INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

The study of adaptation mechanisms during salinity stress in the yeast Saccharomyces cerevisiae has revealed several components of sensing and signal transduction pathways, as well as target genes whose expression is activated upon salt stress (for review see references 18, 45, and 46). Increased expression of the ENA1 gene has been found to represent a crucial cellular response after salt challenge. The ENA/PMR2 gene cluster of S. cerevisiae contains a tandem array of nearly identical genes encoding P-type ATPases involved in the extrusion of Na⁺ and Li⁺ ions from the cytoplasm (17, 59). Active export of these toxic ions is a crucial cellular process to avoid deleterious intracellular Na⁺ and Li⁺ concentrations. Mutants lacking the first ENA gene in the gene cluster (ena1) are hypersensitive to salt stress (17). The ENA1 gene is highly regulated at the transcriptional level, and its expression is increased strongly in response to salt stress (12) and glucose starvation (1, 41).

Salt induction of ENA1 expression depends on both the calcineurin pathway and the high-osmolarity glycerol (HOG) mitogen-activated protein (MAP) kinase pathway (28). The first pathway is activated by high concentrations of either Na⁺ or Ca²⁺ and is dependent on the phosphoprotein phosphatase calcineurin (28, 33). A calcium signalling pathway composed of calmodulin (7), the calcineurin heterodimeric enzyme (6, 23), and the zinc finger transcriptional activator Crz1/Tcn1/Hal8p (31, 32, 50) has been reported to contribute to the resistance of yeast to elevated concentrations of several cations (Na⁺, Li⁺, and Mn²⁺). Therefore, Ca²⁺/calmodulin signalling may act, at least in part, through the transcriptional activation of ion transporter genes such as ENA1.

The HOG pathway responds to moderate concentrations of osmotic agents and rapidly activates via a multistep phosphorelay mechanism the Hog1p MAP kinase by Tyr phosphorylation (2, 26, 39). Although a great number of genes have been found to need HOG signalling for their osmotic up-regulation, the mechanism of gene activation through phosphorylated Hog1p kinase is still unknown. In Schizosaccharomyces pombe, the basic leucine zipper (bZIP) transcriptional activator Atf1p has been identified as a direct phosphorylation target of the Hog1p homolog MAP kinase Sty1p (49, 51, 60). Activated Atf1p, in turn, can bind directly to UASs (upstream activating sequences) located in various stress-regulated promoters and then trigger gene expression (60). In S. cerevisiae, stress response promoter elements (STREs) represent UASs that respond to a great variety of stresses (22, 27, 43) and are bound by the zinc finger activators Msn2p and Msn4p (30, 42). Recent work, however, indicates that osmotic induction of several genes including ENA1 occurs by the release from transcriptional repression (29) and involves the general repressor complex Ssn6p-Tup1p. In the case of the HAL1 gene, an upstream repressing sequence (URS) regulated by osmotic stress has been identified (29). This mechanism based on regulated repressors bound to URSs is similar to the one operating in carbon source regulation.

A great number of yeast genes, including ENA1, are derepressed under glucose starvation conditions, and for many of them the inactivation of the general repressor complex Mig1p-Ssn6p-Tup1p (21, 36, 54) through the protein kinase Snf1p (3, 53) has been reported as an important mechanism of glucose-regulated transcriptional control.

In this work, we analyzed the promoter of the ENA1 gene and found that transcriptional regulation during osmotic stress as well as during glucose starvation occurs through a repression mechanism dependent on the Ssn6p-Tup1p general corepressor. Signalling through general glucose repression occurs through a Mig1/2p binding site (URS_MIG-ENA1), whereas osmotic stress signalling through the HOG pathway is mediated through a cyclic AMP (cAMP) response element (CRE)-like sequence (URS_CRE-ENA1) that is bound by the bZIP transcriptional factor Sko1p.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Strains and growth conditions. The S. cerevisiae strains used in this work are listed in Table 1. Gene disruptions using the loxp-KAN MX-loxp cassette were carried out as described previously (16). All null mutations were verified by genomic PCR. YPD (or YPGal) contained 2% glucose (or 2% galactose), 2% peptone, and 1% yeast extract. Synthetic medium (SD) contained 2% glucose, 0.67% yeast nitrogen base without amino acids (Difco), and the amino acids purine and pyrimidine bases required by the strain of interest. Yeast cells were transformed as described elsewhere (15). The growth of yeast strains under different osmotic and salt stress conditions was assayed by spotting dilutions of saturated cultures onto YPD plates containing the indicated concentrations of osmotic agents or salts.

