INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

The fruiting body maturation of filamentous ascomycetes is an attractive model system to study multicellular development in eukaryotes. It involves the formation of the outer structures of the fruiting body but also development of mature ascospores within the fruiting body itself (for reviews, see references 31 and 47). Ascus development starts with the formation of female gametangia called ascogonia. The ascogenous cells are enveloped by sterile hyphae to form fruiting body precursors. Subsequent tissue differentiation gives rise to an outer pigmented peridial tissue, and following caryogamy, inner ascus initials embedded in sterile paraphyses are formed. Mature fruiting bodies from most ascomycetes harbor 200 to 400 asci, which after meiosis and postmeiotic divisions contain eight ascospores each. In many cases, ascospores are discharged through an apical pore (ostiole) at the neck of the fruiting body. Thus, fruiting body development requires the differentiation of the mycelia into several specialized tissues, and regulation of these morphological and physiological changes will require a number of different genes. However, so far only a limited set of data about the genetic control of fruiting body development is available.

Recently the mating type genes of several species have been characterized at the molecular level (for a review, see reference 7). They regulate different stages of sexual development and encode putative transcription factors that control the expression of developmental genes. Besides these, other genes involved in morphogenesis have been cloned, most of them from the closely related pyrenomycetous fungi Neurospora crassa and Podospora anserina. For example, the asd-1 gene from N. crassa encodes a putative rhamnogalacturonase which is essential for ascospore wall formation (32). Another example concerns the P. anserina car1 gene, which encodes a peroxisomal membrane protein that is essential for peroxisomal assembly (3). car1 mutants show an impaired caryogamy leading to a sterile phenotype. From these data the link between intact peroxisomes and fruiting body maturation becomes evident.

It has been demonstrated for a number of ascomycetes that several genes control not only sexual development but also asexual sporulation and vegetative growth. In N. crassa, macroconidia can serve as asexual spores or as male gametes. Among other factors, their formation is dependent on the nutritional state of the fungus and is controlled by a glucose transporter protein, the product of the rco-3 gene (26). In P. anserina, development of female gametangia and senescence are affected by the grisea gene (35). A failure in the expression of grisea leads to a prolonged life span and to defects in gametangium formation. Similarly, genes such as het-c in P. anserina and the mating type gene mt A-1 in N. crassa are responsible for both vegetative incompatibility and sexual reproduction (53, 54).

To isolate additional developmental genes from filamentous ascomycetes, we have used UV mutagenesis to generate Sordaria macrospora mutants with defects in fruiting body formation. This homothallic pyrenomycetous fungus is closely related to P. anserina and N. crassa, but in contrast to these heterothallic species, single strains of S. macrospora produce fruiting bodies (perithecia) without the presence of a mating partner. S. macrospora has already served as a model organism for the investigation of meiotic pairing and recombination (69), and several mutants with defects in perithecium development have long been reported (15). The development of molecular tools makes S. macrospora a suitable organism for studying fruiting body maturation. Transformation to hygromycin B resistance is feasible (67), and an indexed cosmid library, allowing gene isolation, has been established (42). S. macrospora mating type genes are among the genes which have already been cloned and characterized, providing some insight into fruiting body development of homothallic ascomycetes (43).

In this paper we report on the molecular investigation of the S. macrospora sterile mutant per5. We succeeded in restoring fertility by genomic complementation by using an indexed S. macrospora cosmid library. The complementing factor was found to be ATP citrate lyase (ACL), and to our knowledge, this is the first molecular analysis of a fungal ACL gene. ACL gene expression in S. macrospora is developmentally regulated, and we discuss the correlation between ACL expression and fruiting body development.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Strains and growth conditions. S. macrospora S 1957 and 3346 from our laboratory collection have a wild-type phenotype. The mutant per5 (strain S 10938) was isolated from wild-type strain 3346 after UV mutagenesis (27a). Strains were propagated on BMM fructification medium (14), and spore germination was achieved on BMM with 0.5% sodium acetate. For transformation and DNA isolation, S. macrospora was cultivated in CM medium [1% glucose, 0.2% tryptone, 0.2% yeast extract, 0.15% KH₂PO₄, 0.05% KCl, 0.05% MgSO₄, 0.37% NH₄Cl, and 10 mg each of ZnSO₄, Fe(II)Cl₂, and MnCl₂ per liter].

