Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 78-85, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Polypyrimidine Tract-Binding Protein Positively
Regulates Inclusion of an Alternative 3'-Terminal Exon
Hua
Lou,1,*
David M.
Helfman,2
Robert F.
Gagel,3 and
Susan M.
Berget1
Verna and Marrs McLean Department of
Biochemistry, Baylor College of Medicine,1 and
Section of Endocrine Neoplasia and Hormonal Disorders,
University of Texas, M. D. Anderson Cancer
Center,3 Houston, Texas 77030, and
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York
117242
Received 29 July 1998/Returned for modification 10 September
1998/Accepted 14 October 1998
 |
ABSTRACT |
Polypyrimidine tract-binding protein (PTB) is an abundant
vertebrate hnRNP protein. PTB binding sites have been found within introns both upstream and downstream of alternative exons in a number
of genes that are negatively controlled by the binding of PTB. We have
previously reported that PTB binds to a pyrimidine tract within an RNA
processing enhancer located adjacent to an alternative 3'-terminal exon
within the gene coding for calcitonin and calcitonin gene-related
peptide. The enhancer consists of a pyrimidine tract and CAG directly
abutting on a 5' splice site sequence to form a pseudoexon. Here we
show that the binding of PTB to the enhancer pyrimidine tract is
functional in that exon inclusion increases when in vivo levels of PTB
increase. This is the first example of positive regulation of exon
inclusion by PTB. The binding of PTB was antagonistic to the binding of U2AF to the enhancer-located pyrimidine tract. Altering the enhancer pyrimidine tract to a consensus sequence for the binding of U2AF eliminated enhancement of exon inclusion in vivo and exon
polyadenylation in vitro. An additional PTB binding site was identified
close to the AAUAAA hexanucleotide sequence of the exon 4 poly(A) site. These observations suggest a dual role for PTB in
facilitating recognition of exon 4: binding to the enhancer pyrimidine
tract to interrupt productive recognition of the enhancer pseudoexon by
splicing factors and interacting with the poly(A) site to positively affect polyadenylation.
 |
INTRODUCTION |
Alternative polyadenylation
frequently occurs and results in multiple mRNA products from a single
precursor RNA (reviewed in references 10, 14 and
64). One type of alternative polyadenylation involves the inclusion or exclusion of a 3'-terminal exon embedded within a multiexon transcript (Fig. 1).
The two best-studied examples of this type of processing occur in the
Drosophila doublesex gene (24, 35-38, 54,
57-59) and the human calcitonin/calcitonin gene-related peptide
(CT/CGRP) gene (2, 11, 12, 23, 29-32, 52, 63). Although
similar in exon and intron architecture, the two genes are regulated at
different steps in processing and by different types of elements. The
doublesex alternative processing choice is regulated at the
level of splicing via the binding of multiple splicing regulators
within the family of serine- and arginine-rich RNA binding proteins to
exonic splicing enhancers of simple sequences (24, 35-38, 54,
57-59).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of CT/CGRP alternative RNA processing pathways
and its intron 4 enhancer. (A) Schematic diagram of the CT/CGRP gene
and its alternative RNA processing in thyroid and neuronal cells. (B)
Diagram showing location of the intron enhancer (black oval) downstream
of exon 4 and sequence of the enhancer core including the abutting
pyrimidine tract sequence (Py) and 5' splice site sequence (5' ss).
Sequence differences between the human, mouse, and rat enhancer cores
are indicated.
|
|
Processing of the CT/CGRP precursor RNA, in contrast, is regulated at
the level of polyadenylation through the action of an intron enhancer
located downstream of the regulated exon (30-32). This
enhancer is a complicated 127-nucleotide (nt) region with multiple
sequence elements important for full enhancer activity. The most
important enhancer element is a core sequence that resembles a
pseudoexon, complete with branch point, pyrimidine tract, CAG, and 5'
splice site. There are, however, no internal sequences within the
pseudoexon, so the CAG directly abutts on the +1 nucleotide of the 5'
splice site (Fig. 1).
Previously we have shown that the core pyrimidine tract is important
for enhancer activity (30-32). Mutation of the pyrimidine tract by insertion of purines reduced in vivo exon inclusion and in
vitro polyadenylation. In addition, mutation decreased binding of the
hnRNP protein, polypyrimidine tract-binding protein (PTB), to the
pyrimidine tract (31), suggesting a role for PTB in the enhancer function. PTB was originally isolated as a protein binding to
3' splice site polypyrimidine tracts (6, 15, 16, 18, 47).
PTB has been observed to bind to the 3' polypyrimidine tracts of
multiple regulated exons. PTB action has uniformly been associated with
inhibition of exon recognition, not enhancement (3, 8, 20, 22, 28,
43-45, 47, 60). Thus, the CT/CGRP system offers an interesting
variation in which PTB binds to a pseudoexon regulatory element
resembling a 3' splice site to stimulate recognition of a neighboring
exon. It is unclear in other systems if PTB-mediated induction of exon
skipping involves enhancement of flanking exons or merely repression of
a central alternative exon.
We were interested to see if the pseudoexon model for CT/CGRP enhancer
function was a good one. The normal splicing factor that binds the 3'
splice site polypyrimidine tract is U2AF (1, 26, 27, 55, 60, 65,
67-69). Binding of PTB can compete binding of U2AF (3,
55). Therefore, we designed a set of experiments to see if PTB
affected CT/CGRP splicing in vivo and if U2AF was also involved.
Transfection experiments indicated that increasing PTB levels affected
CT/CGRP processing so as to favor exon inclusion, suggesting that PTB
binding to CT/CGRP sequences positively affects processing. U2AF,
however, did not behave as an enhancer binding protein in cells
normally including the alternative exon. When the enhancer pyrimidine
tract was altered to a consensus binding site for U2AF65,
PTB binding to the enhancer decreased and U2AF65 binding
increased. The same mutation severely depressed in vivo exon inclusion
and in vitro polyadenylation. Our results suggest, therefore, that PTB
does bind to the enhancer pyrimidine tract, thereby excluding U2AF.
Thus, the CT/CGRP enhancer pseudoexon behaves very similarly to other
alternative exons regulated negatively by PTB in nonneuronal cells
(3, 8, 20, 22, 28, 43-45, 48, 61). This similarity suggests
that intronic pseudoexons may exist to regulate other systems.
 |
MATERIALS AND METHODS |
Plasmids.
The minigene constructs depicted in Fig. 2 consist
of CT/CGRP exons 4 to 6 with natural intron sequences fused to a
heterologous first exon from adenovirus (11, 30). The
minigenes used for Fig. 3, in which the CT/CGRP exon 4 and surrounding
intron sequences have been placed into intron 1 of the human
metallothionein gene, have also been described previously (29,
30). Construction of in vitro exon 4 polyadenylation substrates,
including mutant substrates, was described previously (31).
The RNA probes a and b used for Fig. 7 were generated by in vitro
transcription of linearized plasmid coding for the in vitro
polyadenylation precursor RNA. Probe a contains 187 nt of exon 4 upstream of the hexanucleotide AAUAAA and was transcribed
from a SacI-digested plasmid; probe b contains 244 nt of
exon 4 and 95 nt of the downstream intron sequence and was transcribed
from an NheI-digested plasmid. PCR-directed mutagenesis was
used to create new mutant templates, including minigenes, in vitro
polyadenylation templates, and isolated transcribable enhancer
sequences. New mutant templates were sequenced prior to use.
The glutathione S-transferase (GST)-PTB construct was a
gift from M. Garcia-Blanco (Duke University Medical Center), and the GST-U2AF construct was obtained from M. Green (Massachusetts University Medical Center). The PTB and U2AF expression plasmids were generated by
subcloning the PTB or U2AF sequence into the pCDNA3.1His expression vector (Invitrogen), which contains a His tag and an Xpress antigen. LacZ plasmid was from Invitrogen.
Cell transfections and RNA and protein analysis.
Three cell
lines, HeLa, T98G, and CHO cells, were cotransfected with CT/CGRP
minigenes and either the PTB expression plasmid or a control LacZ
plasmid. The basic transfection procedure was previously described
(30). Cotransfections each used 2 µg of the CT/CGRP
minigene and an increasing amount of PTB or LacZ expression plasmid
(0.5, 1, and 2 µg). Cells in each transfection plate were scraped and
divided into two parts: one for RNA isolation and one for protein
isolation. Procedures for total cell RNA isolation and reverse
transcription (RT)-PCR analysis was described previously (30). The RT-PCR analysis used two reverse primers, one for exon 4 and one for exon 5 or metallothionein exon 3. This permitted simultaneous visualization of exon 4 skipping and inclusion products. The RT-PCR protocol was determined to accurately monitor exon 4 inclusion and exclusion products by a set of experiments in which we
tested various combinations of the two reverse primers from a number of
oligonucleotides complementary to either exon 4 or 5. We also
determined that low-cycle (20 to 22 cycles) PCR permitted determination
of the relative abundance of individual RNA species with our protocol.
