Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 392-401, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The B29 (Immunoglobulin
-Chain) Gene
Is a Genetic Target for Early B-Cell Factor
Peter
Åkerblad,
Maria
Rosberg,
Tomas
Leanderson, and
Mikael
Sigvardsson*
Immunology Group, CMB, Lund University, S-223
62 Lund, Sweden
Received 3 June 1998/Returned for modification 30 June
1998/Accepted 17 September 1998
 |
ABSTRACT |
Early B-cell factor (EBF) is a transcription factor suggested as
essential for early B-lymphocyte development by findings in mice where
the coding gene has been inactivated by homologous disruption. This
makes the identification of genetic targets for this transcription
factor pertinent for the understanding of early B-cell development. The
lack of B29 transcripts, coding for the
subunit of the
B-cell receptor complex, in pro-B cells from EBF-deficient mice
suggested that B29 might be a genetic target for EBF. We
here present data suggesting that EBF interacts with three independent
sites within the mouse B29 promoter. Furthermore, ectopic
expression of EBF in HeLa cells activated a B29
promoter-controlled reporter construct 13-fold and induced a low level
of expression from the endogenous B29 gene. Finally,
mutations in the EBF binding sites diminished B29 promoter
activity in pre-B cells while the same mutations did not have as
striking an effect on the promoter function in B-cell lines of later
differentiation stages. These data suggest that the B29
gene is a genetic target for EBF in early B-cell development.
 |
INTRODUCTION |
B-lymphocyte development is a
complex differentiation process that generates
antibody-secreting cells. One key issue for the understanding of this
process is how transcription is controlled in order to achieve lineage-
and stage-specific expression of selected genes. Transcriptional
control has been extensively studied in B cells, and several
transcription factors have been shown to be essential for the
development of the B-cell lineage (3, 5). One of these
transcription factors is early B-cell factor (EBF) expressed in all
stages of B-cell development with the exception of the plasma cell
stage (7, 9). EBF is B-cell restricted but also expressed in
adipocytes and in olfactory neurons (7, 35). The factor
binds to the DNA core sequence CCCNNGGG as a homodimer by a large DNA
binding domain containing a zinc coordination motif (7, 8,
34). The dimerization is mediated by two
-helixes with homology to helix two of the helix-loop-helix (HLH) domain found in transcription factors of the basic HLH family (7,
8). EBF has been shown to contain two independent transactivation domains, one located within the DNA binding domain and another in the
carboxy-terminal part of the protein (8). EBF interacts functionally with transcription control elements regulating a number of
B-cell-specific genes (for a review, see reference
28). The first identified genetic target was the
mb-1 gene (9), which encodes the
-subunit of
the B-cell receptor complex (13, 14). Here, EBF was shown to
interact with an element important for full activity of the promoter
(9). However, the mb-1 gene can be expressed in
cell lines in the absence of EBF as well, demonstrating that this
promoter is not completely dependent on EBF in transformed cells
(29). The pre-B-cell-specific surrogate light-chain genes
5 and VpreB (for a review, see reference
22) have also been suggested to be direct targets
for EBF since both contain EBF binding sites important for promoter
function (21, 26, 29). This was further supported by the
observation that ectopic expression of EBF in the immature
hematopoietic cell line Ba/F3 resulted in activation of the
endogenous
5 and VpreB genes (29). EBF has also been demonstrated to interact with
immunoglobulin (Ig) light-chain promoters (30) and to
functionally modulate the Ig heavy-chain intron-enhancer
(1).
Homologous disruption of the EBF coding gene resulted in
mice lacking IgM expressing B cells, showing the necessity for EBF in
the development of mature B lymphocytes (19). The
developmental block of B-cell differentiation occurred at an early
stage, before the onset of Ig recombination but after the initiation of
expression of sterile Ig transcripts (Iµ and µ0) and terminal
deoxynucleotide transferase. Flow cytometric analysis showed that the
bone marrow of EBF
/
mice contained cells
expressing B220 and CD43 but not BP1 or heat-stable antigen, suggesting
that these cells are arrested in the transition from fraction A (pro-B)
to fraction B (pre-B) cells (10). The interleukin-7 receptor
was expressed, but no detectable mRNA for Rag-1, Ig
-chain, VpreB,
5, or Ig
-chain (Ig
) were detected (19). The absence
of Ig
(B29) transcripts was striking since mRNA coding
for Ig
is present in normal fraction A pro-B cells (17).
Furthermore, Ig
transcripts can be detected in mice homozygous for
an inactivated E2A gene (38), which have a
similar developmental block of B-cell development. These observations suggested to us that the B29 promoter might be a genetic
target for EBF.
The B29 gene encodes the
component of the B-cell
receptor complex and acts as a signal transducer molecule after antigen recognition of surface Ig (for reviews, see references 2,
13, and 14). The gene has been shown to be
essential for B-cell development, since mice homozygous for a mutation
in the B29 gene display an early arrest of B-cell
development, after the onset of D-J but before VDJ recombination of the
Ig heavy-chain locus (6). B29 is expressed in
cell lines representing all B-cell differentiation stages
(11); it was proposed that there is a partial but not
complete overlap of EBF and B29 expression. The B29 promoter has been suggested to interact with IKAROS,
OCT, and Ets proteins (12, 25). The importance of these
factors has also been displayed by mutagenesis experiments where the
Ets and the OCT protein binding sites were shown to be important for the function of the B29 promoter (25). The
B29 gene has also been shown to be under the control of
repressor elements located 5' of the promoter (20).
Here we show data suggesting that EBF binds to the B29
promoter and has the ability to activate the promoter in HeLa cells. Furthermore, we present data indicating that the EBF binding sites are
of great importance in the function of the promoter in pre-B-cell lines
while they have less impact on promoter function in B-cell lines
representing later developmental stages. These experiments suggest that
the B29 gene is a direct genetic target for EBF and would
explain the absence of B29 transcripts in pro-B cells in EBF
/
mice.
 |
MATERIALS AND METHODS |
Tissue culture conditions.
All cells were grown in RPMI
medium supplemented with 7.5% fetal calf serum, 10 mM HEPES, 2 mM
pyruvate, 50 µM 2-mercaptoethanol, and 50 µg of gentamicin per ml
(all purchased from Life Technologies AB, Täby, Sweden) at 37°C
and 5% CO2.
Transient transfections and luciferase assays.