Transformation of S. macrospora. Formation of protoplasts was done by previously described procedures (42) with the following modifications. Inoculated Fernbach flasks were incubated for 2 days at 27°C. Protoplasts were kept in protoplast buffer (13 mM Na₂HPO₄, 45 mM KH₂PO₄, 600 mM KCl, pH 6.0) throughout the whole procedure. Transformation of S. macrospora was performed as described by Walz and Kück (67) with the following modifications. Four hours after transformation, plates were overlaid with hygromycin B-top agar to a final concentration of 110 U of hygromycin B/ml. Transformants appeared within 2 to 3 days after transformation. In order to transfer the transformants to fructification medium, plates were covered with filter paper and incubated for 12 h. The filter papers were then transferred to BMM plates with hygromycin B (110 U/ml) and incubated for another 12 h. Transformants were transferred from the hygromycin plates to BMM plates without hygromycin B by repeating the filter paper inoculation.

Preparation of RNA and genomic DNA and hybridization analysis. Preparation of DNA was done as described by Pöggeler et al. (42). Total RNA was isolated from S. macrospora, using the method of Hoge et al. (19). Southern and Northern blotting were performed as described by Sambrook et al. (51). DNA gels were soaked in 0.1 M HCl prior to denaturation.

Construction of plasmids. Cloning of S. macrospora DNA fragments, using vectors pBluescriptII/KS(+) (Stratagene), pANsCos1 (34), and pBCHygro (59), was done by standard techniques (51). Cosmids and plasmids used in this investigation are listed in Table 1. Construction of plasmid p85.1 was carried out as follows. A fragment of 422 nucleotides (nt) was amplified from wild-type DNA by PCR with oligonucleotide 1037 (5' TTCGACAAGGGCCTAAGCC 3') and the mutated oligonucleotide 1038 (5' TTCATCCCAAGGATGACGG 3') as primers. The fragment was cloned into plasmid p59.3 which had previously been digested with EcoRV and HindIII and was subsequently treated with Klenow polymerase to fill in the HindIII overlap. The correct orientation and sequence of the cloned fragment were checked by sequence analysis. Plasmid p94.1 was constructed by first hybridizing oligonucleotides 1049 (5' ATACCCCTACGACGTCCCCGATTACGCCTTGCA 3') and 1050 (5' AGGCGTAATCGGGGACGTCGTAGGGGTATTGCA 3'), which encode the hemagglutinin (HA) epitope (58), and this double-stranded molecule was then ligated into the PstI site of the acl1 open reading frame (ORF) found in plasmid p58.1 (Table 1). The resulting plasmid was digested with ApaI, and the 3.5-kb DNA fragment containing the complete acl1 ORF was cloned into the vector pBCHygro. The construction of a cosmid library was described previously (42).

DNA sequencing and sequence comparison. The dideoxynucleotide chain termination procedure (52) was carried out with the T7 polymerase sequencing kit (Pharmacia, Freiburg, Germany). Sequencing products were separated by electrophoresis on 4% polyacrylamide gels as described by Lang and Burger (25). Wild-type cDNA and parts of the per5 mutant acl1 allele were sequenced by MWG-Biotech Customer Service (Ebersberg, Germany). Comparisons of nucleotide and amino acid sequences were performed with FASTA (36) and with programs from the HUSAR/Genius server, Heidelberg, Germany.

Preparation of crude extracts from S. macrospora. Fernbach flasks containing 150 ml of BMM medium were inoculated with five or six 0.5-cm³ agar plugs taken from an S. macrospora BMM plate culture and incubated for 1 to 6 days at 27°C. The mycelium was filtered, washed with distilled water, and homogenized with 1 to 2 ml of extraction buffer (0.02 M Tris-HCl, 20% [wt/vol] glycerol, 2 mM MgCl₂, 1 mM EDTA, 5 mM -mercaptoethanol, and 1 mM dithiothreitol [pH 8.0 for the glucose-6-phosphate dehydrogenase test and pH 8.4 for the ACL test]). After centrifugation (15,000 × g, 10 min, 4°C) the protein content of the supernatant was determined as described by Bradford (5).