Quantification of exon inclusion was determined with a PhosphorImager
(Molecular Dynamics). The results shown are representative of at least
three transfections for each experiment. Percent inclusion was
determined as follows: level of inclusion/(level of inclusion + level of exclusion). Standard deviations were determined on the basis
of three to five transfections. Absolute levels of exon 4 inclusion
varied from transfection to transfection. However, relative levels of
exon 4 inclusion between constructs containing a wild-type or mutant enhancer remained the same (e.g., mutation of the core 5' splice site
sequence decreased exon 4 inclusion to about 15% of the wild-type level). Total cell proteins were prepared in lysis buffer containing 50 mM Tris (pH 8.0), 150 mM NaCl, 0.1% sodium dodecyl sulfate, and 1%
Nonidet P-40. Levels of overexpressed proteins were examined by Western
blot analysis with the antitag antibody anti-Xpress (Invitrogen).
Levels of total nuclear PTB (both endogenous and exogenous) were
examined by Western blot analysis by using the anti-PTB antibody DH7
(21). The nuclear extract was prepared from cells
transfected with PTB plasmid as previously described (32).
In vitro assays.
In vitro polyadenylation conditions have
been described in detail previously by Lou et al. (31). The
procedure for RNase H protection assay was also described
(31). Gel shift assays were performed by using recombinant
GST-PTB or GST-U2AF prepared from bacteria and in vitro-transcribed RNA
substrates. The reactions were carried out in 25 µl containing 50%
Roeder D (31), 20 mM creatine phosphate, 2 mM ATP, 2 mg of
heparin per ml, 1 mg of bovine serum albumin per ml, 0 to 4 µg of
recombinant protein, and 25,000 cpm of 32P-labeled RNA. RNA
oligonucleotides were used as competitors in gel shift assays (see Fig.
4B). The reactions were stopped after 10 min of incubation at 30°C by
addition of loading buffer containing 50% glycerol and 1% dye, and
the complex was separated on a 4% nondenaturing polyacrylamide gel in
1× TG buffer (0.5 M Tris and 0.5 M glycine).
Procedures for UV cross-linking and immunoprecipitation of cross-linked
proteins have been previously described (
31). The
PTB-specific antibodies DH3 and DH7 have been described
(
21).
To examine the U2AF binding by UV cross-linking and
immunoprecipitation,
an antitag antibody, anti-Xpress, was used to
detect the binding
of the tagged U2AF protein in nuclear extract
isolated from cells
transfected with U2AF plasmid. The procedure for
preparing this
extract was described in detail elsewhere
(
32).
 |
RESULTS |
We have previously demonstrated that four splicing factors
U1
snRNA, ASF/SF2, SRp20, and PTB
bind to the splice site-like sequences
within the enhancer (31, 32). Both the sequences and the
factors suggested that the enhancer could be modeled after a
pseudomicroexon with 0 nt within the exon. To understand the advantages
and limitations of such a model, we undertook a study to characterize
the functionality of PTB binding to the enhancer pseudoexon and compare
it to the normal binding of U2AF to 3' splice sites.
Raising the in vivo concentration of PTB increases the relative
amount of exon 4 inclusion.
In vitro studies identified PTB as one
protein that bound to the enhancer pyrimidine tract in an in vitro
polyadenylation assay (31). Mutations which significantly
decreased PTB binding also inactivated the enhancer, suggesting that
PTB might play a role in enhancer activity. Because of the abundance of
PTB, it was difficult to determine the role of PTB in enhancer function by using in vitro approaches via PTB inactivation or depletion. We
therefore turned to an in vivo approach to establish the role of PTB in
enhancer activity. For this purpose we cotransfected various cell lines
with a CT/CGRP minigene and a tagged cDNA coding for PTB. The RNA
processing phenotype of the minigene was examined by low-cycle RT-PCR.
To monitor the relative levels of exon 4 inclusion versus skipping, two
3' primers complementary to either exon 4 or exon 5 were used in the
same reaction. The chosen primers and low-cycle conditions were
previously shown to accurately represent relative levels of RNA
resulting from exon 4 inclusion or exclusion (see Materials and Methods).
Three cell lines were chosen: HeLa cells, CHO cells, and a glioblastoma
cell line, T98G. These three cell lines represent
three extremes for
the processing of CT/CGRP from the utilized
minigene (
30,
32). HeLa cells normally direct 40 to 60% inclusion
of exon 4. Inclusion rises to 60 to 70% in CHO cells, and falls
to 10 to 20% in
T98G cells. Therefore, the three cell lines present
a spectrum of
inherent inclusion efficiencies against which to
test the effect of
cotransfected
PTB.
All three cell lines responded to increasing amounts of PTB in such a
way as to raise the percent inclusion levels of exon
4 (Fig.
2 and
3).
In HeLa cells inclusion increased from 42 to
76% in CHO cells
inclusion increased from 65 to 78%, and in T98G
cells inclusion rose
from 13 to 29%. Increasing amounts of PTB
also lowered overall mRNA
levels, so that 2 µg of transfecting
PTB plasmid inhibited CT/CGRP
mRNA processing and caused an increase
in precursor RNA. The increase
of precursor RNA was probably the
result of the general negative effect
of PTB on splicing via its
ability to compete for binding of U2AF to 3'
splice sites. Those
RNAs that were processed, however, were processed
preferentially
by a pathway with exon 4 as the terminal exon.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
In vivo inclusion of CT/CGRP exon 4 is stimulated by
cotransfection of PTB. (A) Diagram of the CT/CGRP minigene and RT-PCR
oligonucleotides (arrows). This gene has natural CT/CGRP sequences from
intron 3 through exon 6 fused to a heterologous first exon. HeLa cells
that have a mixed inclusion-exclusion phenotype were cotransfected with
the CT/CGRP minigene and increasing levels of a cDNA coding for PTB to
test the ability of the protein to stimulate inclusion. (B) RT-PCR
assay of total RNA from transfections with the diagrammed CT/CGRP
minigene with a wild-type enhancer (lanes 1 to 7) or an enhancer in
which the core pyrimidine tract had been mutated from
CUCCGCUCCUCUUC to CUACGCGCAUCGUC (lanes 8 to 11).
The cotransfecting plasmids coded for either His-tagged LacZ or PTB.
Amplification bands resulting from inclusion (319 nt) or exclusion (280 nt) are indicated. The percent inclusion of exon 4 is indicated below
each lane with standard deviations (n = 5).
Higher-molecular-weight amplification products result from precursor
RNA or activation of cryptic splicing. The latter product has been
characterized previously (30) and results from activation of
a cryptic 5' splicing site within exon 4 that changes exon 4 from a
terminal exon to an internal exon. (C) Western blots documenting the
level of protein being produced from the LacZ or PTB cotransfecting
plasmids. Both proteins were detected with tag-specific anti-Xpress
antibody. (D) Western blots documenting the level of total nuclear PTB
in PTB-transfected cells. Nuclear extracts were prepared from control
plasmid or PTB-transfected cells (32). Equal amounts of
protein from each nuclear extract preparation were loaded. Protein
blots were probed with PTB antibody DH7 (left) or anti-CstF 64-kDa
antibody (right) as a control for equal protein load.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Increasing PTB levels facilitates exon 4 recognition in
multiple cell lines, including T86G cells. In vivo transfections
similar to those described in the Fig. 2 legend were performed with
T98G cells (A) or CHO cells (B). Analysis was done as for Fig. 2;
percent product resulting from inclusion or exclusion of exon 4 is
shown below each lane with standard deviations (n = 3).
The band at the top of each panel resulted from unprocessed precursor
RNA. Western blots developed with the tag-specific antibody are shown
for each cell line.
|
|
The effect of PTB cotransfection on CT/CGRP RNA processing was indeed
the result of increased levels of PTB protein. We detected
PTB levels
using both tag-specific and PTB-specific antibodies.
Western blot
analysis using PTB-specific antibodies capable of
detecting both
endogenous and exogenous PTB (Fig.
2D) demonstrated
a significant
increase in the level of nuclear PTB in HeLa cells
transfected with our
PTB cDNA. Because the transfection efficiency
in HeLa cells is usually
70 to 90% (
32), the data in Fig.
2D
represent an
underestimate of the actual PTB level in individual
transfected
cells.
A similar positive effect on exon 4 inclusion of increasing PTB levels
was observed when a CT/CGRP minigene construct containing
an enhancer
pyrimidine tract interrupted by purines was used in
cotransfection
(Fig.
2B). Several explanations for this observation
are possible.
First, purine interruption of the pyrimidine tract
lowers but does not
abolish PTB binding in an in vitro assay (
31)
(see Fig.
6B).
The increased level of PTB protein could compensate
for lowered
affinity for PTB in the mutant. Second, multiple PTB
binding sites
surround exon 4 (see below), and PTB could affect
exon inclusion by
binding to these other sites when the core pyrimidine
tract is
mutated.
