INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

The process of transcriptional activation hinges on the ability of various factors to facilitate the function of the transcription complex. In eukaryotes, chromatin structure is a major obstacle to transcription by RNA polymerase II: DNA is wound around histone proteins to form a repeating array of nucleosomes (81), making it inaccessible to the transcriptional machinery (53, 55). Nucleosomes must therefore be perturbed at promoter regions prior to or during activation, and such remodeling has been observed in a number of studies (29, 69, 71).

In recent years, a variety of factors relevant to transcription have been identified as involved in nucleosome remodeling or modification. ATP-dependent remodeling of nucleosomes has been demonstrated by a number of large protein complexes isolated from several eukaryotes (43). The Swi-Snf complex, identified in yeast and human cells, was shown to remodel chromatin in vivo and in vitro and stimulate activator and basal factor binding to nucleosomal DNA (15, 35, 38, 45, 52). The Drosophila Nurf (73), CHRAC (76), and ACF (39) complexes and the yeast RSC complex (10) are believed to carry out similar functions, also through the hydrolysis of ATP.

Histone acetylation is another mechanism by which nucleosomes are modified. The core histones (H2A, H2B, H3, and H4) can be acetylated on the lysine side chains of their amino-terminal tail regions (7), reducing their positive charge and presumably reducing their affinity for negatively charged DNA or other chromatin proteins. Substantial evidence suggests that acetylated nucleosomes are more permissive for transcription. For example, in vivo, histones associated with active chromosomal loci were shown to be hyperacetylated (34), while those at inactive or heterochromatin regions were shown to be hypoacetylated (8, 42, 50, 74). In vitro, histone acetylation results in increased binding of transcriptional activators to their sites in nucleosomal DNA (77).

A more definitive link between histone acetylation and transcriptional activation was realized with the discovery that the yeast Saccharomyces cerevisiae transcriptional adaptor Gcn5 is a histone acetyltransferase (HAT) (9). Gcn5 is one of a group of adaptors (also known as mediators or coactivators) that were hypothesized to provide a physical bridge between upstream DNA-bound activators and the transcriptional machinery at a promoter (28). Since the discovery of the HAT activity of Gcn5, additional transcriptional cofactors in yeast and higher eukaryotes, including the TATA-binding protein (TBP)-associated factor TAF_II250 (the human homologue of yeast Taf_II145/130 [49]), p300/CBP (2, 51), and P/CAF (p300/CBP-associated factor [82]), have been identified as HATs, suggesting that acetylation may be important in activation. In yeast, genes encoding adaptor proteins were originally identified by mutations that suppress the toxicity caused by a high level of the acidic activator, Gal4-VP16 (5). Besides Gcn5 (48), these proteins include Ada1 (37), Ada2 (5), Ada3 (57), and Ada5 (47), and they were subsequently demonstrated to interact physically and functionally in vivo and in vitro (11, 36, 48). The ability of the adaptors to associate with activation domains (3, 14, 68, 75) and TBP (3), a component of TFIID, further indicated their function as part of a complex involved in activated transcription.

The crucial role of the HAT activity for Gcn5 function was recently demonstrated through the creation and analysis of HAT substitution mutants. Specific alanine substitutions (44, 78) in the previously identified HAT domain of Gcn5 (13) lower HAT activity, and loss of activity strongly correlates with defects in growth and transcription in vivo. Moreover, acetylation of histones at the promoter of the HIS3 gene correlates with gene activity, and the acetylation at this promoter is reduced in the presence of substitution mutations in Gcn5 that impair its HAT activity (44). In addition, mutations in the HAT domain of Gcn5 correlate with perturbation of the normal chromatin structure at the PHO5 promoter (27).

Gcn5 alone acetylates only free histones; however, as a component of native yeast complexes, Gcn5 acetylates histones in nucleosomes (24, 63). In one study, Gcn5 was shown to be a component of two of four distinct nucleosome-acetylating activities (24). These two Gcn5-containing complexes, which acetylate histones H3 and H2B in nucleosomes, also contained the adaptors Ada2 and Ada3. One of these Gcn5-dependent HAT complexes had a molecular size of 0.8 MDa and was termed the Ada complex.

