Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 807-816, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Ribosomal Pausing and Scanning Arrest as Mechanisms
of Translational Regulation from Cap-Distal Iron-Responsive
Elements
Efrosyni
Paraskeva,
Nicola
K.
Gray,*
Britta
Schläger,
Kristina
Wehr, and
Matthias W.
Hentze
European Molecular Biology Laboratory,
D-69117 Heidelberg, Germany
Received 4 June 1998/Returned for modification 23 September
1998/Accepted 8 October 1998
 |
ABSTRACT |
Iron regulatory protein 1 (IRP-1) binding to an iron-responsive
element (IRE) located close to the cap structure of mRNAs represses
translation by precluding the recruitment of the small ribosomal
subunit to these mRNAs. This mechanism is position dependent; reporter
mRNAs bearing IREs located further downstream exhibit diminished
translational control in transfected mammalian cells. To investigate
the underlying mechanism, we have recapitulated this position effect in
a rabbit reticulocyte cell-free translation system. We show that the
recruitment of the 43S preinitiation complex to the mRNA is unaffected
when IRP-1 is bound to a cap-distal IRE. Following 43S complex
recruitment, the translation initiation apparatus appears to stall,
before linearly progressing to the initiation codon. The slow passive
dissociation rate of IRP-1 from the cap-distal IRE suggests that the
mammalian translation apparatus plays an active role in overcoming the
cap-distal IRE-IRP-1 complex. In contrast, cap-distal IRE-IRP-1
complexes efficiently repress translation in wheat germ and yeast
translation extracts. Since inhibition occurs subsequent to 43S complex
recruitment, an efficient arrest of productive scanning may represent a
second mechanism by which RNA-protein interactions within the 5'
untranslated region of an mRNA can regulate translation. In contrast to
initiating ribosomes, elongating ribosomes from mammal, plant, and
yeast cells are unaffected by IRE-IRP-1 complexes positioned within the open reading frame. These data shed light on a characteristic aspect of the IRE-IRP regulatory system and uncover properties of the
initiation and elongation translation apparatus of eukaryotic cells.
| |
INTRODUCTION |
The regulation of iron metabolism by
the iron-responsive element (IRE)-iron regulatory protein (IRP) system
represents an intensively studied example of translational control in
higher eukaryotes. Several mRNAs encoding proteins involved in cellular iron metabolism harbor an IRE at a cap-proximal position of their 5'
untranslated regions (UTRs). The IRE is specifically recognized by
IRP-1 and IRP-2, which bind to and repress the translation of
IRE-containing mRNAs both in vivo and in vitro (17, 39). Translational control by specific mRNA-protein interactions is commonly
enacted at the level of translation initiation (e.g., caudal
[6, 38], 15-lipoxygenase [35, 36],
and oskar [22, 43]). IRP binding to the IRE
of ferritin mRNAs affects an early step of translation initiation: it
prevents the recruitment of the 43S translation preinitiation complex
(which includes the small ribosomal subunit) (13, 33).
Transfection studies using mammalian tissue culture cells revealed a
characteristic feature of this IRE-IRP regulatory mechanism: for IRP
binding to efficiently block translation, the IRE must be located
within <60 nucleotides from the m7GpppN-cap structure of
the mRNA (9, 10). An IRE placed >60 nucleotides downstream
from the cap structure mediates only partial translational inhibition
by IRP binding. In keeping with this position effect, the cap-proximal
location of mammalian IREs is phylogenetically conserved
(10). The manifestation of the position effect displays
cell-type-dependent quantitative differences (10), suggesting that the ability of the translation apparatus to overcome cap-distal IRE-IRP complexes can be affected by cellular determinants.
To investigate the mechanistic basis of the position effect, we have
employed a rabbit reticulocyte cell-free translation system.
Recapitulation of the position effect in this system provided the basis
for biochemical analyses aimed at understanding the role of the
mammalian translation apparatus in overcoming cap-distal IRE-IRP
complexes. We show that sufficiently cap-distal IRE-IRP complexes
permit the recruitment of the 43S complex, but temporarily slow its
further progression. We demonstrate that initiating and elongating
mammalian ribosomes progress through cap-distal IREs in a linear
fashion in both the presence and absence of IRP-1 and suggest that the
mammalian translation apparatus plays an active role in the
displacement of such IRE-IRP complexes. Finally, we provide evidence
that cap-distal IRE-IRP complexes can efficiently regulate translation
in wheat germ extract (WGE) by arresting productive scanning.
| |
MATERIALS AND METHODS |
Plasmid construction.
Plasmid NOP1 is derived from
pBluescript II SK +/
, and chloramphenicol acetyltransferase (CAT)
plasmids were derived from pGEM-3Zf() and are cloned for
transcription from the T7 RNA polymerase promoter. Plasmids NOP1 and
IRE-mut have been previously described (11, 41). IRE.34 was
created by insertion of a BamHI-XbaI fragment
containing the IRE from F64 (10) into IRE-wt (11, 13) digested with BamHI-XbaI. IRE.66 was
created from IRE-wt by digestion with BamHI and filling of
the BamHI cohesive ends by using Klenow fragment, prior to
digestion with XbaI and insertion of a StuI
fragment from F64 containing the IRE and sequences 5' of the IRE.
IRE.100 was created by ligation of annealed phosphorylated oligodeoxyribonucleotides into IRE.66 after digestion with
XhoI. The sequence of the sense-strand oligonucleotide is
5'-TCGAGATTTAACCTCTTCCA ACCCAAAGGC CTCT-3'. IRE.ORF was
created from plasmid IRE-mut by introduction of annealed phosphorylated
oligodeoxyribonucleotides containing the IRE sequence at position +135
(+1 is the T7 RNA polymerase transcription start site) by overlap
extension by the PCR method described by Ho et al. (19). The
sequence of the sense-strand oligonucleotide is
5'-GGATCCTGCT TCAACAGTGCTTGGACGGAT CTT-3'. IRE/AUG.34,
IRE/AUG.66, and IRE/AUG.100 are identical to plasmids IRE.34, IRE.66,
and IRE.100, respectively, except for the sequence of the IRE stem-loop
and flanking nucleotides, which is
5'-GATCCATCGT TGCTTCAACA GTGCTTGGAC ACGATGGATC-3' and which introduces five additional nucleotides between the cap structure and the IRE (Fig. 1A and C).
View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Reporter mRNAs used in this study. The open reading
frame encoding CAT is denoted by an open box. The position of the IRE
relative to the cap structure is indicated. The black triangle
symbolizes an IRE which lacks the first nucleotide of the conserved
loop. The restriction sites used to linearize the plasmids prior to
transcription are indicated. (A) Diagrammatic representation of
transcripts carrying an IRE at different positions in the 5' UTR. The
extension in the 5' UTR is represented by the thick lines. The
distances between the IRE and the initiator AUG are identical. (B)
Insertion of an IRE into the CAT open reading frame. (C) Diagrammatic
representation of transcripts carrying an AUG initiation codon within
the lower part of the IRE stem. The N-terminal extension of the CAT
open reading frame is represented by a striped box.
|
|
In vitro transcription.