Construction of plasmids. To analyze the ENA1 promoter, different stretches from the 5' upstream region were amplified by PCR, generating PstI and XhoI restriction sites at the ends. The fragments were then inserted into the CYC1-lacZ reporter construct pJS205 (44) that was digested with PstI and XhoI. An empty vector control (pMP206) was generated by XhoI/SalI digestion of pJS205 to remove the same CYC1 promoter region as in all the insertion constructs and subsequent self-ligation. The URS_MIG-ENA1-CYC1-lacZ plasmid pMP222 was constructed by inserting the double-stranded oligonucleotide AGCTATTTTGCGGGGCATCGAT (giving HindIII-compatible ends after hybridization; the original ENA1 sequence is underlined) into pMP206. Similarly, the URS_CRE-ENA1-CYC1-lacZ plasmid pMP224 was constructed by inserting the double-stranded oligonucleotide AGCTATCGATTATTTCCTACTTCTATGACGTTT (the original ENA1 sequence is underlined) into pMP206 digested with HindIII. Constructs pMP226 (CRE-CYC1-lacZ) and pMP227 (mutant CRE [CRE*]-CYC1-lacZ) were obtained by insertion of double-stranded oligonucleotides ENACRE1/2 AGCTATCGATCTATGACGTTT (for pMP226; the original CRE sequence from ENA1 is underlined) or ENACRE3/4 AGCTATCGATCTATGAT*GTTT (for pMP227; the point mutation within CRE is indicated by the asterisk) into pMP206 digested with HindIII. In all cases, the number and orientation of inserted oligonucleotides were determined by sequencing. A GAL4_DBD-SKO1 fusion plasmid (pMP235) was obtained by inserting a PCR fragment (SmaI/SalI) containing nearly the entire SKO1 gene (coding region for amino acids 4 to 647) in the two-hybrid vector pGBT9 (Clontech, Palo Alto, Calif.).

-Galactosidase assay. Transformed yeast strains were grown selectively until saturation in the appropriate SD liquid media and were diluted into YPD. Logarithmically growing cells (optical density at 660 nm of 0.5 to 0.8) were then transferred to fresh YPD, YPGal, or YPD with NaCl, KCl, or sorbitol, and -galactosidase activity was determined after 1 h (0.3 M NaCl and KCl, 0.5 M sorbitol) or 4 h (YPGal, YPD with 0.8 M NaCl or KCl). The enzyme assay was performed as described elsewhere (14). Results presented are mean values obtained from at least three independent transformants measured in duplicate.

Purification of GST-Sko1p and gel retardation. The entire reading frame of SKO1 was obtained by PCR using genomic DNA as template generating a NcoI restriction site around the ATG start site and a SalI restriction site after the stop site of SKO1. The fragment was inserted into the bacterial glutathione S-transferase (GST) expression vector pGEX-KG (Pharmacia Biotech) digested with NcoI and XhoI. Expression and purification by affinity chromatography of the full-length GST-Sko1 protein were performed as recommended by the manufacturer. For the protein-DNA binding studies, the double-stranded oligonucleotides ENACRE1/2 and ENACRE3/4 were ³²P-labeled by the Klenow fill-in reaction and purified by polyacrylamide gel electrophoresis. In the binding assays, approximately 1 µg of GST-Sko1p was incubated with 0.5 ng of labeled probe in the presence of 0.5 µg of poly(dI-dC)-10 mM HEPES (pH 7.4)-15% glycerol-0.1 mM EDTA-20 mM NaCl-4 mM MgCl₂-2 mM dithiothreitol at room temperature for 20 min. Binding reaction mixtures were directly loaded onto a 4% polyacrylamide gel in 0.5× TBE buffer (45 mM Tris, 45 mM boric acid, 1 mM EDTA).

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

Deletion analysis of the ENA1 promoter. A preliminary analysis of the ENA1 promoter has shown that the region up to 752 (translational start point is +1) is responsible for the osmotically induced, calcineurin-independent expression of ENA1 (1). To identify sequences in this upstream control region of ENA1 that are important for its regulated expression, we investigated a set of PCR-generated segments of the ENA1 promoter in a CYC1-lacZ test vector under basal (YPD) and induced (0.3 M NaCl) conditions (Fig. 1). The control construct pMP206 gave under both conditions high levels of -galactosidase activity due to the CYC1 TATA box-mediated expression. Insertion of a large upstream region of ENA1 (317 to 742) resulted in a strong decrease of expression under normal growth conditions, while -galactosidase levels again reached control values after osmotic shock. This result indicated that regulation of the ENA1 gene consists mainly of a derepression (rather than an activation) process. We also compared the induction of the artificial fusion of ENA1 (317 to 742) with the CYC1 TATA box in construct pMP205 with that of an entire ENA1-lacZ fusion (up to 1380), but neither the induction capacity nor the kinetics of induction by 0.3 M NaCl was found to be significantly different (data not shown). Therefore, the promoter region from 317 to 742 was subjected to further deletion analysis (Fig. 1, plasmids pMP207 to pMP213). Subsequent removal of 5' or 3' sequences resulted in a total loss of regulation when the region from 490 to 573 (referred to below as URS_ENA1) was affected (plasmids pMP209 and pMP212). Moreover, this region alone was able to change the constitutive control into a salt-regulated promoter by its function as a repressor under basal conditions (plasmid pMP213). Interestingly, the only STRE sequence found in the ENA1 upstream region (AGGGG; 651 to 647) did not contribute to the regulation because its removal caused no loss of the responsiveness to stress (compare pMP207 and pMP208 in Fig. 1), and a promoter version containing STRE but not URS_ENA1 was no longer inducible by NaCl (pMP212). Assuming that URS_ENA1 contained the relevant protein-binding sites for the stress-regulated expression, we examined this 84-bp region by computer analysis using the MatInspector program (40). Within the URS element, two putative recognition sequences for transcription factors were found. Nucleotides 544 to 534 (ATTTTGCGGGG) perfectly match the consensus binding sequence of the yeast transcriptional repressor Mig1p (24), and nucleotides 509 to 502 (TGACGTTT) showed a similarity to mammalian CREs (4, 35).