The other Gcn5-dependent HAT complex, with a molecular size of about 1.8 MDa, possessed the adaptor components as well as four Spt proteins. This complex was therefore named SAGA (Spt-Ada-Gcn5-acetyltransferase). The Spt proteins known to be present in the SAGA complex include Spt3, Spt7, Spt8, and Spt20. Spt7 (20) and Spt20 (60) are apparently vital to the structure of SAGA, since null mutations in either gene causes complete disruption of the SAGA complex and severe growth defects (24). Interestingly, spt20 null mutants also have an Ada phenotype: the gene was independently identified as ADA5 in a genetic screen for ada mutants (47).

The SPT genes were originally identified as suppressors of Ty or  insertions in the promoter regions of the yeast HIS4 and LYS2 genes. The insertion mutations abolish or otherwise alter transcription of the adjacent gene, resulting in a His or Lys phenotype, and strains with spt mutations restore functional transcription of the adjacent gene (reviewed in reference 79). A subset of five SPT genes have been grouped together based on common mutant phenotypes. This group includes SPT15, which encodes TBP (19, 30). The other four members of this group encode the Spt proteins contained in SAGA. Spt3 and Spt8 in particular seem to have the most direct relationship to TBP, since specific spt3 and spt15 mutations suppress each other in an allele-specific fashion (17), implying physical interaction. Genetic evidence also has suggested that Spt8 is required for the functional interaction between Spt3 and TBP (18). Furthermore, TBP, as well as other SAGA components, were pulled down via expressed glutathione S-transferase (GST)-Spt20 from yeast extract (59). Interestingly, TBP also coimmunoprecipitated from yeast extract with Ada3, another SAGA subunit (64). A further potential relationship between SAGA and TBP was identified most recently with the discovery that a subset of five Taf_IIs are also present within SAGA (25). Interestingly, the Taf_II possessing HAT activity, Taf_II145, is not associated with SAGA. The precise mechanism of SAGA interaction with TBP and its role in vivo remain to be determined.

Mutations in different ADA and SPT SAGA genes cause distinct classes of genetic and biochemical phenotypes (26). Two classes of SAGA mutants have moderate sets of phenotypes. Gcn5, Ada2, and Ada3 form one distinct class within SAGA because (i) they are also present in the Ada complex, (ii) they are required for HAT activity within both complexes, and (iii) genetic disruptions of them exhibit Ada but not Spt phenotypes. A second potential subgroup within SAGA is Spt3/Spt8, mutations of which exhibit a significantly less severe range of phenotypes than disruptions of either Spt20 or Spt7, and in particular exhibit an Spt, but not Ada, phenotype. The third subgroup is Spt20/Spt7 mutations, which have severe phenotypes and exhibit both Spt and Ada phenotypes (47, 60). Loss of Spt20 or Spt7 completely disrupts the SAGA complex.

Further genetic support for multiple functions within SAGA comes from an analysis of double-mutant phenotypes between mutations in SAGA genes and mutations in genes that encode other transcription regulatory factors (59). Specifically, spt20 and spt7 are synthetically lethal in combination with mutations in genes that encode members of the Swi-Snf or Srb-mediator complex. In contrast, null mutations in the SAGA genes GCN5, SPT3, and SPT8 do not cause inviability in combination with mutations in these other transcription factor genes.