A total of
250,000 HeLa cells were grown overnight in 1 ml of RPMI medium in a
24-well plate. The cells were washed once with serum-free medium
(OPTIMEM; Life Technologies), and 800 µl of the serum-free medium was
added for transfection. Five microliters of Lipofectin (Life
Technologies) was diluted in 100 µl of serum-free medium, incubated
for 45 min at room temperature, and mixed with the DNA diluted in 100 µl of serum-free medium. The mixture was incubated for 25 min, and
the combined volume of 200 µl was added to the HeLa cells. The cells
were then incubated in a CO2 incubator at 37°C for 6 h, after which the transfection medium was removed and replaced by RPMI
medium supplemented with 10% fetal calf serum. The cells were
harvested after 40 h, and protein extracts were prepared by using
100 µl of cell lysis buffer (Promega, Scandinavian Diagnostic
Services AB, Falkenberg, Sweden). The luciferase assay was then
conducted with 15 µl of the obtained extracts and 200 µl of
luciferase assay reagent (Promega). To induce expression of endogenous
B29 expression in HeLa cells, 2 million cells were transfected with 2 µg of EBF expression plasmid by a scaled-up Lipofectin protocol as described above.
All other cell lines were washed twice in Tris-buffered saline (TBS;
140 mM NaCl, 5 mM KCl, 25 mM Tris [pH 7.4], 0.6 mM phosphate, 0.5 mM
MgCl2, 0.7 mM CaCl2), and 2.5 × 106 cells were transfected with 2 µg of reporter gene
construct in 0.65 ml of TBS with 0.7 mg of DEAE-dextran (Pharmacia,
Uppsala, Sweden) per ml for 30 min at 20°C. After a single wash in
TBS, the transfected cells were cultured in 5 ml of complete RPMI
medium in six-well plates for 48 h. Preparation of protein
extracts and luciferase assays were performed with a luciferase assay
kit (Promega) by using 20% of the protein extract.
Protein extracts and electrophoretic mobility shift assay
(EMSA).
Nuclear extracts were prepared as described by Schreiber
et al. (27). DNA probes were labeled with
[
-32P]ATP by incubation with T4 polynucleotide kinase
(Life Technologies), annealed, and purified on a 5% polyacrylamide
Tris-borate-EDTA (TBE) gel. The B29 probe used in Fig. 5 was
generated by PCR amplification of the B29 promoter cloned in
pGem 3Z (see below) by using the B29 EBF-3 antisense
oligonucleotide together with an SP6 primer (Promega). This
PCR product includes all three EBF binding sites (positions
106 to
152) but lacks OCT, Ets, and SP1 binding sites. The probe was
digested with HindIII and fill-in labeled with
[
-32P]dCTP by incubation with Klenow fragment. The
B29 wild-type promoter used as the probe in the experiment
shown in Fig. 6 was generated by PCR using an SP6 primer
(Promega) together with the B29 antisense primer and pGem
B29 as the template. The resulting full-length B29 promoter
was digested with HindIII and HaeIII and
fill-in labeled with [
-32P]dCTP by incubation with
Klenow fragment, which generates a truncated (
88 to
152) probe. The
mutated B29 promoters used in the experiment shown in Fig. 6
were also generated by PCR using RVprimer3 (Promega) together with the
B29 antisense primer and the respective B29 promoter mutants cloned in pGL3 basic (Promega) as templates (see below). The resulting full-length B29 promoter mutants were
digested with MluI and HaeIII and fill-in labeled
with [
-32P]dCTP by incubation with Klenow fragment,
which generates truncated (
88 to
152) probes. All PCR-generated
probes were purified on 5% polyacrylamide TBE gels. Nuclear extract or
in vitro-transcribed-translated protein was incubated with labeled
probe (20,000 cpm; 3 fmol) for 30 min at room temperature in binding
buffer (10 mM HEPES [pH 7.9], 70 mM KCl, 1 mM dithiothreitol, 1 mM
EDTA, 2.5 mM MgCl2, 0.05% Nonidet P-40) with 0.75 µg
poly(dI/dC) (Pharmacia). DNA competitors were added 10 min before the
addition of the DNA probe. The samples were separated on a 6%
polyacrylamide TBE gel, which was dried and subjected to
autoradiography. Competitors based on synthetic oligonucleotides were
added at the molar excesses indicated in the respective figures.
Full-length B29 promoters (+1 to
152) were generated by
PCR (see below) and were added at the molar excesses indicated in the
respective figures.
5 full-length promoter and actin
control competitors were also generated by PCR (for details, see
reference 29) and were added at the molar excesses indicated in the
respective figures
Oligonucleotides used for EMSAs were as follows:
mb-1 EBF
sense (5'-GAGAGAGACTCAAGGGAATTGTGG),
mb-1 EBF
antisense (5'-CCACAATTCCCTTGAGTCTCTCTC),
B29
EBF-1 sense (5'-TAGGAGCTCCCATAGGGTCCCTGTAGGGAT),
B29 EBF-1
antisense
(5'-ATCCCTACAGGGACCCTATGGGAGCTCCTA),
B29 EBF-2
sense
(5'-TAGGAGCTCCCATACGGTCCCTGGAGGGATGGT),
B29
EBF-2 antisense (5'-ACCATCCCTCCAGGGACCGTATGGGAGCTCCTA),
B29 EBF-3 sense
(5'-GAGGGATGGTGCCTCCCCTGGGTCTCAATT),
B29 EBF-3
antisense (5'-AATTGAGACCCAGGGGAGGCACCATCCCTC),
SP6
EBF sense
(5'-ATGGATTACTTTGCATAGATCCCTAGAGGCCAGCACAGCTGCT),
SP6
EBF antisense
(5'-AGCAGCTGTGCTGGCCTCTAGGGATCTATGCAAAGTAATCCAT), OCT
sense (5'-TTCATTGATTTGCATCGCATGAGACGCTAACATCGTACGTTC),
OCT
antisense (5'-GAACGTACGATGTTAGCGTCTCATGCGATGCAAATCAATGAA),
IKAROS consensus sense (5'-TAGAATTCTTGGGAATACCGATCTT),
and IKAROS
consensus antisense
(5'-AAGATCGGTATTCCCAAGAATTCTA).
Plasmids and constructs.
The EBF expression plasmid
(29) was based on the eukaryotic expression vector cDNA3
(Invitrogen BV, NV Leek, The Netherlands), which places the inserted
cDNA under the control of a cytomegalovirus promoter. The full-length
B29 promoter (+1 to
152) was PCR amplified by using
B29 sense and antisense primers with genomic mouse DNA as
the template. The resulting PCR product was cloned in pGem 3Z (Promega)
and verified by sequencing. Luciferase reporter constructs were based
on the pGL3 basic reporter vector (Promega). The wild-type B29 promoter was isolated as a
BglII-SacI fragment from pGem 3Z and subcloned in
the pGL3 basic reporter vector. B29 promoters with mutated
EBF sites (+1 to
152) were constructed by using PCR primer
B29M1, B29M2, B29M3, B29M,
or B29M1-3 (see Fig. 3A and 6A) together with the
B29 antisense primer. The B29-containing pGem 3Z
vector was used as the template. The resulting B29 promoter mutants were cloned blunt in pGL3 basic reporter vector. All constructs were verified by sequencing.