Examination of the splicing patterns of the three cell lines indicated
that the effect of increasing PTB concentration was
to raise inclusion
of exon 4, not to decrease skipping of exon
4 via splicing to exon 5. In both CHO and T98G cells, a reproducible
increase in the absolute
amount of mRNA resulting from inclusion
of exon 4 was observed. Of
course, we cannot rule out a concomitant
effect on exon 4 skipping
arising from the negative effect on
splicing of increasing
concentrations of PTB. At the concentrations
shown in Fig.
2 and
3,
however, the splicing of a reporter gene
with strong splice sites was
not affected by the cotransfecting
PTB, suggesting no total poisoning
of the processing machinery
(data not
shown).
PTB exists in at least three variants, PTB, PTB1, and PTB2 proteins,
which are derived from the same pre-mRNA through alternative
splicing
(
18). In the cotransfections described here, the PTB
form
with the lowest molecular weight was used. Identical effects
were
observed with the other two forms (data not shown). In addition,
RT-PCR
analysis of endogenous PTB RNA indicated similar ratios
of the three
forms in HeLa and T98G cells (data not shown). Therefore,
each of the
three forms has the ability to alter CT/CGRP splicing,
and differences
in these three forms between cell types are unlikely
to be at the heart
of alternative CT/CGRP
processing.
Altering the enhancer pyrimidine tract to a U2AF binding consensus
sequence inhibits in vivo recognition of exon 4 and in vitro
polyadenylation cleavage.
The binding of PTB to splicing
regulatory sequences is normally considered inhibitory for splicing
(3, 8, 20, 22, 28, 43-45, 48, 61). In at least some models,
this inhibition is thought to result from competition for binding of
U2AF to the polypyrimidine tract of the 3' splice site. The preceding
results suggested that binding of PTB to the enhancer pyrimidine tract activated processing for CT/CGRP exon 4. This "backwards" effect prompted us to ask if the binding of U2AF to the enhancer 3'
pseudo-splice site would be inhibitory for enhancer activity. We
therefore assayed the processing phenotypes of precursor RNAs
containing a pyrimidine tract in which the natural C-rich tract of
CUCCGCUCCUCUUC was altered to a more canonical U2AF binding
pyrimidine tract, UUCCCUUUUUUUUC (55). The effect
of these changes was compared to that obtained with a mutated
pyrimidine tract in which purines were inserted (CUACGCGCAUCGUC).
This latter mutation should inhibit the binding of both PTB and
U2AF (48, 55).
In vivo, these mutations lowered exon inclusion from 66% to 31% and
11%, respectively, in CHO cells, which normally include
exon 4 from
the majority of the minigene pre-mRNA (Fig.
4B). In
vitro, the two mutations reduced
polyadenylation cleavage activity
to one-half or one-quarter of that
observed with the wild-type
sequence (Fig.
4C). Thus, altering the
enhancer pyrimidine sequence
to a preferred U2AF binding signal caused
a direct effect on polyadenylation
activity in a precursor RNA that is
not undergoing splicing. For
both in vivo inclusion and in vitro
polyadenylation, the mutation
that created a good U2AF binding site was
more deleterious than
the mutant that would destroy both the PTB and
the U2AF binding.
These results suggest that the enhancer needs to bind
the negative
splicing regulator PTB, and not U2AF for maximal in vivo
exon
4 recognition and in vitro polyadenylation.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
Altering the enhancer pyrimidine tract to a better
binding site for U2AF depresses in vivo exon 4 inclusion and in vitro
polyadenylation of the exon 4 poly(A) site. (A) Sequence of the
wild-type and mutant enhancer pyrimidine tracts. Purine insertions
(purine) have been characterized previously (31) and were
modeled after mutations used in other studies to inactivate standard 3'
splice sites. Uridine insertions (U2AF) convert the polypyrimidine
tract to a site preferred by U2AF (55). (B) In vivo splicing
of wild-type and mutant constructs. Total cell RNA from transfected CHO
cells was monitored for splicing by using RT-PCR as described for Fig.
2. The minigene for these studies had exon 4 and surrounding intron
sequences inserted into intron 1 of the mouse metallothionein gene.
Splicing of this construct has been characterized previously
(30). The percentage of exon 4 inclusion (versus exclusion)
for each construct is shown below the figure. The
higher-molecular-weight products result from activation of cryptic
splicing which was characterized and described in detail previously
(30). (C) In vitro polyadenylation cleavage of wild-type and
mutant precursor RNAs. The utilized precursor contained the last half
of exon 4 and the beginning of intron 4, including the enhancer
sequence. Processing from this precursor has been described previously
(31). Reaction mixtures contained 3'-dATP to prevent poly(A)
addition. The position of full-length precursor and cleaved but not
polyadenylated RNA is indicated. The percent cleavage relative to that
of wild-type RNA is shown at the bottom of the figure.
|
|
Both PTB and U2AF bind to the enhancer-located pyrimidine
tract.
To ascertain if PTB and U2AF bind to the wild-type and
mutant enhancer pyrimidine tracts, gel shift and UV cross-linking
assays were employed (Fig. 5 and
6). Recombinant GST-tagged PTB and
U2AF65 bound to the wild-type pyrimidine sequence, although
the binding of PTB was considerably better than that of U2AF. Neither
bound well to a pyrimidine tract substrate which had been mutated
through the insertion of purines (Fig. 5A). Binding of both proteins
could be competed by cold specific pyrimidine oligonucleotides but not by nonspecific oligonucleotides (Fig. 5B and C). Both proteins also
bound to the pyrimidine tract mutated to resemble a U2AF preferred
binding site, in agreement with published binding preferences (48,
55) for the two proteins (Fig. 6A). In the absence of other
proteins, PTB bound strongly to both the wild-type pyrimidine tract and
the U2AF binding site. U2AF, however, showed a remarkable preference
for the synthetic U-rich RNA, as predicted from its sequence.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 5.
Both PTB and U2AF can bind the wild type enhancer core
pyrimidine tract. Recombinant GST-tagged PTB and U2AF65
were tested for their ability to bind to the CT/CGRP enhancer by using
gel shift experiments. The RNA substrates consisted of the isolated
127-nt complete enhancer region, including the core sequence
(30) with either a wild-type or purine mutant enhancer
sequence (Fig. 4). Binding reactions were carried out under
polyadenylation conditions in the presence of 2 mg of heparin per ml.
(A) Binding of increasing amounts of GST-PTB or GST-U2AF to wild-type
or mutant enhancer sequences; (B) competition of the binding of GST-PTB
(1.6 µg of GST-PTB) to the wild-type enhancer with 500 pmol of RNA
oligonucleotides containing consensus sequences defined as preferred
binding sites for PTB (GCCUGCUGCUCCUCUUCUGUC), U2AF
(UUUUCCCUUUUUUUUC), or a nonspecific U3 snRNA sequence; (C)
competition of the binding of GST-U2AF (8 µg of protein) to the
wild-type enhancer by increasing amounts (20, 100, or 500 pmol) of
U2AF-specific or U3 RNA oligonucleotides.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Improving the enhancer core to a preferred binding site
for U2AF depresses association of PTB with the enhancer. (A) Gel shift
analysis of the binding of PTB (top) and U2AF (bottom) to the 127-nt
complete enhancer containing the wild-type pyrimidine tract (wild
type), purine mutation (purine), or U2AF mutation (U2AF). Mutations are
as shown in Fig. 4. Binding utilized purified GST-tagged recombinant
proteins under polyadenylation reaction conditions in the presence of 2 mg of heparin per ml. (B) UV cross-linking of PTB and U2AF to the
wild-type and mutant enhancer core in nuclear extract. Radiolabeled
RNAs containing the indicated wild-type or mutated enhancer sequences
were incubated for 10 min in a standard in vitro polyadenylation assay.
Reaction mixtures were subjected to UV cross-linking and
immunoprecipitation (IP) by using antibodies specific for PTB (top) or
U2AF (bottom). The PTB experiment used standard nuclear extract.
Because our available anti-U2AF antibodies were inactive for
immunoprecipitation, a different technique was used for the U2AF
immunoprecipitation. In this experiment, extract was made from cells
expressing a tagged version of U2AF by using a technique we have
recently developed (32). Immunoprecipitation of cross-linked
proteins with this extract utilized tag-specific antibody.
|
|
In the presence of extract under standard polyadenylation conditions,
greater selectivity of the two proteins was observed.
Under these
conditions, PTB could be efficiently UV cross-linked
only to an RNA
containing the enhancer with the wild-type enhancer
pyrimidine tract,
and U2AF could be cross-linked only to enhancer
RNA containing the
U-rich pyrimidine tract mutation resembling
a U2AF binding site (Fig.
6B). Thus, in the presence of extract
factors, considerable preference
was observed for both proteins.
This difference indicates that the
inhibition of in vitro polyadenylation
and in vivo inclusion of exon 4 upon altering the enhancer pyrimidine
site to a U-rich sequence is
accompanied by loss in binding of
PTB and acquisition of binding of
U2AF. Furthermore, these results
suggest that binding of U2AF to the
pseudoexon and the 3' splice
site within the enhancer is detrimental to
enhancer-mediated exon
4
recognition.
