Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 671-679, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Analysis of Mice with Single and Multiple Copies of Transgenes
Reveals a Novel Arrangement for the
5-VpreB1 Locus Control Region
Pierangela
Sabbattini,
Andrew
Georgiou,
Calum
Sinclair, and
Niall
Dillon*
Gene Regulation and Chromatin Group, MRC
Clinical Sciences Centre, Imperial College School of Medicine,
Hammersmith Hospital, London W12 0NN, United Kingdom
Received 16 July 1998/Returned for modification 7 September
1998/Accepted 19 October 1998
 |
ABSTRACT |
The murine
5-VpreB1 locus encodes two
proteins that form part of the pre-B-cell receptor and play a key role
in B-lymphocyte development. We have identified a locus control region
(LCR) which is responsible for coordinate activation of both genes in
pre-B cells. Analysis of mice with single and multiple copies of
transgenes shows a clear difference in the expression behavior of the
genes depending on the transgene copy number. While expression of both
5 and VpreB1 in single- and
two-copy integrations requires the presence of a set of DNase I
hypersensitive sites located 3' of the
5 gene, small
fragments containing the genes have LCR activity when arranged in
multiple-copy tandem arrays, indicating that additional components of
the LCR are located within or close to the genes. The complete LCR is
capable of driving efficient copy-dependent expression of a
5 gene in pre-B cells even when it is integrated into
centomeric
-satellite DNA. The finding that activation of expression
of the locus by positively acting factors is fully dominant over the
silencing effect of heterochromatin has implications for models for
chromatin-mediated gene silencing during B-cell development.
 |
INTRODUCTION |
The generation of multiple cell
types in metazoans requires the establishment of diverse patterns of
tissue-specific gene expression. It is now clear that the mechanisms by
which this is achieved involve the action of transcription factors in
conjunction with changes in chromatin structure. Sequence-specific DNA
binding factors, such as MyoD, are capable of determining entire
differentiation programs, while chromatin structure is thought to play
an important role in the maintenance of specific patterns of expression
and transmission of these patterns through the cell cycle. Locus
control regions (LCRs) are sequences that mediate reorganization of
chromatin and activation of transcription by sequence-specific
transcription factors. The defining characteristic of an LCR is the
ability to drive gene expression in transgenic mice at any site of
integration at levels that are equivalent to those of the gene in its
natural location (11). LCRs were first described in the
human
-globin and CD2 loci (10, 11). They are composed of
clustered DNase I hypersensitive sites (HS) containing binding sites
for tissue-specific and ubiquitous factors (3, 33, 38). In
the multigene
-globin locus, the LCR HS are located outside the gene
cluster and are responsible for activation of all of the genes. In the
absence of the sites, the genes give low levels of expression in
transgenic mice and expression is highly sensitive to the position of
integration of the transgene. Naturally occurring deletions of the
-globin LCR result in inactivation of the locus and conversion to a
DNase I-insensitive configuration (8). Rather than
insulating the gene from position effects, the
-globin and CD2 LCRs
activate expression in a dominant-positive manner.
Differentiation of B cells from the hematopoietic stem cell involves a
number of stages characterized by the sequential rearrangement and
expression of the heavy- and light-chain immunoglobulin (Ig) loci. The
5 and VpreB genes are early
markers of B-cell commitment. They are expressed at the pro- and
pre-B-cell stages and silenced in immature and mature B cells.
VpreB1 and
5 are related to the V and C genes of the
Ig locus but are
expressed in the germ line configuration (19, 20). The two
proteins associate to form the surrogate light chain. In pre-B cells,
following rearrangement of the heavy-chain locus, the surrogate light
chain acts as a chaperone, mediating transport of the newly synthesized
heavy chain µ to the cell surface (35) and together with µ forms part of the pre-B-cell receptor (27). This
receptor is thought to mediate signalling by an unknown ligand, which
leads to proliferation of pre-B cells that have a productive
heavy-chain rearrangement (26). Mice that lack a functional
5 gene show a drastic reduction in the number of B cells
(18). Mutations in
14.1, the human homologue
of
5, are associated with a severe immunodeficiency and
almost complete absence of B cells (29).
Expression of the
5 and VpreB
genes is B-lineage restricted (27) and is also subject to
stage-specific regulation during B-cell development. Although a number
of transcription factors have been implicated in B-lineage-specific
gene regulation, there is no clear correlation between gene expression
at different stages and the presence or absence of specific factors.
Binding sites for the transcription factors EBF, E47, Pax-5, and Ikaros
are present in the
5 and VpreB1
promoters (36, 39). Ectopic expression of EBF and E47 has
been shown to activate the genes in an early pro-B-cell line, where
they are normally silent (36). In a recent study, the Ikaros
protein was shown to form a complex which colocalizes with centromeric
-satellite DNA, the major component of centromeric heterochromatin
in mice (2). The
5-VpreB1 locus
was found to be associated with the Ikaros-centromere complex in a
mature B-cell line that does not express the genes but not in an
expressing pre-B-cell line, suggesting that Ikaros might act as a
repressor of
5 and VpreB1
expression during B-cell development.
In this paper, we describe the identification of a multicomponent LCR
in the
5-VpreB1 locus. Part of the LCR
activity is found in a set of HS located 3' of the locus, while
additional components are present in small fragments containing either
the
5 or the VpreB1 gene. Analysis
of a transgene integration into centromeric
-satellite DNA provides
information on the relationship between positively acting factors and
chromatin-mediated silencing.
 |
MATERIALS AND METHODS |
DNA fragments used for generation of transgenic mice.
Cosmid
2.41, containing a 30-kb region of the
5-VpreB1 locus extending from 8 kb 5' of
VpreB1 to 15 kb 3' of
5, was
isolated from a mouse 129SV cosmid library. A 36-bp tag (5'
GAGCAAAAGCTGATTTCTGAGGAGGATCTGGAATTC 3') was inserted immediately
downstream of the first ATG of the
5 gene by the PCR
overlap extension method described previously (15). The
following fragments were used to generate transgenic mice: L5F1 (4.5-kb
PstI fragment), L5F2 (5.5-kb
BamHI-PstI fragment), L5F3 (10-kb
PstI-BamHI fragment), L5F4 (11-kb
BamHI fragment), L5F5 (12-kb
EcoRI-SphI fragment), L5F6 (19-kb
EcoRI-BamHI fragment), and Vp1 (8-kb
EcoRI-BamHI fragment). The
5-
-globin construct contains 410 bp extending from
the PstI site at
298 to the
5 ATG fused to
the 3.4-kb NcoI-BglII fragment of the human
-globin gene. L5F5, L5F6, and Vp1 each contain a 35-bp tag (5'
GTACCCATACGACGTCCCAGACTACGCGAATTCGG 3') in the PstI
site of VpreB1 exon 2.
Transgenic mice.
DNA fragments were purified and injected
into the pronuclei of C57BL6/CBA F1 mouse eggs as previously described
(5). Fetuses were dissected at 16.5 days posttransfer and
analyzed as described below. Mosaic animals were excluded from the
analysis by measuring the transgene copy numbers in three tissues
(placenta, head, and liver). For some constructs, transgenic lines were
established and individual transgenics were identified by Southern
blotting of tail DNA.