Oligonucleotides used for
B29 promoter constructs included
the following:
B29 sense
(5'-TAGGAGCTCCCATAGGGTCCCTGGAGGGAT),
B29 antisense (5'-CAGAGATCTGGTCACTGCTCTGTCTCTGAGCCC),
B29M
(5'-TAGGAGCTCCCATACGGTCCCTGTAGGGATGGTGCCTCCCCTATGT
CTCAATTTGC),
B29M1 (5'-TAGGAGCTCCCATACGGTCCCTGGAGGGATGGT),
B29M2 (5'-TAGGAGCTCCCATAGGGTCCTTGTAGGGATGGTGCCTCCCCTGGGTCTCAA),
B29M3 (5'-TAGGAGCTCCCATAGGGTCCCTGGAGGGATGGTGCCTCCTCTATGTCTCAA),
and
B29M1-3
(5'-TAGGAGCTCCCATACGGTCCTTGTAGGGATGGTGCCTCCTCTATGTCTCAA).
In vitro transcription and translation.
Recombinant proteins
were generated by coupled in vitro transcription-translation by using a
reticulocyte lysate kit (Promega). A total of 0.5 to 2 µl of a
25-µl reaction mix was used for EMSAs.
RT and PCRs.
RNA was prepared from cells by using RNAzol B
(Tel-Test Inc., Friendswood, Tex.). cDNA was generated by annealing 1 µg of total RNA and 0.5 µg of dT18 oligonucleotide in
10 µl of diethylpyrocarbonate-treated water. Reverse transcriptase
(RT) reactions were performed with 200 U of SuperScript RT (Life
Technologies) in the manufacturer's buffer supplemented with 0.5 mM
deoxynucleoside triphosphate, 10 mM dithiothreitol, and 20 U of RNase
inhibitor (Boehringer Mannheim, Bromma, Sweden), in a total volume of
20 µl at 37°C for 1 h. One-twentieth of the RT reaction mix
was used for the PCR assays.
PCRs were performed with 1 U of
Taq polymerase (Life
Technologies) in the manufacturer's buffer supplemented with 0.2 mM
deoxynucleoside
triphosphate, in a total volume of 25 µl. The
conditions of each
PCR cycle were 94°C for 30 s, 60°C for
30 s, and 72°C for 30 s.
Primers were added to a final
concentration of 1 mM. Twenty-five
cycles were used for all
sets.
PCR products were blotted onto Zeta-Probe GT nylon membranes (Bio-Rad
Laboratories AB, Sundbyberg, Sweden) by the vacuum transfer
method.
Membranes were prehybridized in 0.5 M NaHPO
4 (pH 7.5)-7%
sodium dodecyl sulfate (SDS) at 57°C for 10 min and hybridized
with

-
32P-labeled
B29 oligonucleotide for
12 h at 57°C in the same solution.
Membranes were washed at room
temperature three times in 40 mM
NaHPO
4 (pH 7.5)-1% SDS
for 15
min.
Oligonucleotides used for RT-PCR included the following:
B29
cDNA sense, exon 3 (5'-TCTGGCAGAGCCCACGTTTCATA);
B29 cDNA antisense,
exon 6 (5'-CTCATAGGTGGCTGTCTGGTCAAT);
B29 cDNA
hybridization,
exon 3 (5'-TGAAGCTGGAAAAGGGCCGCAT);
GADPH sense (5'-CCACCCATGGCAAATTCCATGGCA);
and
GADPH antisense
(5'-TCTAGACGGCAGGTCAGGTCCACC).
 |
RESULTS |
EBF interacts with three independent sites in the B29
promoter.
We initially examined the mouse B29 promoter
for potential EBF binding sites and observed three putative recognition
sequences in a region spanning from position
160 to the major
transcription initiation site. Figure 1
shows the sequence of the B29 promoter (25) with
the three potential EBF binding sites indicated. The potential EBF
binding sites were all located between bases
150 and
110 in a
region known to be important for promoter function (25).
These sites were also conserved between the mouse and the human
B29 promoter, even though there were single base
substitutions within the sites (1a, 31). To determine
whether these sites bound to EBF, we performed an EMSA using
double-stranded oligonucleotides, spanning these sites, as competitors
for binding of recombinant in vitro-translated EBF to the EBF
binding site from the mb-1 promoter. To compare the
binding efficiency of the B29 sites to that of other
characterized EBF sites, we also included the mb-1 and
the SP6
promoter EBF binding sites as competitors. An OCT binding site was used as a specificity control. The results
shown in Fig. 1 suggest that EBF indeed interacted with all
three B29 promoter sites, although sites 1 and 3 appeared to be of low affinity. Site 2 bound EBF with a similar
efficiency as the EBF binding site in the mb-1 promoter.
Thus, we conclude that the B29 promoter contains three EBF
binding sites.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
The B29 promoter contains three independent
EBF binding sites. (A) Schematic drawing of the B29 minimal
promoter as defined by Omori and Wall (25). The potential
EBF binding sites are underlined, and a consensus EBF binding site
(34) is shown. (B) EMSA in which the binding of in
vitro-translated recombinant EBF to the mb-1 promoter
binding sites was competed for by potential EBF binding sites from the
B29 promoter. (C) EMSA in which the binding of in
vitro-translated recombinant EBF to the mb-1 promoter
binding site was competed for by EBF binding sites from the
mb-1 and SP6 promoters and a control
octamer-containing oligonucleotide (OCT). F indicates the free probe.
|
|
EBF can activate the B29 promoter in an HeLa cell.
Knowing that EBF bound to the B29 promoter, we wanted to
determine whether EBF was able to directly activate transcription from
the B29 promoter in a non-B cell. To study this, we cloned the B29 promoter (+1 to
152) in front of a luciferase
reporter gene (pGL3) and transfected this construct together with an
expression plasmid for EBF into HeLa cells. Figure
2A shows a diagram of the resulting
luciferase activity from this experiment. The activity of the
B29 promoter was induced up to 13-fold upon cotransfection with increasing amounts of EBF expression plasmid. The
5
promoter, previously identified as an EBF target, was induced to a
similar level, while a fos promoter was unaffected by
the inclusion of an EBF expression vector. We next
investigated whether endogenous B29 expression was
also induced by ectopic expression of EBF. The results when cDNA from
HeLa cells transiently transfected either with empty or
EBF-encoding expression vector were analyzed for endogenous
B29 expression by RT-PCR analysis are shown in Fig. 2B.