Enzyme activities. (i) Malate dehydrogenase-coupled ACL test. The ACL (EC 4.1.3.8) activity was measured as described by Srere (62) with the following modifications. Four hundred microliters of 0.5 M Tris-HCl (pH 8.4), 100 µl of 2 mM acetyl coenzyme A (acetyl-CoA), 20 µl of 10 mM NADH, 50 µl of 0.2 M MgCl₂, 0.7 µl of -mercaptoethanol, 100 µl of 0.2 M sodium citrate, 10 µl of 1 M NaN₃, 1 U of malate dehydrogenase (Boehringer, Mannheim, Germany), and S. macrospora crude extract containing 0.2 mg of protein were mixed in a reaction tube. Distilled water was added to a volume of 900 µl. The decrease of absorption at 340 nm was measured at 25°C for 5 min at 30-s intervals. The reaction was started by the addition of 100 µl of 0.2 M ATP, and measurements were taken for another 5 min at 30-s intervals. The net decrease of absorption was calculated from the difference between the values obtained before and after the addition of ATP. The average NADH oxidation before the addition of ATP was about 1 to 2 nmol per min per mg of protein. For each crude extract, at least three independent measurements were carried out. The average of the absorption decrease is directly proportional to the ACL activity.

(ii) CAT-coupled ACL test. The chloramphenicol acetyltransferase (CAT)-coupled ACL test was done as described by Pentyala and Benjamin (37) with the following modifications. A 255-µl volume of reaction buffer (59 mM Tris-HCl [pH 8.4], 12 mM dithiothreitol, 24 mM MgCl₂, 0.39 mM CoA, 3.5 mM sodium citrate, 21 µM [1,5-¹⁴C]citric acid [0.6 µCi per assay], 0.24 mM NADH, 1.4 U of malate dehydrogenase per ml, 70 U of CAT per ml, 1.4 mM chloramphenicol) was mixed with 15 µl of crude protein extract (2 µg/µl). The reaction was started by the addition of 30 µl of 25 mM ATP or of 30 µl of distilled water in control samples. Incubation was done for 5 min at 25°C, and then the reaction was stopped by heating to 65°C for 3 min. Twenty microliters of 0.1 M Tris-HCl (pH 8.7) and 900 µl of ice-cold ethyl acetate were added and mixed. After centrifugation (3 min, 12,000 × g), the upper phase (ethyl acetate) was removed and the lower phase again was extracted with 900 µl of ethyl acetate. The resulting upper phase was combined with the upper phase from the first extraction step, added to 10 ml of scintillation fluid (LSC Cocktail Hydroluma; Baker), and assayed for radioactivity. For each crude extract, at least three independent measurements were carried out. ACL activity was calculated from the differences between values obtained with and without addition of ATP. The average value without addition of ATP was 0.1 nmol per min per mg of protein.

(iii) Glucose-6-phosphate dehydrogenase test. The glucose-6-phosphate dehydrogenase test was done as described by Scott (55) and Shepherd (57) with the following modifications. An 840-µl volume of reaction buffer (0.1 M Tris-HCl, 10 mM MgCl₂, pH 8.0), 50 µl of 50 mM NADP, and 50 µl of 50 mM glucose-6-phosphate were added to a reaction tube. The reaction was started by the addition of S. macrospora crude extract containing 0.2 mg of protein. The increase of absorption at 340 nm was measured at 25°C for 5 min at 30-s intervals. For each crude extract, at least three independent measurements were done. The initial slopes of absorption increase are a measurement of the glucose-6-phosphate dehydrogenase activity.

SDS-PAGE and Western blot analysis. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli (24). The immunological detection of the recombinant ACL1 polypeptide was done with a polyclonal anti-HA antibody (Santa Cruz Biotechnology), a peroxidase-coupled antirabbit antibody, and a chemiluminescent substrate (Boehringer) according to the manufacturers' protocols.

Oligonucleotides. Oligonucleotides were synthesized by the -cyano-ethyl-phosphoamidite method (61) with an Applied Biosystems (Weiterstadt, Germany) 318A DNA synthesizer. High-pressure liquid chromatography purification was described previously (23).