Abelson virus transformation of fetal liver cells.
Abelson
virus transformation of fetal liver cells was carried out by a
modification of the procedure described by Waneck and Rosenberg
(41). Fetal livers were disaggregated by multiple passages
through a 25-gauge needle in 1× RPMI, 20% fetal calf serum (FCS), 50 µM 2-mercaptoethanol, 50 µg of gentamicin/ml. A 1-ml aliquot of
fetal liver cells (2 × 106/ml) in 1× RPMI medium was
infected with 1 ml of filtered supernatant of a culture of Abelson
murine leukemia virus producer line ABO10 grown to saturation in
Dulbecco modified Eagle medium-10% FCS-50 µg of gentamicin/ml. The
infection was carried out at 37°C and 5% CO2 for 4 h in the presence of 4 µg of Polybrene/ml. The infected cells were
then plated in 1× RPMI-20% FCS-50 µM 2-mercaptoethanol-0.3% agar (Noble-Difco). After 8 to 12 days, colonies were picked from the
agar and expanded in liquid culture in 1× RPMI medium.
Pre-B-cell primary culture system.
The 16.5-day fetal livers
were disaggregated, and the fetal liver cells were resuspended in a
solution of 1× RPMI, 20% FCS, 50 µM 2-mercaptoethanol, 50 µg of
gentamicin/ml, and 1 ng of interleukin 7 (IL-7)/ml. The cell
suspensions were allowed to form their own feeder layers and were
cultured for up to 11 days. When cultures were maintained for longer
periods (up to 3 weeks), the cells were subcultured onto ST-2 stromal
cell feeder layers (32, 34).
DNA analysis.
DNA was extracted from one-fourth of each
fetal liver as well as from the fetal head and placenta. After phenol
extraction and digestion with restriction enzymes, 5 µg of each
sample was separated on 0.6% agarose gels. The transgene fragments
were distinguished from the endogenous genes by the presence of an
EcoRI site in the
5 and
VpreB1 tags. Southern blotting and hybridization
with nick-translated probes was carried out by standard procedures. The
blots were scanned with a phosphorimager, and the results were used to
calculate the transgene copy number. Single-copy integrations were
confirmed by end fragment analysis (5). Transgene integrity
was verified by a combination of Southern blotting with restriction
fragments specific for the transgene and PCR analysis with one primer
derived from the oligonucleotide tag and a second primer from the 5' or
3' region of the gene.
RNA analysis.
RNA was obtained from 16.5-day fetal livers or
transgenic pre-B-cell lines by lithium chloride extraction (reference
1; described in detail in reference
5) and subjected to RNase protection analysis. The
riboprobes were synthesized from 1 µg of pGEMT-derived DNA template
by using the Promega riboprobe system-Sp6 kit. The Promega RNase ONE
kit was used for the RNase protection assay, following conditions of
hybridization and RNase ONE digestion suggested by the manufacturer.
Briefly, the riboprobe was resuspended in 100 µl of hybridization
buffer, and the RNA samples were dried under vacuum and resuspended in
25 µl of hybridization buffer-5 µl of riboprobe. The hybridization
was carried out overnight at 42°C. Digestion was carried out with 1.5 U of RNase ONE per µg of RNA, in RNase ONE buffer at 33°C for
1 h. The digested RNA samples were ethanol precipitated and
separated by electrophoresis on a 4% polyacrylamide-8 M urea
sequencing gel. The protected bands were quantified on a
phosphorimager, and the transgene expression level was normalized to
the expression derived from a single endogenous allele. RNA analysis in
tissues that do not express the endogenous
5 and
VpreB1 genes was carried out with the
-actin
transcript as a loading control. For this purpose, a riboprobe
complementary to a 305-bp region of
-actin mRNA (obtained by PCR
with primers 5' GGGCGCCCGGTTCTTTTTG 3' and 5'
ACACCCAGCCGGCCACAGTCG 3' and cloned in pGEMT) was labelled at
1/10 of the specific activity of the
5 probe and was added to the
hybridization mixture.
DNase I HS mapping.
Nuclei were prepared from a minimum of
2 × 108 cells as described previously (8),
using 20 strokes of a B-type Dounce homogenizer. The nuclei were
resuspended in 1 ml of 1× reticulocyte standard buffer, and aliquots
of 100 µl were digested with increasing volumes of 0.05 µg of DNase
I/ml (from 0.5 to 10 µl) for 4 min at 37°C. The reactions were
stopped, the products were digested with proteinase K, and the DNA was
phenol-chloroform extracted and ethanol precipitated. The DNA was
resuspended in 100 µl, and 20 µl was digested with restriction
enzymes and separated by electrophoresis on a 0.6% agarose gel in 1×
Tris-borate-EDTA and analyzed by Southern blotting (see the legend to
Fig. 2 for details of the probe).
PCR analysis of transgene integration in
-satellite DNA.
The strategy used for PCR analysis of transgene integration in
-satellite DNA was based on the tagged-primer method of Jeffreys et
al. (16). The sequences of the primers used were as follows: primer 1, 5' TCATGCGTCCATGGTCCGGGGACCTGGAATATGGCGAG 3';
primer 2, 5' CCGGTTGTGGTTGGGATGC 3'; and primer 3, 5' TCATGCGTCCATGGTCCGG 3'. Thirty picomoles of primers 2 and
3 and 0.5 pmol of primer 1 were used in a 30-µl PCR to amplify 25 ng
of genomic DNA in PCR buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin), 0.2 mM deoxynucleoside
triphosphates, and 0.5 U of Amplitaq (Perkin-Elmer). The PCR conditions
of amplification were derived from the protocol of Jeffreys et al.
(16). The first nine cycles (94°C for 45 s; 55°C
for 1 min; 72°C for 2 min 30 s) allowed amplification between
the
-satellite-specific primer 1, containing at the 5' end a tag of
19 nucleotides (nt), and the
5-specific primer 2. These
were followed by 11 cycles (94°C for 45 s; 66°C for 1 min;
72°C for 2 min 30 s, with an increment of 10 s/cycle). The
higher annealing temperature used for the second round of cycles
favored amplification from primer 2 and primer 3 (corresponding to the
tag of oligonucleotide 1) of the product generated in the first nine cycles.
FISH.
For fluorescence in situ hybridization (FISH) cells
were hypotonically swollen in 0.056 M KCl and fixed in 3:1
methanol-acetic acid, and slides were made. The slides were pretreated
with 100 µg of RNase A/ml in 2× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate) for 1 h at 37°C, washed in 2× SSC, and
put through an ethanol dehydration series (70, 90, and 100% ethanol).
The chromosomes were denatured at 70°C for 5 min in 70%
formamide-2× SSC, plunged into ice-cold 70% ethanol, and dehydrated
as before. One hundred nanograms of probe (fragment L5F4 labelled with
biotin by nick translation) was precipitated with 1 µg of cot-1 DNA
and 5 µg of salmon sperm DNA; resuspended in 50% formamide-2×
SSC-1% Tween 20-10% dextran sulfate; denatured at 75°C;
preannealed for 15 min at 37°C; and applied to the slides.
