Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 556-566, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Nuclease Activity of Mre11 Is Required for
Meiosis but Not for Mating Type Switching, End Joining, or
Telomere Maintenance
Sylvie
Moreau,
John R.
Ferguson, and
Lorraine S.
Symington*
Institute of Cancer Research and Department
of Microbiology, Columbia University College of Physicians and
Surgeons, New York, New York 10032
Received 25 August 1998/Returned for modification 21 September
1998/Accepted 29 September 1998
 |
ABSTRACT |
The Saccharomyces cerevisiae MRE11 gene is required for
the repair of ionizing radiation-induced DNA damage and for the
initiation of meiotic recombination. Sequence analysis has revealed
homology between Mre11 and SbcD, the catalytic subunit of an
Escherichia coli enzyme with endo- and exonuclease
activity, SbcCD. In this study, the purified Mre11 protein was found to
have single-stranded endonuclease activity. This activity was absent
from mutant proteins containing single amino acid substitutions in
either one of two sequence motifs that are shared by Mre11 and SbcD.
Mutants with allele mre11-D56N or mre11-H125N
were partially sensitive to ionizing radiation but lacked the other
mitotic phenotypes of poor vegetative growth, hyperrecombination,
defective nonhomologous end joining, and shortened telomeres that are
characteristic of the mre11 null mutant. Diploids
homozygous for the mre11-H125N mutation failed to sporulate
and accumulated unresected double-strand breaks (DSB) during meiosis.
We propose that in mitotic cells DSBs can be processed by other
nucleases that are partially redundant with Mre11, but these activities
are unable to process Spo11-bound DSBs in meiotic cells.
 |
INTRODUCTION |
DNA double-strand breaks (DSBs) are
potentially lethal lesions that occur spontaneously during normal
cellular processes, such as replication, or by treatment of cells with
DNA-damaging agents. DSBs are potent stimulators of recombination and
serve to initiate a variety of recombination events including meiotic recombination (9, 57), Saccharomyces cerevisiae
mating type switching (55), and rearrangement of the T-cell
receptor and immunoglobulin loci (48). Eukaryotic cells use
two pathways for the repair of DSBs, homologous recombination and
nonhomologous end joining (NHEJ). Repair of DSBs by homologous
recombination requires the presence of homologous duplex DNA elsewhere
in the genome and generally occurs with high fidelity. In contrast, the NHEJ pathway requires little, if any, sequence homology and is potentially mutagenic. Although yeast cells are capable of
repairing breaks by either pathway, homologous recombination is
favored. In birds and mammals, both pathways appear to contribute to
ionizing radiation resistance of somatic cells (5, 12, 17).
Analysis of the severe combined immunodeficiency (scid)
mouse has provided important clues about the mechanism of end joining. The scid mouse lacks mature T and B cells due to a defect in
joining coding ends created by RAG1 and RAG2 during V(D)J
recombination. The fact that cell lines derived from the
scid mouse show sensitivity to ionizing radiation implies
that the end-joining step of V(D)J recombination occurs by a general
cellular pathway for DSB repair (6). Analysis of other
X-ray-sensitive rodent cell lines identified three complementation
groups that were defective in V(D)J recombination. XRCC5
mutant cells lack the 86-kDa subunit of the heterodimeric DNA-binding
protein Ku, which is the regulatory subunit for the DNA-dependent
protein kinase DNA-PK (46, 60). Subsequent biochemical studies revealed a defect in the DNA-PK catalytic subunit in
scid and V3 cells (28, 30). The product of the
XRCC4 gene, which is also required for V(D)J recombination,
has recently been shown to interact with and stimulate the activity of
DNA ligase IV, suggesting a direct role in end joining (20,
31). Studies of illegitimate recombination and NHEJ in yeast have
shown the requirement for a large number of genes, including
RAD50, XRS2, MRE11, HDF1
(which encodes a protein with homology to Ku70), HDF2, SIR2, SIR3, SIR4, and DNL4
(34, 36, 50, 64, 65, 68). Of these genes, only
RAD50, MRE11, and XRS2 are required
for radiation resistance in yeast (1, 18, 23). Mutation of
the other genes involved in these pathways does not lead to radiation
sensitivity except in a rad52 background (54, 65,
68). Homologs of MRE11 and RAD50 have been
identified in mammals (15, 43), and protein localization
studies suggest that they play a direct role in the repair of DSBs
(32, 38). Furthermore, the human analog of XRS2,
NBS1, is mutated in Nijmegen breakage syndrome, a disease associated with radiation sensitivity, immunodeficiency, and
chromosomal instability (10, 66).
In yeast, the repair of DSBs by homologous recombination requires genes
of the RAD52 epistasis group (RAD50 to
57, RAD59, MRE11, and
XRS2), most of which were identified by their role in repair
of ionizing radiation-induced DNA damage (1, 3, 23, 42).
Initial steps in the repair process involve processing of DNA ends to
produce 3' single-stranded tails, the substrates for homologous pairing
and strand invasion (9, 58, 67). RAD51,
RAD52, RAD54, RAD55, and
RAD57 all appear to act during the homologous pairing stage
of the reaction after exonucleolytic processing (40, 53,
56). The identity of the nuclease (or nucleases) involved in this
processing step has remained elusive, but recent studies suggest Mre11
as a candidate for this activity. The MRE11 gene was
identified by its essential function in meiotic recombination and
subsequently shown to be required for ionizing radiation resistance
(1). mre11 null mutants have phenotypes identical
to those of rad50 and xrs2 mutants, including
poor mitotic growth, a delay in mating type switching, elevated rates
of spontaneous mitotic recombination between heteroalleles in diploids,
short telomeres, and a defect in the formation of meiosis-specific DSBs (2, 7, 23, 24, 26, 29, 63). Johzuka and Ogawa (26) have shown that Mre11 interacts with both Rad50 and
Xrs2, consistent with the similarity of the mutant phenotypes. Although a role in the formation of meiosis-specific DSBs seems incongruent with
a role in processing DSBs, nonnull alleles of both RAD50 and
MRE11 have been identified which separate these two meiotic functions (2, 37, 63). In rad50S cells,
meiosis-specific DSBs are formed, but Spo11 remains covalently attached
to 5' ends, preventing resection (9, 27). Further evidence
in support of the model that the Mre11-Rad50-Xrs2 complex functions in
DSB processing has come from physical analysis of mating type
switching. The DSB produced by the HO endonuclease is processed to
generate 3' single-stranded tails. This processing reaction occurs more slowly in rad50, xrs2, and mre11 null
mutants (24, 63).
Sequence alignments have revealed similarity between Mre11
and several prokaryotic nucleases, including E. coli
SbcD, T4 gp47, and T5 gpD12 (51). The regions of highest
homology include four sequence motifs, termed a phosphoesterase
signature, that are shared by a variety of phosphoesterases,
including serine/threonine protein phosphatases (51,
69). Although the SbcD protein alone exhibits single-stranded
endonuclease activity, in association with SbcC, the complex shows
ATP-dependent double-stranded exonuclease activity (13,
14). The SbcC protein is defined as a member of the
structural-maintenance-of-chromosomes (SMC) family, which includes
Rad50 (51). The human Mre11 (hMre11) protein alone and in
association with hRad50 has 3'-to-5' exonuclease and endonuclease activities, confirming the significance of the sequence homology with
SbcD (41).
A point mutation within one of the Mre11 phosphoesterase motifs was
reported to confer defective Mre11 nuclease activity. This mutation
conferred similar phenotypes in mitotic cells to the mre11
null mutation, and in meiosis, DSBs were formed but were not processed
(11, 63). In this study, we have generated mutations within
two of the other phosphoesterase motifs and characterized the resulting
mutants for nuclease activity by both in vivo and in vitro assays. Our
results demonstrate that the conserved phosphoesterase motifs are
essential for single-stranded DNA endonuclease activity. However, the
mitotic phenotypes conferred by these mutations are strikingly
different from those conferred by null mutations of MRE11.
We conclude that the endonuclease activity is essential for DSB
processing in meiosis, but not for end joining or telomere maintenance.
 |
MATERIALS AND METHODS |
Media, growth conditions, and genetic methods.
Rich medium,
synthetic complete (SC) medium lacking the appropriate amino acid or
nucleic acid base, and sporulation medium were prepared as described
previously (52). Raffinose (2%) was substituted for glucose
as a nonrepressing carbon source in SC medium that was used for
induction of HO or MRE11. Transcription from the
GAL1 promoter was induced by the addition of 1/10 volume of
20% galactose to the growth medium. Yeast cells were grown at 30°C
unless otherwise stated. Transformations were performed by the lithium
acetate method (22). Sporulation was carried out as
described previously (52). The percent sporulation was determined by microscopic analysis of cells scraped from the
sporulation plates and suspended in water. Percent sporulation values
are the averages of at least two independent cultures of each strain, and no fewer than 200 cells were counted per sample. For
SPO13 strains, cells with three or four visible spores were
considered sporulated; for spo13 strains, cells with two
visible spores were considered sporulated. Tetrad and dyad dissection
was carried out as described previously (52).
Yeast strains.
The strains used for this study were derived
from W303 or SK1 and are listed in Table
1. Strains LSY568, LSY569, LSY649, and
LSY650 were constructed by one-step replacement (49) of W303-1A, W303-1B, AMP464, and AMP268, respectively, with a PCR fragment
to generate a deletion-disruption allele of MRE11. PCR was
performed on a LEU2-containing template (pRS405) with the following primers:
5'-TTCGTAGTACTGACCATAATTATGTCATTCTCATCAATAcgactacgtcgtaaggcccg and
5'-GACTATGGACTATCCTGATCCAGACACAATAAGGATTTTActcgaggagaacttctagta. Uppercase letters indicate the bases in MRE11
sequences, and lowercase letters indicate the bases in LEU2
sequences. Leu+ transformants that showed sensitivity to
ionizing radiation were analyzed by PCR using primers complementary to
sequences within the LEU2 gene (5'-GGTGATGCTGTCGCCGAAG)
and the MRE11 3' noncoding region
(5'-TACTATGACGTTTATTCAGG) to verify disruption of
MRE11. The chromosomal mre11-H125N allele
was generated by a PCR-based allele replacement method (16).
The adaptamer primers for MRE11 were obtained from Research
Genetics and the plasmid pRS414:mre11-D56N,H125N used as a
template; the primers for URA3 were as described previously (16). The only yeast transformant that was obtained by this method contained a nontandem duplication of mre11-H125N and
mre11-D56N separated by the URA3 gene. The strain
containing the duplication marked by URA3 was used for
crosses. Subsequently, the URA3 gene and one copy of
mre11 were removed by intrachromosomal recombination selected on medium containing 5-fluoroorotic acid. Eighty-eight percent
of colonies that grew on medium containing 5-fluoroorotic acid had the
weak ionizing radiation sensitivity characteristic of the nuclease
defect. For two of these strains, LSY716A and LSY726A, the chromosomal
mre11 gene was PCR amplified, sequenced, and shown to
contain the mre11-H125N mutation. All other strains were
generated by crossing the appropriate haploid strains and dissecting
tetrads from the resulting diploids to obtain haploid segregants of the
required genotype.