A wild-type enhancer pyrimidine tract is required for maximal
binding of factors to the enhancer-located 5' splice site
sequence.
The enhancement of specificity in binding for PTB in
complete extract versus with purified protein suggested that PTB
interacts with other factors when binding to the enhancer-located
pyrimidine tract. One logical binding site for accessory factors is the
enhancer-located 5' splice site sequence. To monitor binding of factors
to the 5' splice site sequence, an RNase protection assay was utilized. A DNA oligonucleotide complementary to the enhancer-located 5' splice
site sequence was added to an in vitro polyadenylation assay in the
presence of RNase H. If factors bind to the 5' splice site sequence,
accessibility of the oligonucleotide to the precursor will be limited,
cleavage will not occur, and a protection band should be seen.
Appearance of maximal protection of the 5' splice site sequence was
dependent upon the wild-type enhancer pyrimidine tract (Fig.
7). Changing the sequence to either the
purine or U-rich mutant version lowered protection, indicating that
alteration of the PTB binding site lowered recognition of the pseudo-5'
splice site. This observation indicates that recognition of the splice site-like elements within the enhancer is concerted, much like the
recognition of natural exons during exon definition (4, 5,
51). Furthermore, it suggests that interactions at the 5' splice
site sequence could alter interactions at the pyrimidine tract and
cause the increased binding specificity shown in Fig. 6 for PTB in the
context of complete extract.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 7.
Evidence for interaction between the core pyrimidine
tracts and the 5' splice site sequence by using an RNA protection
assay. Binding of factors to the enhancer 5' splice site sequence was
monitored by using an RNase protection assay as diagrammed in the lower
part of the figure. Polyadenylation reaction mixtures containing the
diagrammed precursor encompassing the last 244 nt of exon 4 and the
first 257 nt of intron 4, including the enhancer, were incubated for 10 min. The two antisense DNA oligonucleotides shown in the diagram (an
upstream 15-mer hybridizing 86 nucleotides downstream of the
polyadenylation cleavage site and a 14-mer complementary to the
enhancer 5' splice site beginning 208 nt downstream of the
polyadenylation cleavage site) were added, and incubation was continued
for another 10 min in the presence of RNase H. Cleavage products were
resolved on a denaturing acrylamide gel. Cleavage and protection
products resulting from the binding of factors to the enhancer 5'
splice site sequence are indicated.
|
|
PTB binds within the CT/CGRP exon 4.
What is the function of
the binding of PTB to the enhancer polypyrimidine tract? One answer
seems to be that positioning PTB on the enhancer prevents U2AF binding
and activation of splice sites within the enhancer to direct cryptic
splicing. An alternative hypothesis, however, was that PTB interacted
directly with sequences or factors near the exon 4 poly(A) site. This
idea seemed particularly attractive because pyrimidine tracts near
polyadenylation consensus sequences have been observed to be the
binding site for factors that activate polyadenylation (7, 9, 13,
17, 19, 33, 34, 39-41, 50, 53, 56, 62, 66).
Several pyrimidine tracts are present upstream and immediately
downstream of the exon 4 AAUAAA sequence. Mutation of the
upstream
sequences did not affect PTB binding or in vitro
polyadenylation
activity (data not shown). Between the AAUAAA
sequence and the
cleavage site, however, is the pyrimidine
sequence UUUUUCCCC.
As shown in Fig.
8, this sequence bound PTB. Two
experimental
approaches were used to monitor binding. In the first, gel
shift
experiments were performed with recombinant PTB and RNA
corresponding
to regions of exon 4 or intron 4 (Fig.
8A). An RNA
containing
sequences upstream of the AAUAAA was not bound by
recombinant
PTB in vitro. In contrast, both an RNA containing the
sequences
between the hexanucleotide and the cleavage site (Fig.
8A)
and
an RNA corresponding to the enhancer bound PTB.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8.
PTB binds to a second pyrimidine tract adjacent to the
polyadenylation consensus AAUAAA element. RNAs a, b, and c
as diagrammed were used for gel shift (A) and UV cross-linking (B)
studies. RNAs a, b, and c include sequences from 244 to 58, 244
to +91, or +153 to +280 with respect to the exon 4 polyadenylation
cleavage site. (A) Binding of recombinant GST-PTB to segments of exon 4 and intron 4. The indicated RNAs were incubated with GST-PTB in the
presence of 2 mg of heparin per ml. (B) UV cross-linking and
immunoprecipitation (IP) of cross-linked PTB to an exon 4 polyadenylation precursor RNA lacking the enhancer but including
wild-type or mutant exon sequences. Two mutants were employed. Mutant 1 had an altered AAUAAA consensus sequence (hex mut); mutant 2 had the sequence adjacent to the AAUAAA altered from
UUAUUUUUCCC to UUAUAUGUCACC (Py mut). The
precursor RNAs were incubated in nuclear extract under polyadenylation
conditions for 10 min and subjected to UV cross-linking and
immunoprecipitation with PTB-specific antibodies.
|
|
More important, an RNA substrate containing exon 4 and intron 4 sequences immediately downstream of exon 4 but lacking the
enhancer
could be UV cross-linked to PTB (Fig.
8B). Cross-linking
was depressed
when the pyrimidine tract adjacent to the AAUAAA
element was
mutated, indicating that this sequence was important
for PTB binding.
Mutations in the AAUAAA element also lowered
cross-linking,
but to a lesser extent. These results indicate
the presence of a PTB
binding site within exon 4, suggesting that
PTB could interact with
both the enhancer and with exon 4. The
functionality of this binding,
however, could not be determined,
because mutation of this binding
sequence alone did not depress
polyadenylation cleavage in the presence
or absence of the enhancer
(data not
shown).
 |
DISCUSSION |
We demonstrate here that the CT/CGRP enhancer prefers binding of
PTB but not U2AF. In addition, the binding of PTB appears to be
functional, because increasing the concentration of PTB in vivo
increased the percentage of RNA including the alternative exon. A
number of alternatively processed mRNAs contain PTB binding sites
(3, 8, 20, 22, 28, 43-45, 48, 61) whose mutation alters
inclusion, but conclusive evidence for a PTB protein requirement has
not been obtained. The data presented here suggest that PTB levels can
be determinative for processing.
One of the types of processing frequently regulated by sequences that
bind to PTB is neuronal versus nonneuronal exon inclusion. For
processing of both c-src and gamma amino-butyric acid type A
receptor (GABAA)
2, PTB binds to pyrimidine tracts
adjacent to the regulated exon necessary for exon exclusion in
nonneuronal cells (3, 8). In the case of CT/CGRP, binding of
PTB to an intronic pseudoexon is necessary for inclusion of a
neighboring exon. Binding also seems to repress recognition of the
enhancer-located splice sites by positive splicing factors such as
U2AF. Therefore, the CT/CGRP system resembles other PTB-regulated genes
in that the recognition of an exon is repressed by PTB. It would be
interesting to know if PTB could facilitate the splicing of flanking
exons in the context of other PTB-regulated genes without a concomitant negative effect on a central exon. Removal of PTB binding domains within
-tropomyosin can cause skipping of the upstream nonregulated exon (47a), suggesting that PTB may have positive as well as negative effects.
The important question for all neuronal alternative splicing events
involving PTB is that of how the effect of PTB is negated in neuronal
cells. In the case of CT/CGRP, there are other sequences within the
enhancer core that when mutated cause increased exon inclusion in cells
that normally skip exon 4 (30). Two of these resemble known
splicing signals, a 5' splice site and a purine enhancer
(32a), suggesting that other splicing proteins may bind to
the enhancer and regulate PTB binding in neuronal cells. Alternatively, neuronal forms of PTB may exist (3, 8).
We do not yet know how PTB affects exon 4 polyadenylation. Here we show
that PTB can bind to a pyrimidine tract within exon 4 located between
the AAUAAA and the cleavage site. It is possible that a PTB
dimer with multiple RNA-binding domains (46, 49) binds to
both the exon and the enhancer and thereby brings other enhancer-binding factors such as U1 snRNPs and SR proteins into proximity with polyadenylation factors (Fig.
9). It is also possible that PTB has a
direct effect on exon 4 polyadenylation. It has been recently shown
that PTB binds to pyrimidine tracts adjacent to the AAUAAA
element in the mouse C2 complement gene (42). These
sequences are required for maximal polyadenylation, suggesting that PTB
can directly interact with one or more polyadenylation proteins.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 9.
A model for the role of PTB in the intron
enhancer-mediated facilitation of CT exon 4 polyadenylation.
|
|
Other models are also possible. The data presented here suggest that
binding of U2AF to the enhancer pyrimidine tract is inhibitory for
enhancer activity. PTB, therefore, may be required for enhancer activity simply to prevent U2AF binding to the enhancer core. Thus, the
pseudoexon within the enhancer core binds a negatively acting splicing
factor to its 3' splice site sequence but positively acting factors,
including U1 snRNPs and ASF/SF2, to its 5' splice site sequence
(31). Mutation of either the 3' or 5' splice site sequence
within the enhancer core prevents the binding of another positively
acting splicing factor, SRp20 (32). This observation suggests the existence of interactions between factors that bind the
splice site sequences within the core. In agreement with this observation, we have seen that protection of the core 5' splice site
sequence by factors decreases when the pyrimidine tract is mutated. We
do not yet understand how the core binding factors interact when
binding to the core. SRp20 has been proposed to bind to the 3' splice
site within its own pre-mRNA (25). Thus, both PTB and SRp20
may be binding to the enhancer pyrimidine tract. Given the absence of
any direct evidence for an interaction between PTB and any SR protein,
including SRp20, it is possible that the association of these two
proteins with the pyrimidine tract is sequential rather than simultaneous.