Hybridization was carried out overnight at 37°C. The slides were
washed four times for 3 min each time in 50% formamide-2× SSC at
45°C, four times for 3 min each time in 2× SSC at 45°C, and four
times for 3 min each time in 0.1× SSC at 60°C. After being washed
for 5 min in 4× SSC-0.1% Tween 20, the slides were blocked for 5 min
in 4× SSC-5% low-fat skim milk. The biotin was detected by 30 min of
incubation at 37°C with each of the following: avidin-conjugated
fluorescein isothiocyanate (FITC) (Vector) followed by biotinylated
anti-avidin (Vector) and avidin-conjugated FITC. Between every two
incubations, the slides were washed three times for 2 min each time in
4× SSC-0.1% Tween 20. The slides were mounted and counterstained
with 1.25 mg of DAPI (4',6-diamidino-2-phenylindole) in Vectashield
(Vector). Images were examined with an oil ×100 objective on a Leica
DMRB fluorescence microscope with a Pinkel no. 1 filter set. The images were captured with a Photometrics cooled charge-coupled device camera
and Vysis Smartcapture software.
 |
RESULTS |
A minimal
5 transgene expresses efficiently in mice
with multiple copies of transgenes but not in mice with single-copy
integrations.
In order to identify the control elements involved
in the transcriptional regulation of the
5 gene, we
carried out a functional analysis in transgenic mice, using fragments
containing the gene and various amounts of flanking sequence. A 36-bp
sequence tag was inserted immediately downstream of the ATG, allowing a
direct comparison of the levels of transgene and endogenous transcripts by RNase protection analysis. Since the fetal liver contains large numbers of pro- and pre-B cells, expression was measured in livers from
fetuses dissected at 16.5 days postinjection, when
5
expression was maximal. In addition, pre-B cells from some transgenic
livers were immortalized with Abelson murine leukemia virus to produce clonal transgenic pre-B-cell lines. A third approach involved culturing
cells directly from fetal livers in the presence of IL-7. Culture under
these conditions results in preferential expansion of pre-B cells (see
Materials and Methods). The use of transformed cell lines and primary
cultures containing relatively pure populations of
5- and
VpreB1-expressing cells gave an increased signal
for both the endogenous genes and the transgenes, facilitating
quantitation of transgene expression.
Figure 1A shows the analysis of a
fragment (L5F1) containing the
5 gene with 410 bp of
sequence upstream of the ATG and 1 kb downstream of the poly(A) site.
It can be seen that a proportion of the transgenics (e.g., L-26, L-42,
and C-11) express the
5 gene at levels (per transgene
copy) that are comparable to the levels from the endogenous gene. In
addition to the expressing transgenics, a number of animals (L-24,
L-28, L-29, and L-41) either fail to express the transgene at all or
express it only at very low levels. Inspection of the transgene copy
numbers (Fig. 2) shows that the
expressing animals consistently carry three or more copies of the gene
while those that fail to express the transgene or express it at low
levels have one or two copies. Multiple-copy transgenes in mice are
arranged as head-to-tail tandem repeats, raising the possibility that
some of the signal might be the result of readthrough transcription
through the array. This possibility was excluded by analyzing the
5 transcripts with a probe that extends across the
promoter (Fig. 1B). The results obtained with fragment L5F1 lead us to
conclude that the tandem arrangement of the transgene creates a
structure which can drive efficient position-insensitive expression in
chromatin and therefore has some of the properties of an LCR.
Expression of the
5 gene in this and other constructs
analyzed in this study reached a plateau in animals with high copy
numbers (>20 copies). This plateau effect, which has also been
observed for the
-globin LCR (37), could be due to
limiting levels of transcription or RNA stabilization factors.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Expression analysis of 5 in mice
transgenic for fragment L5F1. The map shows the
5-VpreB1 locus and the location of fragment
L5F1. B, BamHI; E, EcoRI; P, PstI; S,
SphI. Analysis was carried out on 25 µg of RNA from
16.5-day fetal livers (samples L ) and 3 µg of RNA from Abelson
virus-transformed pre-B-cell lines (samples C ). The probe was a
498-bp sequence (probe A) derived from the 5 cDNA,
extending from the BglII site at +65 (downstream of all
mapped transcription initiation sites) to the RsaI site in
exon 3 and including a 36-nt tag immediately downstream of the first
ATG of the gene (see Materials and Methods). The protected fragments
were 498 bp for the 5 transgene (tg) and 412 bp for the
endogenous 5 (wild type [wt]). The transgene copy number is
indicated at the bottom of each lane. Band intensities were quantified
with a phosphorimager. The histograms show the expression level
(normalized to the expression of one allele of the endogenous
5) versus the copy number of each transgenic mouse. (B)
Mapping of transcription initiation sites of the 5
transgene in cell lines (C-11 and C-12) transgenic for the L5F1
fragment. The pattern of initiation was compared with that of a cell
line (C-21) transgenic for the complete locus (2 kb 5' of
VpreB1 to 15 kb 3' of 5) and with
the nontransgenic pre-B-cell line 122-1 (ntg). RNase protection was
carried out with 5 µg of RNA for line C-21 (which contains 16 copies
of the large locus fragment) and 10 µg of RNA for lines C-11, C-12,
and 122-1. The probe (probe B) extends from 281 bp upstream of the
first ATG of the gene to the end of the 36-nt tag (see Materials and
Methods). The segment of the probe downstream of the ATG is derived
from the 5 cDNA and extends to the AvrII site
305 bp from the ATG. This probe includes all previously mapped
5 transcription initiation sites. The numbers refer to
the sizes of the marker bands. As the riboprobe contains the tag, all
the transcripts derived from the endogenous 5 give rise
to a protected fragment of 305 bp (endog.). The major transcription
starting sites correspond to those mapped for the wild-type
5 (+1, +13, and +35) (23, 25). Readthrough
transcripts would give an additional protected fragment of 622 bp and
are not present in significant amounts. (C) RNA was analyzed from
brain, liver, spleen, muscle, and thymus tissues obtained from
10-week-old animals from line 42 and was compared with expression in
16.5-day fetal liver (L-42) from the same line. In the RNase protection
assay, 25 µg of RNA from fetal liver and 40 µg of RNA from the
other tissues were hybridized to probe A. A -actin-specific
riboprobe was added to each reaction mixture as a loading control.
|
|

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 2.
Transgene copy number analysis for L5F1 and L5F3
transgenic mice. Five micrograms of fetal liver DNA (samples L ) or
pre-B-cell line DNA (samples C ) was digested with EcoRI,
Southern blotted, and hybridized to a 446-bp 5 probe
extending from the PstI site at position 296 to the
EcoRI site at the 3' end of the tag. Since the probe is
located at the ends of the constructs, it detects end fragments of
different sizes, depending on the location of EcoRI sites
close to the site of integration, and joining fragments resulting from
digestion of multiple-copy head-to-tail tandem repeats. The intensities
of the bands were measured by phosphorimager. endog., endogenous
5 band; J-L5F1 and J-L5F3, joining fragments for the two
constructs; ntg, nontransgenic cell line. Mice with a single copy of
the transgene give one end fragment (indicated by the arrows) and no
joining fragment. The integrity of the single- and two-copy
integrations was verified as described in Materials and Methods. The
presence of more than one end fragment indicates that there have been
additional integrations (although some of the smaller fragments
observed in mice with multiple copies of the transgene are likely to be
degradation products). Since copy numbers of animals with multiple
copies have been calculated from the intensities of the joining bands,
they refer only to the number of copies in the tandem array.
|
|
To determine whether expression from L5F1 showed correct
tissue-specific regulation, lines of transgenic mice carrying the fragment were generated. Figure 1C shows the analysis of different tissues from one of these lines, which carried three copies of the
transgene. Copy-dependent expression of the transgene was observed in
fetal liver, while no expression was observed in the spleen, thymus,
liver, muscle, and brain. We conclude from this that fragment L5F1
contains sufficient information to give efficient, tissue-specific
expression of the
5 gene. Since immature and mature B
cells make up 50% of spleen cells, we can also conclude that transgene
expression is silenced at these stages and is therefore subject to
stage-specific regulation during B-cell development.