Plasmids.
pRS414:MRE11 was generated by cloning a
3.1-kb BamHI/NruI fragment from plasmid pKJ1101
into the polylinker of pRS414. This plasmid was used for the
construction of MRE11 mutations with the Quick Change
Site-Directed Mutagenesis kit from Stratagene. The oligonucleotides
5'-TTGTACAGTCCGGTAATCTTTTTCACGTGAA and
5'-TTCACGTGAAAAAGATTACCGGACTGTACAA were used to generate the
D56N mutation, and 5' GCATATCAGGTAATAATGATGATGCGTCGGG and
5'CCCGACGCATCATCATT ATTACCTGATATGC were used to generate
the H125N mutation. Two rounds of site-directed mutagenesis were
performed to create plasmid pRS414:mre11-D56N,H125N.
The
MRE11 open reading frame (ORF) was amplified by PCR from
pRS414:
MRE11 using two primers, one containing a
BamHI site,
a FLAG peptide-encoding sequence, and the
beginning of the
MRE11 ORF
(5'-AGCTAGGATCCGACTACAAGGATGACGATGACAAGCATGGACTATCCTGATCCAGACA)
and the second containing the 3' end of the
MRE11 ORF
and a
HindIII
site
(5'-GTAGCTAAGCTTTCGCGAAGGCAAGCCCTTGG). The resulting PCR
fragment was digested with
BamHI and
HindIII
and cloned into the
expression vector pEGKT, a yeast glutathione
S-transferase (GST)
fusion vector (
35).
GST-
mre11-D56N was constructed in a similar
fashion except
that pRS414:
mre11-D56N was used as a template for
the PCR.
GST-
mre11H-125N was made by site-directed mutagenesis
of
GST-
MRE11 using the primers described above for generation
of the
mre11-H125N allele.
pBM272-HO was constructed by insertion of a 2.5-kb
HindIII fragment containing the
HO gene into
the
HindIII site of pBM272
(
25), adjacent to
the
GAL1 promoter.
-Irradiation survival assays.
Cells were grown in liquid
medium to mid-log phase. The cultures were serially diluted (five
10-fold serial dilutions), and aliquots of each dilution were plated on
solid medium. The plates were irradiated in a Gammacell-220 containing
60Co (Atomic Energy of Canada) for the designated dose. The
dose rate of the Gammacell-220 was 79 rads/s. The plates were incubated for 3 days before survivors were counted. Each strain was assayed three
separate times, and the mean survival for each dose is presented in
Fig. 3.
Physical analysis of mating type switching.
Strains to be
tested were transformed to Ura+ with plasmid pBM272-HO.
Ura+ plasmid-containing transformants were grown in 5 ml of
SC medium lacking uracil (SC-Ura) for 24 h. Cells were harvested,
washed with water and used to inoculate 250 ml of SC medium with
raffinose and without uracil [SC(raffinose)-Ura]. Cultures were grown
to an optical density at 600 nm of 0.4 to 0.5 and 27.5 ml of 20% galactose were added. One hour after addition of galactose, the cultures were harvested and resuspended in 250 ml of SC(glucose)-Ura. Samples (50 ml) were removed prior to HO induction and at 1-h intervals
after induction for DNA analysis. Cells were harvested by
centrifugation and washed with water, and the cell pellets were frozen
in liquid nitrogen. DNA was extracted, digested with BamHI
and StyI, and DNA fragments were separated by
electrophoresis through 1% alkaline agarose gels. DNA fragments were
transferred to nylon membranes and hybridized with a 300-bp PCR
fragment generated by amplification of MAT sequences distal
to the HO-cut site. The cultures were maintained in SC medium even
after HO induction, because the growth rate difference between
MRE11 and mre11 strains was less than in rich medium.
Mitotic recombination assay.
Diploid LSY660 was transformed
to Trp+ using plasmid pRS414, pRS414:MRE11, or
pRS414:mre11-H125N. At least 13 independent Trp+
transformants were grown to mid-log phase in SC-Trp medium and then
serially diluted with water. Aliquots from the appropriate dilutions
were plated on SC-Trp medium to determine the number of cells and on
SC-His medium to determine the number of His+ prototrophs.
The recombination frequency was derived from the number of
His+ prototrophs/total number of cells, and the median
value is given.
Plasmid end joining.
Precise end joining was assayed as
described previously (8, 34). In brief, plasmid pRS413 was
digested with EcoRI and 200 ng of linear or uncut DNA was
used to transform each strain. The ratio of His+
transformants obtained with cut or uncut DNA was determined for each
strain. The assay was repeated two more times, and the average value
for each strain is presented in Fig. 5.
Analysis of telomere lengths.
Genomic DNA was isolated from
5-ml saturated cultures and digested with XhoI. The products
were examined by Southern analysis with pYT14 as a hybridization probe
(44). Wild-type strains yield a terminal restriction
fragment of ~1.3 kb which includes ~400 bp of the
G1-3T telomeric repeat (44).
DSB detection during meiosis.
Diploids were induced to
undergo meiosis as previously described (9). Samples (20 ml)
were removed at 2-h intervals from 0 to 8 h after induction of
meiosis, mixed with 20 ml of 100% ethanol, and stored at
20°C. DNA
was extracted as previously described (9) except that only
one phenol-chloroform extraction was performed, followed by extraction
with chloroform, and the Sephadex G-50 column purification step was
omitted. Twenty-four percent of the total DNA was digested with
EcoRI and run on a 0.7% agarose gel. DNA fragments were
transferred to Hybond-N membranes for hybridization. The
THR4 DNA fragment used for the hybridization probe was
generated by PCR using primers 5'-CTAACGCTTCCCAAGTTTAC, corresponding to nucleotides 5 to 24 of the THR4 ORF,
and 5'-TTGTCACCAGTGACGTTTTG, corresponding to nucleotides
320 to 301 of the THR4 ORF.
Purification of GST-Mre11.
The GST fusion plasmids were
transformed into strain YDS371. One-liter cultures were grown in
SC(raffinose)-Ura medium to an optical density at 600 nm of 0.4. Galactose was added to a final concentration of 2%, and growth
continued for 12 h. Cells were harvested, washed with water, and
resuspended in a volume equal to the wet weight of cells in lysis
buffer (20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 1 mM EDTA, 10%
glycerol, 0.5 mM phenylmethylsulfonyl fluoride). An equal volume of
glass beads was added, and cells were lysed by vortexing (five 1-min
pulses). The lysate was clarified by centrifugation for 1 h at
100,000 × g. The soluble fraction was mixed with 1 ml
of glutathione Sepharose 4B (Pharmacia) that had been equilibrated with
lysis buffer and gently mixed for 10 min. The beads were collected by
centrifugation and washed three times with lysis buffer. The GST fusion
protein was recovered from the beads by elution with 10 mM glutathione
in 50 mM Tris-HCl, pH 8.0.
Nuclease assays.
Three hundred nanograms of
X174 viral
DNA or 200 ng of pUC19 DNA was incubated for 1 h at 30°C in a
30-µl reaction mixture volume containing 25 mM Tris-HCl [pH 8.0],
0.1 mM dithiothreitol, 2.5 mM MnCl2 or MgCl2,
and 100 µg of bovine serum albumin per ml with 1 µg of GST-Mre11 or
mutant protein GST-mre11-D56N or GST-mre11-H125N. The reactions were
terminated by the addition of EDTA to 5 mM and proteinase K to a final
concentration of 50 mg/ml and incubated for 10 min at 37°C. The
reaction products were analyzed by agarose gel electrophoresis.
Although 1 µg of GST-Mre11 (or mutant proteins) was used for the
experiment shown in Fig. 2, nuclease activity was still detected using
100 ng of GST-Mre11. Excess protein was used to ensure that the mutants were devoid of a weak nuclease activity.
 |
RESULTS |
The phosphoesterase motifs of Mre11 are required for nuclease
activity.
The sequence homology between Mre11 and SbcD suggests
that Mre11 is a nuclease (Fig. 1). To
test this hypothesis, the Mre11 protein was purified as a GST fusion
and then tested for activity on a variety of DNA substrates. The fusion
protein included a FLAG epitope tag inserted immediately before the
first codon of Mre11 and was expressed from the galactose-inducible
GAL1 promoter in yeast. The fusion protein was shown to
complement the ionizing radiation sensitivity of an mre11
null mutant, even under noninducing conditions, indicating that the GST
moiety does not interfere with Mre11 function. The fusion protein was
purified from crude cell extracts by affinity chromatography using a
glutathione Sepharose matrix (Fig. 2A).
The glutathione eluate contained one major species of approximately 120 kDa that cross-reacted with anti-FLAG antibodies (data not shown). Most
of the lower-molecular-mass species observed in the glutathione eluate
also cross-reacted with the antibody, suggesting that these were likely
to correspond to proteolytic breakdown products. The glutathione eluate
was used directly for nuclease assays. Nuclease activity was observed
only for
X174 single-stranded DNA (Fig. 2B). No activity was
apparent with duplex linear or circular substrates in the presence or
absence of ATP. However, using a 5'-end-labeled 39-bp linear duplex
substrate, a weak 3'-to-5' exonuclease activity was detected (data not
shown). The exonuclease activity observed was comparable to the weak
activity identified for hMre11 in the absence of hRad50
(41). The nuclease activity was optimal with
Mn2+ as a cofactor, and no activity was observed with
Mg2+. To ensure that the activity observed was due to Mre11
rather than a contaminating protein, two mutant proteins were also
purified and shown to lack the single-stranded DNA endonuclease
activity. The mutants used contained point mutations at D56 in
phosphoesterase motif II and H125 in phosphoesterase motif III (Fig. 1)
and were purified by the same procedure used for the wild-type protein (Fig. 2; only mre11-D56N is shown). The failure to detect nuclease activity by either of these proteins confirmed that the activity was
due to Mre11 and that motifs II and III are important for activity.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of eukaryotic Mre11 sequences with prokaryotic
SbcD sequences. The aligned sequences are divided into blocks
corresponding to the mostly highly conserved motifs (motifs I to IV).
Sequences of S. cerevisiae (Sc) Mre11,
Schizosaccharomyces pombe (Sp) Rad32 (Mre11), Homo
sapiens (Hs) Mre11, Mus musculus (Mm) Mre11,
Caenorhabditis elegans (Ce) Mre11, Bacillus
subtilis (Bs) SbcD, and E. coli (Ec) SbcD are shown.
The arrows indicate the locations of the point mutations D56N and
H125N. Gaps introduced to optimize alignment are indicated by dashes.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Mre11 has a single-stranded DNA endonuclease activity.
(A) GST-Mre11 was purified from yeast by affinity chromatography of
crude extracts on glutathione Sepharose. Lane M, molecular mass markers
(in kilodaltons); lanes 1 and 5, uninduced soluble fraction; lanes 2 and 6, induced soluble fraction; lanes 3 and 7, unbound fraction from
glutathione Sepharose; lanes 4 and 8, bound fraction from glutathione
Sepharose eluted with 10 mM glutathione. (B) Endonuclease activity of
Mre11. Lane M, DNA digested with HindIII, lane 1, X174 viral DNA; lane 2, X174 viral DNA with Mre11 and
Mn2+; lane 3, pUC19 circular DNA with Mre11 and
Mn2+; lane 4, pUC19 linear DNA with Mre11 and
Mn2+; lane 5, X174 viral DNA with Mre11 and
Mg2+, X174 viral DNA with mre11-D56N and
Mn2+. The migration positions of molecular size markers (in
kilobases) are given to the left.
|
|
DSB processing is impaired in the mre11-D56N and
mre11-H125N mutants.