Capped mRNAs were generated with T7
RNA polymerase from CAT plasmids after digestion with
HindIII and NOP1 after BamHI digestion (16). Short 32P-labelled IRE.34, IRE.66, and
IRE.ORF mRNAs (1.6 × 107 cpm/µg of RNA) were
transcribed from the corresponding plasmids digested with
PvuII as described above, with the exception that the final
UTP concentration was reduced to 0.5 mM and 5 µM
[32P]UTP was included. IRE short competitor RNA was
transcribed from IRE-wt linearized with XbaI (37)
and unlabelled IRE.34, IRE.66, IRE.100, IRE.ORF and IRE-mut competitor
mRNAs from the corresponding plasmids digested with PvuII
(12, 13). 32P-labelled IRE probe (2.9 × 107 cpm/µg of RNA) was transcribed from an
XbaI-linearized plasmid (37).
Cell-free translations.
Cell-free translations were
performed in the presence of [35S]methionine (10 mCi/ml).
Reactions in rabbit reticulocyte lysate (RRL; 40% lysate [12 µl])
(Promega, Wis.) contained 0.7 or 2.1 mM Mg2+ (as stated in
text and figure legends) and 63 mM K+. Reactions in WGE
(50% extract [15 µl]) (Promega) contained 117 mM K+
and 1.9 or 2.1 mM Mg2+. Recombinant IRP-1 (16)
was added to mRNAs on ice immediately prior to the addition of the
translation extract. Translation reaction which did not receive
recombinant protein were compensated with buffer N (150 mM KOAc, 24 mM
HEPES [pH 7.6], 1.5 mM MgCl2, 5% glycerol). Short
competitor transcripts were added to mRNAs on ice prior to addition of
translation extract. Translation reaction mixtures were incubated at
30°C (RRL; except in Fig. 10) or 25°C (WGE) for 60 min.
[35S]methionine-labelled products were analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
fluorography. Translation initiation assays and sucrose gradient
analysis were performed as described previously (12, 13).
Gel retardation assays.
Protein samples were incubated with
1 ng of probe for 20 min at room temperature (unless otherwise stated),
followed by a 10-min incubation with 20 U of RNase T1
(Boehringer, Mannheim, Germany) (except for the short ferritin IRE
probe). Heparin (5 to 15 µg/ml) was added for an additional 10 min.
Unlabelled competitor mRNAs were added together with the probe (unless
otherwise stated). RNA-protein complexes were resolved on 4%
nondenaturing polyacrylamide gels.
PhosphorImager quantitative analysis.
For quantification,
the gels were exposed in a Storage Phosphor screen (Molecular Dynamics)
that was subsequently scanned with a PhosphorImager (Molecular
Dynamics). Quantification was done with the Image Quant program
(Molecular Dynamics).
| |
RESULTS |
Recapitulation of the IRE-IRP position effect in a reticulocyte
cell translation extract.
To examine the molecular basis of the
IRE-IRP position effect by biochemical means, we aimed to recapitulate
this effect in a cell-free translation extract. To this end, we
designed the CAT reporter mRNAs IRE.34, IRE.66, and IRE.100, bearing
IREs 34, 66, and 100 nucleotides, respectively, downstream from the cap structure (Fig. 1A). The sequences of the spacer inserts between the
cap structure and the IRE were predicted not to form extensive secondary structure nor to disrupt the structure of the IRE itself. To
examine the translation of these mRNAs in the absence of bound IRPs,
short IRE competitor transcripts were added to sequester endogenous
IRPs present in the extract. While all three CAT mRNAs are efficiently
translated in the presence of the IRE competitor RNA (Fig.
2A, lanes 2, 4, and 6), IRE.34 mRNA is
profoundly repressed by the addition of recombinant IRP-1 (lane 3).
Increasing the distance between the cap structure and the IRE in IRE.66
and IRE.100 mRNAs leads to partial derepression of IRP-mediated
translational control (compare lanes 5 and 7 with lane 3). Since the
magnesium concentration can affect cell-free translation reactions
(4, 27), the experiment was performed at low (0.7 mM [Fig.
2A]) and high (2.1 mM [data not shown]) magnesium concentrations.
The position effect is clearly reflected at both magnesium
concentrations. Importantly, the quantitative difference in
translational repression between mRNAs bearing a cap-proximal IRE
(IRE.34) and a more cap-distal IRE (IRE.66 [2.3-fold]) in vitro
accurately reflects the quantitative difference seen in vivo
(2.05-fold) (10) when similar reporter mRNAs are
assayed (see Fig. 2 and Discussion). Further increases in the distance
between the IRE and the cap structure (IRE.100) cause a further loss in
translational repression by IRP binding (3.4-fold [Fig. 2]).
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Translation of IRE.34, IRE.66, and IRE.100 mRNAs in RRL.
(A) NOP1 (2 ng) (lanes 2 to 7) and 2.5 ng of IRE.34 (lanes 2 and 3),
IRE.66 (lanes 4 and 5), or IRE.100 mRNA (lanes 6 and 7) were translated
in vitro. Where indicated (+), 15 ng of IRE competitor transcript
(lanes 1, 2, 4, and 6) or 150 ng of recombinant IRP-1 (lanes 3, 5, and
7) was added to the reactions. 35S-labelled translation
products were analyzed by SDS-PAGE. The migration of the NOP1 and CAT
translation products is indicated by arrows; molecular mass markers are
shown on the left. (B) The quantative effects of moving the IRE are
expressed (in fold differences) as the relative repression between
IRE.34 and IRE.66 or IRE.100. Values are normalized for the NOP1
internal control. The data are derived from four experimental
repetitions. The values for the position effect in cells are from a
study by Goossen and Hentze (10).
|
|
The position of the IRE critically affects the recruitment of the
small ribosomal subunit.
Sucrose gradient analysis of initiation
reactions had previously shown that cap-proximal IRE-IRP-1 complexes
prevent the recruitment of 43S preinitiation complexes to the mRNA
(13). To examine the effect of a cap-distal IRE-IRP-1
complex on the association of the small ribosomal subunit with the
IRE.100 mRNA, we employed sucrose gradient analysis of initiation
assays containing guanylyl-imidodiphosphate (GMP-PNP). This
nonhydrolyzable GTP analog permits the recruitment of the small
ribosomal subunit to the mRNA and its migration toward the translation
initiation codon, but inhibits the GTP-dependent subsequent joining of
the large ribosomal subunit leading to the accumulation of 48S
complexes (43S preinitiation complex plus mRNA) (2, 18). In
the absence of available IRP (i.e., when IRE competitor transcripts are
added), both mRNAs accumulate in 48S and 66S complexes (Fig.