Transcripts were detected in the EBF-transfected cells, but the RT-PCR
analysis suggests that the B29 levels were low (less then
1%) in comparison to the levels found in the Raji B-cell line. Longer
exposures of the filters revealed a low level of B29
transcripts also in HeLa cells transfected with the empty expression
plasmid. We conclude from this analysis that overexpression of EBF in a
non-B cell activates some transcription from the B29 promoter either in the form of a naked template or in the chromatin context of an endogenous gene.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
The B29 promoter is induced by EBF in HeLa
cells. (A) Luciferase activity assay results when a fos, a
5, or a B29 promoter (+1 to 152) construct
was transiently transfected into HeLa cells together with increasing
amounts of EBF expression plasmid. The DNA content in each transfection
was equalized by the addition of empty expression plasmid (cDNA3). The
data represent four transfections from two independent experiments. (B)
RT-PCR analysis of HeLa cells transiently transfected with EBF
expression plasmid. The upper panel shows an ethidium bromide-stained
agarose gel with the resulting amount of GADPH
(glyceraldehyde-3-phosphate dehydrogenase) PCR products obtained from
HeLa cells transfected with either an empty or an EBF-containing cDNA3
expression plasmid and from the human B-cell line Raji. The data show a
serial dilution using 1, 1/5, 1/25 dilutions of the template cDNA after
25 cycles of PCR. The lower panel shows an autoradiogram from RT-PCR
analysis indicating the amount of B29 transcripts in the
same cDNA preparations after 25 cycles of PCR. The PCR products were
blotted onto a nylon membrane and hybridized to an internal
B29 oligonucleotide. The filters with PCR product from
transfected HeLa cells were exposed for 24 h, while the
corresponding filters for Raji cells were exposed for 4 h.
|
|
EBF binding sites are important for full functional activity of the
B29 promoter in pre-B-cell lines.
Knowing that EBF has
the ability to functionally interact with the B29 promoter,
we wanted to investigate the impact of mutations in the EBF binding
sites on the function of the B29 promoter in B cells at
different differentiation stages. To this end, mutations were
introduced in the three EBF binding sites. The mutations were
introduced to avoid disruption of other overlapping binding sites such
as those for IKAROS or transcription factor E3 (Fig. 3A). To confirm that these mutations
resulted in a B29 promoter with impaired ability to interact
with EBF, we performed an EMSA analysis in which the PCR-amplified
full-length (+1 to
152) wild-type or EBF-mutated promoter fragment
was used to compete for binding of in vitro-translated EBF to the
mb-1 promoter EBF site. Figure 3B shows that the wild-type
B29 promoter competed at least as efficiently as the
5 promoter (+1 to
415) while the mutated promoter
competed with low efficiency. No competition was observed when an actin
PCR fragment was used as the control. The residual EBF binding capacity
of the mutated B29 promoter was probably due to the fact
that we introduced only subtle mutations to avoid disruption of other
overlapping binding sites. To examine whether the mutations affected
the binding of factors to the IKAROS consensus site in a pre-B cell, we
performed an EMSA using nuclear extract from cell line 230-238 and a
duplex consensus IKAROS binding site as the probe. This resulted in two
minor complexes and one major complex, but none of these were competed
for by either the wild-type or the mutated B29 promoter
fragment (Fig. 3C). Thus, we conclude that proteins in 230-238 cells
that bind to an IKAROS consensus binding site do not interact
efficiently with the B29 promoter and that this interaction
was not modified by the mutations introduced in the EBF sites while
binding of EBF was impaired.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Mutations in the three defined EBF binding sites impair
the ability of the B29 promoter to bind EBF. (A) Schematic
drawing indicating the mutations introduced into the B29
promoter by PCR using an oligonucleotide with inserted mutations.
Lowercase letters indicate the mutations. (B) EMSA in which the binding
of in vitro-translated recombinant EBF to the mb-1 promoter
EBF binding site was competed for by the PCR-amplified (+1 to 152)
wild-type B29 (B29), the mutated B29 (B29M), or
the 5 promoter. An actin PCR fragment served as a
negative control. (C) EMSA using nuclear extracts from 230-238 pre-B
cells and a consensus IKAROS binding site (3). The obtained
band shift was competed for by an IKAROS consensus binding site, by the
PCR-amplified wild-type (B29) or EBF mutant B29 (B29M)
promoter, and by an octamer-containing oligonucleotide (OCT) as
indicated. F indicates the free probe.
|
|
To investigate the functional role of the EBF binding sites in B cells,
luciferase reporter constructs under the control of
either the
wild-type or the EBF-mutated
B29 promoter (positions
+1 to

152) were transiently transfected into B-cell lines representing
different developmental stages. As shown in Fig.
4, transfection
of the wild-type
B29 promoter fragment into the pre-B-cell line
230-238 or
18.81 resulted in a 13-fold induction of luciferase
activity in
comparison to that resulting from transfection with
the basic reporter
vector (pGL3). When the EBF mutant
B29 promoter
was used,
the corresponding induction was 3.5-fold, a 4-fold reduction
in
functional activity. In contrast, when the same promoter constructs
were transfected into cells from the B-cell lymphoma A20 or the
plasmacytomas J558 and S194, the EBF mutations resulted in less
than a
twofold reduction in the
B29 promoter activity. This
suggests
that EBF is an important regulator of
B29
transcription in early
B-cell development while other factors control
the
B29 gene in
later stages of B-cell differentiation.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
The EBF binding sites are important for the function of
the B29 promoter in pre-B cells. The resulting activities of
wild-type (B29) and EBF-mutated (B29M) B29 promoter
constructs relative to that of a basic luciferase vector (pGL3) after
transient transfections into transformed mouse cells of the B-cell
lineage are shown. The data are collected from four transfections and
two independent experiments from the following cell lines: 230-238
pre-B cells, 18.81 pre-B cells, A20 mature B cells, S194 plasma cells,
and J558 plasma cells.
|
|
EBF interacts with B29 EBF sites 2 and 3 to form a
low-mobility complex.