In this study, we sought to establish the basic functional organization of SAGA, using genetic and biochemical analyses of certain key components. Our results suggest that the multiple discrete biochemical functions relate in a direct way to the distinct genetic phenotypes and that mutant SAGA complexes, lacking certain components, contain subfunctional activity. These data suggest a model for overall SAGA function in the process of transcriptional activation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Yeast strains and media. The yeast strains used in this study are listed in Table 1. All FY strains are congenic and were originally derived from the S288C derivative FY2 (80). To introduce the snf52 null mutant allele (46) into S288C background, integrating plasmid pLY17 was used for transplacement (1, 66) in haploid strain FY37. All other deletion derivatives except ada mutations have been described previously (reference 59 and references therein). Null mutants were constructed by transforming diploids with a restriction fragment designed to delete the gene being studied (62). In each case, the null mutation contained a selectable nutritional marker. Transformants were then sporulated, and tetrads were dissected to generate haploid mutant progeny (1). In the ada1::HIS3, ada2::HIS3, and ada3::HIS3 alleles, the entire open reading frame of each corresponding gene was replaced with the HIS3 gene, using a fragment generated by PCR (1). The following PCR primer pairs were used to create and verify correct integration of the corresponding ada knockout mutations: ADA1KOLEFT (5'-ATAGGGAAAACAAGCCCAGTAGTTTTGATTTCTTCTATCCTGTGCGGTATTTCACACCG-3'), ADA1KORITE (5'-TATAATTACAACATACCGCATACACACACTTTTTATACAAGATTGTACTGAGAGTGC AC-3'), ADA1LCHECK (5'-TGTGCCTTGAACATCGAACTTAC-3'), ADA1RCHECK (5'-GCTCACTTAAGCTCGGTCACA-3'), ADA2KOLEFT (5'-ATCAGCGTAGTCTGAAAATATATACATTAAGCAAAAAGATGCGGTATT TCACACCG-3'), ADA2KORITE (5'-ACTAGTGACAATTGTAGTTACTTTTCAATTTTTTTTTTGAGATTGTACTGAGAGTGCAC-3'), ADA2LCHECK (5'-CCAGACGTTCCAAACAAATAAGTG-3'), ADA2RCHECK (5'-CAAGGTCCCTTTATGACTTGGCC-3'), ADA3KOLEFT (5'-TAACAAAGACGGAGCGACGAGAAGTATTGGACAGGACATCTGTGCGGTATTTCAC ACCG-3'), ADA3KORITE (5'-GTTATTATGCTACGTATTTTTCCTTAGAGTTCGTATATTAGATTGTACTGAGAGTGCAC-3'), ADA3LCHECK (5'-GAGCTCCGACGTGCAACGCGA-3'), and ADA3RCHECK (5'-CCCGCGATCGGAAGTTCATGC-3'). For each ADA gene, the corresponding KOLEFT and KORITE primers were used in a standard PCR to amplify the HIS3 gene from pRS403 (67). The resulting PCR fragments, which contained the HIS3 gene flanked by 78 bp of 5' and 3' noncoding sequence from the respective ADA gene, were used to transform diploid S288C yeast strains. We verified the correct integration event for each mutation by using PCR with three different primer pairs (data not shown).

trp1

ada1

spt7 BrD

gcn5::URA3 hisG

Plasmid constructs. For integration of wild-type and bromodomain truncation mutant GCN5 into yeast, constructs were prepared in which the appropriate open reading frames followed the ADH1 promoter in the vector pRS306 (67). By standard recombinant DNA techniques (65), wild-type GCN5 (coding for residues 1 to 439), and the longer of the two mutant genes (with residues 1 to 350) were obtained as KpnI/PvuII fragments from pPC87-yGCN5 plasmids (13) and subcloned into KpnI/SmaI-cut pRS306. For the other mutant plasmid (with residues 1 to 280), a vector, pRS306-P_ADH, was first created by subcloning a KpnI/PvuII fragment of pPC87 (containing the ADH1 promoter and terminator) into pRS306 that had been digested with BstXI, blunted by the exonuclease activities of T4 and T7 DNA polymerase, and digested with KpnI. The resulting plasmid was cut with NotI, and truncated GCN5 was inserted as an EagI fragment of the pSP64-yGCN5 clone for the 1-280 mutant (13). The pRS306-P_ADH-yGCN5 1-439, 1-350, and 1-280 constructs were then linearized with NsiI and transformed into the gcn5 mutant FY1370. Clones were selected on Ura medium; since pRS306 has no origin of replication, these represent plasmid integrations into the genome at the URA3 locus.