3), indicating the association of one or
two small ribosomal subunits, respectively, with the mRNAs (13). The identity of these complexes was confirmed by
parallel reactions with mixtures containing either cycloheximide or cap analog and by RNase treatment of GMP-PNP-induced complexes which resulted in a single peak at 48S (reference 13 and
data not shown). Upon addition of IRP-1, the recruitment of 43S
preinitiation complexes to IRE.34 mRNA is prevented, and the mRNA
accumulates in the top fractions of the gradient in mRNPs (Fig. 3A). In
contrast, IRE.100 mRNA redistributes into the 48S region of the
gradient, indicating that single 43S complexes associate with the
IRE.100 mRNA in the presence of IRP-1 (compare Fig. 3B and A). This
result shows that the inhibition of 43S complex recruitment by a
cap-proximal IRE-IRP complex is position dependent. Interestingly, the
presence of a single 43S preinitiation complex (rather than multiple
complexes) on IRE.100 mRNA may indicate that the IRE-IRP-1 complex
stalls scanning along the 5' UTR, leaving insufficient room for a
second 43S complex to bind.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Recruitment of 43S complexes to IRE.34 and IRE.100 mRNAs
in RRL. Shortened mRNA transcripts of IRE.34 (A) and IRE.100 (B) were
incubated in RRL for 5 min in the presence of either 45 ng of IRE
competitor RNA (open squares) or 125 ng of recombinant IRP-1 (solid
diamonds) and fractionated after centrifugation through 5 to 25%
linear sucrose gradients. The assays contained 0.5 mM GMP-PNP. The
labelled mRNA in the fractions is expressed as a percentage of total
counts recovered and is plotted against the fraction number. The dashed
line denotes the A254 absorption profiles, which
were identical for gradients with added IRE or IRP-1.
|
|
To further explore 43S complex recruitment to these mRNAs,
kinetic experiments in the presence of GMP-PNP were undertaken
(Fig.
4). These experiments were
performed at high magnesium concentrations,
where initiation proceeds
more slowly (
2), to increase the
kinetic resolution.
Analysis of IRE.34 mRNA revealed the expected
large difference between
ribosomal subunit recruitment in the
presence and absence of IRP (Fig.
4A to C). The pattern of small
ribosomal subunit recruitment in the
absence of IRP does not significantly
change over time, although a
minor shift from 48S to 66S complexes
occurs (Fig.
4A to C). Even at
the longest time points, in the
presence of IRP, there is not a
significant accumulation of IRE.34
mRNA in 48S or 66S complexes (Fig.
4C). A greater proportion of
IRE.100 mRNA is associated with 66S rather
than 48S complexes
compared to IRE.34 mRNA in the absence of IRP (Fig.
4G to I).
This can be explained in terms of the longer 5' UTR, which
favors
preloading (
28). In the presence of IRP, small
ribosomal subunits
are already efficiently recruited to IRE.100 mRNA at
5 min (Fig.
4G), and there is not a noticeable difference in binding at
2
min (data not shown). However, even at 30 min, the majority of
IRE.100 mRNAs are present in 48S rather than 66S complexes (Fig.
4I),
strongly supporting the notion that the small ribosomal subunits
have
not migrated sufficiently far from the 5' end of the mRNA
to provide
unimpeded access for subsequent subunits.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Kinetic analysis of the recruitment of small ribosomal
subunits. Shortened transcripts of IRE.34 (A to C), IRE.66 (D to F),
and IRE.100 (G to I) were assayed in the presence of either 45 ng of
IRE competitor mRNA (open squares) or 125 ng of recombinant IRP-1
(solid diamonds) for 5 (A, D, and G), 15 (B, E, and H), or 30 (C, F,
and I) min. The assays contained 0.5 mM GMP-PNP and were analyzed by
using 5 to 25% linear sucrose gradients. The labelled mRNA in the
fractions is expressed as a percentage of total counts recovered and is
plotted against the fraction number. The dashed line denotes the
A254 profiles, which were identical for
gradients with added IRE or IRP-1.
|
|
The kinetics of small ribosomal subunit association with IRE.66 mRNA
was also examined (Fig.
4D to F). When IRP is not available,
IRE.66
mRNA is present in a higher proportion of 66S rather than
48S complexes
compared to IRE.34 mRNA (Fig.
4D to F). At the shortest
time point,
IRE.66 mRNA association with small ribosomal subunits
is strongly
inhibited by IRP-1 and appears similar to IRE.34 mRNA
(Fig.
4D).
However, the effect of IRP-1 on small ribosomal subunit
recruitment is
much less profound after 30 min than for IRE.34
mRNA (Fig.
4F). It
therefore seems that the recruitment of small
ribosomal subunits to
IRE.66 mRNA is kinetically delayed by IRP-1.
We next analyzed the kinetics of 80S ribosome formation on IRE.34 and
IRE.100 mRNAs. In agreement with the previous analysis,
Fig.
5D to F show that the presence of IRP-1
does not retard 48S
complex formation with IRE.100 mRNA compared to in
its absence.
Furthermore, comparison of Fig.
5D to F with Fig.
5A to C
reveals
the temporary accumulation of 48S complexes on IRE.100 mRNA
even
in the absence of GTP analogs, indicative of stalled scanning.
In
contrast to analysis in the presence of GMP-PNP, in its absence,
small
ribosomal subunits eventually overcome the cap-distal IRE-IRP
complexes, as the formation of 80S ribosomes can be observed (Fig.
5E
to F). The formation of 80S complexes on IRE.100 mRNA at the
later time
points does not reflect an inactivation or passive
dissociation of
IRP-1, because IRE.34 mRNA remains repressed even
at the latest time
point (Fig.
5C). Compatible results were obtained
at low (0.7 mM)
magnesium concentrations (percent mRNA in 80S
or heavier complexes in
the presence of IRP: IRE.34, 6%; IRE.100,
20%). Thus the sucrose
gradient analysis of IRE.100 mRNA suggests
that its partial
translational repression cannot be attributed
to a slower recruitment
of 43S complexes to the mRNA, but more
likely is due to the kinetic
effect of pausing scanning ribosomal
subunits.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
Kinetic analysis of 80S ribosome assembly on IRE.34 and
IRE.100 mRNAs. Shortened transcripts of IRE.34 (A to C) and IRE.100 (D
to F) were assayed in the presence of either 45 ng of IRE competitor
RNA (open squares) or 125 ng of recombinant IRP-1 (solid diamonds) for
5 (A and D), 15 (B and E), or 30 (C and F) min. The assays contained
0.1 mM cycloheximide and were analyzed by using 5 to 25% linear
sucrose gradients. The labelled mRNA in the fractions is expressed as a
percentage of total counts recovered and is plotted against the
fraction number. The dashed line denotes the
A254 profiles, which were identical for
gradients with added IRE or IRP-1.
|
|
In conclusion, this analysis reveals that two mechanisms exist to
impede translation by RNA-protein complexes. In the first,
cap-proximal
RNA-protein complexes inhibit ribosomal association
with the mRNA
(IRE.34). In the second, cap-distal RNA-protein
complexes delay
productive scanning towards 80S complex formation
(IRE.100).
Elongating ribosomes linearly transgress IRE-IRP-1 complexes
located within the open reading frame.