View larger version (29K): [in this window] [in a new window]   FIG. 1.   Deletion analysis of the ENA1 promoter. Segments from the ENA1 upstream region indicated at the left were inserted into a CYC1-lacZ reporter. -Galactosidase (-gal.) specific activity (nanomoles per minute per milligram) was determined in transformed wild-type cells (W303-1A) after growth without (YPD) or with (YPD-0.3 M NaCl) salt. Absolute values including the standard deviation are given at the right. The sequence of URSENA1 (490 to 573) is depicted at the bottom.

The ENA1 promoter contains functional Mig1p-binding and CRE sites. Preliminary characterization of the ENA1 control region qualified the region from 490 to 573 as a URS element. Since we found that the repression effect through URS_ENA1 was counteracted by osmotic stress (0.3 and 0.8 M of either NaCl or KCl) as well as by glucose starvation (galactose or ethanol as the carbon source [data not shown]), we now addressed the question of whether the response to these different environmental changes is triggered by distinct promoter motifs. By testing the two promoter elements separately, we found that both are efficiently repressing transcription under basal conditions (Fig. 2). However, they respond to completely different stimuli. A URS_MIG-ENA1-regulated reporter gene was exclusively derepressed by glucose starvation (pMP222 with YPGal) but not by osmotic induction, while a URS_CRE-ENA1-regulated reporter gene responded exclusively to osmotic stress (pMP224 with NaCl, KCl, and sorbitol) but not to glucose starvation. From these results, we conclude that glucose derepression and hyperosmotic shock induce ENA1 expression independently via (at least) two distinct URS elements, URS_MIG-ENA1 and URS_CRE-ENA1, whose separation allowed us now to investigate the function of transcription factors and signalling components that would specifically affect these repression elements.

View larger version (25K): [in this window] [in a new window]   FIG. 2.   URSMIG-ENA1 and URSCRE-ENA1 are functional repressor elements of the ENA1 promoter. Oligonucleotides containing the indicated sequences of the ENA1 promoter were inserted into a CYC1-[TATA]-driven lacZ reporter. -Galactosidase activity was determined after growth of transformed cells (W303-1A) under basal (YPD), glucose-derepressed (YPGal), salt stress (YPD-0.3 M NaCl, YPD-0.8 M NaCl), or osmotic stress (YPD-0.3 M KCl or YPD-0.5 M sorbitol) conditions.

Repression through URS_MIG-ENA1 depends on the function of Mig1p and Mig2p. To characterize the roles of the two zinc finger repressors, Mig1p and Mig2p, that have been already reported to interact with the GC box motif (25, 36), we tested the repression effect of URS_MIG-ENA1 in mig1, mig2, and mig1 mig2 mutant strains. In the absence of either MIG1 or MIG2, repression of a URS_MIG-ENA1-regulated reporter (pMP222) was only partially lost, while the absence of both genes caused nearly the complete loss of regulation occurring on this promoter element (Fig. 3). This result indicated that both homologous repressors, Mig1p and Mig2p, contribute nearly equally to glucose repression on the ENA1 promoter. A similar effect of complete deregulation of URS_MIG-ENA1 as for the mig1 mig2 mutant was observed in the absence of components of the general repressor complex SSN6-TUP1 (Fig. 3).

View larger version (40K): [in this window] [in a new window]   FIG. 3.   URSMIG-ENA1 function depends on MIG1, MIG2, SSN6, and TUP1. Repressed (growth in YPD) and derepressed (growth in YPGal) expression of a URSMIG-ENA1-CYC1-lacZ fusion gene (pMP222) was measured in transformed wild-type (W303-1A) and various mutant (MAP12, mig1; MAP21, mig2; MAP24, mig1 mig2; MAP6, ssn6; MAP5, tup1) strains.