HAT complex purification and assays. Nucleosomal HAT complexes were prepared from ada1, gcn5, gcn5 spt3, gcn5 spt8, and PSY316 wild-type cells and from wild-type and bromodomain-truncated GCN5 integrants by the previously described purification scheme (24): growth in 4 liters of YPD to an optical density of 2 to 2.5 at 600 nm, cell breakage with glass beads, incubation of extract with Ni²⁺-agarose and recovery of a 300 mM imidazole eluate, and purification on a Mono Q column with a 100 to 500 mM NaCl gradient. For spt3, spt8, and accompanying wild-type complex preparation, starting material was a 6-liter culture, and an additional Superose 6 column step was employed. Peak Mono Q fractions of SAGA were pooled and concentrated to 0.6 ml in a Centriprep-30 concentrator (Amicon). Samples were loaded on a Superose 6 HR 10/30 column (Pharmacia) equilibrated in 250 mM NaCl. The calibration of this column was as follows: thyroglobulin (669 kDa), fraction 24; ferritin (440 kDa), fraction 27; adolase (158 kDa), fraction 30; and ovalbumin (45 kDa), fraction 33/34.

Antibodies and Western blotting. For Western blot experiments, samples were boiled in SDS--mercaptoethanol sample buffer, electrophoresed on SDS-8 or 10% polyacrylamide gels, electroblotted to nitrocellulose, and visualized immunochemically by standard methods (32). Anti-Ada2, anti-Gcn5, and anti-Spt3 antisera and anti-Spt20 affinity-purified antibodies were as described previously (24); primary antibody dilutions used were typically 1:4,000, 1:4,000, 1:500, and 1:2,000, respectively. Anti-Taf_II90, anti-Taf_II68, and anti-Taf_II60 antisera (25) were used at dilutions of 1:3,000, 1:6,000, and 1:6,000, respectively. Rabbit anti-Spt8 antibodies were raised against a synthetic peptide spanning the amino-terminal 20 amino acids (aa) of Spt8 (MDEVDDILINNQVVDDEEDD) by Cocalico Biologicals; this antiserum was used at a dilution of 1:2,000. Immunodetection was performed with a secondary antibody (goat anti-rabbit immunoglobulin G-horseradish peroxidase conjugate; Bio-Rad) and an enhanced chemiluminescence kit (Amersham). Some blots were stripped of antibody before reprobing; this was accomplished with 62.5 mM Tris (pH 6.8)-2% SDS-100 mM -mercaptoethanol at 50°C for 30 min.

In vivo RNA analysis. Yeast strains used for analyzing transcriptional effects of the bromodomain were FY1370 (gcn5) and GCN5 wild-type and bromodomain deletion integrants as described above; for HAT domain experiments, strains were FY1370 plasmid integrants containing wild-type GCN5, empty vector (gcn5), or GCN5 with HAT domain substitution mutations (78). Total RNA was isolated from cultures grown in SC medium to an optical density at 600 nm of 0.8 to 1.2 by the hot phenol method as described previously (40). To derepress HIS3 transcription, cells were grown in SC medium lacking histidine, and 3-aminotriazole was added to 40 mM 2 h (for bromodomain study) or 6 h (for HAT domain study) prior to RNA isolation. RNA concentration was quantitated spectrophotometrically at 260-nm wavelength; 50 µg of each RNA sample was hybridized to a completion with an excess of ³²P-end-labeled HIS3 and tRNA^w oligonucleotides and treated with S1 nuclease as described elsewhere (40, 54). HIS3 RNA levels were quantitated on a PhosphorImager (Molecular Dynamics). S1 assays were performed in duplicate several times (exception for mutants LKN, IFQ, and YIA, performed once), and PhosphorImager quantitation showed less than 15% error. tRNA^w probe (bromodomain study) and PMA1 RNA (HAT domain study) were used as internal controls for equal loading.