PCR and RT-PCR amplification. PCR and reverse transcription-PCR (RT-PCR) were performed as described by Kempken and Kück (20) with some modifications. A DNA template (10 to 100 ng) was amplified by using 40 ng of each primer and 1.25 U of Goldstar polymerase (Eurogentec, Cologne, Germany) in a total volume of 50 µl. The amplification reaction consisted of 40 cycles of 1 min at 92°C, 1 min at 50 to 55°C (depending on the primers used), and 1 to 1.5 min at 72°C (depending on the length of the amplification product). For RT-PCR, 5 µg of RNA was treated with 20 U of DNase (Boehringer) in an appropriate buffer for 1 h at 37°C. After phenol treatment and precipitation of the RNA, the pellet was redissolved in 20 µl of distilled water. The primer (20 ng of oligonucleotide 917 [5' CATGATTGTAACCGCTCCG 3'] or 946 [5' ATGGCAACACCCTCATAAACACC 3']) was added to 10 µl of the RNA solution, and the sample was denatured for 10 min at 85°C. Reverse transcription was done with 80 U of avian myeloblastosis virus (AMV) reverse transcriptase (Boehringer) in the presence of 20 U of RNasin (Boehringer) at 45°C for 1 h in a final volume of 20 µl. After reverse transcription, 30 µl of distilled water was added, and 5 µl was used for PCR as described above. In order to detect any DNA contamination, reverse transcription was also done without AMV reverse transcriptase. Aliquots of these samples gave no PCR product, showing the complete degradation of DNA by the previous DNase treatment.

Primer extension. Primer extension was carried out as described by Krug and Berger (22) and Kennell and Pring (21) with some modifications. Twenty nanograms of oligonucleotide 1035 (5' GTTATGTGAATTGGTGACTCTCCC 3') was 5' labeled with [-³²P]dATP and precipitated with 50 µg of S. macrospora RNA. The pellet was resuspended in distilled water and denatured at 85°C for 5 min, and reverse transcription was undertaken at 45°C for 1 h with 25 U of AMV reverse transcriptase (Boehringer) in the presence of 25 U of RNasin (Boehringer). After phenol treatment and precipitation, the pellet was dissolved in 5 µl of distilled water, and 3.6 µl of stop solution from the T7 polymerase sequencing kit (Pharmacia) was added. One to four microliters of each sample was separated on a polyacrylamide gel (see "DNA sequencing and sequence comparison" above); a sequencing reaction mixture containing just the oligonucleotide primer was used for reference.

Fluorescence microscopy. For observations of nuclei, asci were fixed in carnoy fixative (49) and stained with DAPI (4',6'-diamidino-2-phenylindole) (0.5 µg/ml). Immunological detection of ACL1::HA within S. macrospora hyphae was performed as described by Oakley et al. (33) with the following modifications. Strains were grown on cover slides for 48 h. For cell wall digestion, specimens were incubated for 60 min at 27°C in a solution containing 10 mg of Novozyme 234 (Novo Industrie AIS, Bagsvaerd, Denmark) per ml, 50% egg white, 25 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] (pH 6.7), 12.5 mM EGTA, and 2.5 mM MgSO₄. Incubation in antibody solutions was performed in 50 mM Tris (pH 7.5)-150 mM NaCl. Polyclonal anti-HA antibody was used as the primary antibody; as a secondary antibody fluorescein isothiocyanate-labeled antirabbit antibody (Santa Cruz Biotechnology) was used. Mounting of specimens was performed in 50% glycerol-25 mM PIPES (pH 6.7)-12.5 mM EGTA-2.5 mM MgSO₄. Observations were performed with a Zeiss Axiophot microscope with the appropriate Zeiss filter combinations for DAPI or fluorescein isothiocyanate. Photographs were taken with T-Max 400 (Kodak) or Provia 1600 (Fuji).

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

The developmental mutant per5 shows a defect in fruiting body maturation. The sterile mutant per5, isolated from the wild-type strain after UV mutagenesis, displays normal vegetative growth. The growth rates of the mutant and wild-type strains are identical, and there seems to be no general impairment in essential vegetative functions (data not shown). When inoculated on fructification medium, the mutant strain shows a fivefold reduction in the number of perithecia compared to the wild-type strain. The fruiting body neck is shorter in mutant per5 than in the wild type (Fig. 1a and b). Most importantly, in comparison with those of the wild-type strain, the fruiting bodies of the mutant strain harbor only immature asci containing no ascospores (Fig. 1c to e). However, there seems to be no impairment in karyogamy or meiotic and postmeiotic divisions. As shown in Fig. 1e, we observed up to eight nuclei in immature asci after DAPI staining. In order to investigate whether a single gene is responsible for the mutant phenotype, per5 was crossed against the wild-type strain. A total of 119 tetrads were analyzed and showed a Mendelian segregation (4:4) of the mutant phenotype. These data indicate the involvement of a single gene locus in the mutant phenotype and lead to a calculated distance between the per5 locus and the centromere of 26 centimorgans.