To determine the role of the
Mre11 nuclease activity in vivo, the two point mutations described
above were generated within the MRE11 gene carried on a
single-copy-number yeast plasmid. These plasmids were then used to
transform an mre11 deletion strain to test for
complementation of the mre11 phenotypes. Yeast transformants containing either mutant allele showed mitotic growth rates equivalent to those observed by transformants containing the wild-type
MRE11 gene. In contrast, the doubling time of the
mre11 null mutant was increased by 50%. Although the
mre11 null mutant showed extreme sensitivity to ionizing
radiation, mre11-D56N and mre11-H125N mutations
conferred only partial sensitivity (Fig.
3A). At 50 kilorads, a dose sufficient
for greater than 105-fold killing of the null mutant, the
point mutant strains showed only a 10-fold reduction in survival
compared to the wild type. If each mutation had resulted in partial
retention of nuclease activity, which was not detected by the
biochemical assay, then we predicted that overexpression of the mutant
proteins might completely restore resistance to
-rays. However,
high-copy-number plasmids containing the mre11 point
mutations complemented the null mutant to the same level as observed
with the single-copy-number plasmids (data not shown). We also
constructed a double mutant containing the D56N and H125N alleles, and
this mutant showed the same survival as each of the single mutants
(Fig. 3A). These results are consistent with the hypothesis that
residues Asp 56 and His 125 form part of the catalytic site for
nuclease activity and mutation of either residue destroys the same
function of the protein. The mre11-H125N allele was
substituted for the wild-type chromosomal allele of MRE11,
and the sensitivity of the resulting strain was identical to that of
the strains containing plasmid-borne alleles (Fig. 3B). Strains
containing the chromosomal mre11-H125N allele were used for
all of the experiments described below, except for determination of
spontaneous mitotic recombination frequencies (see Materials and
Methods).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Radiation sensitivity of mre11 strains. (A)
Complementation of ionizing radiation sensitivity of mre11
strains (LSY568) by plasmids expressing wild-type or mutant alleles of
MRE11. Symbols: , wild-type or mre11 strain
with pRS414:MRE11; , mre11 ; ,
mre11 strain with pRS414:mre11-D56N or
pRS414:mre11-H125N or pRS414:mre11-D56N,H125N.
(B) Ionizing radiation sensitivity of haploid and diploid strains.
Strains containing chromosomal mre11 alleles were used for
this experiment. MRE11 (W303-1A) and MRE11/MRE11
(W303) ( ), mre11 (LSY568) ( ),
mre11 /mre11 (LSY730) ( ), mre11-H125N
(LSY716A) ( ), and mre11-H125N/mre11-H125N (LSY729)
( )
strains were used.
|
|
Diploids homozygous for the
mre11,
rad50, or
xrs2 mutation show increased radiation resistance compared
with haploids, a phenomenon
known as diploid-specific repair. This is
thought to reflect a
role for these genes in sister chromatid repair,
whereas in diploid
cells lesions can be repaired, albeit inefficiently,
from a homolog.
Diploids containing the
mre11-H125N allele
were found to be more

-ray sensitive than haploids (Fig.
3B). One
interpretation of
this result is that the Mre11-Rad50-Xrs2 complex is
still present
and lesions are not diverted to the homolog for repair.
If lesions
are not diverted to the homolog for recombinational repair
in
the
mre11-H125N strain, then we would expect to eliminate
the
hyperrecombination phenotype that is observed for
mre11
diploids.
The frequency of His
+
prototroph formation was determined for diploid strains heteroallelic
at the
his4 locus. The
mre11-H125N strain showed
the same frequency
of prototrophs as the wild-type strain did (5.0 × 10
6 and 4.5 × 10
6, respectively).
Consistent with previous observations, the
mre11
strain exhibited a hyperrecombination phenotype for heteroallelic
recombination (1.0 × 10
4 His
+ prototroph).
To determine whether the mutants were defective in the repair of a
single well-defined DSB, a mating type switching assay
was performed.
The repair of an HO endonuclease-induced DSB was
monitored at the DNA
level after induction of HO endonuclease
for 1 h. To measure
resection of the 5' end at the
MAT locus,
as well as the
formation of switched products, the samples were
digested with
StyI and
BamHI and separated on alkaline agarose
gels. Because single-stranded DNA is resistant to digestion by
restriction endonucleases and the 3' end remains intact, the amount
of
DNA resected can be monitored by the appearance of
high-molecular-weight
StyI/
BamHI fragments
(
67). The appearance of a 1.8-kb
StyI fragment
is
indicative of repair of the DSB from the
HML
locus. The
wild-type
and
mre11-H125N strains showed identical kinetics
of repair and
equivalent amounts of single-stranded DNA intermediates,
indicating
no obvious defect in resection of the 5' end at the
MAT locus
(Fig.
4). In
contrast, in the
mre11 null mutant, the cut product
was
still visible 5 h after induction of HO. Repaired products
were
formed, but their appearance was delayed compared to that
for the wild
type. This result is similar to that observed previously
for
mre11 null mutants (
63). Unlike the
mre11-H125N strain,
single-stranded DNA intermediates were
barely detectable in the
mre11
strain.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Kinetics of mating type switching. A schematic
representation of the MATa and MAT loci
indicating the locations of BamHI and StyI sites
and the hybridization probe is shown at the top of the figure. HO
endonuclease produces a 0.7-kb fragment from the 0.9-kb
MATa StyI fragment. A 1.8-kb
StyI fragment is produced when the mating type switches from
MATa to MAT . Extensive 5'-to-3' degradation
from the HO-cut site through the distal BamHI and
StyI sites leads to the appearance of high-molecular-weight
BamHI/StyI fragments. Double digestions with
StyI and BamHI were performed because the
StyI site at position 5450 (67) is absent in W303
strains. DNA was isolated from cultures prior to galactose induction
(0-h time point) and at 1-h intervals after HO induction. The arrows to
the left of the gel indicate the high-molecular-weight fragments
generated by nuclease digestion from the HO-cut site. ssDNA,
single-stranded DNA.
|
|
Synthetic lethality of mre11 rad27 double mutants.
The RAD27 gene encodes a nuclease that functions to process
Okazaki fragments during lagging strand DNA synthesis (61). Strains containing a deletion of RAD27 are viable, but
viability is dependent on homologous recombination (59). To
determine whether the Mre11 nuclease activity is essential for
processing lesions generated in a rad27 mutant, diploids
heterozygous for RAD27 and MRE11 were generated,
and following sporulation, tetrads were dissected to obtain haploid
progeny. The high spore inviability observed for crosses involving
either mre11
or mre11-H125N suggested that the
double mutant combination with rad27 was inviable (Fig. 5). This was confirmed by replica plating
dissection plates to selective media to score for the presence of
markers diagnostic for each mutation. None of the viable spores
contained both the rad27 and mre11 mutations.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Synthetic lethality of rad27 mre11 double
mutants. Viability and genotype of spores derived from a
RAD27/rad27 mre11 /MRE11 diploid (A) or a
RAD27/rad27 mre11-H125N/MRE11 diploid (B). In each case, + indicates the wild-type locus, indicates a mutant locus, and 0 indicates a dead spore.
|
|
End joining and telomere maintenance are normal in the
mre11-H125N strain.
Since MRE11 is required
for both homologous and NHEJ pathways, it seemed possible that some of
the residual repair of ionizing radiation-induced DNA damage observed
in the mre11-H125N strain was due to the NHEJ pathway. To
determine the effect of loss of nuclease function on NHEJ, a plasmid
rejoining assay was used. In this assay, the efficiency of NHEJ is
determined by the percent transformants obtained with a cut plasmid
relative to an uncut control plasmid. The plasmid utilized contained
CEN and ARS elements for stable maintenance in
yeast and the HIS3 selectable marker. The plasmid
was digested with EcoRI, which cuts within a region of the
plasmid with no homology to the yeast genome to avoid repair events by
homologous recombination. The proportion of transformants recovered
with cut plasmid relative to uncut plasmid in wild-type and
mre11-H125N strains was equivalent, indicating proficient end joining (Fig. 6). In contrast,
the hdf1 (Ku70-deficient) and mre11
mutants
showed a 30-fold reduction in the recovery of transformants using
the cut plasmid relative to the uncut control plasmid. The hdf1
mre11
and hdf1 mre11-H125N double mutants showed the
same low level of end joining, indicating that these genes are in the same pathway for NHEJ.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
The Mre11 nuclease activity is not required for end
joining. End-joining assays were as described in Materials and
Methods.
|
|
rad50,
mre11, and
xrs2 mutants have
shortened telomeres and a senescence phenotype, indicating a defect in
telomere maintenance
(
7,
29). The length of telomeric DNA
fragments from
mre11 mutants was examined to determine
whether the nuclease activity
of Mre11 is required for telomere
maintenance. Wild-type and
mre11-H125N strains had telomeres
of similar length, whereas the telomeres
of
mre11
and
hdf1 strains were shorter (Fig.
7). The length of
the telomeres from a
hdf1 mre11
double mutant was similar to
those of the two
single mutants, but the intensity of the telomere
signal was less than
the Y' signal, suggesting a more severe telomere
defect in the double
mutant.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 7.
The Mre11 nuclease activity is not required for telomere
maintenance. Genomic DNA isolated from each of the indicated strains
was digested with XhoI to liberate a terminal fragment of
~1.3 kb. The positions of the Y' and telomere fragments are indicated
to the right of the autoradiogram.
|
|
The Mre11 nuclease is required for meiosis.
Diploids
homozygous for the chromosomal mre11-H125N or
mre11
alleles failed to sporulate in the W303 background
(Table 2). To determine the step in
meiosis at which the block occurred, an epistasis analysis was
performed using spo13 and mei4 mutations in
combination with the chromosomal mre11-H125N allele. The
spo13 mutation allows cells to bypass meiosis I and rescues
the spore inviability of mutants that are blocked prior to DSB
formation. However, mutants that are defective in the repair of DSBs
are not rescued by spo13. The sporulation defect of the
mre11
diploid was rescued by spo13, but the
spo13 mre11-H125N homozygous diploid failed to sporulate.
The latter phenotype is similar to that observed for the
mre11S and rad50S mutations, suggesting that
meiosis-specific DSBs are formed but are not repaired in the
mre11-H125N strain. Because a mei4 mutation
prevents the formation of meiosis-specific DSBs, it was expected to
rescue the sporulation defect of the spo13 mre11-H125N
strain. The triple mutant showed normal levels of dyads, of which 98%
were viable. This analysis suggested that the nuclease activity of
Mre11 is essential for processing meiosis-specific DSBs. To test this,
DSB formation was monitored at the THR4 locus in W303
derivatives (Fig. 8). In both
rad50S and mre11-H125N strains, a discrete band
of 5.6 kb, corresponding to the location of the THR4 hot
spot, was initially detected at 4 h and persisted through 8 h. In wild-type cells, DSBs are processed to produce 3' single-stranded tails that are characterized by a smear rather than a discrete band.