GST-TBP binding study. Escherichia coli DH5, grown in LB medium with 100 µg of ampicillin per ml, was used for induction of GST and GST-TBP. Expression was induced with 1 mM isopropyl--D-thiogalactopyranoside for 4 h at 37°C, and cell lysates were prepared by sonication in phosphate-buffered saline (65) containing protease inhibitors and rotated for 30 min at 4°C with glutathione-Sepharose beads (Pharmacia). Samples of these beads (about 15 µl containing several µg of GST or GST-TBP) were then rotated alone or with Superose 6-purified wild-type (fraction 20), spt3 (fraction 21), or spt8 (fraction 21) SAGA complexes for 1 h at 4°C. Amounts of SAGA samples used (30 µl for wild-type and spt8 strains and 20 µl for spt3 strains) were adjusted to have similar amounts of protein, based on prior Western blotting. Each reaction (150 µl, final volume) was adjusted to a final NaCl concentration of approximately 60 mM and contained 100 µl of binding buffer (20 mM HEPES [pH 7.3], 5 mM MgCl₂, 0.5 mM EDTA, 15% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). The resulting beads were washed three times with 500 µl of binding buffer with 50 mM NaCl, boiled in SDS sample buffer, and loaded onto an SDS-10% polyacrylamide gel, which was used for Western blot analysis with anti-Ada2, anti-Spt20, and anti-Spt3 antibodies.

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

Loss of Spt3 or Spt8 has moderate effects on SAGA structure. Our previous results have indicated that severe phenotypes correspond to disruption in SAGA structure; i.e., the major growth defects seen in spt20 and spt7 mutants correlate with a complete loss of the SAGA complex. In contrast, the mild gcn5 phenotype corresponds to a subtly altered SAGA complex. To test further the hypothesis that severity in mutant phenotype relates directly to biochemical integrity of the SAGA complex, we examined SAGA structure in the moderately defective spt3 and spt8 and the severe ada1 mutants and then compared their mutant phenotypes.

spt3

spt8

spt3

spt8

spt8

spt3

View larger version (41K): [in this window] [in a new window]   FIG. 1.   Western blot characterization of Superose 6-purified spt3 and spt8 SAGA complexes. (A) SAGA complexes derived from wild-type (FY631), spt3 (FY294), and spt8 (FY462) strains were pooled, concentrated, and run on a Superose 6 column for separation based on molecular weight. Western blots of these fractions were performed to compare the sizes of the complexes. Blots were visualized with dilutions of antisera raised against the Ada2 or Spt3 proteins as indicated. (B) Western blots of wild-type (fraction 20), spt3 (fraction 21), and spt8 (fraction 21) SAGA, visualized with antisera specific to Spt8, TafII90, TafII68, or TafII60.

Ada1 is integral to SAGA structure. In contrast to the modest effects on structure from loss of either Gcn5 (24), Spt3, or Spt8, our previous biochemical analyses of Spt20 and Spt7 suggested that these proteins are critical to the structural integrity of the SAGA complex (24). The large size of SAGA (1.8 MDa) indicates that there may be additional proteins having a similar role in holding the complex together. The observation that a strain bearing an ADA1 disruption exhibits severe phenotypes similar to those of SPT20 mutants, along with the indication that Ada1 may exist in a large complex with Ada2, Ada3, Gcn5, and Spt20 (5, 37), suggested that Ada1 might be present in SAGA and required for its integrity.

ada1

ada1

View larger version (41K): [in this window] [in a new window]   FIG. 2.   Presence of Ada1 in the SAGA complex. HAT complexes were derived from wild-type (PSY316) and ada1 (SB11) yeast strains through the Mono Q column step of the previously described purification procedure. (A) Fluorographs of nucleosome acetylation assays of the even-numbered column fractions. The arrows denote the relative positions of the four histone proteins as separated on SDS-18% polyacrylamide gels; visualized species contain acetyl groups labeled with 3H. Wild-type fractions displaying the H3/H2B-acetylating activities of the Ada and SAGA complexes are indicated at the top. (B) Western blots of the fractions, visualized with dilutions of antisera raised against Ada1, Ada2, or Gcn5 protein.

ada1

Three phenotypic classes of SAGA components. Thus, structural analysis of SAGA provides a biochemical correlation with previous observations that disruptions of SAGA components cause phenotypes with a range of severity. We further tested the hypothesis that loss of components that have little detectable effect on SAGA complex integrity result in modest phenotypes, and in contrast, loss of components that are completely disruptive to the complex result in severe phenotypes.