View larger version (129K): [in this window] [in a new window]   FIG. 1.   Phenotypes of the S. macrospora wild-type strain (wt) and mutant per5. Strains were grown for 7 days at 27°C. (a and b) Scanning electron micrographs of perithecia from the wild-type strain (a) and mutant per5 (b). The magnifications in panels a and b are the same. (c and d) Differential interference contrast light micrographs of a wild-type ascus (c) and a mutant ascus (d). (e) Fluorescence micrograph of the mutant ascus in panel d stained with DAPI. Eight nuclei can be distinguished within the ascus. Two pairs of nuclei, not yet completely separated after postmeiotic mitosis, are marked by arrows. The magnifications in panels c, d, and e are the same.

Complementation of the sterile mutant per5 by using an indexed cosmid library. Mutant per5 was complemented to fertility by transformation with an indexed cosmid library representing the S. macrospora genome. The cosmid library consists of 96 cosmid pools, each containing 48 individual cosmid clones (42). Seventy cosmid pools were used in transformation experiments, and a total of 5,100 transformants were screened for restoration of fertility. Fertile transformants, identified by their ability to eject mature ascospores, occurred after transformation with five of the cosmid pools. In order to prove genomic complementation, transformations were repeated with these five putative complementing pools. In addition, spores of the fertile transformants were genetically analyzed for linkage between fertility and hygromycin B resistance. These investigations showed that one of the five cosmid pools contained a complementing cosmid clone. Tetrad analysis demonstrated that fertile transformants obtained by transformation with the four other pools were due to suppressor mutations (data not shown).

View larger version (11K): [in this window] [in a new window]   FIG. 2.   Partial map of cosmid clone B3 together with derivatives used in transformation experiments. Cosmid clone B3 complements mutant per5 and contains the gene for ACL (acl1). The ORF of the acl1 gene and the direction of transcription are indicated by an arrow. Plasmids p59.3, p49.4, p52.9, p41.1, and p85.1 are derivatives of cosmid clone B3 (Table 1). The site of mutation within plasmid p85.1 is shown by an arrow. The values on the right give the total number of transformants (transf.) obtained with the corresponding plasmid and the number and corresponding percentage of fertile transformants. Abbreviations for restriction enzymes: A, ApaI; B, BamHI; E, EcoRV; H, HindIII; P, PstI; S, SalI; X, XhoI.

Sequence analysis of the complementing DNA fragment. Sequencing of a total of 4.8 kb containing the 3.5-kb complementing fragment and adjacent regions revealed an ORF of 2.1 kb with a single intron of 66 nt (Fig. 3). The ORF encodes a predicted 674-amino acid-protein having significant homology with higher eukaryotic ACLs. As shown in Fig. 4, amino acid sequence homologies to animal ACLs vary between 62 and 65% over a length of about 600 amino acids. Translation is most probably initiated at the first ATG (position 1357 [Fig. 3]) of the ORF, and flanking sequences show the highest level of similarity with translation initiation sites from other S. macrospora genes (41). The putative polypeptide from S. macrospora has a calculated molecular mass of 73 kDa and thus has only about two-thirds of the molecular mass of animal ACL polypeptides (11, 12). The S. macrospora ACL1 polypeptide has homology with the C-terminal part of the corresponding animal polypeptides, which carries the enzyme's proposed catalytic center, including the histidine residue that is autophosphorylated during the catalyzed reaction (Fig. 4). Southern hybridization analysis indicates that the acl1 gene is a single-copy gene (data not shown). The length of the ORF (2.1 kb) is consistent with data from Northern hybridizations showing a 2.7-kb transcript when the acl1 ORF is used as a probe (data not shown). Thus, the ACL1 polypeptide of S. macrospora seems to be shorter than the corresponding animal polypeptide, since there are no indications of trans-splicing events or any other acl1-containing regions elsewhere in the genome. In order to confirm that the ACL1 polypeptide has the expected size, the HA epitope of the human influenza virus was introduced into the single PstI restriction site of the acl1 gene (Fig. 5a). The resulting plasmid, p94.1, was able to complement mutant per5 in transformation experiments; thus, the HA epitope did not significantly influence the physiological activity of the protein. For immunological detection of the ACL1 polypeptide, crude protein extracts from transformants K37B2 and K37D4, carrying plasmid p94.1 and the nontagged plasmid p61.2, respectively, were separated by SDS-PAGE. Both transformants contain multiple copies of either plasmid p94.1 or p61.2. By using polyclonal anti-HA antibodies for Western blot analysis, a single specific 74-kDa band in protein extracts of K37B2 was detected (Fig. 5b). The calculated molecular mass of 74 kDa corresponds to the expected size of 75 kDa for the recombinant polypeptide carrying the HA epitope.