DSB fragments were not detected in the wild type because the strain
background used, W303, does not have the highly synchronous meiosis
required to detect DSB intermediates during meiosis. The detection of
DSB fragments in the mre11-H125N strain is further evidence
supporting the hypothesis that DSBs are not processed in the absence of
the Mre11 nuclease.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 8.
Meiosis-specific DSBs at the THR4 locus. The
physical map of the THR4 region of chromosome III
indicating the EcoRI sites, location of the probe, and
approximate site of the DSB is shown at the top of the figure. A time
course (in hours) of meiosis of wild-type, rad50S, and
mre11-H125N strains is shown at the bottom. DNA samples from
each time point were digested with EcoRI. The positions of
the parental and DSB fragments are indicated to the right of the
autoradiogram, and the migration positions of molecular size markers
(in kilobases) are given to the left.
|
|
 |
DISCUSSION |
The phosphoesterase motifs present in Mre11 are important for
nuclease activity.
Mre11 contains sequence motifs that are shared
by a variety of phosphoesterases, including serine/threonine protein
phosphatases and nucleases (51, 69). The importance of these
sequence motifs in protein phosphatases has been established by
mutational and structural studies (19, 21, 69). To evaluate
the role of these motifs in Mre11 function, conservative amino acid
substitutions were generated within motifs II and III. The sites
mutated, D56 and H125, correspond to residues of lambda phosphatase
that are essential for catalysis (69). Furthermore, the
crystal structure of mammalian protein phosphatase 1 identified the
equivalent residues as part of the catalytic site (19). The
aspartic acid residue of protein phosphatase 1 equivalent to D56 is
directly involved in coordination of the two manganese ions at the
catalytic site and is therefore predicted to play an essential role in
catalysis. The mre11-D56N and mre11-H125N mutant proteins lack the
single-stranded endonuclease associated with the wild-type Mre11
protein, consistent with the predicted role of these residues in
catalysis (Fig. 2).
Role of the Mre11 nuclease in processing DSBs.
The
Mre11-Rad50-Xrs2 complex has been suggested to function in processing
DSBs based on two lines of evidence. First, yeast strains containing a
null allele of rad50 or xrs2 show a delay in
mating type switching and the extent of exonucleolytic processing of 5'
ends is reduced. Second, diploid strains containing rad50S, mre11S, or mre11-58 alleles accumulate
unprocessed DSBs during meiosis. In this study, we show that
nuclease-defective alleles of MRE11 confer weak sensitivity
to ionizing radiation and no delay in mating type switching. Therefore,
the delay in mating type switching observed in mre11
mutants does not appear to be due to loss of the Mre11 endonuclease
activity. These data suggest that either the Mre11 nuclease does not
process DSBs in mitotic cells or that other nucleases can efficiently
process breaks in the absence of the Mre11 nuclease. The
mre11-58 mutation is a His-to-Tyr substitution of a
conserved histidine residue (H213) within one of the phosphodiesterase
motifs of MRE11 (63). The mre11-58 protein has
been shown to lack the nuclease activities associated with the
wild-type Mre11 protein and also fails to interact with Rad50
(40a). Thus, the more severe mitotic phenotype of the
mre11-58 strain compared with that of the
mre11-H125N strain may be due to disruption of the
Mre11-Rad50-Xrs2 complex in addition to the defect in the nuclease
function of Mre11. The only mitotic phenotype shared by
mre11
and mre11-H125N strains is lethality in
combination with rad27. This result suggests that the Mre11 nuclease is required to process lesions generated in a rad27
strain. The failure of redundant nucleases to efficiently process these lesions may be because the level of damage is too high or because the
nature of the lesions prevents the activity of other nucleases. For
example, some of the lesions may be flap structures that can be
processed only by an endonuclease. During meiosis, unprocessed DSBs
accumulated in both the mre11-H125N and rad50S
diploid strains. This result, in combination with the spo13
epistasis analysis, indicates that the Mre11 nuclease activity is
required for DSB processing in meiosis. Meiosis-specific DSBs differ
from breaks produced by HO endonuclease by the covalent attachment of a
protein, Spo11, to the 5' ends. Our results suggest that the Mre11
nuclease is essential when 5' ends are blocked, either by the
attachment of a protein, an unusual structure, or possibly base damage
induced by ionizing radiation (Fig. 9).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 9.
Models for Mre11 function. In meiotic cells, the 5' ends
at DSB sites remain bound by the Spo11 protein, preventing access of
exonucleases. The Mre11-Rad50-Xrs2 complex binds to break sites and
unwinds the ends to reveal single-stranded DNA for cleavage by Mre11.
This cleavage removes Spo11 and the 5' strand, resulting in the
formation of a 3' single-stranded tail. When DSBs are produced by
ionizing radiation or by the HO endonuclease, the 5' ends are generally
free and accessible to other nucleases in addition to the
Mre11-Rad50-Xrs2 complex.
|
|
The
E. coli SbcD protein has a single-stranded endonuclease
activity but in the presence of SbcC functions as an ATP-dependent
exonuclease (
13,
14). The SbcC protein contains conserved
nucleotide binding motifs and two coiled-coil domains that are
characteristic of the SMC family of proteins. Rad50, which is
known to
associate with Mre11, is also a member of the SMC family.
The Walker A
nucleotide binding site is essential for Rad50 function,
and the
purified protein shows ATP-dependent DNA binding (
2,
47).
These findings suggest that the Rad50-Mre11 complex may
also be an
ATP-dependent exonuclease. Alternatively, Rad50 or
some other factor
might unwind duplex ends to provide a single-stranded
region for the
Mre11 endonucleolytic activity (Fig.
9).
Biochemical analysis of the SbcCD complex has shown that the polarity
of exonuclease degradation is 3' to 5' (
29a). Similarly,
the
hMre11 protein alone, or in association with hRad50 and p95,
has
3'-to-5' exonuclease and single-stranded endonuclease activities
(
41,
62). However, in yeast, DSBs are processed to generate
3' single-stranded tails, a reaction thought to require the activity
of
a 5'-to-3' nuclease. The function of the 3'-to-5' activity
of Mre11 is
currently unclear. It has been suggested that the
hMre11 nuclease
functions with DNA ligase I in the imprecise end-joining
pathway
(
41). This pathway for the repair of extrachromosomal
DSBs
has been well characterized in mammalian cells, and the types
of
junctions generated are similar to those produced by hMre11
and ligase
I in
vitro.
Role of Mre11 in vegetative cells.
Strains containing the
mre11-D56N or mre11-H125N mutation have quite
different phenotypes in vegetative cells compared to strains containing
an mre11 null mutation. The mre11 null mutation confers poor vegetative growth, hypersensitivity to ionizing radiation, increased rates of heteroallelic recombination, a defect in
illegitimate recombination, and short telomeres. In contrast, the
mre11-H125N strain has only weak sensitivity to ionizing
radiation and is not defective in the other processes listed above.
Based on the phenotypic differences between mre11 null and
mre11-H125N strains, we suggest that the Mre11-Rad50-Xrs2
complex has important functions in mitotic cells other than nucleolytic
processing of DSBs. The requirement for this complex in maintenance of
telomeres and NHEJ suggests that it interacts with DNA ends directly or
in association with the Ku heterodimer. Recent studies have shown that
although the efficiency of precise end joining is decreased to a
similar level by mutation of HDF1, HDF2,
RAD50, MRE11, or XRS2, there are
qualitative differences (7). Repaired products recovered from hdf1 or hdf2 strains contain large
deletions, whereas products obtained from rad50,
mre11, and xrs2 strains are usually precise. These observations imply that Ku protects ends from nuclease
degradation while end joining takes place. Since end-joined products
obtained from the mre11 hdf1 double mutant are
indistinguishable from those obtained from hdf1 strains, it
seems unlikely that the Mre11 nuclease is responsible for the
degradation that occurs in hdf1 strains. Moore and Haber
(36) examined the repair of HO-induced DSBs generated at the
MAT
locus in the absence of homologous recombination. In
this system, precise end-joining events create substrates for further
cleavage by HO and aberrant end-joining events are selected as
survivors. Most of the survivors from wild-type strains expressing HO
through the cell cycle had small (2-bp) insertions at the HO-cut site.
In rad50, xrs2, and mre11 strains, the
efficiency of repair was reduced almost 100-fold and most of the events
were deletions of 3 bp, but some larger deletions (>700 bp) were also
detected. These results are consistent with the view that the nuclease
activity of Mre11 does not play a significant role in end joining.
Instead, the function of the Mre11-Rad50-Xrs2 complex may be to bring
together broken ends and/or to recruit other factors involved in joining.
The Mre11-Rad50-Xrs2 complex is proposed to function in telomere
maintenance by facilitating telomere replication. It has
been suggested
that the nuclease activity of the Mre11 complex
may be important to
generate a single-stranded DNA substrate for
telomerase
(
39). However, our demonstration of normal length
telomeres
in the
mre11-H125N strain suggests additional functions
for
the complex at
telomeres.
Meiotic functions of the Mre11-Rad50-Xrs2 complex.
The
Mre11-Rad50-Xrs2 complex has at least two functions in meiotic cells.
First, it is required for the formation of meiosis-specific DSBs. There
are at least seven other genes required for DSB formation in meiotic
cells, but of these genes, only SPO11 has been shown to be
directly involved (27). Spo11 catalyzes DSB formation by a
transesterification mechanism that results in covalent attachment of
the protein to 5' ends through a tyrosine residue (4, 27). How Spo11 is targeted to sites at which DSBs occur is currently unknown. In rad50S mutants, Spo11 remains covalently bound
to the 5' ends at DSB sites, preventing resection (2, 27).
Because unprocessed DSBs, indistinguishable from those generated in
rad50S strains, accumulate in mre11S,
mre11-58, mre11-H125N, and
com1/sae2
mutants, it is assumed that Spo11 remains bound
to break sites in these mutants as well (33, 37, 45, 63).
This suggests that the second function of Mre11 and Rad50 is in a step
subsequent to DSB formation. The removal of Spo11 from 5' ends could
occur by a direct reversal of the esterification reaction or by
endonucleolytic removal of Spo11 attached to single-stranded DNA
(27). The observations that Mre11 has a single-stranded DNA
endonuclease activity and that nuclease-defective alleles of
mre11 result in retention of Spo11 on 5' ends are consistent
with the hypothesis that Mre11 is directly involved in removal of Spo11
from DSB sites. By this endonucleolytic mode, the 5' ends could be
resected a variable distance from the DSB site. Continued resection of
5' ends could occur by the action of the Mre11-Rad50-Xrs2 complex or by
a different nuclease (Fig. 9).
In summary, Mre11 is an endonuclease and the sequence motifs
characteristic of this class of proteins are important for nuclease
activity. The nuclease activity of Mre11 plays an essential role
in
meiosis, probably in the removal of Spo11 protein from 5' ends
of DSB
sites. However, in mitotic cells, the nuclease activity
is dispensable
for normal vegetative growth, mating type switching,
NHEJ, and telomere
maintenance. We propose that in mitotic cells,
DSBs can be processed by
other nucleases that are partially redundant
with Mre11, but these
activities are unable to process Spo11-bound
DSBs in meiotic
cells.
 |
ACKNOWLEDGMENTS |
We thank members of the Symington laboratory and W. Holloman for
critical reading of the manuscript. We thank H. Tsubouchi and H. Ogawa
for providing plasmid pKJ1101, H. Smith for construction of pBM272-HO,
and H. Klein, A. Mitchell, A. Rattray, R. Rothstein, and D. Shore for
providing yeast strains.