ada1

spt7

spt20

spt3

spt8

gcn5

ada2

ada3

ada1

spt20

View larger version (64K): [in this window] [in a new window]   FIG. 3.   Phenotypic comparison of ada1 and other SAGA deletion mutants. Strains FY630, FY1106, FY1559, FY297, FY463, FY1599, and FY1553 were grown overnight in liquid YPD medium. For each strain, approximately 5 × 103 cells were spotted on the indicated plates and grown for 2 days at 30°C. All strains contain the his4-917 insertion mutation. Otherwise, wild-type strains containing this allele are His, while strains containing a mutation able to suppress this allele are His+ (Spt phenotype).

ada1

spt20

spt7

ada1

ada2

ada3

spt3

spt8

gcn5

gcn5

ada2

ada3

swi1

Double mutants gcn5 spt3 and gcn5 spt8 are similar in phenotype to spt20 and spt7 mutants. Based on the above data, it appears that each of the two moderate phenotypic classes contributes distinct functions to SAGA. Because moderate phenotypes result from deletions of genes of either class, we postulated that in the absence of one class, the function of the second class remains intact. However, in the cases of ada1, spt7, and spt20 mutations, where the complex is completely disrupted, both functions are lost and severe phenotypic defects result. Based on these observations and ideas, we hypothesized that double mutants that disrupt the function of each moderate phenotypic class simultaneously would cause severe phenotypes similar to those of ada1, spt7, and spt20 mutations.

gcn5 spt3

gcn5 spt8

spt3

spt8

gcn5

spt3

spt8

gcn5

gcn5 spt3

gcn5 spt8

gcn5 spt8

spt20

View larger version (56K): [in this window] [in a new window]   FIG. 4.   Comparison of gcn5 spt3 and gcn5 spt8 double mutants with an spt20 mutant. (A) Strains FY2, FY293, FY1299, FY1286, FY1440, FY1719, and FY1098 were grown overnight in liquid YPD medium. For each strain, approximately 2 × 103 cells were spotted on the indicated plates. Growth is shown after 2 days of incubation at 30°C, except in the case of the caffeine plates, which were photographed after 3 days. (B) Double-mutant SAGA complexes are intact. Mono Q fractions from gcn5 spt3 (FY1441) and gcn5 spt8 (FY1720) HAT complex preparations were analyzed by Western blotting. SAGA subunits were visualized with dilutions of antisera raised against Ada2 or Spt20 protein as indicated.

Gcn5 bromodomain is important for normal levels of nucleosome acetylation by SAGA. We wished to characterize the biochemical functions of the Gcn5/Ada2/Ada3 and Spt3/Spt8 subgroups in SAGA. Each member of the Gcn5/Ada2/Ada3 subgroup previously was shown to be required for histone acetylation, and Gcn5 was identified as the HAT catalytic subunit. Recombinant Gcn5 acetylates free core histones and not nucleosomes; however, both the Ada and SAGA complexes acetylate nucleosomes (24). Thus, an important question is the determinant(s) of physical interaction with nucleosomes.

gcn5

View larger version (44K): [in this window] [in a new window]   FIG. 5.   Effect of Gcn5 bromodomain deletion on nucleosomal HAT activity. Cells containing wild-type (w.t.; residues 1 to 439) or BrD (residues 1 to 350 or 1 to 280) GCN5 were used to prepare Mono Q fractions by the standard purification method for the HAT complexes. (A) HAT assays with nucleosomal or free histone substrates were performed with even-numbered fractions surrounding the Ada and SAGA peaks; fluorographs of the resulting gels are presented. The arrows denote the relative positions of the four histone proteins as separated on SDS-18% polyacrylamide gels; visualized species contain acetyl groups labeled with 3H. The bar graph at right presents the ratio of nucleosomal to free histone H3/H2B acetylation for SAGA fraction 40, normalized to the wild-type ratio. (B) Samples of fractions 20 (Ada peak), 30 (negative control; no HAT complex), and 40 (SAGA peak) were also analyzed by Western blotting. Five microliters of each was run on SDS-polyacrylamide gels and electroblotted to nitrocellulose, which underwent immunodetection with dilutions of anti-Ada2, anti-Gcn5, or anti-TafII antibodies. Markers on the Gcn5 panels indicate the Gcn5 species visualized on equivalent portions of the blots, and their positions of migration agreed with their predicted sizes (51, 40, and 32 kDa for the 1-439, 1-350, and 1-280 constructs, respectively). The peak SAGA fraction from a preparation of gcn5 (FY1370) cells was also tested for TafIIs (right).