A 410-bp
5 promoter fragment is capable of giving
high-level expression of a reporter gene.
A recent study has shown
that the ectopic expression of the transcription factors EBF and E47
activates endogenous
5 and VpreB1
expression in an early pro-B-cell line (36). Since the
5 promoter contains binding sites for these factors, we
considered the possibility that the promoter directly contributes to
the LCR-like activity observed with tandem repeats of L5F1. To test whether this was the case, a 410-bp fragment 5' of
5
(from the PstI site to the ATG of the gene) was cloned
upstream of the coding region of a human
-globin gene. This region
contains approximately 300 bp upstream of the main transcription
initiation site for
5 (Fig.
3). Pre-B cells from livers of 16.5-day
fetuses transgenic for this construct were cultured in the presence of
IL-7 (see Materials and Methods and the legend to Fig. 3).
Fluorescence-activated cell sorter analysis of the cultured cells
showed that they were >99% B220 positive. The four transgenics
obtained carried the fragment in multiple-copy tandem arrays (between 3 and 30 copies), and all expressed the
5-
-globin fusion
transcript (Fig. 3). Three animals (PC-6, PC-7, and PC-8) gave an
expression per copy that was between two- and eightfold higher than
that of endogenous
5. The stronger signal observed for
the transgene could be due in part to differences between the
hybridization efficiencies of the two probes, but it could also be
caused by the greater stability of the
-globin transcript. The
fourth transgenic (PC-9), which had the highest copy number (30 copies), expressed the transgene at a level that was much lower than
expected. Thus, the promoter alone is able to drive high-level
expression of the transgene in pre-B cells of mice with multiple copies
of the transgene, although this expression is more sensitive to
position effects than that obtained with the 4.5-kb minimal
5 transgene (L5F1). As with all experiments using
reporter gene constructs, we cannot say whether the increased
sensitivity to position is due to the absence of sequences in the
5 gene or the introduction of foreign sequences in the
reporter gene that might interfere with interactions in the tandem
repeats.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
Expression analysis of the human -globin gene under
the control of the 5 promoter. The level of human
-globin transcript was compared to the level of the endogenous
5 by using probes specific for the two genes. RNase
protection was carried out by hybridizing 20 µg of RNA extracted from
fetal liver cell primary cultures (PC ) grown in the presence of IL-7
to a -globin-specific probe (probe D) containing the 296-bp
NcoI-BamHI fragment of the -globin cDNA. The
5-specific probe A was also included in the
hybridizations. The table shows the level of expression of -globin
normalized to the expression of one endogenous (endog.) 5
allele. The schematic diagram of the 5 promoter shows
binding sites for EBF, E47, and Ikaros (Ik) together with their
positions relative to the major transcription start site. ntg,
nontransgenic cell line.
|
|
Location of candidate LCR sequences by DNase I HS mapping.
The
minimal 4.5-kb
5 gene fragment, while displaying LCR
activity in multiple-copy integrations and giving tissue-specific expression of
5, was unable to promote efficient
transcription in transgenic mice carrying one or two copies of the
transgene. Since the gene in its normal location is present as a single
copy, we set out to determine whether additional flanking sequences could give efficient expression at low copy numbers. Previous reports
of a series of DNase I HS 3' of the
5 gene
(42) suggested to us that this region might contain part of
the LCR. To determine the precise location of the HS surrounding the
gene, we carried out DNase I sensitivity analysis on the flanking
sequences in nuclei from the pre-B-cell line 122-1 (obtained by Abelson
virus transformation of fetal liver cells) and the B-cell line
WEHI-231. The results are shown in Fig.
4.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
DNase I HS mapping of the regions flanking the
5 gene. (A) Map of the 5 gene and
surrounding regions. B, BamHI; Bg, BglII; P,
PstI; S, SphI. (B) DNase I HS 5' of
5. Pre-B-cell line 122-1 and B-cell line WEHI-231 nuclei
were digested with increasing amounts of DNase I, and genomic DNA was
extracted and digested with SphI, followed by
electrophoresis and Southern blotting. The blot was hybridized to a
probe spanning the third exon of 5 (0.6-kb
SacI-SphI fragment). (C) DNase I HS 3' of
5. DNase I-treated DNA was digested with BglII
and probed with the 0.6-kb SacI-SphI fragment.
HS1 to -6 were mapped against restriction fragments derived from
partial digestion of the BglII fragment with
HindIII (H), PstI (P), and SphI
(S).
|
|
In the pre-B-cell line 122-1, the region containing the
5
promoter is strongly hypersensitive and two additional HS (HS6 and HS7)
are detected approximately 1.5-kb 5' of the gene (Fig. 4B). No HS were
found in the 5' region of
5 in the B-cell lines WEHI-231,
J558L, and Bal-17 (Fig. 4B and data not shown). A total of five HS were
detected between 2 and 6 kb downstream of the
5 gene in
cell line 122-1 (Fig. 4C). The strongest of these sites, HS1, is also
found in IgM-producing WEHI-231 cells, which are derived from a B-cell
lymphoma and represent the immature-B-cell stage (21) (Fig.
4C). HS1 was also observed in the Ig
-expressing myeloma cell line
J558L (13) and in the mature-B-cell line Bal-17 (17), which do not express
5 or
VpreB (data not shown). The remaining sites (HS2
to -5) are only observed in the pre-B-cell line. A set of HS were
previously identified in the same region in the early-pre-B-cell line
70Z/3 (42), while no HS were found 3' of
5 in
J558L cells in the same study. Our finding that HS-1 is present in
WEHI-231, Bal-17, and J558L cells shows that this site is present after
the genes have been silenced during B-cell maturation. The discrepancy
between our results and those of Yang et al. may be due to the use of
different sublines of J558L.
Position-insensitive expression of
5 in mice with
one and two copies of the transgene requires the presence of the 3'
HS.
To investigate the sequence requirements for expression of
5 in single-copy integrations, constructs containing
additional 5' and 3' flanking sequences (Fig.