Regulation through URS_CRE-ENA1 requires the functions of the bZIP repressor Sko1p (Acr1p) and the corepressors Ssn6p and Tup1p. The yeast SKO1 (ACR1) gene has been found to encode a bZIP transcriptional repressor that binds to CRE sequences, although the physiological role of the protein remained undetermined (37, 56). We therefore examined whether the URS_CRE-ENA1 promoter element would need Sko1p for its repression function. Indeed, as depicted in Fig. 4, a sko1 mutant showed a complete loss of regulation through the CRE-like ENA1 sequence, indicating that Sko1p is the CRE-interacting protein responsible for the osmotically regulated repression of ENA1. The URS_CRE-ENA1 motif, like the URS_MIG-ENA1 element, was dependent on a functional Ssn6p-Tup1p general repressor complex since ssn6 or tup1 mutants were defective in repression of a URS_CRE-ENA1-CYC1-lacZ reporter plasmid (Fig. 4). Although both negative cis elements of the ENA1 gene were dependent on Ssn6p-Tup1p, glucose and osmotic signalling were strictly separated on the level of the DNA-binding transcription factors, since the sko1 mutation did not affect URS_MIG-ENA1-regulation, nor were mig1 mutants defective in URS_CRE-ENA1 regulation (data not shown). Furthermore, we tested whether URS_CRE-ENA1 was able to repress activated transcription. We found that when placed upstream or downstream of UAS_Rap1 (binding site for the transcriptional activator Rap1p), the CRE of ENA1 was a functional repressor regulated by osmotic stress and dependent on Sko1p and Ssn6p (data not shown).

View larger version (42K): [in this window] [in a new window]   FIG. 4.   URSCRE-ENA1 function depends on SKO1, SSN6, and TUP1. Repressed (growth in YPD) and derepressed (growth in YPD-0.8 M NaCl) expression of a URSCRE-ENA1-CYC1-lacZ fusion gene (pMP224) was measured in transformed wild-type (W303-1A) and various mutant (MAP19, sko1; MAP6, ssn6; MAP5, tup1) strains.

Sko1p binds to the CRE-like sequence of ENA1. To test whether Sko1p can directly and specifically interact with the CRE motif of the ENA1 promoter, we performed gel retardation assays using oligonucleotides containing the entire CRE sequence or a point-mutated version of the binding motif changing the core sequence ACGT to ATGT (designated CRE*). As shown in Fig. 5, Sko1p bound specifically to the CRE sequence (lane 2) but not to CRE* (lane 4). Moreover, the Sko1p complex was efficiently competed by the use of nonlabeled CRE but not the CRE* sequence (Fig. 5, lanes 6 to 9). The same oligonucleotides were also tested for transcriptional repression by insertion into the CYC1-lacZ reporter system. As shown in Fig. 6, the 12 nucleotides representing the original CRE_ENA1 motif repressed transcription under nonstress conditions independently of their orientation to the transcription start, while the CRE* sequence was not functional. The repression effect was counteracted by elevated concentrations of either NaCl (Fig. 6), KCl, or sorbitol (data not shown). Taken together, the results indicated that the binding of Sko1p to its CRE target sequence is responsible for ENA1 repression that is relieved by osmotic shock.

View larger version (54K): [in this window] [in a new window]   FIG. 5.   Sko1p binds to CREENA1 in vitro. Purified GST-Sko1p was incubated with labeled CRE (TGACGTTT) or CRE* (TGATGTTT). Lanes: 1, labeled CRE without added protein; 2, labeled CRE with added GST-Sko1p; 3, labeled CRE* without added protein; 4, labeled CRE* with added GST-Sko1p; 5, as lane 2; 6 (and 7), competition with 20× (and 50×) excess of CRE; 8 (and 9), competition with 20× (and 50×) excess of CRE*.

View larger version (15K): [in this window] [in a new window]   FIG. 6.   Binding of Sko1p correlates with the repression of CREs. Oligonucleotides that were used for Sko1p-binding assays (Fig. 5) were tested for repression ability in a CYC1-lacZ reporter. Constructions indicating the orientation of oligonucleotide insertion are given at the left. The repression effect of each oligonucleotide is depicted at the right as a percentage of the activity of the control plasmid without any insertion.

Derepression of URS_CRE-ENA1 requires signalling through the Hog1p MAP kinase. Induction of ENA1 expression during salt stress has been reported to be dependent on various signalling pathways (28). We therefore attempted to relate the CRE-mediated osmotic regulation to one (or more) of the known signal transduction pathways. We tested a variety of regulatory mutants for their effect on a URS_CRE-ENA1-CYC1-lacZ gene. No significant change in the repression/derepression behavior was found for mutants bearing cnb1, defective in calcineurin phosphatase activity, or bcy1, defective in signalling through protein kinase A (PKA) by constitutively activating PKAs (data not shown). However, a dramatic effect was observed with a hog1 mutant with impaired HOG MAP kinase signalling. As can be seen in Fig. 7, the hog1 strain repressed a CRE-regulated reporter gene even more strongly under basal conditions and was unable to remove repression during osmotic shock, while a Mig1p-binding site-regulated control was not affected. These results strongly suggested that the Sko1p-mediated repression on the CRE sequence is a target of osmotic sensing through the HOG pathway.