gcn5

Gcn5 bromodomain and HAT domain mutants display similar HIS3 transcriptional defects. In vitro, nucleosomal acetylation by Gcn5 was specifically lowered by deletion of the bromodomain. The effect of Gcn5 bromodomain deletion in vivo was investigated by S1 analysis of RNA produced from the HIS3 gene, which has been shown to be regulated by Gcn5's nucleosome acetylation activity (44). There are two RNA start sites in HIS3 (Fig. 6A), and in wild-type cells under basal conditions these sites are used equally (Fig. 6C and reference 70). In strains lacking Gcn5 or bearing Gcn5 BrD, usage of the +13 start site was reduced (Fig. 6C). Also similar to the absence of Gcn5, the Gcn5 BrD strains show diminished activation potential (Fig. 6D).

View larger version (48K): [in this window] [in a new window]   FIG. 6.   HIS3 transcriptional defects observed in GCN5 null, HAT domain substitution, and BrD mutants. (A) Diagram of HIS3 promoter function. Weak and strong TBP-binding sequences (TATA boxes) direct transcription from the +1 and +13 start sites, respectively. The activator Gcn4 binds to multiple upstream sites (UAS). (B) Start site usage for activated HIS3 transcription in wild-type (w.t.), gcn5, and GCN5 HAT domain substitution mutant strains. Activating conditions were achieved with 3-aminotriazole. PhosphorImager quantitation of the S1 assays is presented as the ratio of +13 to +1. Shown at the bottom are in vitro HAT activities (as a percentage of wild-type activity) of native SAGA complexes purified from the indicated strains (27). (C) Start site preference for wild-type, gcn5, and BrD strains under noninducing conditions (no 3-aminotriazole). (D) Activated HIS3 transcription in wild-type, gcn5, and BrD strains. PMA1 RNA and tRNA were included as internal controls for sample loading.

gcn5

gcn5

gcn5

TBP binding by SAGA in vitro requires Spt8 but not Spt3. We then characterized SAGA prepared from strains bearing deletions of the other moderate class, Spt3 or Spt8, to determine whether the biochemical functions of the complexes were altered. SAGA complexes purified from spt3 and spt8 cells were tested for HAT activity, and no major differences in acetylation were observed (data not shown). Thus, in contrast to Gcn5, neither Spt3 nor Spt8 is crucial for the HAT activity of SAGA.

spt3

spt8

spt3

View larger version (28K): [in this window] [in a new window]   FIG. 7.   In vitro binding of wild-type, spt3, and spt8 SAGA complexes to TBP. Glutathione-Sepharose beads containing bacterially expressed GST or GST-TBP were incubated alone or with similar amounts of wild-type, spt3, or spt8 SAGA complexes at 4°C under conditions of approximately 60 mM NaCl. After washing, Western blotting was performed with these beads to analyze the proteins that had bound to GST (G lanes) or GST-TBP (T lanes). The input (I) lanes contained half of the amount of SAGA used for the binding experiments. The position of the antibody-visualized Ada2, Spt20, and Spt3 bands on the Western blots are indicated by arrows. An unidentified species in the GST-TBP preparation (T lanes) had a mobility similar to but slightly slower than that of Spt3 and cross-reacted with anti-Spt3 antibodies; the band seen in the spt8 T lane is a combination of this species and a small amount of Spt3.

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

A number of interconnected processes are involved in the activation of transcription, and the recently discovered SAGA complex apparently combines several of them: activator interaction (through Ada2, Gcn5, and Ada3), histone acetylation (by Gcn5), and TBP interaction (through Spt8 and Spt3). We have sought to characterize the latter two of these functions in vivo and in vitro and to analyze the structure of SAGA by studying mutant complexes and individual subunits in vitro. These studies indicate that while neither the Gcn5/Ada2/Ada3 nor Spt3/Spt8 subgroup is critical for SAGA structure, each confers a distinct and important biochemical function. Either may be partially dispensable, but loss of both is highly detrimental to overall SAGA function.

