|
| 20.
|
Dinman, J. D.,
M. J. Ruiz-Echevarria, and S. W. Peltz.
1998.
Translating old drugs into new treatments: identifying compounds that modulate programmed 1 ribosomal frameshifting and function as potential antiviral agents.
Trends Biotechnol.
16:190-196[Medline].
|
| 21.
|
Dinman, J. D., and R. B. Wickner.
1992.
Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast M1 double-stranded RNA virus propagation.
J. Virol.
66:3669-3676[Abstract/Free Full Text].
|
| 22.
|
Dinman, J. D., and R. B. Wickner.
1994.
Translational maintenance of frame: mutants of Saccharomyces cerevisiae with altered 1 ribosomal frameshifting efficiencies.
Genetics
136:75-86[Abstract].
|
| 23.
|
Dinman, J. D., and R. B. Wickner.
1995.
5S rRNA is involved in fidelity of translational reading frame.
Genetics
141:95-105[Abstract].
|
| 24.
|
Farabaugh, P. J.
1996.
Programmed translational frameshifting.
Microbiol. Rev.
60:103-134[Free Full Text].
|
| 25.
|
Fried, H. M., and G. R. Fink.
1978.
Electron microscopic heteroduplex analysis of "killer" double-stranded RNA species from yeast.
Proc. Natl. Acad. Sci. USA
75:4224-4228[Abstract/Free Full Text].
|
| 26.
|
Fried, H. M., and J. R. Warner.
1981.
Cloning of yeast gene for trichodermin resistance and ribosomal protein L3.
Proc. Natl. Acad. Sci. USA
78:238-242[Abstract/Free Full Text].
|
| 27.
|
Gesteland, R. F., and J. F. Atkins.
1996.
Recoding: dynamic reprogramming of translation.
Annu. Rev. Biochem.
65:741-768[Medline].
|
| 28.
|
Grant, P. G.,
D. Schindler, and J. E. Davies.
1976.
Mapping of trichodermin resistance in Saccharomyces cerevisiae: a genetic locus for a component of the 60S ribosomal subunit.
Genetics
83:667-673[Abstract/Free Full Text].
|
| 29.
|
Hsu, C. L., and A. Stevens.
1993.
Yeast cells lacking 5' 3' exoribonuclease 1 contain mRNA species that are poly(A) deficient and partially lack the 5' cap structure.
Mol. Cell. Biol.
13:4826-4835[Abstract/Free Full Text].
|
| 30.
|
Jacks, T.
1996.
Translational suppression in gene expression in retroviruses and retrotransposons.
Curr. Top. Microbiol. Immunol.
157:93-124.
|
| 31.
|
Jacks, T.,
H. D. Madhani,
F. R. Masiraz, and H. E. Varmus.
1988.
Signals for ribosomal frameshifting in the Rous Sarcoma Virus gag-pol region.
Cell
55:447-458[Medline].
|
| 32.
|
Jimenez, A.,
L. Sanchez, and D. Vazquez.
1975.
Simultaneous ribosomal resistance to trichodermin and anisomycin in Saccharomyces cerevisiae mutants.
Biochim. Biophys. Acta
383:427-434[Medline].
|
| 33.
|
Johnson, A. W., and R. D. Kolodner.
1995.
Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control.
Mol. Cell. Biol.
15:2719-2727[Abstract/Free Full Text].
|
| 34.
|
Lee, S. I.,
J. G. Umen, and H. E. Varmus.
1995.
A genetic screen identifies cellular factors involved in retroviral 1 frameshifting.
Proc. Natl. Acad. Sci. USA
92:6587-6591[Abstract/Free Full Text].
|
| 35.
|
Masison, D. C.,
A. Blanc,
J. C. Ribas,
K. Carroll,
N. Sonenberg, and R. B. Wickner.
1995.
Decoying the Cap mRNA degradation system by a double-stranded RNA virus and poly(A) mRNA surveillance by a yeast antiviral system.
Mol. Cell. Biol.
15:2763-2771[Abstract/Free Full Text].
|
| 36.
|
Morikawa, S., and D. H. L. Bishop.
1992.
Identification and analysis of the gag-pol ribosomal frameshift site of feline immunodeficiency virus.
Virology
186:389-397[Medline].
|
| 37.
|
Muhlrad, D., and R. Parker.
1992.
Mutations affecting stability and deadenylation of the yeast MFA2 transcript.
Genes Dev.
6:2100-2111[Abstract/Free Full Text].
|
| 38.
|
Noller, H. F.
1993.
Peptidyl transferase: protein, ribonucleoprotein, or RNA?
J. Bacteriol.
175:5297-5300[Free Full Text].
|
| 39.
|
Noller, H. F.
1997.
Ribosomes and translation.
Annu. Rev. Biochem.
66:679-716[Medline].
|
| 40.
|
Ohtake, Y., and R. B. Wickner.
1995.
Yeast virus propagation depends critically on free 60S ribosomal subunit concentration.