To examine if an IRE-IRP-1
complex located within the open reading frame of an mRNA can affect
translation, an IRE was inserted into the CAT coding region, 32 nucleotides downstream of the A of the AUG codon, to create IRE.ORF
(Fig. 1B). This insertion preserved and extended the CAT open reading
frame. IRE.34 mRNA and IRE.ORF mRNA were translated in the RRL
cell-free system (Fig. 6), including NOP1
mRNA as an internal control and IRE-mut mRNA as a negative control with
a point-mutated IRE that cannot bind IRP-1. In the presence of
competitor IRE transcripts to titrate the endogenous IRPs, all
mRNAs are translated with similar efficiencies (lanes 2, 5, and 8). The
translation product of ORF.CAT mRNA displays a slower mobility
(labelled CAT+ [lane 5]), consistent with the insertion of the
IRE sequence. When the competitor IRE is omitted (lanes 3 and 6) or
when saturating quantities of recombinant IRP-1 are added (lanes 4, 7, and 9), only IRE.34 mRNA translation is repressed, while the
translation of IRE.ORF mRNA is entirely unaffected and yields the
extended CAT+ translation product (lanes 6 and 7). Thus, elongating
ribosomes possess the capacity to linearly translate regions of the
mRNA that are bound by high-affinity RNA binding proteins. The
impediment imposed by such RNA-protein complexes is not sufficient to
significantly impinge on the yield of translation products.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
IRE-IRP-1 complexes within the open reading frame do
not affect mRNA translation. NOP1 (5 ng) (lanes 2 to 9) and 2.5 ng of
IRE.34 (lanes 2 to 4), IRE.ORF (lanes 5 to 7), or IRE-mut (lanes 8 and
9) were translated in RRL. Where indicated, 15 ng of IRE competitor
transcript (lanes 2, 5, and 8) or 200 ng of recombinant IRP-1 (lanes 4, 7, and 9) was added to the reactions. 35S-labelled
translation products were analyzed by SDS-PAGE. [35S]Met
incorporation into translation products was determined by
phosphoimaging, and the relative repression of CAT synthesis in the
presence of recombinant IRP-1 normalized for the NOP1 internal control
is shown below each lane, with repression of IRE.34 set as 100%. The
migrations of the NOP1 and CAT and longer CAT+ translation products are
indicated by arrows; molecular mass markers are shown on the left.
|
|
Linear scanning through cap-distal IRE-IRP complexes during
translation initiation.
To overcome cap-distal IRE-IRP complexes
subsequent to the recruitment of the small ribosomal subunit to IRE.100
mRNA, the initiation apparatus might either traverse the entire 5' UTR
in a linear fashion or bypass the IRE-IRP-1 complex by a jumping or
shunting mechanism, as shown for the initiation of translation of
cauliflower mosaic virus 35S RNA (7) or adenovirus late mRNAs (44). To distinguish between these possibilities, an
in-frame AUG codon was introduced into the IREs of IRE.34, IRE.66, and IRE.100 mRNAs to create IRE/AUG.34, IRE/AUG.66, and IRE/AUG.100 mRNAs,
respectively (Fig. 1C). If the translation machinery were to hop or
shunt past the IRE-IRP-1 complex, initiation should occur at the
downstream CAT initiation codon. However, if the entire 5' UTR is
linearly scanned, protein synthesis should start from the AUG within
the IRE and yield an extended protein product. When endogenous IRPs are
titrated by competitor IREs, translation of the three different IRE/AUG
mRNAs predominantly yields the N-terminally extended CAT polypeptide,
indicating that the AUG codon within the IRE is efficiently recognized
in the absence of IRP-1 (Fig. 7, lanes 5, 9, and 13). Interestingly, leaky scanning, which leads to the synthesis
of the smaller CAT polypeptide, decreases as the distance between the
5' end of the mRNA and the initiation codon is increased (compare
IRE/AUG.34 with IRE/AUG.100). All three IRE/AUG mRNAs
display the same response to IRP-1 as their non-IRE/AUG
counterparts (compare lanes 5 and 6 with lanes 3 and 4, lanes 9 and 10 with lanes 7 and 8, and lanes 13 and 14 with lanes 11 and 12, respectively), demonstrating that the position effect is preserved
following the insertion of the AUGs. Importantly, IRE/AUG.66 and
IRE/AUG.100 mRNAs yield the N-terminally extended CAT polypeptides,
even in the presence of IRP-1. Thus, the entire 5' UTR including the
IRE is scanned in a linear fashion during initiation of translation,
inconsistent with the notion that the IRE-IRP complex is bypassed by a
hopping or shunting mechanism.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
Cap-distal IRE-IRP complexes are not bypassed during
initiation of translation. NOP1 (5 ng) (lanes 2 to 14) and 2.5 ng of
IRE.34 (lanes 3 and 4), IRE/AUG.34 (lanes 5 and 6), IRE.66 (lanes 7 and
8), IRE/AUG.66 (lanes 9 and 10), IRE.100 (lanes 11 and 12), or
IRE/AUG.100 (lanes 13 and 14) were translated in RRL, in the presence
of 15 ng of IRE competitor RNA or 200 ng of recombinant IRP-1.
35S-labelled translation products were analyzed by
SDS-PAGE. [35S]Met incorporation into translation
products was determined by phosphoimaging, and the relative repression
of CAT synthesis in the presence of recombinant IRP-1 normalized for
the NOP1 internal control is shown below, with repression of IRE.34 set
as 100%. The migrations of the NOP1 and CAT and longer CAT+
translation products are indicated by arrows; molecular mass markers
are shown on the left.
|
|
Active IRP-1 displacement from cap-distal IREs by the mammalian
translation apparatus.
The possibility that the observed IRE
position effect could result from different affinities of the
respective IREs for IRP-1 was excluded by competition gel retardation
assays (data not shown). This is consistent with previous results
(10).
Another series of competition gel retardation assays were then
performed to estimate the passive dissociation rate of IRP-1
in the
cell-free-translation extract (Fig.
8).
The RRL was pretreated
with an m
7GpppG cap analog to
prevent the recruitment of the translation
apparatus to the mRNAs,
which might cause active IRP-1 displacement.
Capped radiolabelled
IRE.34, IRE.100, and IRE.ORF mRNAs were subsequently
incubated in this
extract with 50 ng of recombinant IRP-1 to allow
formation of
IRE-IRP-1 complexes. After 10 min, 1 µg of IRE competitor
or rRNA as
a nonspecific competitor was added, and the incubation
was continued to
assess the passive dissociation of IRP-1 from
the mRNAs. Aliquots taken
at 0, 10, 20, and 60 min after the addition
of competitor RNA were
loaded on a running, native polyacrylamide
gel, resulting in the
shorter migration distances of IRE-IRP complexes
of samples loaded at
later time points (Fig.
8). Addition of the
IRE competitor
simultaneously with the probe completely abolishes
complex formation
(lanes 9 to 12), demonstrating that the competitor
is in excess.
Complexes formed between the IRE.34, IRE.100, and
IRE.ORF IREs and
IRP-1 appear to be equally stable, and the majority
of the mRNAs are
still associated with IRP-1 after 60 min. Due
to the stability of the
IRE-IRP-1 complexes, their half-lives
(
t1/2s)
exceed the duration of the assay; the
t1/2s were
thus
extrapolated to range between 66 and 73 min (Fig.
8). The slow
passive dissociation of IRP-1 from IRE.34, IRE.100, and IRE.ORF
RNAs
suggests that both the initiation apparatus and the elongation
translation apparatus play an active role in displacing IRP-1
from
cap-distal IREs.
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 8.
Stability of the IRE-IRP-1 complexes.