5) were analyzed in transgenic fetal
livers and Abelson virus-transformed cell lines. The addition of 1 kb
of 5' sequence (L5F2) failed to rescue the impaired expression in
animals with one and two copies of the transgene, as was observed in
L5F1. In fact, the additional sequences appeared to further reduce the
functioning of the transgene, with low expression observed in four of
five mice with multiple copies of the transgene (L-19, L-21, C-4, and
C-9). The 5' region does not include HS6 and -7, and no other HS have
been mapped within it. The weak expression of L5F2 suggests that the
LCR effect of tandem repeats may be quite sensitive to the
configuration and/or sequence composition of the repeated fragment.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
Expression analysis of 5 in mice and
Abelson virus-transformed pre-B-cell lines transgenic (tg) for
fragments L5F2, L5F3, and L5F4. A map of the fragments is shown at the
top. The RNase protection assay was carried out as described in
Materials and Methods and in the legend to Fig. 1. wt, wild type; cn,
copy number.
|
|
In contrast, the addition of a 6-kb region containing the HS 3' to the
minimal
5 gene gave good expression in an animal with a
single copy of the transgene and in an animal with two copies (L5F3,
L-13, and L-9; see Fig. 2 for copy number determination). Fragment
L5F4, which contains both 5' and 3' flanking sequences, also expressed
the gene efficiently in two animals carrying two transgene copies (L-1
and L-4). Both constructs gave copy-dependent expression in mice with
multiple copies of the transgene. Expression of L5F4 in adult animals
from line L8 was also found to be tissue and stage specific (data not
shown). A strong positive position effect was observed in one of the
L5F3 transgenics (C-1). This was not unexpected, since it is known that
LCRs do not insulate transgenes from positive position effects
(4). We conclude from these results that the presence of the
3' HS rescues expression of
5 in single- and two-copy
integrations and counteracts the inhibitory effect of the 5' sequences
in mice with multiple copies of the transgene. Our data indicate that
the 10-kb fragment containing the 3' HS together with the
5 gene and 300 bp of promoter sequence has the properties
of an LCR.
Coordinate regulation of the VpreB1 and
5 genes.
The proximity of the
5 and
VpreB1 genes to one another and the fact that
they are coexpressed raises the possibility that they are coordinately
regulated by shared elements. To compare the regulation of the two
genes, we generated transgenics by using a fragment containing only the
VpreB1 gene (Fig.
6). Because the smaller probe used to
analyze VpreB1 expression gave a weak signal for
RNA extracted from whole fetal liver, VpreB1
expression was analyzed only in cell lines and primary fetal liver cell
cultures. Five transgenics were obtained for the fragment Vp1 and
analyzed by culturing pre-B cells from fetal liver in IL-7. Four of the transgenics contained the gene in multiple-copy tandem arrays (3 to 14 copies) and gave efficient copy-dependent expression, apart from one
positive position effect (PC-3). A fifth animal (PC-2) contained two
copies of the transgene and expressed it at very low levels. Thus, the
VpreB1 transgene appears to behave in a way
similar to that of
5, suggesting that it might also depend on the presence of the 3' HS for efficient expression in single-copy integrations. To directly test whether this is the case, we
analyzed the functioning of large constructs containing both genes in
the presence and absence of the 3' HS (L5F6 and L5F5) (Fig.
7). The analysis of
5
expression for the two constructs is shown in Fig. 7A. A single-copy
transgene containing the 3' HS gave good expression (Fig. 7A, L5F6,
lane C-20), while a single-copy integration lacking the 3' HS gave
expression that was sevenfold lower (Fig. 7A, L5F5, lane C-15).
Expression of VpreB1 was reduced by a similar
amount in the single-copy integration that lacked the 3' HS (Fig. 7B,
compare lanes C-20 and C-15). Interestingly, the relative levels of
VpreB1 observed in the mouse with 14 copies of
the transgene L5F5, C-13, are 2.5-fold lower than those of
5, suggesting a loss of coordinate regulation of the
genes in this construct. The finding that VpreB1
alone and in conjunction with
5 fails to express
efficiently in transgenics with low copy numbers (Fig. 6, lane PC-2,
and Fig. 7B, lane C-15) leads us to conclude that the 3' HS are
involved in activating both genes and form part of an LCR for the
entire locus. The importance of the 3' region is further illustrated by
the summarized data for all of the constructs shown in Table
1. Of 19 transgenics with low copy
numbers for constructs that lack the 3' HS, 15 either failed to express
the transgenes or expressed them at low levels. In the presence of the
HS, five of five transgenics with low copy numbers gave good
expression.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Expression analysis of VpreB1 in
primary cultures of fetal liver cells transgenic for fragment Vp1. The
primary cultures were grown as described in Materials and Methods.
Twenty micrograms of each RNA was used in the RNase protection assay.
The VpreB-specific probe (probe C) spanned the
KpnI-AccI region of VpreB1
exon 2 and contained a 35-bp tag (see Materials and Methods) inserted
in the PstI site. The size of the protected fragments is 288 bp for the VpreB1 transgene (tg) and 146 bp for
the endogenous VpreB1 (wt). Mice have a second
VpreB gene (VpreB2),
which differs from VpreB1 by a single-base
substitution in the protected region. We cannot exclude the possibility
that some of the endogenous signal arises from
VpreB2 as a result of incomplete RNase digestion
at the base mismatch. cn, copy number.
|
|

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Analysis of 5 expression in mice
transgenic for fragments L5F5 or L5F6. The RNase protection assay for
the analysis of 5 expression was carried out as described
in Materials and Methods and in the legend to Fig. 1. (B) RNase
protection analysis to measure VpreB1
expression. Ten micrograms of RNA from transgenic pre-B-cell lines was
hybridized to probe C (see the legend to Fig. 6). The histograms
compare the expression of VpreB1 (solid bars)
with that of 5 (shaded bars) for each cell line. tg,
transgene; wt, wild type; ntg, nontransgenic cell line; cn, copy
number.
|
|
The
5 LCR can activate transcription in centromeric
heterochromatin.
A defining feature of LCRs is the fact that they
are dominant over inhibitory position effects, including those that
result from integration close to heterochromatin (7, 28). In
order to test whether the
5 LCR can function efficiently
in centromeric heterochromatin, we used a novel PCR-based assay to
screen the
5 transgenics for integrations into
-satellite DNA, the major satellite component of centromeric
heterochromatin in the mouse. The advantage of this approach is that it
detects transgenes that are directly integrated into centromeric
satellite DNA and provides an extremely stringent test of whether an
LCR can function in heterochromatin. Amplification of DNA from cell
line C-3 (L5F3) gave a ladder of fragments which was diagnostic for the
presence of
-satellite repeats flanking the transgene (Fig.