Mol. Cell. Biol.
15:2772-2781[Abstract/Free Full Text].
|
| 41.
|
Peltz, S. W.,
C. Trotta,
F. He,
A. Brown,
J. Donahue,
E. Welch, and A. Jacobson.
1993.
Identification of the cis-acting sequences and trans-acting factors involved in nonsense-mediated mRNA decay, p. 1-10.
In
M. Tuite, J. McCarthy, A. Brown, and F. Sherman (ed.), Protein synthesis and targeting in yeast. Springer-Verlag, Berlin, Germany.
|
| 42.
|
Ridley, S. P.,
S. S. Sommer, and R. B. Wickner.
1984.
Superkiller mutations in Saccharomyces cerevisiae suppress exclusion of M2 double-stranded RNA by L-A-HN and confer cold sensitivity in the presence of M and L-A-HN.
Mol. Cell. Biol.
4:761-770[Abstract/Free Full Text].
|
| 43.
|
Ruiz-Echevarria, M. J.,
C. I. Gonzalez, and S. W. Peltz.
1998.
Identifying the right stop: determining how the surveillance complex recognizes and degrades an aberrant mRNA.
EMBO J.
17:575-589[Medline].
|
| 44.
|
Ruiz-Echevarria, M. J.,
J. M. Yasenchak,
X. Han,
J. D. Dinman, and S. W. Peltz.
1998.
The Upf3p is a component of the surveillance complex that monitors both translation and mRNA turnover and affects viral maintenance.
Proc. Natl. Acad. Sci. USA
95:8721-8726[Abstract/Free Full Text].
|
| 45.
|
Schindler, D.,
P. Grant, and J. Davies.
1974.
Trichodermin resistance mutation affecting eukaryotic ribosomes.
Nature
248:535-536[Medline].
|
| 46.
|
Schultz, L. D., and J. D. Friesen.
1983.
Nucleotide sequence of the tcm1 gene (ribosomal protein L3) of Saccharomyces cerevisiae.
J. Bacteriol.
155:8-14[Abstract/Free Full Text].
|
| 47.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 48.
|
Somogyi, P.,
A. J. Jenner,
I. Brierley, and S. C. Inglis.
1993.
Ribosomal pausing during translation of an RNA pseudoknot.
Mol. Cell. Biol.
13:6931-6940[Abstract/Free Full Text].
|
| 49.
|
Stevens, A.
1980.
Purification and characterization of a Saccharomyces cerevisiae exoribonuclease which yields 5'-mononucleotides by a 5' leads to 3' mode of hydrolysis.
J. Biol. Chem.
255:3080-3085[Abstract/Free Full Text].
|
| 50.
|
Stevens, A., and M. K. Maupin.
1987.
A 5' 3' exoribonuclease of Saccharomyces cerevisiae: size and novel substrate specificity.
Arch. Biochem. Biophys.
252:339-347[Medline].
|
| 51.
|
TenDam, E.,
K. Pleij, and L. Bosch.
1990.
RNA pseudoknots: translational frameshifting and readthrough on viral RNAs.
Virus Genes
4:121-136[Medline].
|
| 52.
|
Thiele, D. J.,
E. M. Hannig, and M. J. Leibowitz.
1984.
Genome structure and expression of a defective interfering mutant of the killer virus of yeast.
Virology
137:20-31[Medline].
|
| 53.
|
Tu, C.,
T.-H. Tzeng, and J. A. Bruenn.
1992.
Ribosomal movement impeded at a pseudoknot required for ribosomal frameshifting.
Proc. Natl. Acad. Sci. USA
89:8636-8640[Abstract/Free Full Text].
|
| 54.
|
Tumer, N. E.,
B. A. Parikh,
P. Li, and J. D. Dinman.
1998.
Pokeweed antiviral protein specifically inhibits Ty1-directed +1 ribosomal frameshifting and Ty1 retrotransposition in Saccharomyces cerevisiae.
J. Virol.
72:1036-1042[Abstract/Free Full Text].
|
| 55.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1996.
Identification and characterization of mutations in the UPF1 gene that affect nonsense suppression and the formation of the Upf protein complex but not mRNA turnover.
Mol. Cell. Biol.
16:5491-5506[Abstract/Free Full Text].
|
| 56.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1996.
Genetic and biochemical characterization of mutations in the ATPase and helicase regions of the Upf1 protein.
Mol. Cell. Biochem.
16:5477-5490.
|
| 57.
|
Weng, Y.,
K. Czaplinski, and S. W. Peltz.
1998.
ATP is a cofactor of the Upf1 protein that modulates its translation termination and RNA binding activities.
RNA
4:205-214[Abstract].
|
| 58.
|
Wickner, R. B.
1996.
Double-stranded RNA viruses of Saccharomyces cerevisiae.
Microbiol. Rev.
60:250-265[Free Full Text].
|
| 59.
|
Wickner, R. B., and M. J. Leibowitz.