32P-labelled IRE.34, IRE.100, or IRE.ORF probes (2 ng) were
incubated with 100 ng of recombinant IRP-1 in 40% RRL for 10 min at
30°C, to allow formation of IRE-IRP complexes, before addition of IRE
competitor (1 µg) (lanes 1 to 4) or 1 µg of rRNA (lanes 5 to 8).
Aliquots were taken after 0, 10, 20, and 60 min and analyzed on a
running nondenaturing gel. In control reactions, the IRE competitor RNA
was added simultaneously with the probe (lanes 9 to 12).
|
|
The position effect is species restricted.
IRP-1-mediated
repression has previously been reconstituted in WGE (13, 16,
42), which, unlike mammalian cells and extracts, does not contain
endogenous IRP (16, 42). To test whether IRP-1-mediated
repression in this system is position dependent, the translation of
IRE.34 and IRE.100 was examined in WGE by using IRE-mut and NOP mRNAs
as negative and internal controls, respectively. In the absence of
exogenous IRP-1, all three test transcripts are translated with
comparable efficiencies (Fig. 9, lanes 2, 4, and 6). The translation of both IRE.34 and IRE.100 mRNAs is repressed specifically and to a comparable extent with saturating (lanes 3 and 5) and subsaturating (data not shown) amounts of exogenously added IRP-1. We also evaluated the effect of IRP-1 in a
yeast-free-cell translation extract, which, like wheat germ, is devoid
of endogenous IRE-binding activity (34). As in the wheat
germ system, IRP-mediated translational repression does not exhibit a
significant position dependence in yeast (25) or in a
yeast-free-cell translation extract (data not shown). This apparent
difference between RRL and the wheat germ and yeast extracts was
further investigated with the wheat germ system. Control experiments
showed that the observed differences were not due to different buffer
conditions or incubation temperatures (data not shown). Direct
comparison of ribosome assembly on IRE.100 mRNA in the presence of
IRP-1 shows that both 48S and 80S complexes assemble in RRL after 30 min, whereas only 48S complexes assemble in WGE (compare Fig.
10B and C [Fig. 10A
is a control for IRP-1 activity]). This result is best explained by
extended stalling of the scanning subunits by the cap-distal IRE-IRP-1
complexes in WGE. These results also show that the position effect
observed in mammalian cells and in the cell-free-translation extract
derived from mammalian cells is not universal, but species restricted. They suggest that mammalian cells possess an activity with which they
can overcome cap-distal high-affinity RNA-protein complexes.
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
Position-independent translational repression by IRP-1
in WGE. NOP1 (10 ng) (lanes 2 to 7) and 5 ng of IRE.34 (lanes 2 and 3),
IRE.100 (lanes 4 and 5), or IRE-mut (lanes 6 and 7) mRNAs were
translated in WGE in the absence () (lanes 2, 4, and 6) or presence
(+) of 200 ng of recombinant IRP-1 (lanes 3, 5, and 7).
35S-labelled translation products were analyzed by
SDS-PAGE. The migrations of NOP1 and CAT translation products are
indicated by arrows; molecular mass markers are shown on the left.
|
|
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 10.
Ribosome assembly on IRE.34 and IRE.100 mRNAs in
RRL (A and B) and WGE (C). Shortened mRNA transcripts of IRE.34 (A) and
IRE.100 (B and C) were assayed in the absence of IRP-1 (C [open
squares]) and the presence of either 45 ng of IRE competitor RNA (A
and B [open squares]) or 125 ng of recombinant IRP-1 (A, B, and C
[solid diamonds]). The samples were incubated for 30 min at 25°C in
the presence of cycloheximide and analyzed on 5 to 25% linear sucrose
gradients. The labelled mRNA in the fractions is expressed as a
percentage of total counts recovered and is plotted against the
fraction number. The dashed line denotes the
A254 profile, which was unaltered by the
addition of IRE competitor transcripts or IRP-1.
|
|
| |
DISCUSSION |
This study addresses a long-standing question that was raised when
the positions of IREs in various mRNAs and from different species were
found to be phylogenetically conserved and functionally important
(9, 10). Subsequent studies added further examples of
cellular mRNAs that appear to obey the position effect (15, 32) and also uncovered possible exceptions (15,
23 [see below]). The mechanism by which cap-proximal
IRE-IRP complexes regulate translation initiation is increasingly well
understood. In this report, we provide a molecular analysis of the
function of cap-distal IRE-IRP complexes. These findings have shed
light on the understanding of the biology of the IRE-IRP regulatory system in particular and the understanding of the functional interplay between ribosomes and mRNA binding proteins in general.
The experimental system.
The position effect was recapitulated
in a well-characterized mammalian cell-free translation system, RRL
(20). Using reporter mRNAs with the same 5' UTR spacer
sequences as in previous transfection experiments with murine B6
fibroblasts and human HeLa cells (10), we could directly
compare the qualitative and quantitative effects of IRP binding to IREs
located in different positions of the mRNA. IRE.34 mRNA in this study
and F44 mRNA in the transfection experiments (10) served as
positive controls and points of reference for the profound repressive
effect of IRP binding to a cap-proximal IRE. IRE.66 mRNA (this study)
and F64 mRNA (in the transfection experiments [10])
allowed a comparative assessment of the role of IRE-IRP complexes
formed more than 60 nucleotides downstream from the cap structure. Our
results show that the RRL system reflects the roughly twofold (50%)
difference between F44 and F64 mRNAs in vivo (10) and IRE.34
and IRE.66 mRNAs in vitro (Fig. 2) with reassuring accuracy. In
addition to the IRE.34 and IRE.66 mRNAs, we designed the two constructs
IRE.100 and IRE.ORF. The former displays a stronger 5' UTR position
effect than F64 and IRE.66, respectively, by placing the IRE 100 nucleotides downstream from the cap structure (Fig. 2). The latter
allowed the analysis of the effect of IRE-IRP complexes on elongating
ribosomes (Fig. 6).
Function of cap-distal IRE-IRP complexes in the 5' UTRs of
mammalian and nonmammalian mRNAs.
In contrast to cap-proximal
IRE-IRP-1 complexes that preclude the recruitment of the 43S
translation preinitiation complex (including the 40S ribosomal subunit)
(Fig. 3A) (13, 33), 43S complex recruitment to IRE.100 mRNA
is not impeded (Fig. 3B and Fig. 4G to I). Kinetic analyses employing
IRE.66 and IRE.100 mRNAs revealed that IRP-1 binding to IRE.100 mRNA
does not even delay 43S complex recruitment (Fig. 4), whereas this
complex associates more slowly and less efficiently with IRE.66 mRNA in
the presence of IRP-1 than in its absence (Fig. 4D to F). This kinetic
delay contributes to the stronger repressive effect of IRP-1 on IRE.66 than that on IRE.100 mRNA. It is unclear from the analysis of IRE.66
whether small ribosomal subunit scanning is also delayed.