We began this study asking if our model for the enhancer core as a
pseudoexon was useful for understanding regulation by this unusual
enhancer. Our data suggest that it is so, as long as we present the
enhancer core as a pseudoexon binding the negative splicing regulator
PTB. In this fashion, the enhancer core resembles many PTB-regulated
alternative exons as they are recognized in the tissues in which they
are not included (3, 8, 20, 22, 28, 43-45, 48, 61). The
abundance of the factors we have observed recognizing this pseudoexon
is high, raising the intriguing possibility that pseudoexon elements
could be frequent within large vertebrate introns and could be used to
promote splicing of flanking exons.
 |
ACKNOWLEDGMENTS |
We thank Mariano Garcia-Blanco and Michael Green for providing
GST-PTB and GST-U2AF clones, respectively. We acknowledge the helpful
advice of members in the Gagel and Berget laboratories.
This work was supported by an ACS grant to S.M.B. and USPHS grants
(RO1-DK38146 to R.F.G. and 2P30-CA16672) to the M.D. Anderson Cancer
Center. D.M.H. was supported by NIH grant GM43049.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Verna and Marrs
McLean Department of Biochemistry, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Phone: (713) 798-4622. Fax: (713) 795-5487. E-mail: hlou{at}bcm.tmc.edu.
 |
REFERENCES |
| 1.
|
Adams, M. D.,
D. Z. Rudner, and D. C. Rio.
1996.
Biochemistry and regulation of pre-mRNA splicing.
Curr. Opin. Cell Biol.
8:331-339[Medline].
|
| 2.
|
Amara, S. G.,
V. Jonas, and M. G. Rosenfeld.
1982.
Alternative RNA processing in calcitonin gene expression generates mRNAs encoding different polypeptide products.
Nature
298:240-244[Medline].
|
| 3.
|
Ashiya, M., and P. J. Grabowski.
1997.
A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart.
RNA
3:996-1015[Abstract].
|
| 4.
|
Berget, S. M.
1995.
Exon recognition in vertebrate splicing.
J. Biol. Chem.
2:2411-2414.
|
| 5.
|
Black, D. L.
1995.
Finding splice sites in a wilderness of RNA.
RNA
1:763-771[Medline].
|
| 6.
|
Bothwell, A. L.,
D. W. Ballard,
W. M. Philbrick,
G. Lindwall,
S. E. Maher,
M. M. Bridgett,
S. F. Jamison, and M. A. Garcia-Blanco.
1991.
Murine polypyrimidine tract binding protein. Purification, cloning, and mapping of the RNA binding domain.
J. Biol. Chem.
266:24657-24663[Abstract/Free Full Text].
|
| 7.
|
Brackenridge, S.,
H. L. Ashe,
M. Giacca, and N. J. Proudfoot.
1997.
Transcription and polyadenylation in a short human intergenic region.
Nucleic Acids Res.
25:2326-2335[Abstract/Free Full Text].
|
| 8.
|
Chan, R. C., and D. L. Black.
1997.
The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream.
Mol. Cell. Biol.
17:4667-4676[Abstract].
|
| 9.
|
Chou, Z.-F.,
F. Chen, and J. Wilusz.
1994.
Sequence and position requirements for uridylate-rich downstream elements of polyadenylation.
Nucleic Acids Res.
22:2525-2531[Abstract/Free Full Text].
|
| 10.
|
Colgan, D. F., and J. L. Manley.
1997.
Mechanism and regulation of mRNA polyadenylation.
Genes Dev.
11:2755-2766[Free Full Text].
|
| 11.
|
Cote, G. J.,
D. T. Stolow,
S. Peleg,
S. M. Berget, and R. F. Gagel.
1992.
Identification of exon sequences and an exon binding protein involved in alternative RNA splicing of calcitonin/CGRP.
Nucleic Acids Res.
20:2361-2366[Abstract/Free Full Text].
|
| 12.
|
Crenshaw, E. B.,
A. F. Russo,
L. W. Swanson, and M. G. Rosenfeld.
1987.
Neuron-specific alternative RNA processing in transgenic mice expressing a metallothionein-calcitonin fusion gene.
Cell
49:389-398[Medline].
|
| 13.
|
DeZazzo, J. D., and M. J. Imperiale.
1989.
Sequences upstream of AAUAAA influence poly(A) site selection in a complex transcription unit.
Mol. Cell. Biol.
9:4951-4961[Abstract/Free Full Text].
|
| 14.
|
Edwalds-Gilbert, G.,
K. L. Veraldi, and C. Milcarek.
1997.
Alternative poly(A) site selection in complex transcription units: means to an end?
Nucleic Acids Res.
25:2547-2561[Abstract/Free Full Text].
|
| 15.
|
Garcia-Blanco, M.,
S. Jamison, and P. A. Sharp.
1986.
Identification and purification of a 62,000-dalton protein that binds specifically to the polypyrimidine tract of introns.
Genes Dev.
3:1874-1886[Abstract/Free Full Text].
|
| 16.
|
Ghetti, A.,
S. Pinol-Roma,
W. Michael,
C. Morandi, and G. Dreyfuss.
1992.
HnRNP I, the polypyrimidine tract-binding protein: distinct nuclear localization and association with hnRNAs.
Nucleic Acids Res.
20:3671-3678[Abstract/Free Full Text].
|
| 17.
|
Gil, A., and N. J. Proudfoot.
1984.
A sequence downstream of AAUAAA is required for rabbit b globin mRNA 3' end formation.
Nature
312:473-474[Medline].
|
| 18.
|
Gil, A.,
P. A. Sharp,
S. F. Jamison, and M. A. Garcia-Blanco.
1991.
Characterization of cDNAs encoding the polypyrimidine tract-binding protein.
Genes Dev.
5:1224-1236[Abstract/Free Full Text].
|
| 19.
|
Gilmartin, G. M.,
E. S. Fleming,
J. Oetjen, and B. R. Graveley.
1995.
CPSF recognition of an HIV-1 mRNA 3'-processing enhancer: multiple sequence contacts involved in poly(A) site definition.
Genes Dev.
9:72-83[Abstract/Free Full Text].
|
| 20.
|
Gooding, C.,
G. C. Roberts, and C. W. Smith.
1998.
Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.
RNA
4:85-100[Abstract].
|
| 21.
|
Grossman, J. S.,
M. I. Meyer,
Y.-C. Wang,
G. J. Mulligan,
R. Kobayashi, and D. M. Helfman.
1998.
The use of antibodies to the polypyrimidine tract binding protein (PTB) to analyze the protein components that assemble on alternatively spliced pre-mRNAs that use distant branch points.
RNA
4:613-625[Abstract].
|
| 22.
|
Guo, W.,
G. J. Mulligan,
S. Wormsley, and D. M. Helfman.
1991.
Alternative splicing of beta-tropomyosin pre-mRNA: cis-acting elements and cellular factors that block the use of a skeletal muscle exon in nonmuscle cells.
Genes Dev.
5:2096-2107[Abstract/Free Full Text].
|
| 23.
|
Hedjran, F.,
J. M. Yeakley,
G. S. Huh,
R. O. Hynes, and M. G. Rosenfeld.
1997.
Control of alternative pre-mRNA splicing by distributed pentameric repeats.
Proc. Natl. Acad. Sci. USA
94:12343-12347[Abstract/Free Full Text].
|
| 24.
|
Heinrichs, V., and B. S. Baker.
1995.
The Drosophila SR protein RBP1 contributes to the regulation of doublesex alternative splicing by recognizing RBP1 RNA target sequences.
EMBO J.
14:3987-4000[Medline].
|
| 25.
|
Jumaa, H., and P. J. Nielsen.
1997.
The splicing factor SRp20 modifies splicing of its own mRNA and ASF/SF2 antagonizes this regulation.
EMBO J.
16:5077-5085[Medline].
|
| 26.
|
Kanaar, R.,
S. E. Roche,
E. L. Beall,
M. R. Green, and D. C. Rio.
1993.
The conserved pre-mRNA splicing factor U2AF from Drosophila: requirement for viability.
Science
262:569-572[Abstract/Free Full Text].
|
| 27.
|
Krámer, A.
1996.
The structure and function of proteins involved in mammalian pre-mRNA splicing.
Annu. Rev. Biochem.
65:367-409[Medline].
|
| 28.
|
Lin, C. H., and J. G. Patton.
1995.
Regulation of alternative 3' splice site selection by constitutive splicing factors.