1974.
Chromosomal and non-chromosomal mutations affecting the "killer character" of Saccharomyces cerevisiae.
Genetics
76:423-432[Abstract/Free Full Text].
|
| 60.
|
Wickner, R. B.,
S. Porter-Ridley,
H. M. Fried, and S. G. Ball.
1982.
Ribosomal protein L3 is involved in replication or maintenance of the killer double-stranded RNA genome of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
79:4706-4708[Abstract/Free Full Text].
|
| 61.
|
Zhang, B., and T. R. Cech.
1997.
Peptide bond formation by in vitro selected ribozymes.
Nature
390:96-100[Medline].
|
Molecular and Cellular Biology, January 1999, p. 384-391, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Meskauskas, A., Dinman, J. D.
(2008). Ribosomal protein L3 functions as a 'rocker switch' to aid in coordinating of large subunit-associated functions in eukaryotes and Archaea. Nucleic Acids Res
36: 6175-6186
[Abstract]
[Full Text]
-
Chaudhuri, S., Vyas, K., Kapasi, P., Komar, A. A., Dinman, J. D., Barik, S., Mazumder, B.
(2007). Human ribosomal protein L13a is dispensable for canonical ribosome function but indispensable for efficient rRNA methylation. RNA
13: 2224-2237
[Abstract]
[Full Text]
-
Rosado, I. V., Kressler, D., Cruz, J. d. l.
(2007). Functional analysis of Saccharomyces cerevisiae ribosomal protein Rpl3p in ribosome synthesis. Nucleic Acids Res
0: gkm388v1-11
[Abstract]
[Full Text]
-
Mansouri, S., Nourollahzadeh, E., Hudak, K. A.
(2006). Pokeweed antiviral protein depurinates the sarcin/ricin loop of the rRNA prior to binding of aminoacyl-tRNA to the ribosomal A-site. RNA
12: 1683-1692
[Abstract]
[Full Text]
-
Meskauskas, A., Petrov, A. N., Dinman, J. D.
(2005). Identification of Functionally Important Amino Acids of Ribosomal Protein L3 by Saturation Mutagenesis. Mol. Cell. Biol.
25: 10863-10874
[Abstract]
[Full Text]
-
Ivanovska, I., Hardwick, J. M.
(2005). Viruses activate a genetically conserved cell death pathway in a unicellular organism. JCB
170: 391-399
[Abstract]
[Full Text]
-
Su, M.-C., Chang, C.-T., Chu, C.-H., Tsai, C.-H., Chang, K.-Y.
(2005). An atypical RNA pseudoknot stimulator and an upstream attenuation signal for -1 ribosomal frameshifting of SARS coronavirus. Nucleic Acids Res
33: 4265-4275
[Abstract]
[Full Text]
-
Jacobs, J. L., Dinman, J. D.
(2004). Systematic analysis of bicistronic reporter assay data. Nucleic Acids Res
32: e160-e160
[Abstract]
[Full Text]
-
MESKAUSKAS, A., HARGER, J. W., MULDOON JACOBS, K. L., DINMAN, J. D.
(2003). Decreased peptidyltransferase activity correlates with increased programmed -1 ribosomal frameshifting and viral maintenance defects in the yeast Saccharomyces cerevisiae. RNA
9: 982-992
[Abstract]
[Full Text]
-
Meskauskas, A., Baxter, J. L., Carr, E. A., Yasenchak, J., Gallagher, J. E. G., Baserga, S. J., Dinman, J. D.
(2003). Delayed rRNA Processing Results in Significant Ribosome Biogenesis and Functional Defects. Mol. Cell. Biol.
23: 1602-1613
[Abstract]
[Full Text]
-
Arkov, A. L., Hedenstierna, K. O. F., Murgola, E. J.
(2002). Mutational Evidence for a Functional Connection between Two Domains of 23S rRNA in Translation Termination. J. Bacteriol.
184: 5052-5057
[Abstract]
[Full Text]
-
Barry, J. K., Miller, W. A.
(2002). A -1 ribosomal frameshift element that requires base pairing across four kilobases suggests a mechanism of regulating ribosome and replicase traffic on a viral RNA. Proc. Natl. Acad. Sci. USA
99: 11133-11138
[Abstract]
[Full Text]
-
Smith, M. W., Meskauskas, A., Wang, P., Sergiev, P. V., Dinman, J. D.
(2001). Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 8264-8275
[Abstract]
[Full Text]
-
BRIERLEY, I., PENNELL, S.
(2001). Structure and Function of the Stimulatory RNAs Involved in Programmed Eukaryotic -1 Ribosomal Frameshifting. Cold Spring Harb Symp Quant Biol
66: 233-248
[Abstract]
-
Hudak, K. A., Dinman, J. D., Tumer, N. E.
(1999). Pokeweed Antiviral Protein Accesses Ribosomes by Binding to L3. J. Biol. Chem.
274: 3859-3864
[Abstract]
[Full Text]