Subsequent to 43S complex recruitment, the small ribosomal subunit
appears to be stalled by the IRE-IRP complex of IRE.100
mRNA. This is
suggested by the reduced translational efficiency
of IRE.100 mRNA in
the presence of IRP-1 compared to that in its
absence (despite the
unimpeded initial association of the 43S
complex) and the
redistribution of IRE.100 mRNA from 66S complexes
(indicative of two
43S complexes) to 48S complexes (with a single
43S complex) in the
presence of IRP-1 (Fig.
3B and Fig.
4G to
I). This redistribution
indicates that the temporary stalling
of a 43S complex which occupies
~35 to 80 nucleotides of the 5'
UTR (
29) prevents the
binding of a second
complex.
After the temporary scanning arrest, the translation machinery linearly
transgresses the remainder of the 5' UTR to the translation
initiation
codon (Fig.
5). Our findings with the IRE/AUG.66 and
IRE/AUG.100 mRNAs
(Fig.
7) show that the translation apparatus
does not negotiate the
IRE-IRP complex by a nonlinear hopping
or shunting mechanism (
7,
40,
44). Ribosomal scanning through
the region of the IRE will
likely require the absence of IRP-1,
although this cannot be formally
concluded from our experiments.
This interpretation begs the question
of whether the stalled preinitiation
complex "sits and waits" for
the passive dissociation of IRP-1
or whether it actively participates
in dislodging the bound protein.
We favor the latter hypothesis. In
contrast to IRE.34 mRNA, IRE.100
mRNA displays only a 26 to 35%
repression (Fig.
2 [27%]), yet
both mRNAs bind IRP-1 with equal
affinities (data not shown) and
comparable dissociation rates (Fig.
8).
While this difference
may suggest that a preloaded ribosomal complex
can actively contribute
to IRP-1 displacement, the more efficient
translation of IRE.100
mRNA could be alternatively explained by a
faster rate at which
a preloaded and stalled preinitiation complex
scans through the
IRE region before IRP-1 rebinding, compared to the
less rapid
recruitment of a 43S complex to IRE.34 mRNA. However, we
favor
an active contribution of the mammalian translational apparatus,
since this is consistent with the very slow passive dissociation
rate
of IRP-1 (Fig.
8) and the species specificity of the position
effect
(Fig.
9). Assuming that the translation apparatus actively
contributes
to IRP-1 displacement, the displacement activity would
be predicted to
be recruited to the mRNA with or after the 43S
preinitiation complex.
This activity may represent an RNA helicase,
which could indirectly
displace IRP by disrupting the IRE, or
a novel protein-displacing
factor.
Function of IRE-IRP complexes in the open reading frame of
mRNAs.
When an IRE-IRP-1 complex is encountered by elongating
rather than initiating ribosomes, translation proceeds without
noticeable impediment. The translation of IRE.ORF mRNA (which bears
an IRE 32 nucleotides downstream from the initiation codon) is equally efficient in the presence of IRP-1 as in its absence in RRL (Fig. 6)
and yeast and wheat germ translation extracts (data not shown). Thus,
this property of elongating ribosomes appears to be a more general one.
These data are also consistent with other reports which have shown that
impediments imposed by RNA secondary structures within the open reading
frame are more easily overcome than those within the 5' UTR (30,
31). Nonetheless, previous data indicate that even translation
elongation can be affected by IRE-IRP complexes under special
circumstances: the human immunodeficiency virus Gag-Pol ribosomal
frameshift requires a so-called "heptanucleotide slippery
sequence," which induces a low level of basal frameshifting and a
downstream RNA structure as an enhancer of this process. IRE-IRP
complexes can functionally substitute for the downstream RNA structure
and mediate regulated ribosomal frameshifting (24).
System-specific and general biological implications of the position
effect.
An expanding number of mRNAs have been found to be
translationally regulated by the IRE-IRP system (15, 17,
23). In mammalian cells, all of the examples that have been
identified to date are regulated by cap-proximal IREs located <50
nucleotides downstream from the cap structure. Since IRE-IRP complexes
that are located further downstream in the 5' UTR still display
translational control by IRP binding, albeit less efficiently (this
study and reference 10), variation of the distance
of the IRE from the transcription start site could be employed as a
means of fine-tuning the regulatory effects of IRP binding.
In contrast to mammalian cells and RRL, we have found that plant and
yeast translation extracts do not display a position
effect. The lack
of a position effect in yeast translation extracts
correlates well with
a recent study that suggests that yeast cells
do not exhibit a position
effect, at least when the IRE is moved
approximately 60 nucleotides
from the cap (
25). Our results
suggest that increasing this
distance further would not lead to
position dependence in yeast cells.
The relative insensitivity
of yeast cells and extracts to the positions
of RNA-protein complexes
within their 5' UTR is consistent with the
observation that the
translation of mRNAs in yeast is particularly
sensitive to the
presence of secondary structures (
1). No
such observation has
been made with WGE, where moderately stable
structures have been
shown not to inhibit the progression of the
translational machinery
(
26). While neither yeast nor plants
appear to regulate their
iron metabolism by the IRE-IRP system, the
succinate dehydrogenase
(Ip subunit) mRNA from
Drosophila
melanogaster was found to be
translationally regulated by IRP
(
15,
23). Dependent on the
transcription start site, the IRE
in this mRNA is located in either
a cap-proximal or a cap-distal
position. It is currently unknown
whether
Drosophila is
mammal-like or wheat germ- or yeast-like
with regard to the position
effect. Nonetheless, our data (Fig.
3B,
4G to I, 5D to F, and 10) would
suggest that, at least in
part, regulation may be achieved by stalling
the progression of
the scanning preinitiation
complex.
More generally, other RNA-protein interactions have been identified
that regulate translation by means of 5' UTR binding sites
(
14). The data in this report show that there are at least
two
different mechanisms by which translation initiation can be
regulated
by 5' UTR mRNA binding proteins: inhibition of 43S complex
recruitment
(as in IRE.34 mRNA) and stalled scanning without inhibited
43S
complex recruitment (as in IRE.100 mRNA). The newly identified
mechanism of stalled scanning by cap-distal RNA-protein complexes
could
potentially explain known examples of translational control,
such as
the autoregulation of poly(A)-binding protein mRNA by
poly(A)-binding
protein (
5) or the regulation of
Drosophila msl-2 mRNA by the Sex-lethal protein (
3,
8,
21).
The regulation
of F64 and IRE.66 mRNAs may result from a composite of
the two
mechanisms described above. Stalled scanning could represent a
very efficient means of translational regulation in yeast and
plant
systems, so that the dissociation rate of the binding protein
becomes a
key determinant for control. In mammals, the position
effect offers an
opportunity for tissue-specific or developmental
regulation by changing
the concentration or activity of factors
which assist the initiating
ribosomes in overcoming cap-distal
RNA-protein complexes or by altering
the transcription start
site.
| |
ACKNOWLEDGMENTS |
We thank Thomas Preiss for the gift of yeast translation extract.
N.K.G. thanks Jeremy Brock for encouragement and advice during the
course of this work. We also thank Thomas Preiss and George Simos for
critical reading of the manuscript.
E.P. and N.K.G. were supported through grants by the European
Commission and the Deutsche Forschungsgemeinschaft, respectively, to
M.W.H.