This work was supported by Public Health Service grants GM41784 and 2 T32 CA09503 from the National Institutes for Health and the National
Cancer Institute, respectively.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Cancer Research and Department of Microbiology, Columbia University
College of Physicians and Surgeons, 701 W. 168th St., New York, NY
10032. Phone: (212) 305-4793. Fax: (212) 305-1741. E-mail:
lss5{at}columbia.edu.
 |
REFERENCES |
| 1.
|
Ajimura, M.,
S.-H. Leem, and H. Ogawa.
1993.
Identification of new genes required for meiotic recombination in Saccharomyces cerevisiae.
Genetics
133:51-66[Abstract].
|
| 2.
|
Alani, E.,
R. Padmore, and N. Kleckner.
1990.
Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination.
Cell
61:419-436[Medline].
|
| 3.
|
Bai, Y., and L. S. Symington.
1996.
A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.
Genes Dev.
10:2025-2037[Abstract/Free Full Text].
|
| 4.
|
Bergerat, A.,
B. de Massy,
D. Gadelle,
P.-C. Varoutas,
A. Nicolas, and P. Forterre.
1997.
An atypical topoisomerase II from archae with implications for meiotic recombination.
Nature
386:414-417[Medline].
|
| 5.
|
Bezzubova, O.,
A. Silbergleit,
Y. Yamaguchi-Iwai,
S. Takeda, and J.-M. Buerstedde.
1997.
Reduced X-ray resistance and homologous recombination frequencies in a RAD54 / mutant of the chicken DT40 cell line.
Cell
89:185-193[Medline].
|
| 6.
|
Blunt, T.,
N. J. Finnie,
G. E. Taccioli,
G. C. M. Smith,
J. Demengeot,
T. M. Gottlieb,
R. Mizuta,
A. J. Varghese,
F. W. Alt,
P. A. Jeggo, and S. P. Jackson.
1995.
Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation.
Cell
80:813-823[Medline].
|
| 7.
|
Boulton, S. J., and S. P. Jackson.
1998.
Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing.
EMBO J.
17:1819-1828[Medline].
|
| 8.
|
Boulton, S. J., and S. P. Jackson.
1996.
Saccharomyces cerevisiae Ku70 potentiates illegitimate DNA double-strand break repair and serves as a barrier to error-prone DNA repair pathways.
EMBO J.
15:5093-5103[Medline].
|
| 9.
|
Cao, L.,
E. Alani, and N. Kleckner.
1990.
A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae.
Cell
61:1089-1101[Medline].
|
| 10.
|
Carney, J. P.,
R. S. Maser,
H. Olivares,
E. M. Davis,
M. Le Beau,
J. R. Yates,
L. Hays,
W. F. Morgan, and J. H. J. Petrini.
1998.
The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response.
Cell
93:477-486[Medline].
|
| 11.
|
Chepurnaya, O. V.,
S. A. Kozhin,
V. T. Peshekhonov, and V. G. Korolev.
1995.
RAD58 (XRS4) a new gene in the RAD52 epistasis group.
Curr. Genet.
28:274-279[Medline].
|
| 12.
|
Chu, G.
1997.
Double strand break repair.
J. Biol. Chem.
272:24097-24100[Free Full Text].
|
| 13.
|
Connelly, J. C.,
E. S. de Leau,
E. A. Okely, and D. R. F. Leach.
1997.
Overexpression, purification and characterization of the SbcCD protein from Escherichia coli.
J. Biol. Chem.
272:19819-19826[Abstract/Free Full Text].
|
| 14.
|
Connelly, J. C., and D. R. F. Leach.
1996.
The sbcC and sbcD genes of Escherichia coli encode a nuclease involved in palindrome inviability and genetic recombination.
Genes Cells
1:285-291[Abstract].
|
| 15.
|
Dolganov, G. M.,
R. S. Maser,
A. Novikov,
L. Tosto,
S. Chong,
D. A. Bressan, and J. H. J. Petrini.
1996.
Human Rad50 is physically associated with human Mre11: identification of a conserved multiprotein complex implicated in recombinational DNA repair.
Mol. Cell. Biol.
16:4832-4841[Abstract].
|
| 16.
|
Erdeniz, N.,
U. H. Mortensen, and R. Rothstein.
1997.
Cloning-free PCR-based allele replacement methods.
Genome Res.
7:1174-1183[Abstract/Free Full Text].
|
| 17.
|
Essers, J.,
R. W. Hendriks,
S. M. A. Swagemakers,
C. Troelstra,
J. de Wit,
D. Bootsma,
J. H. J. Hoeijmakers, and R. Kanaar.
1997.
Disruption of mouse RAD54 reduces ionizing radiation resistance and homologous recombination.
Cell
89:195-204[Medline].
|
| 18.
|
Game, J., and R. K. Mortimer.
1974.
A genetic study of X-ray sensitive mutants in yeast.
Mutat. Res.
24:281-292[Medline].
|
| 19.
|
Goldberg, J.,
H. Huang,
Y. Kwon,
P. Greengard,
A. Nairn, and J. Kuriyan.
1995.
Three-dimensional structure of the catalytic subunit of protein serine/threonine phosphatase-1.
Nature
376:745-753[Medline].
|
| 20.
|
Grawunder, U.,
M. Wilm,
X. Wu,
P. Kulesza,
T. E. Wilson,
M. Mann, and M. R. Lieber.
1997.
Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells.
Nature
388:492-495[Medline].
|
| 21.
|
Huang, H.-B.,
A. Horiuchi,
J. Goldberg,
P. Greengard, and A. C. Nairn.
1997.
Site-directed mutagenesis of amino acid residues of protein phosphatase 1 involved in catalysis and inhibitor binding.
Proc. Natl. Acad. Sci. USA
94:3530-3535[Abstract/Free Full Text].
|
| 22.
|
Ito, H.,
Y. Fukada,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 23.
|
Ivanov, E.,
V. Korolev, and F. Fabre.
1992.
XRS2, a DNA repair gene of Saccharomyces cerevisiae, is needed for meiotic recombination.
Genetics
132:651-664[Abstract].
|
| 24.
|
Ivanov, E. L.,
N. Sugawara,
C. I. White,
F. Fabre, and J. Haber.
1994.
Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:3414-3425[Abstract/Free Full Text].
|
| 25.
|
Johnston, M., and R. W. Davis.
1984.
Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:1440-1448[Abstract/Free Full Text].
|
| 26.
|
Johzuka, K., and H. Ogawa.
1995.
Interaction of Mre11 and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae.
Genetics
139:1521-1532[Abstract].
|
| 27.
|
Keeney, S.,
C. N. Giroux, and N. Kleckner.
1997.
Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family.
Cell
88:375-384[Medline].
|
| 28.
|
Kirchgessner, C. U.,
C. K. Patil,
J. W. Evans,
C. A. Cuomo,
L. M. Fried,
T. Carter,
M. A. Oettinger, and J. M. Brown.
1995.
DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect.
Science
267:1178-1183[Abstract/Free Full Text].
|
| 29.
|
Kironmai, K. M., and K. Muniyappa.
1997.
Alteration of telomeric sequences and senescence caused by mutations in RAD50 of Saccharomyces cerevisiae.
Genes Cells
2:443-455[Abstract].
|
| 29a.
| Leach, D. Personal communication.
|
| 30.
|
Lees-Miller, S. P.,
R. Godbout,
D. W. Chan,
M. Weinfeld,
R. S. Day,
G. M. Barron, and J. Allalunis-Turner.
1995.
Absence of p350 subunit of DNA-activated protein kinase from a radiosensitive human cell line.
Science
267:1183-1185[Abstract/Free Full Text].
|
| 31.
|
Li, Z.,
T. Otevrel,
Y. Gao,
H.-L. Cheng,
B. Seed,
T. D. Stamato,
G. E. Taccioli, and F. W. Alt.
1995.
The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination.
Cell
83:1079-1089[Medline].
|
| 32.
|
Maser, R. S.,
K. J. Monsen,
B. E. Nelms, and J. H. J. Petrini.
1997.
hMre11 and hRad50 nuclear foci are induced during the normal cellular response to DNA double-strand breaks.
Mol. Cell. Biol.
17:6087-6096[Abstract].
|
| 33.
|
McKee, A. H. Z., and N. Kleckner.
1997.
A general method for identifying recessive diploid-specific mutations in Saccharomyces cerevisiae, its application to the isolation of mutants blocked at intermediate stages of meiotic prophase and characterization of a new gene SAE2.
Genetics
146:797-815[Abstract].
|
| 34.
|
Milne, G. T.,
S. Jin,
K. Shannon, and D. T. Weaver.
1996.
Mutations in two Ku homologs define a DNA end-joining repair pathway in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:4189-4198[Abstract].
|
| 35.
|
Mitchell, D. A.,
T. K. Marshall, and R. J. Deschenes.
1993.
Vectors for the inducible overexpression of glutathione S-transferase fusion proteins in yeast.
Yeast
9:715-723[Medline].
|
| 36.
|
Moore, J. K., and J. E. Haber.
1996.
Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:2164-2173[Abstract].
|
| 37.
|
Nairz, K., and F. Klein.
1997.
mre11S a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis.
Genes Dev.
11:2272-2290[Abstract/Free Full Text].
|
| 38.
|
Nelms, B. E.,
R. S. Maser,
J. F. MacKay,
M. G. Lagally, and J. H. J. Petrini.
1998.
In situ visualization of DNA double-strand break repair in human fibroblasts.
Science
280:590-592[Abstract/Free Full Text].
|
| 39.
|
Nugent, C. I.,
G. Bosco,
L. O. Ross,
S. K. Evans,
A. P. Salinger,
J. K. Moore,
J. E. Haber, and V. Lundblad.
1998.
Telomere maintenance is dependent on activities required for end repair of double-strand breaks.
Curr. Biol.
8:657-660[Medline].
|
| 40.
|
Ogawa, T.,
A. Shinohara,
A. Nabetani,
T. Ikeya,
X. Yu,
E. H. Egelman, and H. Ogawa.
1993.
RecA-like recombination proteins in eukaryotes: functions and structures of RAD51 genes.
Cold Spring Harbor Symp. Quant. Biol.
58:567-576[Abstract/Free Full Text].
|
| 40a.
| Ogawa, T., and H. Ogawa. Personal communication.
|
| 41.
|
Paull, T. T., and M. Gellert.
1998.
The 3' to 5' exonuclease activity of Mre11 facilitates repair of DNA double-strand breaks.
Mol. Cell
1:969-979[Medline].
|
| 42.
|
Petes, T. D.,
R. E. Malone, and L. S. Symington.
1991.
Recombination in yeast, vol. I.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Petrini, J. H. J.,
M. E. Walsh,
C. DiMare,
X.-N. Chen,
J. R. Korenberg, and D. T. Weaver.
1995.
Isolation and characterization of the human MRE11 homologue.