To further examine the proteins interacting
with the region from
105 to
152 of the B29 promoter in
pre-B cells, we used this region as a probe in an EMSA with nuclear
extracts from the 230-238 pre-B-cell line. Two complexes were detected
(Fig. 5A), one major and one minor with
slower mobility. Both complexes were competed for by the B29
promoter fragment and the mb-1 EBF binding site, while
neither of the complexes was efficiently competed for by an EBF mutant
B29 promoter, an IKAROS consensus binding site, or an OCT
binding site. We interpret these data as suggesting that EBF is the
major factor interacting with this region of the B29
promoter in pre-B cells. The presence of two complexes that could be
competed for by the mb-1 EBF binding site indicated that the
high-mobility complex represented a B29 promoter occupied by
more than one EBF homodimer. To examine this more carefully, we used
the B29 promoter
105 to
152 fragment as a probe and used
increasing amounts of 230-238 cell nuclear extract or in vitro-translated EBF in an EMSA (Fig. 5B). This experiment suggested that with increasing amounts of recombinant protein, a second high-mobility complex, migrating with the same mobility as that of the
complex found in nuclear extracts, was formed. These data supported the
idea that multiple EBF homodimers bind simultaneously to the
B29 promoter but do not discriminate between double
occupancy due to interaction with two sites or due to formation of a
ternary complex on one site (7). To address this, we
introduced mutations in the individual EBF binding sites by
PCR and used the mutated promoters as binding sites in EMSAs with
increasing amounts of recombinant EBF. Figure
6A shows the promoter mutants used, with the introduced mutations indicated. It is important to note that these
promoter fragments span a larger part (
152 to
88) of the promoter than the probe used in Fig. 5A. When the wild-type promoter or
the promoter with a mutation introduced in site 1 was used as a probe,
formation of the low-mobility complex occurred (Fig. 6B). This complex
was competed for by the addition of an mb-1 promoter, while
the complex indicated by an asterisk in Fig. 6B was not (data not
shown). In contrast, the promoters carrying mutations in site 2 or 3 did not form any low-mobility EBF complex. The promoter carrying a
mutation in site 2 also appeared to interact with EBF with a reduced
affinity, suggesting that site 2 is the major EBF binding site in the
promoter. These experiments lead us to suggest that the low-mobility
complex consists of two EBF homodimers bound to sites 2 and 3.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
The B29 promoter interacts with EBF in
230-238 pre-B cells and has the ability to interact with multiple EBF
homodimers simultaneously. (A) EMSA using an end-labeled truncated
B29 promoter spanning nucleotides 105 to 152 and nuclear
extracts from 230-238 pre-B cells. The obtained band shifts were
competed for by the addition of the PCR-amplified full-length (+1 to
152) wild-type (B29) or EBF-mutated (B29M) B29 promoter;
the mb-1 EBF, IKAROS consensus, or OCT protein binding site;
and an actin PCR fragment as indicated. (B) EMSA using the
B29 105 to 152 probe and increasing amounts of either
230-238 pre-B-cell nuclear extracts or in vitro-translated recombinant
EBF (rEBF). F indicates the free probe.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 6.
EBF binding sites 2 and 3 are essential for the
formation of the low-mobility complex. (A) Schematic drawing of the
B29 promoter fragments that were used as binding sites for
EBF in the EMSA. Introduced mutations are indicated by lowercase
letters. (B) EMSA analysis with increasing amounts (0.5, 2, and 4 µl)
of recombinant EBF and 20,000 cpm of the indicated end-labeled
B29 promoter variants as binding sites. The band indicated
by an asterisk was not competed for by an mb-1 promoter EBF
binding site. F indicates free probe.
|
|
B29 EBF sites 2 and 3 are important for the full
function of the B29 promoter.
Having established that
EBF interacts with functionally important sites in the B29 promoter, we
wanted to examine the individual contributions of the sites to promoter
function. To this end, we introduced point mutations in site 1, 2, or 3 or in all three binding sites. The contribution of the individual sites
to the total EBF affinity of the promoter was examined in competition experiments using recombinant EBF bound to the mb-1 promoter
EBF binding site. This suggested that a B29 promoter with a
mutation in EBF site 1 still competed efficiently for binding (Fig.
7A). A mutation in site 2 resulted in a
decrease in EBF binding, while a mutation in site 3 reduced it but to a
lesser extent. This suggests that EBF site 2 is critical for the high
affinity of the B29 promoter for EBF. The point mutations
were more drastic than those used in our initial analysis (Fig. 3A),
and the EMSA experiment illustrated in Fig. 7A shows that the promoter
with all three mutations (B29M1-3) did not compete for the
binding of recombinant EBF to the mb-1 EBF binding site to
the same extent as the previously used promoter mutant
(B29M) did (Fig. 7A).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7.
EBF binding sites 2 and 3 are important for
high-affinity binding and full functional activity of the
B29 promoter. (A) Results of an EMSA in which the binding of
0.5 µl of recombinant in vitro-translated EBF to an excess of the
mb-1 promoter EBF binding site was competed for by
increasing amounts (50 and 100 times molar excess) of wild-type (B29)
or EBF-mutated full-length B29 promoters (B29M1, B29M2,
B29M3, M1-3, and B29M). The autoradiogram is cut to show only the
EBF-DNA complex and not the free probe present in all lanes. (B)
Luciferase activity resulting from DEAE-mediated transient transfection
of luciferase reporter constructs controlled by wild-type (B29) or EBF
site-mutated B29 promoters (M1, M2, M3, and M1-3) into
18-81 pre-B cells. Data represent the results of four experiments. (C)
Resulting induction of activity of 250 ng of B29
promoter-controlled luciferase reporter gene in the presence of 400 ng
of EBF expression plasmid after Lipofectin-mediated transient
transfections into HeLa cells. The DNA content in each transfection was
normalized with empty expression plasmid (cDNA3), and the data are
taken from three independent transfections. Induction was calculated
based on the activity of the different promoter constructs when
transfected together with 400 ng of empty expression plasmid.
|
|
To examine the functional relevance of the individual sites, we
transiently transfected reporter constructs under the control
of the
mutated promoters into 18-81 pre-B cells. A mutation in
site 1 did not
affect the function of the promoter, while a mutation
in site 2 resulted in a 50% decrease in promoter activity. A mutation
in site 3 resulted in a 75% reduction, while a mutation in all
the sites
resulted in an 80% reduction in promoter activity. The
same
observation was made in 230-238 pre-B cells (data not shown).
The
relatively low impact of the mutation on site 2 may be explained
by the
fact that this region has been suggested to interact with
a repressor
in B cells. The loss of affinity for the repressor
may then compensate
for loss of function of the EBF site. To examine
this more carefully,
we used the same reporter constructs in transient
transfections in HeLa
cells and assayed the induction of promoter
activity in the presence of
either 400 ng of empty or EBF-encoding
expression plasmid. A mutation
in site 1 did not impair induction,
while a mutation in either site 2 or 3 resulted in a 50% reduction
in reporter gene activation.
Mutations in all three sites resulted
in an 85% reduction of induced
activity. Thus, we conclude that
sites 2 and 3 are the binding sites of
greatest importance for
B29 promoter
function.
 |
DISCUSSION |
The finding that pro-B cells from mice carrying a mutation in the
gene encoding EBF did not express the B29 gene suggested to
us that B29 may be a genetic target for EBF. Examination of the promoter sequence revealed three potential EBF binding sites within
160 bp upstream of the main transcription initiation site. All three
sites were shown to interact with EBF, although affinities varied from
high to low among the sites. Furthermore, we showed that EBF can
interact functionally with the B29 promoter since ectopic
expression of EBF in HeLa cells resulted in induction of promoter
activity. EMSAs showed that EBF bound to the B29 promoter in
pre-B-cell extracts and transient transfections showed that the binding
sites were important for promoter activity in these cells. Thus, we
suggest that EBF plays a critical role in the transcriptional control
of the B29 gene in pre-B cells.