E.P. and N.K.G. contributed equally to this work.
| |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Biochemistry, 433 Babcock Dr., University of Wisconsin
Madison,
Madison, WI 53706. Phone: (608) 262-0347. Fax: (608) 265-9898. E-mail: ngray{at}biochem.wisc.edu.
Present address: ZMBH, 69120 Heidelberg, Germany.
| |
REFERENCES |
| 1.
|
Altmann, M., and H. Trachsel.
1994.
The yeast Saccharomyces cerevisiae system: a powerful tool to study the mechanism of protein synthesis initiation in eukaryotes.
Biochimie
76:853-861[Medline].
|
| 2.
|
Anthony, D. D., and W. C. Merrick.
1992.
Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.
J. Biol. Chem.
267:1554-1562[Abstract/Free Full Text].
|
| 3.
|
Bashaw, G. J., and B. S. Baker.
1997.
The regulation of the Drosophila msl-2 gene reveals a function for Sex-lethal in translational control.
Cell
89:789-798[Medline].
|
| 4.
|
Dasso, M. C., and R. J. Jackson.
1989.
On the fidelity of mRNA translation in the nuclease-treated rabbit reticulocyte lysate system.
Nucleic Acids Res.
17:3129-3144[Abstract/Free Full Text].
|
| 5.
|
de Melo Neto, O. P.,
N. Standart, and C. Martins de Sa.
1995.
Autoregulation of poly(A)-binding protein synthesis in vitro.
Nucleic Acids Res.
23:2198-2205[Abstract/Free Full Text].
|
| 6.
|
Dubnau, J., and G. Struhl.
1996.
RNA recognition and translational regulation by a homeodomain protein.
Nature
379:694-699[Medline].
|
| 7.
|
Fütterer, J.,
Z. Kiss-Laszlo, and T. Hohn.
1993.
Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA.
Cell
73:789-802[Medline].
|
| 8.
|
Gebauer, F.,
L. Meredino,
M. W. Hentze, and J. Valcarcel.
1998.
The Drosophila splicing regulator Sex-lethal directly inhibits translation of male-specific-lethal-2 mRNA.
RNA
4:142-150[Abstract].
|
| 9.
|
Goossen, B.,
S. W. Caughman,
J. B. Harford,
R. D. Klausner, and M. W. Hentze.
1990.
Translational repression by a complex between the iron-responsive element of ferritin mRNA and its specific cytoplasmic binding protein is position-dependent in vivo.
EMBO J.
9:4127-4133[Medline].
|
| 10.
|
Goossen, B., and M. W. Hentze.
1992.
Position is the critical determinant for function of iron-responsive elements as translational regulators.
Mol. Cell. Biol.
12:1959-1966[Abstract/Free Full Text].
|
| 11.
|
Gray, N. K.
1994.
The mechanism of translational repression by iron regulatory protein. Ph.D. thesis
University of Glasgow, Glasgow, Scotland.
|
| 12.
|
Gray, N. K.
1998.
Translational control by repressor proteins binding to the 5'UTR of mRNAs.
Methods Mol. Biol.
77:379-397[Medline].
|
| 13.
|
Gray, N. K., and M. W. Hentze.
1994.
Iron regulatory protein prevents binding of the 43S translation pre-initiation complex to ferritin and eALAS mRNAs.
EMBO J.
13:3882-3891[Medline].
|
| 14.
|
Gray, N. K., and M. W. Hentze.
1994.
Regulation of protein synthesis by mRNA structure.
Mol. Biol. Rep.
19:195-200[Medline].
|
| 15.
|
Gray, N. K.,
K. Pantopoulos,
T. Dandekar,
B. A. C. Ackrell, and M. W. Hentze.
1996.
Translational regulation of mammalian and Drosophila Krebs cycle enzymes via iron-responsive elements.
Proc. Natl. Acad. Sci. USA
93:4925-4930[Abstract/Free Full Text].
|
| 16.
|
Gray, N. K.,
S. Quick,
B. Goossen,
A. Constable,
H. Hirling,
L. C. Kühn, and M. W. Hentze.
1993.
Recombinant iron regulatory factor functions as an iron-responsive element-binding protein, a translational repressor and an aconitase. A functional assay for translational repression and direct demonstration of the iron switch.
Eur. J. Biochem.
218:657-667[Medline].
|
| 17.
|
Hentze, M. W., and L. C. Kühn.
1996.
Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide and oxidative stress.
Proc. Natl. Acad. Sci. USA
93:8175-8182[Abstract/Free Full Text].
|
| 18.
|
Hershey, J. W. B., and R. E. Monro.
1966.
A competitive inhibitor of the GTP reaction in protein synthesis.
J. Mol. Biol.
18:68-76[Medline].
|
| 19.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction.
Gene
77:51-59[Medline].
|
| 20.
|
Jackson, R. J., and T. Hunt.
1983.
Preparation and use of nuclease-treated rabbit reticulocyte lysates for the translation of eukaryotic messenger RNA.
Methods Enzymol.
96:50-74[Medline].
|
| 21.
|
Kelley, R. L.,
J. Wang,
L. Bell, and M. I. Kuroda.
1997.
Sex-lethal controls dosage compensation in Drosophila by a non-splicing mechanism.
Nature
387:195-199[Medline].
|
| 22.
|
Kim-Ha, J.,
K. Kerr, and P. M. Macdonald.
1995.
Translational regulation of oskar mRNA by Bruno, an ovarian RNA-binding protein, is essential.
Cell
81:403-412[Medline].
|
| 23.
|
Kohler, S. A.,
B. R. Henderson, and L. C. Kuhn.
1995.
Succinate dehydrogenase b mRNA of Drosophila melanogaster has a functional iron-responsive element in its 5'-untranslated region.
J. Biol. Chem.
270:30781-30789[Abstract/Free Full Text].
|
| 24.
|
Kollmus, H.,
M. W. Hentze, and H. Hauser.
1996.
Regulated ribosomal frameshifting by an RNA-protein interaction.
RNA
2:316-323[Abstract].
|
| 25.
|
Koloteva, N.,
P. P. Mueller, and J. E. G. McCarthy.
1997.
The position dependence of translational regulation via RNA-RNA and RNA-protein interactions in the 5'-untranslated region of eukaryotic mRNA is a function of the thermodynamic competence of 40S ribosomes in translational initiation.
J. Biol. Chem.
272:16531-16539[Abstract/Free Full Text].
|
| 26.
|
Kozak, M.
1989.
Circumstances and mechanisms of inhibition of translation by secondary structure in eucaryotic mRNAs.
Mol. Cell. Biol.
9:5134-5142[Abstract/Free Full Text].
|
| 27.
|
Kozak, M.
1990.
Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources.
Nucleic Acids Res.
18:2828[Free Full Text].
|
| 28.
|
Kozak, M.
1991.
Effects of long 5' leader sequences on initiation by eukaryotic ribosomes in vitro.
Gene Expr.
1:117-125[Medline].
|
| 29.
|
Kozak, M., and A. J. Shatkin.
1977.
Sequences of two 5'-terminal ribosome-protected fragments from reovirus messenger RNAs.
J. Mol. Biol.
112:75-96[Medline].
|
| 30.
|
Liebhaber, S. A.,
F. E. Cash, and S. H. Shakin.
1984.