Genomics
29:80-86[Medline].
|
| 44.
|
Porter, S. E.,
P. W. Greenwell,
K. B. Ritchie, and T. D. Petes.
1996.
The DNA-binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae.
Nucleic Acids Res.
24:582-585[Abstract/Free Full Text].
|
| 45.
|
Prinz, S.,
A. Amon, and F. Klein.
1997.
Isolation of COM1, a new gene required to complete meiotic double-strand break-induced recombination in Saccharomyces cerevisiae.
Genetics
146:781-795[Abstract].
|
| 46.
|
Rathmell, W. K., and G. Chu.
1994.
A DNA end-binding factor involved in double-strand break repair and V(D)J recombination.
Mol. Cell. Biol.
14:4741-4748[Abstract/Free Full Text].
|
| 47.
|
Raymond, W. E., and N. Kleckner.
1993.
RAD50 protein of S. cerevisiae exhibits ATP-dependent DNA binding.
Nucleic Acids Res.
21:3851-3856[Abstract/Free Full Text].
|
| 48.
|
Roth, D. B.,
P. B. Nakajima,
J. P. Menetski,
M. J. Bosma, and M. Gellert.
1992.
V(D)J recombination in mouse thymocytes: double-strand breaks near T cell receptor delta rearrangement signals.
Cell
69:41-53[Medline].
|
| 49.
|
Rothstein, R. J.
1983.
One-step gene disruption in yeast.
Methods Enzymol.
101:202-211[Medline].
|
| 50.
|
Schiestl, R. H.,
J. Zhu, and T. D. Petes.
1994.
Effect of mutations in genes affecting homologous recombination on restriction enzyme-mediated and illegitimate recombination in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:4493-4500[Abstract/Free Full Text].
|
| 51.
|
Sharples, G. J., and D. R. F. Leach.
1995.
Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast.
Mol. Microbiol.
17:1215-1220[Medline].
|
| 52.
|
Sherman, F.,
G. Fink, and J. Hicks.
1986.
Methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 53.
|
Shinohara, A.,
H. Ogawa, and T. Ogawa.
1992.
Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein.
Cell
69:457-470[Medline].
|
| 54.
|
Siede, W.,
A. A. Friedl,
I. Dianova,
F. Eckardt-Schupp, and E. C. Friedberg.
1996.
The Saccharomyces cerevisiae Ku autoantigen homologue affects radiosensitivity only in the absence of homologous recombination.
Genetics
142:91-102[Abstract].
|
| 55.
|
Strathern, J. N.,
A. J. S. Klar,
J. B. Hicks,
J. A. Abraham,
J. M. Ivy,
K. A. Nasmyth, and C. McGill.
1982.
Homothallic switching of yeast mating type cassettes is initiated by a double-stranded cut in the MAT locus.
Cell
31:183-192[Medline].
|
| 56.
|
Sugarawa, N.,
E. L. Ivanov,
J. Fishman-Lobell,
B. L. Ray, and J. E. Haber.
1995.
DNA structure-dependent requirements for yeast RAD genes in gene conversion.
Nature
373:84-86[Medline].
|
| 57.
|
Sun, H.,
D. Treco,
N. P. Schultes, and J. W. Szostak.
1989.
Double-strand breaks at an initiation site for meiotic gene conversion.
Nature
338:87-90[Medline].
|
| 58.
|
Sun, H.,
D. Treco, and J. Szostak.
1991.
Extensive 3'-overhang, single-stranded DNA associated with the meiosis-specific double-strand breaks at the ARG4 recombination initiation site.
Cell
64:1155-1161[Medline].
|
| 59.
| Symington, L. S. Homologous recombination is
essential for the viability of rad27 mutants. Nucleic Acids
Res., in press.
|
| 60.
|
Taccioli, G.,
T. M. Gottlieb,
T. Blunt,
A. Priestly,
J. Demengeot,
R. Mizuta,
A. R. Lehmann,
F. W. Alt,
S. P. Jackson, and P. A. Jeggo.
1994.
Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination.
Science
265:1442-1445[Abstract/Free Full Text].
|
| 61.
|
Tishkoff, D. X.,
N. Filosi,
G. M. Gaida, and R. D. Kolodner.
1997.
A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from mismatch repair.
Cell
88:253-263[Medline].
|
| 62.
|
Trujillo, K. M.,
S.-S. F. Yuan,
E. Y.-H. Lee, and P. Sung.
1998.
Nuclease activities in a complex of human recombination and DNA repair factors Rad50, Mre11, and p95.
J. Biol. Chem.
273:21447-21450[Abstract/Free Full Text].
|
| 63.
|
Tsubouchi, H., and H. Ogawa.
1998.
A novel mre11 mutation impairs processing of double-strand breaks of DNA during both mitosis and meiosis.
Mol. Cell. Biol.
18:260-268[Abstract/Free Full Text].
|
| 64.
|
Tsukamoto, Y.,
J. Kato, and H. Ikeda.
1997.
Budding yeast Rad50, Mre11, Xrs2, and Hdf1, but not Rad52, are involved in the formation of deletions on a dicentric plasmid.
Mol. Gen. Genet.
255:543-547[Medline].
|
| 65.
|
Tsukamoto, Y.,
J. Kato, and H. Ikeda.
1997.
Silencing factors participate in DNA repair and recombination in Saccharomyces cerevisiae.
Nature
388:900-903[Medline].
|
| 66.
|
Varon, R.,
C. Vissinga,
M. Platzer,
K. M. Cerosaletti,
K. H. Chrzanowska,
K. Saar,
G. Beckmann,
E. Seemanova,
P. R. Cooper,
N. J. Nowak,
M. Stumm,
C. M. R. Weemaes,
R. A. Gatti,
R. K. Wilson,
M. Digweed,
A. Rosenthal,
K. Sperling,
P. Concannon, and A. Reis.
1998.
Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome.
Cell
93:467-476[Medline].
|
| 67.
|
White, C. I., and J. E. Haber.
1990.
Intermediates of recombination during mating type switching in Saccharomyces cerevisiae.
EMBO J.
9:663-673[Medline].
|
| 68.
|
Wilson, T. E.,
U. Grawunder, and M. R. Lieber.
1997.
Yeast DNA ligase IV mediates non-homologous DNA end joining.
Nature
388:495-498[Medline].
|
| 69.
|
Zhuo, S.,
J. C. Clemens,
R. L. Stone, and J. E. Dixon.
1994.
Mutational analysis of a Ser/Thr phosphatase.
J. Biol. Chem.
269:26234-26238[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 1999, p. 556-566, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Karen, K. A., Hoey, P. J., Young, C. S. H., Hearing, P.
(2009). Temporal Regulation of the Mre11-Rad50-Nbs1 Complex during Adenovirus Infection. J. Virol.
83: 4565-4573
[Abstract]
[Full Text]
-
Pandita, T. K., Richardson, C.
(2009). Chromatin remodeling finds its place in the DNA double-strand break response. Nucleic Acids Res
37: 1363-1377
[Abstract]
[Full Text]
-
Hartsuiker, E., Mizuno, K., Molnar, M., Kohli, J., Ohta, K., Carr, A. M.
(2009). Ctp1CtIP and Rad32Mre11 Nuclease Activity Are Required for Rec12Spo11 Removal, but Rec12Spo11 Removal Is Dispensable for Other MRN-Dependent Meiotic Functions. Mol. Cell. Biol.
29: 1671-1681
[Abstract]
[Full Text]
-
Porter-Goff, M. E., Rhind, N.
(2009). The Role of MRN in the S-Phase DNA Damage Checkpoint Is Independent of Its Ctp1-dependent Roles in Double-Strand Break Repair and Checkpoint Signaling. Mol. Biol. Cell
20: 2096-2107
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2009). Telomerase- and Rad52-Independent Immortalization of Budding Yeast by an Inherited-Long-Telomere Pathway of Telomeric Repeat Amplification. Mol. Cell. Biol.
29: 965-985
[Abstract]
[Full Text]
-
Palmbos, P. L., Wu, D., Daley, J. M., Wilson, T. E.
(2008). Recruitment of Saccharomyces cerevisiae Dnl4-Lif1 Complex to a Double-Strand Break Requires Interactions With Yku80 and the Xrs2 FHA Domain. Genetics
180: 1809-1819
[Abstract]
[Full Text]
-
Liao, S., Toczylowski, T., Yan, H.
(2008). Identification of the Xenopus DNA2 protein as a major nuclease for the 5'->3' strand-specific processing of DNA ends. Nucleic Acids Res
36: 6091-6100
[Abstract]
[Full Text]
-
Raynard, S., Niu, H., Sung, P.
(2008). DNA double-strand break processing: the beginning of the end. Genes Dev.
22: 2903-2907
[Abstract]
[Full Text]
-
Banos, B., Lazaro, J. M., Villar, L., Salas, M., de Vega, M.
(2008). Editing of misaligned 3'-termini by an intrinsic 3'-5' exonuclease activity residing in the PHP domain of a family X DNA polymerase. Nucleic Acids Res
36: 5736-5749
[Abstract]
[Full Text]
-
Lakdawala, S. S., Schwartz, R. A., Ferenchak, K., Carson, C. T., McSharry, B. P., Wilkinson, G. W., Weitzman, M. D.
(2008). Differential Requirements of the C Terminus of Nbs1 in Suppressing Adenovirus DNA Replication and Promoting Concatemer Formation. J. Virol.
82: 8362-8372
[Abstract]
[Full Text]
-
Cartagena-Lirola, H., Guerini, I., Manfrini, N., Lucchini, G., Longhese, M. P.
(2008). Role of the Saccharomyces cerevisiae Rad53 Checkpoint Kinase in Signaling Double-Strand Breaks during the Meiotic Cell Cycle. Mol. Cell. Biol.
28: 4480-4493
[Abstract]
[Full Text]
-
Wu, D., Topper, L. M., Wilson, T. E.
(2008). Recruitment and Dissociation of Nonhomologous End Joining Proteins at a DNA Double-Strand Break in Saccharomyces cerevisiae. Genetics
178: 1237-1249
[Abstract]
[Full Text]
-
Kim, H.-S., Vijayakumar, S., Reger, M., Harrison, J. C., Haber, J. E., Weil, C., Petrini, J. H. J.
(2008). Functional Interactions Between Sae2 and the Mre11 Complex. Genetics
178: 711-723
[Abstract]
[Full Text]
-
Longhese, M. P.
(2008). DNA damage response at functional and dysfunctional telomeres. Genes Dev.
22: 125-140
[Abstract]
[Full Text]
-
Cullen, J. K., Hussey, S. P., Walker, C., Prudden, J., Wee, B.-Y., Dave, A., Findlay, J. S., Savory, A. P., Humphrey, T. C.
(2007). Break-Induced Loss of Heterozygosity in Fission Yeast: Dual Roles for Homologous Recombination in Promoting Translocations and Preventing De Novo Telomere Addition. Mol. Cell. Biol.
27: 7745-7757
[Abstract]
[Full Text]
-
Lee, K., Lee, S. E.
(2007). Saccharomyces cerevisiae Sae2- and Tel1-Dependent Single-Strand DNA Formation at DNA Break Promotes Microhomology-Mediated End Joining. Genetics
176: 2003-2014
[Abstract]
[Full Text]
-
Baker, A., Rohleder, K. J., Hanakahi, L. A., Ketner, G.