EBF is not a unique activator of B29 transcription, since it
has been shown that B29 can be expressed in cell lines where EBF is not detected. Thus, B29 transcripts have been
detected in both the bone marrow-derived cell line Ba/F3 that lacks EBF (29) and in plasma cell lines that should be devoid of EBF
(11). This probably reflects the fact that other DNA binding
factors like OCT and Ets family proteins can interact with, and
activate, the promoter (25, 31). This resembles the
situation found in the mb-1 promoter, where EBF has been
shown to be one of several transcription factors with functional
importance (4, 9, 33). The mutation of the EBF binding sites
also resulted in a slight reduction of promoter activity in plasma
cells, suggesting that the EBF binding sites overlap with another
factor present in these cells. One such candidate would be the factor
defined as BF/FA (18, 30), which has been shown to be
involved in octamer-dependent activation of the SP6
promoter. Even though B29 can be expressed in the absence of
EBF, the role of EBF in the activation of B29 may still be
pivotal in normal early B-cell development since EBF-deficient mice
lack B29 transcripts in the pro-B-cell compartment
(19).
The presence of multiple EBF binding sites within the promoter and the
fact that several of these sites can be occupied simultaneously even
with a large excess of binding sites indicate that EBF may bind
cooperatively to sites 2 and 3 in the B29 promoter. This is,
however, weakly supported by the functional analysis of the individual
sites since only the mutation in site 3 resulted in a significant
reduction of promoter activity in pre-B cells. The explanation for this
may come from experiments by Omori and Wall (25) that
suggested the presence of a repressor activity overlapping with site 2. A mutation in EBF site 2 would then result in the neutralization of
both EBF and repressor activities, to result in only a modest loss of
function. Functional cooperation also could not be supported by
induction experiments with HeLa cells, where a mutation in either site
2 or 3 resulted in only a modest reduction of activity. This could
depend on the fact that the EBF levels in these experiments were high,
which may compensate for the loss of affinity due to loss of one of the
binding sites. The contribution to the function of the independent
sites and the ability of EBF to bind cooperatively to target genes are
therefore still unclear. However, the large number of EBF target genes
carrying multiple EBF binding sites in their promoters suggests that
cooperative binding and activation may be a common theme in promoter
activation by EBF.
The B29 gene is the fourth important target gene defined for
EBF in pre-B cells. It has previously been shown that EBF is an
activator of mb-1 (7, 9), as well as of the
5 and VpreB genes (29). This would
suggest that EBF is a pleiotropic activator of early B-cell-specific
genes, similar to the role of MyoD in myocyte development (for reviews,
see references 36 and 37). In
contrast to MyoD, however, there are no data supporting the possibility
that EBF would be a master regulator of B-cell development, able to
initiate the full developmental program. On the contrary, it appears as
if B-cell fate determination is initiated at a stage before EBF
expression since EBF
/
mice still develop
fraction A pro-B cells. Furthermore, ectopic expression of EBF in the
immature hematopoietic cell line Ba/F3 resulted only in activation of
certain pre-B-cell-specific genes (29), which would suggest
that EBF controls only a subset of genes important for B-cell
differentiation. Neither does EBF, in contrast to MyoD, appear to
regulate its own transcription (30a). A positive
autoregulation may be an important feature for a fate-determining
factor to maintain its own activity and drive differentiation
processes. An alternative possibility would be that EBF acts together
with another transcription factor to initiate the full differentiation
program. Such a synergy has been shown in adipogenesis where PPAR
2
and C/EBP
cooperate to drive a fibroblast into an adipocyte
(32) and in myogenesis where coexpression of myeloid HLH
proteins with MEF2 induces myogenesis (23). One such
cooperation partner for EBF is the E2A-encoded HLH
transcription factor E47 (for reviews, see references
15 and 24). Mice deficient in a
functional E2A gene display a B-cell differentiation block
with similarities to that observed in EBF-deficient mice (1b, 19,
38). Furthermore, EBF and E47 have been shown to act in synergy
to stimulate transcription of the B-cell-specific genes
5
and VpreB (29) but, again, they only induced
expression of some early B-cell markers in stably transfected Ba/F3
cells. The apparent lack of a master gene activity for B-cell
development may reflect an inherent difference in the nature of the
developmental process from a fibroblast to a myocyte, as compared to
the more complex B-lymphoid differentiation process.
Even though both
5 and B29 have been shown to
be essential for early B-cell development (6, 16), their
absence cannot explain the early B-cell differentiation block in
EBF-deficient mice. This makes further identification of genetic
targets for EBF an important issue in the effort to understand the
earliest stages of B-cell development.
 |
ACKNOWLEDGMENTS |
We thank R. Grosschedl for the kind gift of the EBF expression plasmid.
This work was funded by the Swedish Medical Research Council, American
Cancer Society, The Swedish Cancer Society, and The Crafoord,
Österlunds, and Kocks Foundations.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Immunology
Group, CMB, Lund University, Sölvegatan 21, S-223 62 Lund,
Sweden. Phone: 46 462224160. Fax: 46 462224218. E-mail:
mikael.sigvardsson{at}immuno.lu.se.
 |
REFERENCES |
| 1.
|
Åkerblad, P.,
M. Sigvardsson, and T. Leanderson.
1996.
Early B cell factor (EBF) down regulates immunoglobulin heavy chain intron enhancer function in a plasmacytoma cell line.
Scand. J. Immunol.
44:145-149.
|
| 1a.
| Åkerblad, P. Unpublished data.
|
| 1b.
|
Bain, G.,
E. Robanus Maandag,
D. Izon,
D. Amsen,
A. Kruisbeek,
B. Weintraub,
I. Krop,
M. Schlissel,
A. Feeney,
M. van Roon,
M. van der Valk,
H. te Riele,
A. Berns, and C. Murre.
1994.
E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements.
Cell
79:885-892[Medline].
|
| 2.
|
Borst, J.,
H. Jacobs, and G. Brouns.
1996.
Composition and function of T cell receptor and B cell receptor complexes on precursor lymphocytes.
Curr. Opin. Immunol.
8:181-190[Medline].
|
| 3.
|
Clevers, H., and R. Grosschedl.
1996.
Transcriptional control of lymphoid development: lessons from gene targeting.
Immunol. Today
17:336-343[Medline].
|
| 4.
|
Fitzsimmons, D.,
W. Hodsdon,
W. Wheat,
S.-M. Maira,
B. Wasylyk, and J. Hagman.
1996.
Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter.
Genes Dev.
10:2198-2211[Abstract/Free Full Text].
|
| 5.
|
Georgopoulos, K.
1997.
Transcription factors required for lymphoid lineage commitment.
Curr. Opin. Immunol.
9:222-227[Medline].
|
| 6.
|
Gong, S., and M. Nussenzweig.
1996.
Regulation of an early developmental checkpoint in the B cell pathway by Ig .
Science
272:411-414[Abstract].
|
| 7.
|
Hagman, J.,
C. Belanger,
A. Travis,
C. Turck, and R. Grosschedl.
1993.
Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression.
Genes Dev.
7:760-773[Abstract/Free Full Text].
|
| 8.
|
Hagman, J.,
M. Gutch,
H. Lin, and R. Grosschedl.
1995.
EBF contains a novel zinc coordination motif and multiple dimerization and transcriptional activation domains.
EMBO J.