RNA
1:234-245[Abstract].
|
| 29.
|
Lou, H.,
G. J. Cote, and R. F. Gagel.
1994.
The calcitonin exon and its flanking intronic sequences are sufficient for the regulation of human calcitonin/calcitonin gene-related peptide alternative splicing.
Mol. Endocrinol.
8:1618-1626[Abstract/Free Full Text].
|
| 30.
|
Lou, H.,
Y. Yang,
G. J. Cote,
S. M. Berget, and R. F. Gagel.
1995.
An intron splicing enhancer containing a 5' splice site sequence in the human calcitonin/calcitonin gene-related peptide gene.
Mol. Cell. Biol.
15:7135-7142[Abstract].
|
| 31.
|
Lou, H.,
R. F. Gagel, and S. M. Berget.
1996.
An intron enhancer recognized by splicing factors activates polyadenylation.
Genes Dev.
1:208-219.
|
| 32.
|
Lou, H.,
K. M. Neugebauer,
R. F. Gagel, and S. M. Berget.
1998.
Regulation of alternative polyadenylation by U1 snRNPs and SRp20.
Mol. Cell. Biol.
18:4977-4985[Abstract/Free Full Text].
|
| 32a.
| Lou, H., and S. M. Berget. Unpublished data.
|
| 33.
|
Lutz, C. S., and J. C. Alwine.
1994.
Direct interaction of the U1 snRNP-A protein with the upstream efficiency element of the SV40 late polyadenylation signal.
Genes Dev.
8:576-586[Abstract/Free Full Text].
|
| 34.
|
Lutz, C. S.,
K. G. K. Murthy,
N. Schek,
J. P. O'Connor,
J. L. Manley, and J. C. Alwine.
1996.
Interaction between the U1 snRNP-A protein and the 160-kD subunit of cleavage-polyadenylation specificity factor increases polyadenylation efficiency in vitro.
Genes Dev.
10:325-337[Abstract/Free Full Text].
|
| 35.
|
Lynch, K. W., and T. Maniatis.
1995.
Synergistic interactions between two distinct elements of a regulated splicing enhancer.
Genes Dev.
9:284-293[Abstract/Free Full Text].
|
| 36.
|
Lynch, K. W., and T. Maniatis.
1996.
Assembly of specific SR protein complexes on distinct regulatory elements of the Drosophila doublesex splicing enhancer.
Genes Dev.
10:2089-2101[Abstract/Free Full Text].
|
| 37.
|
Mattox, W., and B. S. Baker.
1991.
Autoregulation of the splicing of transcripts from the transformer-2 gene of Drosophila.
Genes Dev.
5:786-796[Abstract/Free Full Text].
|
| 38.
|
Mattox, W.,
L. Ryner, and B. S. Baker.
1992.
Autoregulation and multifunctionality among trans-acting factors that regulate alternative pre-mRNA processing.
J. Biol. Chem.
267:19023-19026[Free Full Text].
|
| 39.
|
McDevitt, M. A.,
R. P. Hart,
W. W. Wong, and J. R. Nevins.
1986.
Sequences capable of restoring poly(A) site function define two distinct downstream elements.
EMBO J.
5:2907-2913[Medline].
|
| 40.
|
McLauchlan, J.,
J. L. Gaffney,
J. L. Whitton, and J. B. Clements.
1985.
The consensus sequence YGTGTTYY located downstream from the AAUAAA signal is required for efficient formation of mRNA 3' termini.
Nucleic Acids Res.
13:1347-1368[Abstract/Free Full Text].
|
| 41.
|
Moreira, A.,
M. Wollerton,
J. Monks, and N. J. Proudfoot.
1995.
Upstream sequence elements enhance poly(A) site efficiency of the C2 complement gene and are phylogenetically conserved.
EMBO J.
14:3809-3819[Medline].
|
| 42.
|
Moreira, A.,
Y. Takagaki,
S. Brackenridge,
M. Wollerton,
J. L. Manley, and N. J. Proudfoot.
1998.
The upstream sequence element of the C2 complement poly(A) signal activates mRNA 3' end formation by two distinct mechanisms.
Genes Dev.
12:2522-2534[Abstract/Free Full Text].
|
| 43.
|
Mullen, M.,
C. Smith,
J. Patton, and B. Nadal-Ginard.
1991.
-Tropomyosin mutually exclusive exon selection: competition between branchpoint/polypyrimidine tracts determines default exon choice.
Genes Dev.
5:642-655[Abstract/Free Full Text].
|
| 44.
|
Mulligan, G. J.,
W. Guo,
S. Wormsley, and D. M. Helfman.
1992.
Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of beta-tropomyosin pre-mRNA.
J. Biol. Chem.
267:25480-25487[Abstract/Free Full Text].
|
| 45.
|
Norton, P. A.
1994.
Polypyrimidine tract sequences direct selection of alternative branch sites and influence protein binding.
Nucleic Acids Res.
22:3854-3860[Abstract/Free Full Text].
|
| 46.
|
Oh, Y. L.,
B. Hahm,
Y. K. Kim,
H. K. Lee,
J. W. Lee,
O. Song,
K. Tsukiyama-Kohara,
M. Kohara,
A. Nomoto, and S. K. Jang.
1998.
Determination of functional domains in polypyrimidine-tract-binding protein.
Biochem. J.
331:169-175.
|
| 47.
|
Patton, J. G.,
S. A. Mayer,
P. Tempst, and B. Nadal-Ginard.
1991.
Characterization and molecular cloning of polypyrimidine tract-binding protein: a component of a complex necessary for pre-mRNA splicing.
Genes Dev.
5:1237-1251[Abstract/Free Full Text].
|
| 47a.
| Patton, J. G. Personal communication.
|
| 48.
|
Perez, I.,
C. H. Lin,
J. G. McAfee, and J. G. Patton.
1997.
Mutation of PTB binding sites causes misregulation of alternative 3' splice site selection in vivo.
RNA
3:764-778[Abstract].
|
| 49.
|
Perez, I.,
J. G. McAfee, and J. G. Patton.
1997.
Multiple RRMs contribute to RNA binding specificity and affinity for polypyrimidine tract binding protein.
Biochemistry
36:11881-11890[Medline].
|
| 50.
|
Prescott, J., and E. Falck-Pedersen.
1994.
Sequence elements upstream of the 3' cleavage site confer substrate strength to the adenovirus L1 and L3 polyadenylation sites.
Mol. Cell. Biol.
14:4682-4693[Abstract/Free Full Text].
|
| 51.
|
Reed, R.
1996.
Initial splice-site recognition and pairing during pre-mRNA splicing.
Curr. Opin. Genet. Dev.
6:215-220[Medline].
|
| 52.
|
Rosenfeld, M. G.,
S. G. Amara, and R. M. Evans.
1984.
Alternative RNA processing: determining neuronal phenotype.
Science
225:1315-1320[Abstract/Free Full Text].
|
| 53.
|
Russnak, R.
1991.
Regulation of polyadenylation in hepatitis B viruses: stimulation by the upstream activating signal PS1 is orientation-dependent and additive.
Nucleic Acids Res.
19:6449-6456[Abstract/Free Full Text].
|
| 54.
|
Ryner, L. C., and B. S. Baker.
1991.
Regulation of doublesex pre-mRNA processing occurs by 3'-splice site activation.
Genes Dev.
5:2071-2085[Abstract/Free Full Text].
|
| 55.
|
Singh, R.,
J. Valcárcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 56.
|
Sitler, A.,
H. Gallinaro, and M. Jacob.
1994.
Upstream and downstream cis-acting elements for cleavage at the L4 polyadenylation site of adenovirus-2.
Nucleic Acids Res.
22:222-231[Abstract/Free Full Text].
|
| 57.
|
Tian, M., and T. Maniatis.
1992.
Positive control of pre-mRNA splicing in vitro.
Science
256:237-240[Abstract/Free Full Text].
|
| 58.
|
Tian, M., and T. Maniatis.
1993.
A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA.
Cell
74:105-114[Medline].
|
| 59.
|
Tian, M., and T. Maniatis.
1994.
A splicing enhancer exhibits both constitutive and regulated activities.
Genes Dev.
8:1703-1712[Abstract/Free Full Text].
|
| 60.
|
Valcárcel, J.,
R. K. Gaur,
R. Singh, and M. R. Green.
1996.
Interaction of U2AF65 RS region with pre-mRNA branch point and promotion of base pairing with U2 snRNA.
Science
273:1706-1709[Abstract/Free Full Text].
|
| 61.
|
Valcárcel, J., and F. Gebauer.
1997.
Post-transcriptional regulation: the dawn of PTB.
Curr. Biol.
7:R705-R708[Medline].
|
| 62.
|
Valsamakis, A.,
S. Zeichner,
S. Carswell, and J. C. Alwine.
1991.
The human immunodeficiency virus type 1 polyadenylation signal: a 3' long terminal repeat element upstream of the AAUAAA necessary for efficient polyadenylation.