Translationally associated helix-destabilizing activity in rabbit reticulocyte lysate.
J. Biol. Chem.
259:15597-15602[Abstract/Free Full Text].
|
| 31.
|
Lingelbach, K., and B. Dobberstein.
1988.
An extended RNA/RNA duplex structure within the coding region of mRNA does not block translational elongation.
Nucleic Acids Res.
16:3405-3414[Abstract/Free Full Text].
|
| 32.
|
Melefors, Ö.,
B. Goossen,
H. E. Johansson,
R. Stripecke,
N. K. Gray, and M. W. Hentze.
1993.
Translational control of 5-aminolevulinate synthase mRNA by iron-responsive elements in erythroid cells.
J. Biol. Chem.
268:5974-5978[Abstract/Free Full Text].
|
| 33.
|
Muckenthaler, M.,
N. K. Gray, and M. W. Hentze.
1998.
IRP-1 binding to ferritin mRNA disrupts the bridging interaction between cap-binding complex and the small ribosomal subunit.
Mol. Cell
2:383-388[Medline].
|
| 34.
|
Oliveira, C. C.,
B. Goossen,
N. I. T. Zanchin,
J. E. G. McCarthy,
M. W. Hentze, and R. Stripecke.
1993.
Translational repression by the human iron-regulatory factor (IRF) in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:5316-5322[Abstract/Free Full Text].
|
| 35.
|
Ostareck, D. H.,
A. Ostareck-Lederer,
M. Wilm,
B. J. Thiele,
M. Mann, and M. W. Hentze.
1997.
mRNA silencing in erythroid differentiation: hnRNP K and hnRNP E1 regulate 15-lipoxygenase translation from the 3' end.
Cell
16:597-606.
|
| 36.
|
Ostareck-Lederer, A.,
D. H. Ostareck,
N. Standart, and B. Thiele.
1994.
Translation of 15-lipoxygenase mRNA is inhibited by a protein that binds to a repeated sequence in the 3' untranslated region.
EMBO J.
13:1476-1481[Medline].
|
| 37.
|
Pantopoulos, K., and M. W. Hentze.
1995.
Nitric oxide signaling to iron-regulatory protein (IRP): direct control of ferritin mRNA translation and transferrin receptor mRNA stability in transfected fibroblasts.
Proc. Natl. Acad. Sci. USA
92:1267-1271[Abstract/Free Full Text].
|
| 38.
|
Rivera-Pomar, R.,
D. Niessing,
U. Schmidt-Ott,
W. J. Gehring, and H. Jaeckle.
1996.
RNA binding and translational suppression by bicoid.
Nature
379:746-749[Medline].
|
| 39.
|
Rouault, T. A.,
R. D. Klausner, and J. B. Harford.
1996.
Translational control of ferritin, p. 335-363.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonnenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 40.
|
Schneider, R. J.
1996.
Adenovirus and vaccinia virus translational control, p. 575-606.
In
J. W. B. Hershey, M. B. Matthews, and N. Sonenberg (ed.), Translational control. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Stripecke, R., and M. W. Hentze.
1992.
Bacteriophage and spliceosomal proteins function as position-dependent cis/trans repressors of mRNA translation in vitro.
Nucleic Acids Res.
20:5555-5564[Abstract/Free Full Text].
|
| 42.
|
Walden, W. E.,
M. M. Patino, and L. Gaffield.
1989.
Purification of a specific repressor of ferritin mRNA translation from rabbit liver.
J. Biol. Chem.
264:13765-13769[Abstract/Free Full Text].
|
| 43.
|
Webster, P. J.,
L. Liang,
C. A. Berg,
P. Lasko, and P. M. Macdonald.
1997.
Translational repressor bruno plays multiple roles in development and is widely conserved.
Genes Dev.
11:2510-2521[Abstract/Free Full Text].
|
| 44.
|
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat shocked cells.
Genes Dev.
10:1557-1567[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 1999, p. 807-816, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schepetilnikov, M., Schott, G., Katsarou, K., Thiebeauld, O., Keller, M., Ryabova, L. A.
(2009). Molecular dissection of the prototype foamy virus (PFV) RNA 5'-UTR identifies essential elements of a ribosomal shunt. Nucleic Acids Res
37: 5838-5847
[Abstract]
[Full Text]
-
Nie, M., Htun, H.
(2006). Different modes and potencies of translational repression by sequence-specific RNA-protein interaction at the 5'-UTR. Nucleic Acids Res
34: 5528-5540
[Abstract]
[Full Text]
-
Meng, Z., King, P. H., Nabors, L. B., Jackson, N. L., Chen, C.-Y., Emanuel, P. D., Blume, S. W.
(2005). The ELAV RNA-stability factor HuR binds the 5'-untranslated region of the human IGF-IR transcript and differentially represses cap-dependent and IRES-mediated translation. Nucleic Acids Res
33: 2962-2979
[Abstract]
[Full Text]
-
Melo, E. O., Dhalia, R., de Sa, C. M., Standart, N., de Melo Neto, O. P.
(2003). Identification of a C-terminal Poly(A)-binding Protein (PABP)-PABP Interaction Domain: ROLE IN COOPERATIVE BINDING TO POLY(A) AND EFFICIENT CAP DISTAL TRANSLATIONAL REPRESSION. J. Biol. Chem.
278: 46357-46368
[Abstract]
[Full Text]
-
Macchi, P., Hemraj, I., Goetze, B., Grunewald, B., Mallardo, M., Kiebler, M. A.
(2003). A GFP-based System to Uncouple mRNA Transport from Translation in a Single Living Neuron. Mol. Biol. Cell
14: 1570-1582
[Abstract]
[Full Text]
-
Newton, D. C., Bevan, S. C., Choi, S., Robb, G. B., Millar, A., Wang, Y., Marsden, P. A.
(2003). Translational Regulation of Human Neuronal Nitric-oxide Synthase by an Alternatively Spliced 5'-Untranslated Region Leader Exon. J. Biol. Chem.
278: 636-644
[Abstract]
[Full Text]
-
Wang, J., Pantopoulos, K.
(2002). Conditional Derepression of Ferritin Synthesis in Cells Expressing a Constitutive IRP1 Mutant. Mol. Cell. Biol.
22: 4638-4651
[Abstract]
[Full Text]
-
Ryabova, L. A., Hohn, T.
(2000). Ribosome shunting in the cauliflower mosaic virus 35S RNA leader is a special case of reinitiation of translation functioning in plant and animal systems. Genes Dev.
14: 817-829
[Abstract]
[Full Text]
-
Niepel, M., Gallie, D. R.
(1999). Identification and Characterization of the Functional Elements within the Tobacco Etch Virus 5' Leader Required for Cap-Independent Translation. J. Virol.
73: 9080-9088
[Abstract]
[Full Text]
-
Ryabova, L. A., Pooggin, M. M., Dominguez, D. I., Hohn, T.
(2000). Continuous and Discontinuous Ribosome Scanning on the Cauliflower Mosaic Virus 35 S RNA Leader Is Controlled by Short Open Reading Frames. J. Biol. Chem.
275: 37278-37284
[Abstract]
[Full Text]
Top
Abstract
Introduction