14:2907-2916[Medline].
|
| 9.
|
Hagman, J.,
A. Travis, and R. Grosschedl.
1991.
A novel lineage-specific nuclear factor regulates mb-1 gene transcription at the early stages of B cell differentiation.
EMBO J.
10:3409-3417[Medline].
|
| 10.
|
Hardy, R.,
C. Carmack,
S. Shinton,
J. Kemp, and K. Hayakawa.
1991.
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J. Exp. Med.
173:1213-1225[Abstract/Free Full Text].
|
| 11.
|
Hermanson, G.,
D. Eisenberg,
P. Kincade, and R. Wall.
1988.
B29 a member of the immunoglobulin gene superfamily exclusively expressed on beta lineage cells.
Proc. Natl. Acad. Sci. USA
85:6890-6894[Abstract/Free Full Text].
|
| 12.
|
Hermanson, G.,
M. Briskin,
D. Sigman, and R. Wall.
1989.
Immunoglobulin enhancer and promoter motifs 5' of the B29 B-cell specific gene.
Proc. Natl. Acad. Sci. USA
86:7341-7345[Abstract/Free Full Text].
|
| 13.
|
Hombach, J.,
F. Lottspeich, and M. Reth.
1990.
Identification of the genes encoding the Ig- and Ig- components of the IgM antigen receptor complex by aminoterminal sequencing.
Eur. J. Immunol.
20:2795-2799[Medline].
|
| 14.
|
Hombach, J.,
T. Tsubata,
L. Leclercq,
H. Stappert, and M. Reth.
1990.
Molecular components of the B-cell antigen receptor complex of the IgM class.
Nature
343:760-762[Medline].
|
| 15.
|
Kadesch, T.
1992.
Helix-loop-helix proteins in the regulation of immunoglobulin gene transcription.
Immunol. Today
13:31-36[Medline].
|
| 16.
|
Kitamura, D.,
A. Kudo,
S. Schaal,
W. Muller,
F. Melchers, and K. Rajewsky.
1992.
A critical role of 5 protein in B cell development.
Cell
69:823-831[Medline].
|
| 17.
|
Li, Y.-S.,
R. Wasserman,
K. Hayakawa, and R. Hardy.
1996.
Identification of the earliest B lineage stage in mouse bone marrow.
Immunity
5:527-535[Medline].
|
| 18.
|
Liberg, D.,
M. Sigvardsson,
M. Bemark, and T. Leanderson.
1998.
Differentiation specific, octamer dependent costimulation of transcription.
J. Immunol.
160:3899-3907[Abstract/Free Full Text].
|
| 19.
|
Lin, H., and R. Grosschedl.
1995.
Failure of B-cell differentiation in mice lacking the transcription factor EBF.
Nature
376:263-267[Medline].
|
| 20.
|
Malone, C.,
S. Omori, and R. Wall.
1997.
Silencer elements controlling the B29 (Ig ) promoter are neither promoter nor cell-type-specific.
Proc. Natl. Acad. Sci. USA
94:12314-12319[Abstract/Free Full Text].
|
| 21.
|
Mårtensson, A., and I.-L. Mårtensson.
1997.
Early B cell factor binds to a site critical for lambda5 core enhancer activity.
Eur. J. Immunol.
27:315-320[Medline].
|
| 22.
|
Melchers, F.,
H. Karasuyama,
D. Haasner,
S. Bauer,
A. Kudo,
N. Sakaguchi,
B. Jameson, and A. Rolink.
1993.
The surrogate light chain in B-cell development.
Immunol. Today
14:60-68[Medline].
|
| 23.
|
Molkentin, J.,
B. Black,
J. Martin, and E. Olson.
1995.
Cooperative activation of muscle gene expression by MEF and myogenic bHLH proteins.
Cell
83:1125-1136[Medline].
|
| 24.
|
Murre, C.,
G. Bain,
M. van Dijk,
I. Engel,
B. Furnari,
M. Massari,
J. Matthews,
M. Quong,
R. Rivera, and M. Stuiver.
1994.
Structure and function of helix-loop-helix proteins.
Biochim. Biophys. Acta
1218:129-135[Medline].
|
| 25.
|
Omori, S., and R. Wall.
1993.
Multiple motifs regulate the B cell specific promoter of the B29 gene.
Proc. Natl. Acad. Sci. USA
90:11732-11727.
|
| 26.
|
Persson, C.,
A. Måartensson, and I.-L. Måartensson.
1998.
Identification of a tissue and differentiation stage specific enhancer of the VpreB1 gene.
Eur. J. Immunol.
28:787-798[Medline].
|
| 27.
|
Schreiber, E.,
P. Matthias,
M. Muller, and W. Schaffner.
1989.
Rapid detection of octamer binding proteins with "mini-extracts" prepared from a small number of cells.
Nucleic Acids Res.
17:6419[Free Full Text].
|
| 28.
|
Sigvardsson, M., and R. Grosschedl.
1998.
Transcriptional control of B cell differentiation by EBF and E47.
In
J. G. Monroe, and E. V. Rothenberg (ed.), Molecular biology of B and T cell development. Humana Press Inc., Totowa, N.J.
|
| 29.
|
Sigvardsson, M.,
M. Oriordan, and R. Grosschedl.
1997.
EBF and E47 collaborate to induce expression of the endogenous immunoglobulin surrogate light chain genes.
Immunity
7:25-36[Medline].
|
| 30.
|
Sigvardsson, M.,
P. Åkerblad, and T. Leanderson.
1996.
Early B cell factor interacts with a subset of promoters.
J. Immunol.
156:3788-3796[Abstract].
|
| 30a.
| Sigvardsson, M. Unpublished observation.
|
| 31.
|
Thompson, A.,
W. Wood,
M. Gilly,
M. Damore,
S. Omori, and R. Wall.
1996.
The promoter and 5' flanking sequences controlling human B29 gene expression.
Blood
87:666-673[Abstract/Free Full Text].
|
| 32.
|
Tontonoz, P.,
E. Hu, and M. Spiegelman.
1994.
Stimulation of adipogenesis in fibroblasts by PPARg2, a lipid-activated transcription factor.
Cell
79:1147-1156[Medline].
|
| 33.
|
Travis, A.,
J. Hagman, and R. Grosschedl.
1991.
Heterogeneously initiated transcription from the pre-B- and B-cell-specific mb-1 promoter: analysis of the requirement for upstream factor-binding sites and initiation site sequences.
Mol. Cell. Biol.
11:5756-5766[Abstract/Free Full Text].
|
| 34.
|
Travis, A.,
J. Hagman,
L. Hwang, and R. Grosschedl.
1993.
Purification of early-B-cell factor and characterization of its DNA-binding specificity.
Mol. Cell. Biol.
13:3392-3400[Abstract/Free Full Text].
|
| 35.
|
Wang, M., and R. Reed.
1993.
Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast.