View larger version (28K): [in this window] [in a new window]   FIG. 7.   Derepression of URSCRE-ENA1 is dependent on the Hog1p MAP kinase. A URSMIG-ENA1-CYC1-lacZ (pMP222) and a URSCRE-ENA1-CYC1-lacZ (pMP224) reporter were assayed in wild-type (YPH499) and hog1 mutant (JBY10) cells under repressed (YPD) and derepressed (YPGal for pMP222; YPD-0.3 M NaCl for pMP224) conditions. The degree of repression is given as relative -galactosidase activity compared to the nonregulated empty CYC1-lacZ vector.

Disruption of SKO1 suppresses hog1 mutant phenotypes. To test whether the Hog1p kinase acts through the Sko1p repressor, we investigated epistatic effects of the loss of SKO1 function over the hog1 disruption. We examined the expression of an integrated ENA1-lacZ fusion gene in hog1 and sko1 single mutants and in hog1 sko1 double mutants. As shown in Fig. 8A, osmotic induction of ENA1 by KCl is absent in hog1 mutants. On the other hand, a strong increase in basal ENA1 expression (YPD without salt) is observed in a sko1 strain. This elevated expression cannot be further induced by osmotic shock (0.3 M KCl). With respect to the expression of ENA1, the loss of SKO1 completely compensates for the hog1 deletion since the hog1 sko1 double mutant showed the same elevated expression levels as the sko1 strain. Therefore, we conclude that in the case of the osmotic up-regulation of ENA1, signalling through the HOG MAP kinase pathway acts on the Sko1p transcriptional repressor. This was also confirmed by the finding that additional deletion of SKO1 in a hog1 background partially suppressed the osmotic sensitivity of hog1 mutants (Fig. 8B). Again, this result clearly qualified Sko1p as a downstream effector of the HOG pathway.

View larger version (52K): [in this window] [in a new window]   FIG. 8.   Disruption of SKO1 acts in an epistatic manner over the loss of Hog1p function. (A) Expression of an integrative ENA1-lacZ gene (pFR70i) was measured under repressed (YPD) and derepressed (YPD-0.3 M KCl) growth conditions in strains W303-1A (wild type), MAP32 (hog1), MAP19 (sko1), and MAP33 (hog1 sko1). (B) Growth of wild-type strain W303-1A, MAP32 (hog1), and MAP33 (hog1 sko1) on high-osmolarity media.

A Gal4_DBD-Sko1 fusion protein confers osmotic regulation to the GAL1 promoter that depends on Ssn6p and Tup1p function. To prove that Sko1p contains transcriptional repression activity that is regulated by external osmolarity, we targeted the protein to the heterologous promoter of the GAL1 gene by expressing a GAL4_DBD-SKO1 fusion. As depicted in Table 2 the fusion protein repressed the GAL1-lacZ reporter under normal growth conditions (YPD), while this down-regulation was counteracted by osmotic shock (0.3 M NaCl). This led to a strong osmotic regulation of the GAL1 promoter (10-fold) that is normally not regulated by salt. Moreover, the differential transcriptional control through Gal4-Sko1p is largely abolished in either ssn6 or tup1 mutants (Table 2), indicating that Sko1p function is dependent on the Ssn6-Tup1p corepressor complex.