(2007). Adenovirus E4 34k and E1b 55k Oncoproteins Target Host DNA Ligase IV for Proteasomal Degradation. J. Virol.
81: 7034-7040
[Abstract]
[Full Text]
-
Toczylowski, T., Yan, H.
(2006). Mechanistic Analysis of a DNA End Processing Pathway Mediated by the Xenopus Werner Syndrome Protein. J. Biol. Chem.
281: 33198-33205
[Abstract]
[Full Text]
-
Krogh, B. O., Llorente, B., Lam, A., Symington, L. S.
(2005). Mutations in Mre11 Phosphoesterase Motif I That Impair Saccharomyces cerevisiae Mre11-Rad50-Xrs2 Complex Stability in Addition to Nuclease Activity. Genetics
171: 1561-1570
[Abstract]
[Full Text]
-
Clerici, M., Mantiero, D., Lucchini, G., Longhese, M. P.
(2005). The Saccharomyces cerevisiae Sae2 Protein Promotes Resection and Bridging of Double Strand Break Ends. J. Biol. Chem.
280: 38631-38638
[Abstract]
[Full Text]
-
Ghosal, G., Muniyappa, K.
(2005). Saccharomyces cerevisiae Mre11 is a high-affinity G4 DNA-binding protein and a G-rich DNA-specific endonuclease: implications for replication of telomeric DNA. Nucleic Acids Res
33: 4692-4703
[Abstract]
[Full Text]
-
Rattray, A. J., Shafer, B. K., Neelam, B., Strathern, J. N.
(2005). A mechanism of palindromic gene amplification in Saccharomyces cerevisiae. Genes Dev.
19: 1390-1399
[Abstract]
[Full Text]
-
Deng, C., Brown, J. A., You, D., Brown, J. M.
(2005). Multiple Endonucleases Function to Repair Covalent Topoisomerase I Complexes in Saccharomyces cerevisiae. Genetics
170: 591-600
[Abstract]
[Full Text]
-
Clatworthy, A. E., Valencia-Burton, M. A., Haber, J. E., Oettinger, M. A.
(2005). The MRE11-RAD50-XRS2 Complex, in Addition to Other Non-homologous End-joining Factors, Is Required for V(D)J Joining in Yeast. J. Biol. Chem.
280: 20247-20252
[Abstract]
[Full Text]
-
Shim, E. Y., Ma, J.-L., Oum, J.-H., Yanez, Y., Lee, S. E.
(2005). The Yeast Chromatin Remodeler RSC Complex Facilitates End Joining Repair of DNA Double-Strand Breaks. Mol. Cell. Biol.
25: 3934-3944
[Abstract]
[Full Text]
-
Farah, J. A., Cromie, G., Steiner, W. W., Smith, G. R.
(2005). A Novel Recombination Pathway Initiated by the Mre11/Rad50/Nbs1 Complex Eliminates Palindromes During Meiosis in Schizosaccharomyces pombe. Genetics
169: 1261-1274
[Abstract]
[Full Text]
-
Chen, L., Trujillo, K. M., Van Komen, S., Roh, D. H., Krejci, L., Lewis, L. K., Resnick, M. A., Sung, P., Tomkinson, A. E.
(2005). Effect of Amino Acid Substitutions in the Rad50 ATP Binding Domain on DNA Double Strand Break Repair in Yeast. J. Biol. Chem.
280: 2620-2627
[Abstract]
[Full Text]
-
Nakada, D., Hirano, Y., Sugimoto, K.
(2004). Requirement of the Mre11 Complex and Exonuclease 1 for Activation of the Mec1 Signaling Pathway. Mol. Cell. Biol.
24: 10016-10025
[Abstract]
[Full Text]
-
Tseng, H.-M., Tomkinson, A. E.
(2004). Processing and Joining of DNA Ends Coordinated by Interactions among Dnl4/Lif1, Pol4, and FEN-1. J. Biol. Chem.
279: 47580-47588
[Abstract]
[Full Text]
-
Rattray, A. J.
(2004). A method for cloning and sequencing long palindromic DNA junctions. Nucleic Acids Res
32: e155-e155
[Abstract]
[Full Text]
-
Tomita, K., Kibe, T., Kang, H.-Y., Seo, Y.-S., Uritani, M., Ushimaru, T., Ueno, M.
(2004). Fission Yeast Dna2 Is Required for Generation of the Telomeric Single-Strand Overhang. Mol. Cell. Biol.
24: 9557-9567
[Abstract]
[Full Text]
-
Llorente, B., Symington, L. S.
(2004). The Mre11 Nuclease Is Not Required for 5' to 3' Resection at Multiple HO-Induced Double-Strand Breaks. Mol. Cell. Biol.
24: 9682-9694
[Abstract]
[Full Text]
-
d'Adda di Fagagna, F., Teo, S.-H., Jackson, S. P.
(2004). Functional links between telomeres and proteins of the DNA-damage response. Genes Dev.
18: 1781-1799
[Abstract]
[Full Text]
-
Mohammadi, E. S., Ketner, E. A., Johns, D. C., Ketner, G.
(2004). Expression of the adenovirus E4 34k oncoprotein inhibits repair of double strand breaks in the cellular genome of a 293-based inducible cell line. Nucleic Acids Res
32: 2652-2659
[Abstract]
[Full Text]
-
Jokela, M., Eskelinen, A., Pospiech, H., Rouvinen, J., Syvaoja, J. E.
(2004). Characterization of the 3' exonuclease subunit DP1 of Methanococcus jannaschii replicative DNA polymerase D. Nucleic Acids Res
32: 2430-2440
[Abstract]
[Full Text]
-
Lewis, L. K., Storici, F., Van Komen, S., Calero, S., Sung, P., Resnick, M. A.
(2004). Role of the Nuclease Activity of Saccharomyces cerevisiae Mre11 in Repair of DNA Double-Strand Breaks in Mitotic Cells. Genetics
166: 1701-1713
[Abstract]
[Full Text]
-
Arthur, L. M., Gustausson, K., Hopfner, K.-P., Carson, C. T., Stracker, T. H., Karcher, A., Felton, D., Weitzman, M. D., Tainer, J., Carney, J. P.
(2004). Structural and functional analysis of Mre11-3. Nucleic Acids Res
32: 1886-1893
[Abstract]
[Full Text]
-
Grandin, N., Charbonneau, M.
(2003). Mitotic Cyclins Regulate Telomeric Recombination in Telomerase-Deficient Yeast Cells. Mol. Cell. Biol.
23: 9162-9177
[Abstract]
[Full Text]
-
Ma, J.-L., Kim, E. M., Haber, J. E., Lee, S. E.
(2003). Yeast Mre11 and Rad1 Proteins Define a Ku-Independent Mechanism To Repair Double-Strand Breaks Lacking Overlapping End Sequences. Mol. Cell. Biol.
23: 8820-8828
[Abstract]
[Full Text]
-
Liu, L., Usher, M., Hu, Y., Kmiec, E. B.
(2003). Nuclease Activity of Saccharomyces cerevisiae Mre11 Functions in Targeted Nucleotide Alteration. Appl. Environ. Microbiol.
69: 6216-6224
[Abstract]
[Full Text]
-
Ueno, M., Nakazaki, T., Akamatsu, Y., Watanabe, K., Tomita, K., Lindsay, H. D., Shinagawa, H., Iwasaki, H.
(2003). Molecular Characterization of the Schizosaccharomyces pombe nbs1+ Gene Involved in DNA Repair and Telomere Maintenance. Mol. Cell. Biol.
23: 6553-6563
[Abstract]
[Full Text]
-
Tomita, K., Matsuura, A., Caspari, T., Carr, A. M., Akamatsu, Y., Iwasaki, H., Mizuno, K.-i., Ohta, K., Uritani, M., Ushimaru, T., Yoshinaga, K., Ueno, M.
(2003). Competition between the Rad50 Complex and the Ku Heterodimer Reveals a Role for Exo1 in Processing Double-Strand Breaks but Not Telomeres. Mol. Cell. Biol.
23: 5186-5197
[Abstract]
[Full Text]
-
Symington, L. S.
(2002). Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair. Microbiol. Mol. Biol. Rev.
66: 630-670
[Abstract]
[Full Text]
-
Tseng, H.-M., Tomkinson, A. E.
(2002). A Physical and Functional Interaction between Yeast Pol4 and Dnl4-Lif1 Links DNA Synthesis and Ligation in Nonhomologous End Joining. J. Biol. Chem.
277: 45630-45637
[Abstract]
[Full Text]
-
Cummings, W. J., Merino, S. T., Young, K. G., Li, L., Johnson, C. W., Sierra, E. A., Zolan, M. E.
(2002). The Coprinus cinereus adherin Rad9 functions in Mre11-dependent DNA repair, meiotic sister-chromatid cohesion, and meiotic homolog pairing. Proc. Natl. Acad. Sci. USA
99: 14958-14963
[Abstract]
[Full Text]
-
Liu, C., Pouliot, J. J., Nash, H. A.
(2002). Repair of topoisomerase I covalent complexes in the absence of the tyrosyl-DNA phosphodiesterase Tdp1. Proc. Natl. Acad. Sci. USA
99: 14970-14975
[Abstract]
[Full Text]
-
Bundock, P., Hooykaas, P.
(2002). Severe Developmental Defects, Hypersensitivity to DNA-Damaging Agents, and Lengthened Telomeres in Arabidopsis MRE11 Mutants. Plant Cell
14: 2451-2462
[Abstract]
[Full Text]
-
Morgan, E. A., Shah, N., Symington, L. S.
(2002). The Requirement for ATP Hydrolysis by Saccharomyces cerevisiae Rad51 Is Bypassed by Mating-Type Heterozygosity or RAD54 in High Copy. Mol. Cell. Biol.
22: 6336-6343
[Abstract]
[Full Text]
-
de Jager, M., Kanaar, R.
(2002). Genome instability and Rad50S: subtle yet severe. Genes Dev.
16: 2173-2178
[Full Text]
-
Bender, C. F., Sikes, M. L., Sullivan, R., Huye, L. E., Le Beau, M. M., Roth, D. B., Mirzoeva, O. K., Oltz, E. M., Petrini, J. H. J.
(2002). Cancer predisposition and hematopoietic failure in Rad50S/S mice. Genes Dev.
16: 2237-2251
[Abstract]
[Full Text]
-
Manthey, G. M., Bailis, A. M.
(2002). Multiple Pathways Promote Short-Sequence Recombination in Saccharomyces cerevisiae. Mol. Cell. Biol.
22: 5347-5356
[Abstract]
[Full Text]
-
Robinson, N. P., McCulloch, R., Conway, C., Browitt, A., Barry, J. D.
(2002). Inactivation of Mre11 Does Not Affect VSG Gene Duplication Mediated by Homologous Recombination in Trypanosoma brucei. J. Biol. Chem.
277: 26185-26193
[Abstract]
[Full Text]
-
DuBois, M. L., Haimberger, Z. W., McIntosh, M. W., Gottschling, D. E.
(2002). A Quantitative Assay for Telomere Protection in Saccharomyces cerevisiae. Genetics
161: 995-1013
[Abstract]
[Full Text]
-
Farah, J. A., Hartsuiker, E., Mizuno, K.-i., Ohta, K., Smith, G. R.