Proc. Natl. Acad. Sci. USA
88:2108-2112[Abstract/Free Full Text].
|
| 63.
|
van Oers, C. C. M.,
G. J. Adema,
H. Zandberg,
T. C. Moen, and P. D. Baas.
1994.
Two different sequence elements within exon 4 are necessary for calcitonin-specific splicing of the human calcitonin/calcitonin gene-related peptide I pre-mRNA.
Mol. Cell. Biol.
14:951-960[Abstract/Free Full Text].
|
| 64.
|
Wahle, E., and W. Keller.
1996.
The biochemistry of polyadenylation.
Trends Biochem. Sci.
21:247-250[Medline].
|
| 65.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 66.
|
Wilusz, J., and T. Shenk.
1990.
A uridylate tract mediates efficient heterogeneous nuclear ribonucleoprotein C protein-RNA cross-linking and functionally substitutes for the downstream element of the polyadenylation signal.
Mol. Cell. Biol.
10:6397-6407[Abstract/Free Full Text].
|
| 67.
|
Zamore, P. D., and M. R. Green.
1989.
Identification, purification and characterization of U2 small nuclear ribonucleoprotein auxiliary factor.
Proc. Natl. Acad. Sci. USA
86:9243-9247[Abstract/Free Full Text].
|
| 68.
|
Zamore, P. D., and M. R. Green.
1991.
Biochemical characterization of U2 snRNP auxiliary factor: an essential pre-mRNA splicing factor with a novel intracellular distribution.
EMBO J.
10:207-214[Medline].
|
| 69.
|
Zuo, P., and T. Maniatis.
1996.
The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing.
Genes Dev.
10:1356-1368[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 1999, p. 78-85, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cosme, R. S. C., Yamamura, Y., Tang, Q.
(2009). Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus. J. Virol.
83: 2839-2850
[Abstract]
[Full Text]
-
Zhou, H.-L., Lou, H.
(2008). Repression of Prespliceosome Complex Formation at Two Distinct Steps by Fox-1/Fox-2 Proteins. Mol. Cell. Biol.
28: 5507-5516
[Abstract]
[Full Text]
-
Wang, C., Norton, J. T., Ghosh, S., Kim, J., Fushimi, K., Wu, J. Y., Stack, M. S., Huang, S.
(2008). Polypyrimidine Tract-binding Protein (PTB) Differentially Affects Malignancy in a Cell Line-dependent Manner. J. Biol. Chem.
283: 20277-20287
[Abstract]
[Full Text]
-
Somberg, M., Zhao, X., Frohlich, M., Evander, M., Schwartz, S.
(2008). Polypyrimidine Tract Binding Protein Induces Human Papillomavirus Type 16 Late Gene Expression by Interfering with Splicing Inhibitory Elements at the Major Late 5' Splice Site, SD3632. J. Virol.
82: 3665-3678
[Abstract]
[Full Text]
-
Paradis, C., Cloutier, P., Shkreta, L., Toutant, J., Klarskov, K., Chabot, B.
(2007). hnRNP I/PTB can antagonize the splicing repressor activity of SRp30c. RNA
13: 1287-1300
[Abstract]
[Full Text]
-
Dalziel, M., Nunes, N. M., Furger, A.
(2007). Two G-Rich Regulatory Elements Located Adjacent to and 440 Nucleotides Downstream of the Core Poly(A) Site of the Intronless Melanocortin Receptor 1 Gene Are Critical for Efficient 3' End Processing. Mol. Cell. Biol.
27: 1568-1580
[Abstract]
[Full Text]
-
Zhu, H., Zhou, H.-L., Hasman, R. A., Lou, H.
(2007). Hu Proteins Regulate Polyadenylation by Blocking Sites Containing U-rich Sequences. J. Biol. Chem.
282: 2203-2210
[Abstract]
[Full Text]
-
Young, J. I., Hong, E. P., Castle, J. C., Crespo-Barreto, J., Bowman, A. B., Rose, M. F., Kang, D., Richman, R., Johnson, J. M., Berget, S., Zoghbi, H. Y.
(2005). Inaugural Article: Regulation of RNA splicing by the methylation-dependent transcriptional repressor methyl-CpG binding protein 2. Proc. Natl. Acad. Sci. USA
102: 17551-17558
[Abstract]
[Full Text]
-
Le Sommer, C., Lesimple, M., Mereau, A., Menoret, S., Allo, M.-R., Hardy, S.
(2005). PTB Regulates the Processing of a 3'-Terminal Exon by Repressing both Splicing and Polyadenylation. Mol. Cell. Biol.
25: 9595-9607
[Abstract]
[Full Text]
-
SHUKLA, S., DEL GATTO-KONCZAK, F., BREATHNACH, R., FISHER, S. A.
(2005). Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1. RNA
11: 1725-1736
[Abstract]
[Full Text]
-
Oberstrass, F. C., Auweter, S. D., Erat, M., Hargous, Y., Henning, A., Wenter, P., Reymond, L., Amir-Ahmady, B., Pitsch, S., Black, D. L., Allain, F. H.-T.
(2005). Structure of PTB Bound to RNA: Specific Binding and Implications for Splicing Regulation. Science
309: 2054-2057
[Abstract]
[Full Text]
-
Mitchell, S. A., Spriggs, K. A., Bushell, M., Evans, J. R., Stoneley, M., Le Quesne, J. P.C., Spriggs, R. V., Willis, A. E.
(2005). Identification of a motif that mediates polypyrimidine tract-binding protein-dependent internal ribosome entry. Genes Dev.
19: 1556-1571
[Abstract]
[Full Text]
-
Kol, G., Lev-Maor, G., Ast, G.
(2005). Human-mouse comparative analysis reveals that branch-site plasticity contributes to splicing regulation. Hum Mol Genet
14: 1559-1568
[Abstract]
[Full Text]
-
Burnette, J. M., Miyamoto-Sato, E., Schaub, M. A., Conklin, J., Lopez, A. J.
(2005). Subdivision of Large Introns in Drosophila by Recursive Splicing at Nonexonic Elements. Genetics
170: 661-674
[Abstract]
[Full Text]
-
Kralovicova, J., Houngninou-Molango, S., Kramer, A., Vorechovsky, I.
(2004). Branch site haplotypes that control alternative splicing. Hum Mol Genet
13: 3189-3202
[Abstract]
[Full Text]
-
ROESSER, J. R.
(2004). Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene. RNA
10: 1243-1250
[Abstract]
[Full Text]
-
Hamon, S., Le Sommer, C., Mereau, A., Allo, M.-R., Hardy, S.
(2004). Polypyrimidine Tract-binding Protein Is Involved in Vivo in Repression of a Composite Internal/3' -Terminal Exon of the Xenopus {alpha}-Tropomyosin Pre-mRNA. J. Biol. Chem.
279: 22166-22175
[Abstract]
[Full Text]
-
Castelo-Branco, P., Furger, A., Wollerton, M., Smith, C., Moreira, A., Proudfoot, N.
(2004). Polypyrimidine Tract Binding Protein Modulates Efficiency of Polyadenylation. Mol. Cell. Biol.
24: 4174-4183
[Abstract]
[Full Text]
-
Auboeuf, D., Dowhan, D. H., Kang, Y. K., Larkin, K., Lee, J. W., Berget, S. M., O'Malley, B. W.
(2004). Differential recruitment of nuclear receptor coactivators may determine alternative RNA splice site choice in target genes. Proc. Natl. Acad. Sci. USA
101: 2270-2274
[Abstract]
[Full Text]
-
Qiu, J., Nayak, R., Pintel, D. J.
(2004). Alternative Polyadenylation of Adeno-Associated Virus Type 5 RNA within an Internal Intron Is Governed by both a Downstream Element within the Intron 3' Splice Acceptor and an Element Upstream of the P41 Initiation Site. J. Virol.
78: 83-93
[Abstract]
[Full Text]
-
Auboeuf, D., Dowhan, D. H., Li, X., Larkin, K., Ko, L., Berget, S. M., O'Malley, B. W.
(2004). CoAA, a Nuclear Receptor Coactivator Protein at the Interface of Transcriptional Coactivation and RNA Splicing. Mol. Cell. Biol.
24: 442-453
[Abstract]
[Full Text]
-
Leary, D. J., Terns, M. P., Huang, S.
(2004). Components of U3 snoRNA-containing Complexes Shuttle between Nuclei and the Cytoplasm and Differentially Localize in Nucleoli: Implications for Assembly and Function. Mol. Biol. Cell
15: 281-293
[Abstract]
[Full Text]
-
McCracken, S., Longman, D., Johnstone, I. L., Caceres, J. F., Blencowe, B. J.
(2003). An Evolutionarily Conserved Role for SRm160 in 3'-End Processing That Functions Independently of Exon Junction Complex Formation. J. Biol. Chem.
278: 44153-44160
[Abstract]
[Full Text]
-
Gu, H., Schoenberg, D. R.
(2003). U2AF modulates poly(A) length control by the poly(A)-limiting element. Nucleic Acids Res
31: 6264-6271
[Abstract]
[Full Text]
-
Soller, M., White, K.