ENA1 expression is modulated by multiple repressors. To test the extent to which the repressors Mig1/2p and Sko1p contribute to ENA1 regulation, we measured the transcriptional regulation in the whole promoter context, using an integrative ENA1-lacZ fusion. In general, the loss of one of the three repressors caused a partial derepression of ENA1 under normal growth conditions and concomitantly a drop in the level of induction observed upon glucose starvation or salt shock (Table 3). This was in agreement with the speculative role of all three repressors influencing the basal expression of ENA1. As was found for the specific regulation of URS_MIG-ENA1, the whole ENA1 promoter was under the additive control of both repressors Mig1p and Mig2p since the double mutant showed an even higher degree of derepression than either of the single mutants. Although induction by both galactose and NaCl was reduced in a mig1 mig2 strain, specific involvement of Mig1/2p in salt induction is unlikely because a separate URS_MIG-ENA1 clearly was not derepressed by salinity. The loss of SKO1 caused an increase in basal expression, and the inducibility of ENA1 upon salt stress was severely diminished whereas induction upon glucose starvation was only slightly affected. This was in agreement with the previous finding that Sko1p is responsible for the part of repression that is susceptible to osmotic stress. However, sko1 mutants still showed a fourfold derepression upon severe Na⁺ stress, and a sko1 mig1 mig2 strain, although dramatically impaired for ENA1 transcriptional regulation, still responded to a high sodium shock, indicating that part(s) of the salt-regulated repression is not regulated by Sko1p. Therefore, we also derepressed ENA1 transcription by osmotic stress by using 0.8 M KCl, which does not activate calcineurin signalling (28). Under these conditions, the wild type increases ENA1 expression fivefold, while no derepression occurs in the sko1 null mutant, which has derepressed ENA1 expression levels under normal conditions (Table 3). Similar results were obtained with moderate concentrations of NaCl (0.3 M [data not shown]), indicating that Sko1p mediates osmotic induction whereas upon high-sodium challenge, the ENA1 gene is additionally up-regulated by calcineurin-mediated activation. The most severe phenotype with respect to ENA1 expression was exhibited by a ssn6 mutant strain, which lost all responsiveness due to the total derepression of the gene under nonstress conditions (Table 3). By applying severe salt stress under glucose derepression conditions (YPGal plus 0.8 M NaCl), the ENA1-lacZ gene was completely derepressed in the strains tested up to levels comparable to the expression observed in the ssn6 strain (data not shown). We also tested whether the elevated ENA1 expression in the various mutants had consequences for the survival under osmotic and salt stress conditions. While a mig1 mig2 mutant strain grew only slightly better under conditions of elevated Li⁺ concentrations, the sko1 and ssn6 mutant strains clearly showed a greater resistance to high concentrations of Na⁺ and Li⁺ (Fig. 9). Under osmotic stress conditions (1.5 M sorbitol and 1.5 M KCl), all strains grew similarly. According to their different degrees of derepression of the ENA1 gene (Table 3), ssn6 mutants were more resistant to severe salt stress than sko1 mutants, as was particularly evident for Li⁺ resistance. However, loss of the glucose-regulated repression in the mig1 mig2 double mutant did not give rise to a clear salt resistance despite activating ENA1 expression even more strongly than the sko1 mutation. This result suggested that the Sko1p-Ssn6p/Tup1p-mediated regulation may also play an important role in the repression of other salt stress defense genes that are not affected by glucose repression.

View larger version (29K): [in this window] [in a new window]   FIG. 9.   Mutants sko1 and ssn6 are resistant to Na+ and Li+ stress. Growth of mutant strains MAP24 (mig1 mig2), MAP19 (sko1), and MAP6 (ssn6) on high-osmolarity media is compared with that of the wild type (W303-1A).

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

Increased expression of the ENA1 sodium and lithium extrusion ATPase in S. cerevisiae is a crucial adaptation to salt stress. We have shown that the underlying regulatory mechanism to adjust ENA1 expression is based mainly on a negative control through multiple DNA-binding repressors that act together with the general corepressor complex Tup1p-Ssn6p. Deletion of SSN6 has dramatic consequences with respect to the transcriptional regulation of ENA1, since the gene is nearly expressed to the maximal level under nonstress conditions and only a marginal up-regulation upon salt stress or glucose starvation is left. Similar results were obtained for a tup1 null mutant (data not shown). This is in complete agreement with the recent finding that the Ssn6p-Tup1p complex is involved in the osmotic regulation of stress-regulated genes (29). To different extents, transcriptional repression modulates the expression of other salt-inducible genes such as GPD1, CTT1, and ALD2, whose basal transcription is clearly increased in a ssn6 background (29). In the case of these genes, a further activation during osmotic shock can be observed. Therefore, the overall regulation on these promoters is composed of a negative component keeping transcript levels low during normal growth and a positive component that activates transcription only when cells are confronted with high salinity or other stresses. A positively acting STRE with the core AGGGG has been found to be responsible for transcriptional activation as a response to a great variety of stresses (22, 27, 43). STREs can be regarded as the promoter elements that trigger the cellular multistress response, as they can be activated by osmotic, oxidative, and heat stress, as well as by nutrient starvation. Osmotic induction of STRE is dependent on signalling through the HOG MAP kinase pathway (43), and generally STRE regulation is negatively affected by the RAS-cAMP pathway (27). The two zinc finger proteins Msn2p and Msn4p directly bind and activate STRE sequences and are important determinants of the multistress resistance of yeast cells (30, 42). Clearly the ENA1 gene is not regulated by STREs. Only one sequence that matches the core sequence AGGGG (positions 651 to 647) can be found in the ENA1 upstream region, but this promoter region is dispensable for stress induction (Fig. 1 and reference 1). Moreover, in a msn2msn4 mutant background, ENA1 transcriptional regulation upon salt shock and glucose starvation is not affected compared to the wild type (1, 39a). Together with the finding that in repression-deficient (ssn6 or tup1) mutants ENA1 transcription is nearly fully activated without any exposure to osmotic stress, it has to be concluded that stimulation of ENA1 expression by osmotic stress acts through the inactivation of repression. According to this concept, we present the identification of two separated promoter elements that mediate negative regulation via two different signalling systems, the general glucose repression pathway and the HOG MAP kinase pathway. The ENA1 promoter is activated by carbon source starvation and osmotic stress independently, and both stimuli additively increase ENA1 expression (1, 39a). The following results presented in this work demonstrate that repression by glucose is carried out by the binding of the zinc finger repressors Mig1p and Mig2p to the URS_MIG-ENA1 element (533 to 544): (i) a separate URS_MIG-ENA1 element in single copy confers carbon source-regulated repression to a reporter gene; (ii) mig1 and mig2 single mutants (partially) and mig1mig2 double mutants (totally) lose repression of a URS_MIG-ENA1-regulated reporter gene; and (iii) mig1, mig2, and mig1mig2 mutants show increased basal levels of expression of an integrated ENA1-lacZ gene. Obviously the two homologous repressor proteins Mig1p and Mig2p can recognize the same promoter region within ENA1. The same observation, although with a minor contribution of Mig2p, has been made for the glucose-regulated SUC2 gene (25). The mechanism by which Mig1p-mediated repression is removed upon carbon source starvation occurs through its phosphorylation by the Snf1p protein kinase (38, 38a, 53) and subsequent nuclear export (9). Accordingly, the induction of ENA1 by glucose derepression is absent in an snf1 null mutant (1).