(2002). A 160-bp Palindrome Is a Rad50{middle dot}Rad32-Dependent Mitotic Recombination Hotspot in Schizosaccharomyces pombe. Genetics
161: 461-468
[Abstract]
[Full Text]
-
Huang, J., Dynan, W. S.
(2002). Reconstitution of the mammalian DNA double-strand break end-joining reaction reveals a requirement for an Mre11/Rad50/NBS1-containing fraction. Nucleic Acids Res
30: 667-674
[Abstract]
[Full Text]
-
Lewis, L. K., Karthikeyan, G., Westmoreland, J. W., Resnick, M. A.
(2002). Differential Suppression of DNA Repair Deficiencies of Yeast rad50, mre11 and xrs2 Mutants by EXO1 and TLC1 (the RNA Component of Telomerase). Genetics
160: 49-62
[Abstract]
[Full Text]
-
Moreau, S., Morgan, E. A., Symington, L. S.
(2001). Overlapping Functions of the Saccharomyces cerevisiae Mre11, Exo1 and Rad27 Nucleases in DNA Metabolism. Genetics
159: 1423-1433
[Abstract]
[Full Text]
-
Bucholc, M., Park, Y., Lustig, A. J.
(2001). Intrachromatid Excision of Telomeric DNA as a Mechanism for Telomere Size Control in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 6559-6573
[Abstract]
[Full Text]
-
Debrauwere, H., Loeillet, S., Lin, W., Lopes, J., Nicolas, A.
(2001). Links between replication and recombination in Saccharomyces cerevisiae: A hypersensitive requirement for homologous recombination in the absence of Rad27 activity. Proc. Natl. Acad. Sci. USA
98: 8263-8269
[Abstract]
[Full Text]
-
Rattray, A. J., McGill, C. B., Shafer, B. K., Strathern, J. N.
(2001). Fidelity of Mitotic Double-Strand-Break Repair in Saccharomyces cerevisiae: A Role for SAE2/COM1. Genetics
158: 109-122
[Abstract]
[Full Text]
-
de Jager, M., Dronkert, M. L. G., Modesti, M., Beerens, C. E. M. T., Kanaar, R., van Gent, D. C.
(2001). DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways. Nucleic Acids Res
29: 1317-1325
[Abstract]
[Full Text]
-
Chin, G. M., Villeneuve, A. M.
(2001). C. elegans mre-11 is required for meiotic recombination and DNA repair but is dispensable for the meiotic G2 DNA damage checkpoint. Genes Dev.
15: 522-534
[Abstract]
[Full Text]
-
Klein, H. L.
(2001). Mutations in Recombinational Repair and in Checkpoint Control Genes Suppress the Lethal Combination of srs2{{Delta}} With Other DNA Repair Genes in Saccharomyces cerevisiae. Genetics
157: 557-565
[Abstract]
[Full Text]
-
Symington, L. S., Kang, L. E., Moreau, S.
(2000). Alteration of gene conversion tract length and associated crossing over during plasmid gap repair in nuclease-deficient strains of Saccharomyces cerevisiae. Nucleic Acids Res
28: 4649-4656
[Abstract]
[Full Text]
-
Kirkpatrick, D. T., Ferguson, J. R., Petes, T. D., Symington, L. S.
(2000). Decreased Meiotic Intergenic Recombination and Increased Meiosis I Nondisjunction in exo1 Mutants of Saccharomyces cerevisiae. Genetics
156: 1549-1557
[Abstract]
[Full Text]
-
Hopfner, K.-P., Karcher, A., Shin, D., Fairley, C., Tainer, J. A., Carney, J. P.
(2000). Mre11 and Rad50 from Pyrococcus furiosus: Cloning and Biochemical Characterization Reveal an Evolutionarily Conserved Multiprotein Machine. J. Bacteriol.
182: 6036-6041
[Abstract]
[Full Text]
-
Evans, E., Alani, E.
(2000). Roles for Mismatch Repair Factors in Regulating Genetic Recombination. Mol. Cell. Biol.
20: 7839-7844
[Full Text]
-
Cheng, C., Shuman, S.
(2000). Recombinogenic Flap Ligation Pathway for Intrinsic Repair of Topoisomerase IB-Induced Double-Strand Breaks. Mol. Cell. Biol.
20: 8059-8068
[Abstract]
[Full Text]
-
Merino, S. T., Cummings, W. J., Acharya, S. N., Zolan, M. E.
(2000). Replication-dependent early meiotic requirement for Spo11 and Rad50. Proc. Natl. Acad. Sci. USA
10.1073/pnas.190346097v1
[Abstract]
[Full Text]
-
Pan, X., Leach, D. R. F.
(2000). The roles of mutS, sbcCD and recA in the propagation of TGG repeats in Escherichia coli. Nucleic Acids Res
28: 3178-3184
[Abstract]
[Full Text]
-
Tsubouchi, H., Ogawa, H.
(2000). Exo1 Roles for Repair of DNA Double-Strand Breaks and Meiotic Crossing Over in Saccharomyces cerevisiae. Mol. Biol. Cell
11: 2221-2233
[Abstract]
[Full Text]
-
Kues, U.
(2000). Life History and Developmental Processes in the Basidiomycete Coprinus cinereus. Microbiol. Mol. Biol. Rev.
64: 316-353
[Abstract]
[Full Text]
-
Chamankhah, M., Fontanie, T., Xiao, W.
(2000). The Saccharomyces cerevisiae mre11(ts) Allele Confers a Separation of DNA Repair and Telomere Maintenance Functions. Genetics
155: 569-576
[Abstract]
[Full Text]
-
McHugh, P. J., Sones, W. R., Hartley, J. A.
(2000). Repair of Intermediate Structures Produced at DNA Interstrand Cross-Links in Saccharomyces cerevisiae. Mol. Cell. Biol.
20: 3425-3433
[Abstract]
[Full Text]
-
Nasar, F., Jankowski, C., Nag, D. K.
(2000). Long Palindromic Sequences Induce Double-Strand Breaks during Meiosis in Yeast. Mol. Cell. Biol.
20: 3449-3458
[Abstract]
[Full Text]
-
Gerecke, E. E., Zolan, M. E.
(2000). An mre11 Mutant of Coprinus cinereus Has Defects in Meiotic Chromosome Pairing, Condensation and Synapsis. Genetics
154: 1125-1139
[Abstract]
[Full Text]
-
Rattray, A. J., Shafer, B. K., Garfinkel, D. J.
(2000). The Saccharomyces cerevisiae DNA Recombination and Repair Functions of the RAD52 Epistasis Group Inhibit Ty1 Transposition. Genetics
154: 543-556
[Abstract]
[Full Text]
-
DE LANGE, T., PETRINI, J.H.J.
(2000). A New Connection at Human Telomeres: Association of the Mre11 Complex with TRF2. Cold Spring Harb Symp Quant Biol
65: 265-274
[Abstract]
-
PETRINI, J.H.J.
(2000). S-phase Functions of the Mre11 Complex. Cold Spring Harb Symp Quant Biol
65: 405-412
[Abstract]
-
Bressan, D. A., Baxter, B. K., Petrini, J. H. J.
(1999). The Mre11-Rad50-Xrs2 Protein Complex Facilitates Homologous Recombination-Based Double-Strand Break Repair in Saccharomyces cerevisiae. Mol. Cell. Biol.
19: 7681-7687
[Abstract]
[Full Text]
-
Bai, Y., Davis, A. P., Symington, L. S.
(1999). A Novel Allele of RAD52 That Causes Severe DNA Repair and Recombination Deficiencies Only in the Absence of RAD51 or RAD59. Genetics
153: 1117-1130
[Abstract]
[Full Text]
-
Petukhova, G., Van Komen, S., Vergano, S., Klein, H., Sung, P.
(1999). Yeast Rad54 Promotes Rad51-dependent Homologous DNA Pairing via ATP Hydrolysis-driven Change in DNA Double Helix Conformation. J. Biol. Chem.
274: 29453-29462
[Abstract]
[Full Text]
-
Wilson, T. E., Lieber, M. R.
(1999). Efficient Processing of DNA Ends during Yeast Nonhomologous End Joining. EVIDENCE FOR A DNA POLYMERASE beta (POL4)-DEPENDENT PATHWAY. J. Biol. Chem.
274: 23599-23609
[Abstract]
[Full Text]
-
Zhong, Q., Chen, C., Li, S., Chen, Y., Wang, C., Xiao, J., Chen, P., Sharp, Z. D., Lee, W.
(1999). Association of BRCA1 with the hRad50-hMre11-p95 Complex and the DNA Damage Response. Science
285: 747-750
[Abstract]
[Full Text]
-
Dong, Z., Zhong, Q., Chen, P.-L.
(1999). The Nijmegen Breakage Syndrome Protein Is Essential for Mre11 Phosphorylation upon DNA Damage. J. Biol. Chem.
274: 19513-19516
[Abstract]
[Full Text]
-
Paques, F., Haber, J. E.
(1999). Multiple Pathways of Recombination Induced by Double-Strand Breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
63: 349-404
[Abstract]
[Full Text]
-
Paull, T. T., Gellert, M.
(1999). Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev.
13: 1276-1288
[Abstract]
[Full Text]
-
Le, S., Moore, J. K., Haber, J. E., Greider, C. W.
(1999). RAD50 and RAD51 Define Two Pathways That Collaborate to Maintain Telomeres in the Absence of Telomerase. Genetics
152: 143-152
[Abstract]
[Full Text]
-
Smith, G. C.M., Jackson, S. P.
(1999). The DNA-dependent protein kinase. Genes Dev.
13: 916-934
[Full Text]
-
Wu, G., Lee, W.-H., Chen, P.-L.
(2000). NBS1 and TRF1 Colocalize at Promyelocytic Leukemia Bodies during Late S/G2 Phases in Immortalized Telomerase-negative Cells. IMPLICATION OF NBS1 IN ALTERNATIVE LENGTHENING OF TELOMERES. J. Biol. Chem.
275: 30618-30622
[Abstract]
[Full Text]
-
Xiao, J., Liu, C.-C., Chen, P.-L., Lee, W.-H.
(2001). RINT-1, a Novel Rad50-interacting Protein, Participates in Radiation-induced G2/M Checkpoint Control. J. Biol. Chem.
276: 6105-6111
[Abstract]
[Full Text]
-
Trujillo, K. M., Sung, P.
(2001). DNA Structure-specific Nuclease Activities in the Saccharomyces cerevisiae Rad50{middle dot}Mre11 Complex. J. Biol. Chem.
276: 35458-35464
[Abstract]
[Full Text]
-
Budd, M. E., Choe, W.-c., Campbell, J. L.
(2000). The Nuclease Activity of the Yeast Dna2 Protein, Which Is Related to the RecB-like Nucleases, Is Essential in Vivo. J. Biol. Chem.
275: 16518-16529
[Abstract]
[Full Text]
-
Merino, S. T., Cummings, W. J., Acharya, S. N., Zolan, M. E.
(2000). Replication-dependent early meiotic requirement for Spo11 and Rad50. Proc. Natl. Acad. Sci. USA
97: 10477-10482
[Abstract]
[Full Text]