Components necessary for SAGA structure. In this study, we have identified Ada1 as a component of the SAGA complex, and we have further shown that its loss leads to the physical disruption of SAGA and severe phenotypic defects. This places it in a class with two other previously described SAGA components with similar qualities, Spt20 and Spt7. These three subunits each appear to be necessary for the structure of the complex, with the critical role of holding it together. The precise interactions among these proteins and with other SAGA components remain to be determined, but their function could be to link the Spt and Ada subunits within SAGA.

spt3

spt8

gcn5

Nucleosomal acetylation by the SAGA complex. The most thoroughly characterized function within the SAGA complex has been the HAT activity of Gcn5, and recent studies indicate that the HAT domain is required for Gcn5's role in transcription (13, 44, 78). The experiments presented here suggest that another region of Gcn5, the bromodomain, may have significant effects on the function of the SAGA complex in acetylation. Specifically, removal of the bromodomain reduces the HAT activity of SAGA on nucleosomal substrates, even though the complex and its activity on free histones are otherwise largely intact. One interpretation of these data is that the bromodomain is required for physical interaction either with histones or with other components in SAGA that bind to histones (and other proteins would fulfill such a function in the Ada complex). Relevant to this is the observation that the size of SAGA prepared from the BrD strain was not grossly altered. However, small changes in size or shape of SAGA would not be apparent due to the low sensitivity of the Superose 6 sizing column near the void volume (where SAGA elutes). In this view, Gcn5 possesses separate domains for catalytic HAT function and for interaction with nucleosomal substrates. This is consistent with two previous observations. First, recombinant Gcn5 acetylates free core histones but not nucleosome-assembled histones (24); second, mutations in Taf_II68 similarly reduce nucleosomal histone acetylation without reducing free histone acetylation (25). However, the SAGA complexes bearing Gcn5 deletions of the bromodomain are not altered for Taf_II60, Taf_II68, or Taf_II90, indicating that there may be multiple determinants for nucleosome interaction.

TBP interaction by the SAGA complex. TBP interaction is another function of SAGA that had been suggested by previous studies but has been directly demonstrated here. In vitro binding experiments show specific interaction between purified SAGA and GST-TBP. Thus, these data agree with previous evidence that TBP interacts with Ada2 (3), Ada3 (64), or Spt20 (59) in the context of yeast whole-cell extract.

spt8

Model for multiple functionality of SAGA. The spt3 gcn5 and spt8 gcn5 double mutants (Fig. 4) apparently disrupt two in vivo functions, namely, TBP binding and nucleosome acetylation, leading to major phenotypic defects. The combined losses cause defects which approximate those of a mutant which disrupts SAGA altogether (spt20). This provides further evidence that multiple functions are incorporated in the SAGA complex in vivo, and that the two discussed above are needed for its full functionality but are partially redundant. Thus, one hypothesis that emerges from these data is that two functions of SAGA are directed at the same objective: regulation of TBP binding to the TATA box. Activation domain interaction is a third presumptive function of the SAGA complex. This was indicated in earlier studies of Ada2, Ada3, and Gcn5 function and has been shown directly by recent studies with SAGA itself (75).

View larger version (27K): [in this window] [in a new window]   FIG. 8.   Model for SAGA structure and function in transcription. Depicted is a hypothetical gene with an upstream activation sequence (UAS) and TATA box; the DNA is wound around nucleosomes (cylinders). The SAGA complex, composed of adaptor (white) and Spt (black) functional regions and held together by several structurally important proteins (grey), is proposed to interact with the an activator (such as Gcn4) at the UAS through Ada2. This allows the HAT activity of Gcn5, in cooperation with its bromodomain (BrD), to acetylate (Ac = acetyl group) the amino-terminal tails of nucleosomal histones, providing more effective TATA binding of TBP. Further regulation is provided by SAGA-TBP interaction, principally through Spt8, in conjunction with Spt3 and/or other factors. The large white and black circles represent unidentified members of SAGA; several TafIIs are also present in SAGA (25), but their exact role in the complex has yet to be defined.

gcn5

spt8

gcn5 spt3

ada1