Osmotic induction of many genes requires the HOG MAP kinase signalling cascade, and for CTT1 (encoding cytosolic catalase) and HSP12 (encoding a small heat shock protein), the importance of activated STREs has been demonstrated to be crucial for this process (43, 55). Nevertheless, it remains to be determined how the activated HOG pathway finally stimulates STRE-driven transcription via its binding factors Msn2p and Msn4p. Although ENA1 is a HOG-dependent gene, its differential expression during osmotic shock is completely independent of Msn2p/4p and STREs. A very different mechanism must be proposed to explain how the active Hog1p MAP kinase can modulate ENA1 expression. We provide several lines of evidence that this mechanism consists of the repressing activity of the bZIP transcription factor Sko1p, which recruits the Ssn6p-Tup1p corepressor by binding to the URS_CRE-ENA1 motif: (i) a single copy of the URS_CRE-ENA1 promoter element (513 to 502) confers repression to a CYC1-lacZ reporter that is abolished under osmotic stress conditions; (ii) in the sko1, ssn6, and tup1 null mutants the URS_CRE-ENA1-mediated repression is completely absent; (iii) a GST-Sko1 fusion protein binds specifically to the CRE_ENA1 element in vitro; (iv) a Gal4_DBD-Sko1 fusion protein acts as a Ssn6p/Tup1p-dependent repressor of the GAL1 promoter that is counteracted by osmotic stress; (v) in a hog1 null mutant, repression occurring on URS_CRE-ENA1 is constitutive and cannot be overcome during salt treatment; (vi) osmotic stress-sensitive phenotypes of hog1 mutants can be rescued by additional deletion of SKO1; and (vii) sko1 mutants have increased basal ENA1 expression and are hyperresistant to Na⁺ and Li⁺ stress. Therefore, we propose a model of osmotic gene induction that implies the inactivation of a Sko1p-Ssn6p/Tup1p repressor complex by the activity of the Hog1p kinase. This scenario has an interesting parallelism to stress signalling in fission yeast and higher eukaryotes, where transcription factors of the bZIP family are phosphorylation targets of MAP kinase cascades (19, 49, 52, 60). In the specific case of S. pombe, a signal transduction pathway that is activated by a broader spectrum of adverse environmental conditions (osmotic, oxidative, heat, and UV stress) than in the case of the S. cerevisiae HOG pathway has been identified. It contains the Hog1p-homologous MAP kinase Sty1p (Spc1p) (20, 34, 47) that is activated by the MAP kinase kinase Wis1p (48, 58). As a final signalling target in S. pombe, the pleiotropic bZIP activator Atf1p has been identified (49, 51, 60). Activated Atf1p promotes the transcription from various target promoters, including those for stress response genes (gpd1⁺, fbp1⁺, and ctt1⁺) and genes required for sexual differentiation (ste11⁺), through binding to CRE motifs. Although the output of stress signalling in fission yeast was considered the primary Atf1p-mediated gene activation event, recent evidence suggests that transcriptional repression plays an important role in stress regulation of S. pombe (8).