(2003). ELAV inhibits 3'-end processing to promote neural splicing of ewg pre-mRNA. Genes Dev.
17: 2526-2538
[Abstract]
[Full Text]
-
Zhu, H., Hasman, R. A., Young, K. M., Kedersha, N. L., Lou, H.
(2003). U1 snRNP-Dependent Function of TIAR in the Regulation of Alternative RNA Processing of the Human Calcitonin/CGRP Pre-mRNA. Mol. Cell. Biol.
23: 5959-5971
[Abstract]
[Full Text]
-
Dredge, B. K., Darnell, R. B.
(2003). Nova Regulates GABAA Receptor {gamma}2 Alternative Splicing via a Distal Downstream UCAU-Rich Intronic Splicing Enhancer. Mol. Cell. Biol.
23: 4687-4700
[Abstract]
[Full Text]
-
Miyaso, H., Okumura, M., Kondo, S., Higashide, S., Miyajima, H., Imaizumi, K.
(2003). An Intronic Splicing Enhancer Element in Survival Motor Neuron (SMN) Pre-mRNA. J. Biol. Chem.
278: 15825-15831
[Abstract]
[Full Text]
-
Gooding, C., Kemp, P., Smith, C. W. J.
(2003). A Novel Polypyrimidine Tract-binding Protein Paralog Expressed in Smooth Muscle Cells. J. Biol. Chem.
278: 15201-15207
[Abstract]
[Full Text]
-
Guil, S., Gattoni, R., Carrascal, M., Abian, J., Stevenin, J., Bach-Elias, M.
(2003). Roles of hnRNP A1, SR Proteins, and p68 Helicase in c-H-ras Alternative Splicing Regulation. Mol. Cell. Biol.
23: 2927-2941
[Abstract]
[Full Text]
-
Miriami, E., Margalit, H., Sperling, R.
(2003). Conserved sequence elements associated with exon skipping. Nucleic Acids Res
31: 1974-1983
[Abstract]
[Full Text]
-
Dansereau, D. A., Lunke, M. D., Finkielsztein, A., Russell, M. A., Brook, W. J.
(2003). hephaestus encodes a polypyrimidine tract binding protein that regulates Notch signalling during wing development in Drosophila melanogaster. Development
129: 5553-5566
[Abstract]
[Full Text]
-
Messina, M., Yu, D. M. T., Both, G. W., Molloy, P. L., Robinson, B. G.
(2003). Calcitonin-Specific Transcription and Splicing Targets Gene-Directed Enzyme Prodrug Therapy to Medullary Thyroid Carcinoma Cells. J. Clin. Endocrinol. Metab.
88: 1310-1318
[Abstract]
[Full Text]
-
Kosinski, P. A., Laughlin, J., Singh, K., Covey, L. R.
(2003). A Complex Containing Polypyrimidine Tract-Binding Protein Is Involved in Regulating the Stability of CD40 Ligand (CD154) mRNA. J. Immunol.
170: 979-988
[Abstract]
[Full Text]
-
Ray, B. K., Murphy, R., Ray, P., Ray, A.
(2002). SAF-2, a Splice Variant of SAF-1, Acts as a Negative Regulator of Transcription. J. Biol. Chem.
277: 46822-46830
[Abstract]
[Full Text]
-
Auboeuf, D., Honig, A., Berget, S. M., O'Malley, B. W.
(2002). Coordinate Regulation of Transcription and Splicing by Steroid Receptor Coregulators. Science
298: 416-419
[Abstract]
[Full Text]
-
Aissouni, Y., Perez, C., Calmels, B., Benech, P. D.
(2002). The Cleavage/Polyadenylation Activity Triggered by a U-rich Motif Sequence Is Differently Required Depending on the Poly(A) Site Location at Either the First or Last 3'-Terminal Exon of the 2'-5' Oligo(A) Synthetase Gene. J. Biol. Chem.
277: 35808-35814
[Abstract]
[Full Text]
-
Peterson, M. L., Bertolino, S., Davis, F.
(2002). An RNA Polymerase Pause Site Is Associated with the Immunoglobulin {micro}s Poly(A) Site. Mol. Cell. Biol.
22: 5606-5615
[Abstract]
[Full Text]
-
Simard, M. J., Chabot, B.
(2002). SRp30c Is a Repressor of 3' Splice Site Utilization. Mol. Cell. Biol.
22: 4001-4010
[Abstract]
[Full Text]
-
Yuan, X., Davydova, N., Conte, M. R., Curry, S., Matthews, S.
(2002). Chemical shift mapping of RNA interactions with the polypyrimidine tract binding protein. Nucleic Acids Res
30: 456-462
[Abstract]
[Full Text]
-
Kamath, R. V., Leary, D. J., Huang, S.
(2001). Nucleocytoplasmic Shuttling of Polypyrimidine Tract-binding Protein Is Uncoupled from RNA Export. Mol. Biol. Cell
12: 3808-3820
[Abstract]
[Full Text]
-
Tran, D. P., Kim, S. J., Park, N. J., Jew, T. M., Martinson, H. G.
(2001). Mechanism of Poly(A) Signal Transduction to RNA Polymerase II In Vitro. Mol. Cell. Biol.
21: 7495-7508
[Abstract]
[Full Text]
-
Wagner, E. J., Garcia-Blanco, M. A.
(2001). Polypyrimidine Tract Binding Protein Antagonizes Exon Definition. Mol. Cell. Biol.
21: 3281-3288
[Full Text]
-
Lou, H., Gagel, R. F.
(2001). Alternative Ribonucleic Acid Processing in Endocrine Systems. Endocr. Rev.
22: 205-225
[Abstract]
[Full Text]
-
Standiford, D. M., Sun, W. T., Davis, M. B., Emerson, C. P. , Jr.
(2001). Positive and Negative Intronic Regulatory Elements Control Muscle-Specific Alternative Exon Splicing of Drosophila Myosin Heavy Chain Transcripts. Genetics
157: 259-271
[Abstract]
[Full Text]
-
Simard, M. J., Chabot, B.
(2000). Control of hnRNP A1 Alternative Splicing: an Intron Element Represses Use of the Common 3' Splice Site. Mol. Cell. Biol.
20: 7353-7362
[Abstract]
[Full Text]
-
Carstens, R. P., Wagner, E. J., Garcia-Blanco, M. A.
(2000). An Intronic Splicing Silencer Causes Skipping of the IIIb Exon of Fibroblast Growth Factor Receptor 2 through Involvement of Polypyrimidine Tract Binding Protein. Mol. Cell. Biol.
20: 7388-7400
[Abstract]
[Full Text]
-
Gosert, R., Chang, K. H., Rijnbrand, R., Yi, M., Sangar, D. V., Lemon, S. M.
(2000). Transient Expression of Cellular Polypyrimidine-Tract Binding Protein Stimulates Cap-Independent Translation Directed by Both Picornaviral and Flaviviral Internal Ribosome Entry Sites In Vivo. Mol. Cell. Biol.
20: 1583-1595
[Abstract]
[Full Text]
-
Jin, W., McCutcheon, I. E., Fuller, G. N., Huang, E. S-C., Cote, G. J.
(2000). Fibroblast Growth Factor Receptor-1 {{alpha}}-Exon Exclusion and Polypyrimidine Tract-binding Protein in Glioblastoma Multiforme Tumors. Cancer Res.
60: 1221-1224
[Abstract]
[Full Text]
-
Ritchie, S., Boyd, F. M., Wong, J., Bonham, K.
(2000). Transcription of the Human c-Src Promoter Is Dependent on Sp1, a Novel Pyrimidine Binding Factor SPy, and Can Be Inhibited by Triplex-forming Oligonucleotides. J. Biol. Chem.
275: 847-854
[Abstract]
[Full Text]
-
Chao, L. C., Jamil, A., Kim, S. J., Huang, L., Martinson, H. G.
(1999). Assembly of the Cleavage and Polyadenylation Apparatus Requires About 10 Seconds In Vivo and Is Faster for Strong than for Weak Poly(A) Sites. Mol. Cell. Biol.
19: 5588-5600
[Abstract]
[Full Text]
-
Christmas, P., Ursino, S. R., Fox, J. W., Soberman, R. J.
(1999). Expression of the CYP4F3 Gene. TISSUE-SPECIFIC SPLICING AND ALTERNATIVE PROMOTERS GENERATE HIGH AND LOW Km FORMS OF LEUKOTRIENE B4 omega -HYDROXYLASE. J. Biol. Chem.
274: 21191-21199
[Abstract]
[Full Text]
-
Zhao, J., Hyman, L., Moore, C.
(1999). Formation of mRNA 3' Ends in Eukaryotes: Mechanism, Regulation, and Interrelationships with Other Steps in mRNA Synthesis. Microbiol. Mol. Biol. Rev.
63: 405-445
[Abstract]
[Full Text]
-
Polydorides, A. D., Okano, H. J., Yang, Y. Y. L., Stefani, G., Darnell, R. B.
(2000). A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl. Acad. Sci. USA
97: 6350-6355
[Abstract]
[Full Text]