View larger version (64K): [in this window] [in a new window]   FIG. 3.   Nucleotide and derived amino acid sequences for the S. macrospora acl1 gene and its flanking regions. Intron sequences are indicated in lowercase, and characteristic intron sequences are underlined. The transcription initiation site is marked by an arrow; a putative CAAT box is marked by a line above the sequence. The catalytic center is indicated by a box around the sequence (11). The single nucleotide exchange present in mutant per5 at position 3372 (T to A) and the resulting amino acid exchange (aspartic to glutamic acid) are shown in boldface above and below the corresponding wild-type sequences, respectively. The nucleotide and deduced polypeptide sequence are numbered on the left, starting with nucleotide 626 according to the numbering of the complete sequence (4,847 bp) deposited in the EMBL sequence database under accession no. AJ224922.

View larger version (72K): [in this window] [in a new window]   FIG. 4.   Comparison of the C-terminal sequences of ACL polypeptides from different eukaryotes. S.m., S. macrospora (this work); H.s., human (accession no. U18197), R.n., rat (accession no. J05210); D.m., Drosophila melanogaster (accession no. U87317); C.e., Caenorhabditis elegans (accession no. U58727). Alignments were made by using the MULTalign program provided by the HUSAR/Genius computer software package. Dashes represent gaps introduced into the sequence to obtain the best consensus. Asterisks under the sequence represent amino acid residues conserved in all sequences. The catalytic center is indicated by a box around the sequences (11). The amino acid exchange (D to E) in mutant per5 is indicated by an arrow above the corresponding aspartic acid residue of the S. macrospora wild-type sequence. Homologies between the S. macrospora ACL1 sequence and those from other eukaryotes are given.

View larger version (28K): [in this window] [in a new window]   FIG. 5.   Immunological detection of the ACL1 polypeptide in crude protein extracts. (a) Introduction of the HA epitope into the acl1 gene. The insert of plasmid p94.1, which carries the complete ORF of the acl1 gene, is shown. The HA epitope was introduced into the PstI site within the ORF. (b) Detection of ACL1::HA in crude protein extracts of the transformed strain K37B2 during different stages of development. Forty micrograms of total protein per lane was separated by SDS-7% PAGE and blotted onto a nitrocellulose membrane. The HA-tagged protein was visualized by using polyclonal anti-HA antibodies, antirabbit secondary antibodies, and a chemiluminescence detection system. The time of growth in hours is given above each lane. As a control, a protein extract of strain K37D4 (48 h of growth) was used. This strain was transformed with plasmid p61.2, containing the acl1 gene without the HA epitope. Sizes of marker polypeptides are given on the right.

Analysis of the mutant acl1 gene. In order to prove that the ACL is the complementing factor, two different strategies were used. The acl1 allele of mutant per5 was compared with the wild-type allele, while transformation experiments were carried out with clones containing either a truncated version of the acl1 gene or a mutated acl1 ORF (Fig. 2).

View larger version (46K): [in this window] [in a new window]   FIG. 6.   Restriction analysis of the acl1 gene. (a) Map of the wild-type (wt) acl1 gene, giving the site of the nucleotide exchange present in mutant per5. The EcoRV fragment used as a hybridization probe is indicated by a double arrow. (b) Autoradiograph from a Southern hybridization experiment. Nucleic acids were isolated from the wild type, mutant per5, two complemented transformants (Tr 1 and Tr 2), and spore isolates. The latter were obtained from crosses between the wild type and mutant per5 (ascus 1 and ascus 2). The phenotypes of the spore isolates (wt or per5) are indicated above the lanes. EcoRV digests of genomic DNAs were separated in a 0.8% agarose gel. Hybridization was done with the radiolabeled 3-kb EcoRV fragment carrying parts of the acl1 gene ORF (panel a). Plasmid p27.7, carrying a fragment of the complementing cosmid clone, was used as a control. The sizes of the hybridization signals are given.