Our genetic data strongly implicate the bZIP repressor Sko1p as a possible target of signalling through the HOG pathway of S. cerevisiae. Originally the SKO1 (ACR1) gene was identified as a multicopy suppressor of lethal PKA overexpression (37) and by the loss of repression mediated through ATF/CREB sites in a sko1 mutant (56). A contribution of Sko1p to the repression of SUC2 (encoding invertase) has been reported (37), although this effect was much weaker than that exhibited by Mig1p. Although a putative PKA target motif (KRRMS) within Sko1p has been described, the relationship of this transcriptional repressor to cAMP signalling has not been described. The in vitro binding of Sko1p homodimers to the canonical CRE (TGACGTCA) and related sequences has been shown (37, 56), but the physiological function of Sko1p remained undetermined. We have demonstrated that Sko1p mediates repression to the ENA1 gene that is counteracted upon osmotic shock by a mechanism dependent on Hog1p. Whether the Sko1p-CRE interaction also plays an important role in the regulation of other HOG-dependent genes should be investigated by identifying relevant CRE-like sequences in the various promoters. Although we demonstrate that Sko1p confers repression that is released by osmotic stress, a contribution of CRE-binding activators (56) to osmotic control cannot be excluded. We found no influence of signalling through PKA on the responsiveness of URS_CRE-ENA1 to osmotic shock. In a bcy1 null mutant with constitutive PKA activity, derepression upon salt shock remained unaffected although in general the expression levels were markedly decreased both in the CYC1-lacZ control and in the URS_CRE-ENA1-regulated reporter (data not shown). This points to a more general modulation through PKA on both basal and stress-induced expression, as has been described for regulation of the whole ENA1 promoter (28). However, the effect of a hog1 null mutation on the Sko1p- and Ssn6p-Tup1p-regulated CRE was dramatic, and further experimental approaches will be focused on the likely interaction of Sko1p with the corepressor complex and the mechanism of signal transduction from activated Hog1p MAP kinase to Sko1p. In addition to the data presented in this work, a connection between HOG signalling and transcriptional repression has been established by the finding that also ssn6 or tup1 null mutations can partially suppress the osmotic stress-sensitive phenotype of hog1 mutant cells (29), a result very similar to those presented in this work for the sko1 null mutation. Interestingly, the induction of the HOG-independent HAL1 gene (14) by severe osmotic stress also occurs through the release from Ssn6p-Tup1p repression (29). In this case, a protein complex formed on a negative HAL1 promoter element is abolished under stress conditions. Neither the DNA-binding protein nor the signal-transducing pathway operating in this case has been identified.

In addition to the negative mechanisms of regulation described in this work, ENA1 is also subjected to positive control. A third signal transduction pathway involving Ca²⁺/calmodulin-calcineurin contributes to the salt inducibility of the ENA1 gene (28, 33). Signalling through calcineurin is activated by high Na⁺ and Ca²⁺ concentrations and leads to the transcriptional activation of genes in addition to ENA1 such as PMC1 and PMR1, encoding Ca²⁺-ATPases (5), and FKS2, encoding a subunit of glucan synthase (10, 13). Very recently a calcineurin-dependent zinc-binding transcription factor, Crz1p (Tcn1p, Hal8p), that acts as an activator of transcription has been identified (31, 32, 50). The binding of Crz1p to a calcineurin-dependent UAS element in the FKS2 promoter has been described (50). crz1 mutants show decreased ENA1 expression and are hypersensitive to salt stress (32). Most likely, calcineurin signalling results in ENA1 transcriptional activation through the binding of Crz1p. The UAS element responsible for this calcineurin-dependent activation in the ENA1 upstream control region has not been identified. However, a promoter region (positions 752 to 853 in ENA1) that responds to high Ca²⁺ therefore could include a binding site for Crz1p has been described (1).

We have demonstrated that Sko1p-mediated repression explains the osmotic regulation of the ENA1 gene since under conditions that do not activate the calcineurin pathway (0.8 M KCl or 0.3 M NaCl), the sko1 null mutant cannot further increase ENA1 expression. By additionally stimulating calcineurin signalling (0.8 M NaCl), the ENA1 promoter is further activated independently of HOG- and Sko1p-mediated repression (Table 3). Taken together, these findings allow us to propose a model to explain how different environmental signals are integrated on the ENA1 gene: (i) glucose starvation activates the Snf1p protein kinase that subsequently inhibits Mig1/2p-Ssn6p-Tup1p-mediated repression on the URS_MIG-ENA1 element; (ii) the high Na⁺ or Ca²⁺ signal is triggered by the calcineurin phosphatase and subsequent activation of Crz1p (Tcn1p, Hal8p), which enhances transcription from a so far unidentified UAS_ENA1; (iii) osmotic induction through the HOG pathway operates by counteraction of Sko1p-Ssn6p-Tup1p-mediated repression on the URS_CRE-ENA1 element. The variety of regulatory events that influence transcription from the ENA1 promoter region render this gene a very productive and complex model of stress signalling.