8A). Cloning and sequencing of the PCR
product showed that
5 and
-satellite sequences were
present on the same fragment. FISH analysis confirmed that the
transgene was indeed located in centromeric DNA (Fig. 8B). Transgenic
C-3 contains seven copies of the transgene and expresses it at 10 times
the level of each endogenous
5 allele (Fig. 5). This is
within the range of variation for the RNase protection assay and shows
that the
5 LCR gives full copy-dependent expression even
when integrated into constitutive heterochromatin.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
(A) PCR amplification of the 5 transgene
integrated in -satellite DNA in pre-B-cell line C-3. A scheme of the
PCR procedure described in Materials and Methods is shown. The PCR
product was detected by Southern blotting and probing with a
5-specific probe. (B) Centromeric localization of the
5 transgene in pre-B-cell line C-3 by FISH.
|
|
 |
DISCUSSION |
LCRs are dominant activating sequences that are able to activate
gene expression at any location in the genome. In this study we
describe the identification of an LCR in the pro- and
pre-B-cell-specific
5-VpreB1 locus. Detailed
characterization of the LCR involved a comparison of expression in
transgenic mice with low copy numbers (one or two copies) and with
multiple copies of the transgene (greater than three copies). This
analysis has revealed two quite different types of behavior, depending
on the transgene copy number. In transgenic mice with one or two
copies, efficient and position-independent expression of both genes
requires the presence of a region located 3' of the locus. This region
resembles previously described LCRs, which are composed of clusters of
DNase I HS. However, a shorter fragment containing the
5
gene and lacking the 3' HS gave full position-independent and
copy-dependent expression when present in tandem repeats of three or
more copies. Similar behavior was observed with a fragment containing
the VpreB1 gene. We conclude from these results
that the shorter fragments contain elements that are capable of
functioning as LCRs when they are reiterated in multiple-copy tandem
repeats. Since these elements can cooperate to give rise to an LCR
effect, it is reasonable to suppose that they form part of the LCR for
the complete locus.
What are the sequences that are responsible for the LCR-like behavior
of the minimal gene fragments in tandem repeats? Within the minimal
5 gene fragment, the strong HS on the
5
promoter is the only HS that has been detected, making it a good
candidate for mediating the LCR effect observed with tandem repeats of
this fragment. This is supported by the observation that the promoter has enhancer activity in transient expression assays (25,
42) and the observation in this study that a 410-bp
5 promoter fragment linked to a
-globin reporter gene
gave expression in all of the multiple-copy transgenic mice analyzed.
The levels of expression observed were also much higher than is
generally observed with minimal promoter fragments. For example, the
promoter of the related
1 Ig gene gives no expression in
mice with multiple copies of the transgene in the absence of additional
distal HS (6, 12, 22a). However, the expression from the
5 promoter was not completely position insensitive,
possibly because of interference by the
-globin sequences within the
repeated unit. A similar interference is also observed when a region of
1 kb 5' of the gene is added to the minimal
5 fragment
(L5F2), indicating that the configuration of the repeated unit is
critical for the LCR effect in tandem repeats.
The organization of the
5-VpreB1 LCR has a
number of important implications for ideas about LCR organization and
function in general. The distribution of the LCR components throughout the locus is quite different from that of the human
-globin locus, where the LCR is a discrete unit located some distance from the gene
cluster (11). The difference between the
5-VpreB1 and
-globin LCRs highlights two
different aspects of LCRs, namely, their role as dominant-positive
activators and the specific organization of LCR HS in individual loci.
The dominant activation function is clearly a widespread phenomenon and
is arguably the most important and defining feature of LCRs. On the
other hand, the arrangement of LCR components appears to be quite
flexible and is likely to be as much a product of evolutionary
contingency as of selection for specific functions.
A second implication of our results is the need to analyze single- and
multiple-copy integrations when analyzing gene regulation in transgenic
animals. An analysis that included only integrations of three or more
transgene copies would have given a quite different picture of the
organization of the regulatory elements in the
5-VpreB1 locus and would not have detected
the role of the 3' HS. An additional conclusion from our study relates
to recent findings that suggest that arrangement in multiple-copy
tandem repeats has an intrinsic silencing effect on transgene
expression (9, 14). Our results indicate that the opposite
effect (repression at single-copy levels and activation at
multiple-copy levels) is just as likely to be observed, suggesting that
repeats amplify the effects of inhibitory or activating sequences
present in the repeated sequence.
The complete unit required for efficient expression of the
5 and VpreB1 genes at single copy
extends over a 19-kb region and includes the five HS located 3' of
5. What are the determinants of tissue and stage
specificity within this functional unit? Four of the 3' sites are
present only in pre-B cells, while the strongest site, HS1, is also
detected in later stages of the B-cell lineage. The efficient
expression that is observed with the tandemly repeated minimal
5 transgene (L5F1) is also fully tissue and stage
specific, implying that sequences that are important for cell type
specificity reside in this fragment. A recent study showed that a
720-bp
5 promoter fragment gave tissue- and
stage-specific expression when placed upstream of a CD25-
-globin
reporter gene in transgenic mice (24), although expression
of the transgene was highly position sensitive, with only three of nine
transgenic lines with multiple copies giving expression. Taken
together, these results indicate that efficient tissue- and
stage-specific expression at single-copy levels involves both the
promoter and the 3' HS. Binding sites for EBF, E47, and Ikaros are
present in the promoter (22, 36), and ectopic expression of
EBF and E47 has been used to demonstrate the importance of these
factors for activating
5 and
VpreB1 expression (36). Sequence
analysis has also revealed the presence of consensus binding sites for
EBF, E47, and Ikaros in HS1 (data not shown). Further studies will be
required to analyze the dynamics of the interactions between these
elements and the roles played by the different regulatory elements in
the locus.
Recent studies have shown that the
-globin and CD-2 LCRs can give
efficient nonvariegated expression even when integrated in
pericentromeric regions (7, 28). In this study, we have taken this type of analysis a step further by using a PCR assay to
identify a centromeric integration that is directly flanked by
centromeric
-satellite DNA. The fact that the transgene in this
integration gives full copy-dependent expression demonstrates that the
5 LCR is able to activate expression in pre-B cells even
when directly flanked by heterochromatin-forming sequences. Nuclear-localization studies have shown that the
5-VpreB1 locus colocalizes with
Ikaros-centromeric
-satellite clusters in nonexpressing mature-B-cell lines but not in expressing pre-B-cell lines
(2). This finding raises the possibility that nuclear
localization plays a role in silencing and cellular memory. Our results
provide important additional information on this phenomenon by showing that localization to the heterochromatin compartment is not in itself
sufficient to give silencing when the full spectrum of factors is
present. The available data supports a model where silencing is the
product of a combination of changes in the factor profile and the
position of the gene in the nucleus.
The identification of the
5-VpreB1 LCR
provides the means for obtaining reproducible levels of expression of
the
5 and VpreB1 genes. This
should facilitate studies that aim to test this type of model. In
particular, it will now be possible to carry out mutagenesis studies to
determine the precise role of Ikaros and other transcription factors in
regulating expression of the locus.
 |
ACKNOWLEDGMENTS |
We thank Norman Thompson and Donna Hawkesworth for technical
assistance. We are grateful to Niels Gelhardt for providing the 129SV
cosmid library. We thank Amanda Fisher, Matthias Merkenschlager, and
Mauro Santibanez-Koref for discussions and critical reading of the manuscript.
This work was supported by the Medical Research Council, United Kingdom.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Gene Regulation
and Chromatin Group, MRC Clinical Sciences Centre, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Rd., London W12 0NN,
United Kingdom. Phone: 44 181 383 8233. Fax: 44 181 383 8338. E-mail:
ndillon{at}rpms.ac.uk.
 |
REFERENCES |
| 1.
|
Auffray, C., and F. Rougeon.
1980.
Purification of mouse immunoglobulin heavy-chain messenger RNAs from total myeloma tumour RNA.
Eur. J. Biochem.