Physiological analysis of ACL expression in wild-type and mutant strains. ACL has been shown to be involved in lipid metabolism in animals and some fungi (4, 12, 27, 38). It catalyzes the formation of acetyl-CoA and oxaloacetate from CoA and citrate, with concomitant hydrolysis of ATP. The enzyme activity can be assayed in crude extracts of various tissues (4, 38, 62).

Immunological detection of the ACL1 polypeptide in S. macrospora hyphae. In order to determine the localization of the ACL1 polypeptide in S. macrospora, hyphae from strains K37B2 and K37D4 were processed for secondary immunofluorescence. Strain K37B2 carries an HA-tagged copy of the acl1 gene (Fig. 5), while strain K37D4, carrying the corresponding nontagged plasmid, was used as a control. As shown in Fig. 7c and d, staining of the cytoplasm was observed in strain K37B2, thus demonstrating the localization of the ACL1 polypeptide within the cytosol. As expected, in the control strain K37D4 only autofluorescence of the septa was observed (Fig. 7a and b). By this method, we cannot exclude the possibility that ACL also resides within other subcellular compartments. In general, however, our data are in accordance with subcellular fractionation experiments that detected ACL within the cytosol in some yeasts and Aspergillus niger (4, 38).

View larger version (87K): [in this window] [in a new window]   FIG. 7.   Immunological detection of the ACL1 polypeptide in S. macrospora hyphae. Hyphae from strain K37D4 (a and b) (transformed with plasmid p61.2, without the HA epitope) and strain K37B2 (c and d) (transformed with plasmid p94.1, carrying the HA epitope) were grown on cover slides and processed for immunofluorescence. (a and c) Differential interference contrast light micrographs; (b and d) fluorescence of ACL1::HA in the same hyphae. Magnifications are all the same.

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

The ACL gene is highly conserved. In this paper we describe the isolation and characterization of per5, a sterile mutant of S. macrospora which was complemented to fertility by the gene encoding ACL. ACL produces acetyl-CoA, which in eukaryotes is used mainly in fatty acid and sterol biosynthesis. ACL is localized in the cytosol in animals and fungi (4, 38), whereas in plants it resides in the chloroplasts, which are the sites of fatty acid biosynthesis within photoautotrophic organisms (46). In S. macrospora, ACL also resides within the cytoplasm, as was demonstrated by immunofluorescence analysis (Fig. 7).

ACL is essential for fruiting body development. Analysis of the S. macrospora mutant per5 has demonstrated that although a drastic reduction of ACL activity does not impair vegetative growth, ACL is an essential requirement for fruiting body maturation. ACL produces acetyl-CoA and oxaloacetate, and so far no further function has been attributed to the protein. The acetyl-CoA produced by ACL is used mainly in fatty acid and sterol biogenesis. Fatty acids and sterols play important roles in many cellular processes, such as the generation of biomembranes, hormones, and secondary messengers. Besides these general functions, many developmental processes in different organisms are dependent on fatty acid metabolism. In plants, the formation of pollen grains and seeds is closely correlated with lipid production. Several genes of the fatty acid biosynthesis pathway of Brassica napus are tightly regulated in a spatiotemporal manner, e.g., those for acyl carrier proteins and stearoyl-acyl carrier protein desaturases (8, 40). In animals, enzymes for lipid biosynthesis and fatty acid beta-oxidation are both regulated during morphogenesis, as can be seen in developing rats (9, 13). In fungi, fatty acid biosynthesis has been well studied at the cellular level, but only in a few cases have more specialized functions been attributed to lipid metabolism (for a review, see reference 6). For example, in N. crassa fatty acids were shown to be involved in the circadian rhythm, and they are also needed for mitosis in Schizosaccharomyces pombe (28, 50). Lipids as well as sterol derivatives serve as growth factors or pheromones in some fungal species (for a review, see reference 10).