Nature
364:121-126[Medline].
|
| 36.
| Weintraub, H., R. Davis, S. Tapscott, M. Thayer, M. Krause, R. Benezra, T. Blackwell, D. Turner, R. Rupp, S. Hollenberg, Y. Zhuang, and A. Lassar. 1991. The myoD gene family:
nodal point during specification of the muscle cell lineage.
251:761-766.
|
| 37.
|
Wright, W.
1992.
Muscle basic helix-loop-helix proteins and the regulation of myogenesis.
Curr. Opin. Genet. Dev.
2:243-248[Medline].
|
| 38.
|
Zhuang, Y.,
P. Soriano, and H. Weintraub.
1994.
The helix-loop-helix gene E2A is required for B cell formation.
Cell
79:875-884[Medline].
|
Molecular and Cellular Biology, January 1999, p. 392-401, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zandi, S., Mansson, R., Tsapogas, P., Zetterblad, J., Bryder, D., Sigvardsson, M.
(2008). EBF1 Is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors. J. Immunol.
181: 3364-3372
[Abstract]
[Full Text]
-
Kuo, Y.-H., Gerstein, R. M., Castilla, L. H.
(2008). Cbf{beta}-SMMHC impairs differentiation of common lymphoid progenitors and reveals an essential role for RUNX in early B-cell development. Blood
111: 1543-1551
[Abstract]
[Full Text]
-
Lagergren, A., Mansson, R., Zetterblad, J., Smith, E., Basta, B., Bryder, D., Akerblad, P., Sigvardsson, M.
(2007). The Cxcl12, Periostin, and Ccl9 Genes Are Direct Targets for Early B-cell Factor in OP-9 Stroma Cells. J. Biol. Chem.
282: 14454-14462
[Abstract]
[Full Text]
-
van Zelm, M. C., van der Burg, M., de Ridder, D., Barendregt, B. H., de Haas, E. F. E., Reinders, M. J. T., Lankester, A. C., Revesz, T., Staal, F. J. T., van Dongen, J. J. M.
(2005). Ig Gene Rearrangement Steps Are Initiated in Early Human Precursor B Cell Subsets and Correlate with Specific Transcription Factor Expression. J. Immunol.
175: 5912-5922
[Abstract]
[Full Text]
-
Smith, E. M. K., Akerblad, P., Kadesch, T., Axelson, H., Sigvardsson, M.
(2005). Inhibition of EBF function by active Notch signaling reveals a novel regulatory pathway in early B-cell development. Blood
106: 1995-2001
[Abstract]
[Full Text]
-
Smith, E., Sigvardsson, M.
(2004). The roles of transcription factors in B lymphocyte commitment, development, and transformation. J. Leukoc. Biol.
75: 973-981
[Abstract]
[Full Text]
-
Mansson, R., Tsapogas, P., Akerlund, M., Lagergren, A., Gisler, R., Sigvardsson, M.
(2004). Pearson Correlation Analysis of Microarray Data Allows for the Identification of Genetic Targets for Early B-cell Factor. J. Biol. Chem.
279: 17905-17913
[Abstract]
[Full Text]
-
Merluzzi, S., Moretti, M., Altamura, S., Zwollo, P., Sigvardsson, M., Vitale, G., Pucillo, C.
(2004). CD40 Stimulation Induces Pax5/BSAP and EBF Activation through a APE/Ref-1-dependent Redox Mechanism. J. Biol. Chem.
279: 1777-1786
[Abstract]
[Full Text]
-
Zhao, F., McCarrick-Walmsley, R., Akerblad, P., Sigvardsson, M., Kadesch, T.
(2003). Inhibition of p300/CBP by Early B-Cell Factor. Mol. Cell. Biol.
23: 3837-3846
[Abstract]
[Full Text]
-
Liberg, D., Sigvardsson, M., Akerblad, P.
(2002). The EBF/Olf/Collier Family of Transcription Factors: Regulators of Differentiation in Cells Originating from All Three Embryonal Germ Layers. Mol. Cell. Biol.
22: 8389-8397
[Full Text]
-
Akerblad, P., Lind, U., Liberg, D., Bamberg, K., Sigvardsson, M.
(2002). Early B-Cell Factor (O/E-1) Is a Promoter of Adipogenesis and Involved in Control of Genes Important for Terminal Adipocyte Differentiation. Mol. Cell. Biol.
22: 8015-8025
[Abstract]
[Full Text]
-
Smith, E. M. K., Gisler, R., Sigvardsson, M.
(2002). Cloning and Characterization of a Promoter Flanking the Early B Cell Factor (EBF) Gene Indicates Roles for E-Proteins and Autoregulation in the Control of EBF Expression. J. Immunol.
169: 261-270
[Abstract]
[Full Text]
-
Gisler, R., Sigvardsson, M.
(2002). The Human V-PreB Promoter Is a Target for Coordinated Activation by Early B Cell Factor and E47. J. Immunol.
168: 5130-5138
[Abstract]
[Full Text]
-
Malone, C. S., Wall, R.
(2002). Bob1 (OCA-B/OBF-1) Differential Transactivation of the B Cell-Specific B29 (Ig{beta}) and mb-1 (Ig{alpha}) Promoters. J. Immunol.
168: 3369-3375
[Abstract]
[Full Text]
-
Malone, C. S., Miner, M. D., Doerr, J. R., Jackson, J. P., Jacobsen, S. E., Wall, R., Teitell, M.
(2001). CmC(A/T)GG DNA methylation in mature B cell lymphoma gene silencing. Proc. Natl. Acad. Sci. USA
10.1073/pnas.181206898v1
[Abstract]
[Full Text]
-
Gisler, R., Jacobsen, S. E. W., Sigvardsson, M.
(2000). Cloning of human early B-cell factor and identification of target genes suggest a conserved role in B-cell development in man and mouse. Blood
96: 1457-1464
[Abstract]
[Full Text]
-
Malone, C. S., Patrone, L., Buchanan, K. L., Webb, C. F., Wall, R.
(2000). An Upstream Oct-1- and Oct-2-Binding Silencer Governs B29 (Ig{beta}) Gene Expression. J. Immunol.
164: 2550-2556
[Abstract]
[Full Text]
-
Akerblad, P., Sigvardsson, M.
(1999). Early B Cell Factor Is an Activator of the B Lymphoid Kinase Promoter in Early B Cell Development. J. Immunol.
163: 5453-5461
[Abstract]
[Full Text]
-
NUTT, S.L., ROLINK, A.G., BUSSLINGER, M.
(1999). The Molecular Basis of B-cell Lineage Commitment. Cold Spring Harb Symp Quant Biol
64: 51-60
[Abstract]
-
Malone, C. S., Miner, M. D., Doerr, J. R., Jackson, J. P., Jacobsen, S. E., Wall, R., Teitell, M.
(2001). CmC(A/T)GG DNA methylation in mature B cell lymphoma gene silencing. Proc. Natl. Acad. Sci. USA
98: 10404-10409
[Abstract]
[Full Text]