107:303-314[Medline].
|
| 2.
|
Brown, K. E.,
S. S. Guest,
S. T. Smale,
K. Hahm,
M. Merkenschlager, and A. G. Fisher.
1997.
Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin.
Cell
91:845-854[Medline].
|
| 3.
|
Caterina, J. J.,
T. M. Ryan,
K. M. Pawlik,
R. D. Palmiter,
R. L. Brinster,
R. R. Behringer, and T. M. Townes.
1991.
Human beta-globin locus control region: analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice.
Proc. Natl. Acad. Sci. USA
88:1626-1630[Abstract/Free Full Text].
|
| 4.
|
Dillon, N., and F. Grosveld.
1993.
Transcriptional regulation of multigene loci: multilevel control.
Trends Genet.
9:134-137[Medline].
|
| 5.
|
Dillon, N., and F. Grosveld.
1993.
Transcriptional analysis using transgenic animals, p. 153-188.
In
B. D. Hames, and S. J. Higgins (ed.), Gene transcription: a practical approach. IRL Press, Oxford, United Kingdom.
|
| 6.
|
Eccles, S.,
N. Sarner,
M. Vidal,
A. Cox, and F. Grosveld.
1990.
Enhancer sequences located 3' of the mouse immunoglobulin lambda locus specify high-level expression of an immunoglobulin lambda gene in B cells of transgenic mice.
New. Biol.
2:801-811[Medline].
|
| 7.
|
Festenstein, R.,
M. Tolaini,
P. Corbella,
C. Mamalaki,
J. Parrington,
M. Fox,
A. Miliou,
M. Jones, and D. Kioussis.
1996.
Locus control region function and heterochromatin-induced position effect variegation.
Science
271:1123-1125[Abstract].
|
| 8.
|
Forrester, W. C.,
E. Epner,
M. C. Driscoll,
T. Enver,
M. Brice,
T. Papayannopoulou, and M. Groudine.
1990.
A deletion of the human beta-globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta-globin locus.
Genes Dev.
4:1637-1649[Abstract/Free Full Text].
|
| 9.
|
Garrick, D.,
S. Fiering,
D. I. K. Martin, and E. Whitelaw.
1998.
Repeats-induced gene silencing in mammals.
Nat. Genet.
18:56-59[Medline].
|
| 10.
|
Greaves, D. R.,
F. D. Wilson,
G. Lang, and D. Kioussis.
1989.
Human CD2 3'-flanking sequences confer high-level, T cell-specific, position-independent gene expression in transgenic mice.
Cell
56:979-986[Medline].
|
| 11.
|
Grosveld, F.,
G. B. van Assendelft,
D. R. Greaves, and G. Kollias.
1987.
Position-independent, high-level expression of the human beta-globin gene in transgenic mice.
Cell
51:975-985[Medline].
|
| 12.
|
Hagman, J.,
D. Lo,
L. T. Doglio,
J. Hackett, Jr.,
C. M. Rudin,
D. Haasch,
R. Brinster, and U. Storb.
1989.
Inhibition of immunoglobulin gene rearrangement by the expression of a lambda 2 transgene.
J. Exp. Med.
169:1911-1929[Abstract/Free Full Text].
|
| 13.
|
Halpren, M. S., and R. Coffman.
1972.
Polymer formation and J-chain synthesis in mouse plasmacytomas.
J. Immunol.
109:674-682[Abstract/Free Full Text].
|
| 14.
|
Henikoff, S.
1998.
Conspiracy of silence among repeated transgenes.
Bioessays
20:532-535[Medline].
|
| 15.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. Pullen, and L. R. Pease.
1989.
Site directed mutation by overlap extension using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 16.
|
Jeffreys, A. J.,
A. MacLeod,
K. Tamaki,
D. L. Neil, and D. G. Monckton.
1991.
Minisatellite repeat coding as a digital approach to DNA typing.
Nature
354:204-209[Medline].
|
| 17.
|
Kim, K. J.,
C. Kanellopoulos-Langevin,
R. M. Merwin,
D. H. Sachs, and R. Asofsky.
1979.
Establishment and characterisation of BALB/c lymphoma lines with B cell properties.
J. Immunol.
122:549-554[Abstract/Free Full Text].
|
| 18.
|
Kitamura, D.,
A. Kudo,
S. Schaal,
W. Muller,
F. Melchers, and K. Rajewsky.
1992.
A critical role of lambda 5 protein in B cell development.
Cell
69:823-831[Medline].
|
| 19.
|
Kudo, A., and F. Melchers.
1987.
A second gene, VpreB in the lambda5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes.
EMBO J.
6:2267-2272[Medline].
|
| 20.
|
Kudo, A.,
N. Sakaguchi, and F. Melchers.
1987.
Organization of the murine Ig-related lambda 5 gene transcribed selectively in pre-B lymphocytes.
EMBO J.
6:103-107[Medline].
|
| 21.
|
Lanier, L. L., and N. L. Warner.
1981.
Cell cycle related heterogeneity of Ia antigen expression on a murine lymphoma cell line: analysis by flow cytometry.
J. Immunol.
126:626-631[Abstract].
|
| 22.
|
Lo, K.,
N. R. Landau, and S. T. Smale.
1991.
LyF-1, a transcriptional regulator that interacts with a novel class of promoters for lymphocyte-specific genes.
Mol. Cell. Biol.
11:5229-5243[Abstract/Free Full Text].
|
| 22a.
| MacNeil, A., and N. Dillon. Unpublished data.
|
| 23.
|
Mai, S., and I. L. Martensson.
1995.
The c-myc protein represses the lambda 5 and TdT initiators.
Nucleic Acids Res.
23:1-9[Abstract/Free Full Text].
|
| 24.
|
Martensson, I.,
F. Melchers, and T. H. Winkler.
1997.
A transgenic marker for mouse B lymphoid precursors.
J. Exp. Med.
185:653-661[Abstract/Free Full Text].
|
| 25.
|
Martensson, I. L., and F. Melchers.
1994.
Pre-B cell-specific lambda 5 gene expression due to suppression in non-pre-B cells.
Int. Immunol.
6:863-872[Abstract/Free Full Text].
|
| 26.
|
Melchers, F.
1995.
The role of B cell and pre-B cell receptors in development and growth control of the B-lymphocyte cell lineage, p. 33-56.
In
T. Honjo, and F. W. Alt (ed.), Immunoglobulin genes. Academic Press, London, United Kingdom.
|
| 27.
|
Melchers, F.,
H. Karasuyama,
D. Haasner,
S. Bauer,
A. Kudo,
N. Sakaguchi,
B. Jameson, and A. Rolink.
1993.
The surrogate light chain in B-cell development.
Immunol. Today
14:60-68[Medline].
|
| 28.
|
Milot, E.,
J. Strouboulis,
T. Trimborn,
M. Wijgerde,
E. de Boer,
A. Langeveld,
K. Tan Un,
W. Vergeer,
N. Yannoutsos,
F. Grosveld, and P. Fraser.
1996.
Heterochromatin effects on the frequency and duration of LCR-mediated gene transcription.
Cell
87:105-114[Medline].
|
| 29.
|
Minegishi, Y.,
E. Coustan-Smith,
Y. Wang,
M. D. Cooper,
D. Campana, and M. Conley.
1998.
Mutations in the human 5/14.1 gene result in B cell deficiency and agammaglobulinemia.
J. Exp. Med.
187:71-77[Abstract/Free Full Text].
|
| 30.
|
Molnár, Á., and K. Georgopoulos.
1994.
The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins.
Mol. Cell. Biol.
14:8292-8303[Abstract/Free Full Text].
|
| 31.
|
Murre, C.,
P. Schonleber-McCaw,
H. Vaessin,
M. Caudy,
L. Y. Jan,
Y. N. Jan,
C. V. Cabrera,
J. N. Buskin,
S. D. Hauschka,
A. B. Lassar, et al.
1989.
Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence.
Cell
58:537-544[Medline].
|
| 32.
|
Ogawa, M.,
S. Nishikawa,
K. Ikuta,
F. Yamamura,
M. Naito,
K. Takahashi, and S. I. Nishikawa.
1988.
B cell ontogeny in murine embryo studied by a culture system with the monolayer of a stroma cell clone, ST-2: B cell progenitor develops first in the embryonal body rather than in the yolk sac.
EMBO J.
7:1337-1343[Medline].
|
| 33.
|
Philipsen, S.,
D. Talbot,
P. Fraser, and F. Grosveld.
1990.
The beta-globin dominant control region: hypersensitive site 2.
EMBO J.
9:2159-2167[Medline].
|
| 34.
|
Rolink, A.,
A. Kudo,
H. Karasuyama,
Y. Kikuchi, and F. Melchers.
1991.
Long-term proliferating early pre B cell lines and clones with the potential to develop to surface Ig-positive, mitogen reactive B cells in vitro and in vivo.
EMBO J.
10:327-336[Medline].
|
| 35.
|
Schaffer, A. L., and M. S. Schlissel.
1997.
A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development.
J. Immunol.
159:1265-1275[Abstract].
|
| 36.
|
Sigvardsson, M.,
M. O'Riordan, and R. Grosschedl.
1997.
EBF and E47 collaborate to induce expression of the endogenous immunoglobulin surrogate light-chain genes.
Immunity
7:25-36[Medline].
|
| 37.
|
Talbot, D.,
P. Collis,
M. Antoniou,
M. Vidal,
F. Grosveld, and D. R. Greaves.
1989.
A dominant control region from the human beta-globin locus conferring integration site-independent gene expression.
Nature
338:352-355[Medline].
|
| 38.
|
Talbot, D.,
S. Philipsen,
P. Fraser, and F. Grosveld.
1990.
Detailed analysis of the site 3 region of the human beta globin dominant control region.
EMBO J.
9:2169-2177[Medline].
|
| 39.
|
Tian, J.,
T. Okabe,
T. Miyazaki,
S. Takeshita, and A. Kudo.
1997.
Pax-5 is identical to EBB-1/KLP and binds to the VpreB and lambda5 promoters.
Eur. J. Immunol.
27:750-755[Medline].
|
| 40.
|
Travis, A.,
J. Hagman,
L. Hwang, and R. Grosschedl.
1993.
Purification of early-B-cell factor and characterization of its DNA-binding specificity.
Mol. Cell. Biol.
13:3392-3400[Abstract/Free Full Text].
|
| 41.
|
Waneck, G. L., and N. Rosenberg.
1981.
Abelson leukemia virus induces lymphoid and erythroid colonies in infected fetal cell cultures.
Cell
26:79-89[Medline].
|
| 42.
|
Yang, J.,
M. A. Glozak, and B. B. Blomberg.
1995.
Identification and localization of a developmental stage-specific promoter activity from the murine lambda 5 gene.
J. Immunol.
155:2498-2514[Abstract].
|
Molecular and Cellular Biology, January 1999, p. 671-679, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vettermann, C., Herrmann, K., Albert, C., Roth, E., Bosl, M. R., Jack, H.-M.
(2008). A Unique Role for the {lambda}5 Nonimmunoglobulin Tail in Early B Lymphocyte Development. J. Immunol.
181: 3232-3242
[Abstract]
[Full Text]
-
Williams, A., Harker, N., Ktistaki, E., Veiga-Fernandes, H., Roderick, K., Tolaini, M., Norton, T., Williams, K., Kioussis, D.
(2008). Position effect variegation and imprinting of transgenes in lymphocytes. Nucleic Acids Res
36: 2320-2329
[Abstract]
[Full Text]
-
Laurencikiene, J., Tamosiunas, V., Severinson, E.
(2007). Regulation of {epsilon} germline transcription and switch region mutations by IgH locus 3' enhancers in transgenic mice. Blood
109: 159-167
[Abstract]
[Full Text]
-
Mundt, C., Licence, S., Maxwell, G., Melchers, F., Martensson, I.-L.
(2006). Only VpreB1, but not VpreB2, is expressed at levels which allow normal development of B cells. Int Immunol
18: 163-172
[Abstract]
[Full Text]
-
Harrow, F., Ortiz, B. D.
(2005). The TCR{alpha} Locus Control Region Specifies Thymic, But Not Peripheral, Patterns of TCR{alpha} Gene Expression. J. Immunol.
175: 6659-6667
[Abstract]
[Full Text]
-
Szutorisz, H., Canzonetta, C., Georgiou, A., Chow, C.-M., Tora, L., Dillon, N.
(2005). Formation of an Active Tissue-Specific Chromatin Domain Initiated by Epigenetic Marking at the Embryonic Stem Cell Stage. Mol. Cell. Biol.
25: 1804-1820
[Abstract]
[Full Text]
-
Wang, Y.-H., Zhang, Z., Burrows, P. D., Kubagawa, H., Bridges, S. L. Jr, Findley, H. W., Cooper, M. D.
(2003). V(D)J recombinatorial repertoire diversification during intraclonal pro-B to B-cell differentiation. Blood
101: 1030-1037
[Abstract]
[Full Text]
-
Cowell, L. G., Davila, M., Yang, K., Kepler, T. B., Kelsoe, G.
(2003). Prospective Estimation of Recombination Signal Efficiency and Identification of Functional Cryptic Signals in the Genome by Statistical Modeling. J. Exp. Med.
197: 207-220
[Abstract]
[Full Text]
-
Li, Q., Peterson, K. R., Fang, X., Stamatoyannopoulos, G.
(2002). Locus control regions. Blood
100: 3077-3086
[Abstract]
[Full Text]
-
Wang, Y.-H., Stephan, R. P., Scheffold, A., Kunkel, D., Karasuyama, H., Radbruch, A., Cooper, M. D.
(2002). Differential surrogate light chain expression governs B-cell differentiation. Blood
99: 2459-2467
[Abstract]
[Full Text]
-
Stephan, R. P., Elgavish, E., Karasuyama, H., Kubagawa, H., Cooper, M. D.
(2001). Analysis of VpreB Expression During B Lineage Differentiation in {lambda}5-Deficient Mice. J. Immunol.
167: 3734-3739
[Abstract]
[Full Text]
-
Ortiz, B. D., Harrow, F., Cado, D., Santoso, B., Winoto, A.
(2001). Function and Factor Interactions of a Locus Control Region Element in the Mouse T Cell Receptor-{alpha}/Dad1 Gene Locus. J. Immunol.
167: 3836-3845