Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 86-98, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Functional Organization of the Yeast SAGA Complex:
Distinct Components Involved in Structural Integrity, Nucleosome
Acetylation, and TATA-Binding Protein Interaction
David E.
Sterner,1
Patrick A.
Grant,2
Shannon M.
Roberts,3
Laura J.
Duggan,1
Rimma
Belotserkovskaya,1
Lisa A.
Pacella,3
Fred
Winston,3
Jerry L.
Workman,2 and
Shelley
L.
Berger1,*
The Wistar Institute, Philadelphia,
Pennsylvania 191041;
Department of
Biochemistry and Molecular Biology and Center for Gene Regulation, The
Pennsylvania State University, University Park, Pennsylvania
168022; and
Department of Genetics,
Harvard Medical School, Boston, Massachusetts
021153
Received 22 June 1998/Returned for modification 5 August
1998/Accepted 18 September 1998
 |
ABSTRACT |
SAGA, a recently described protein complex in Saccharomyces
cerevisiae, is important for transcription in vivo and possesses histone acetylation function. Here we report both biochemical and
genetic analyses of members of three classes of transcription regulatory factors contained within the SAGA complex. We demonstrate a
correlation between the phenotypic severity of SAGA mutants and SAGA
structural integrity. Specifically, null mutations in the
Gcn5/Ada2/Ada3 or Spt3/Spt8 classes cause moderate phenotypes and
subtle structural alterations, while mutations in a third subgroup,
Spt7/Spt20, as well as Ada1, disrupt the complex and cause severe
phenotypes. Interestingly, double mutants (gcn5
spt3
and gcn5 spt8) causing loss of a member of each of
the moderate classes have severe phenotypes, similar to
spt7, spt20, or ada1
mutants. In addition, we have investigated biochemical functions
suggested by the moderate phenotypic classes and find that first,
normal nucleosomal acetylation by SAGA requires a specific domain of
Gcn5, termed the bromodomain. Deletion of this domain also causes
specific transcriptional defects at the HIS3 promoter in
vivo. Second, SAGA interacts with TBP, the TATA-binding protein, and
this interaction requires Spt8 in vitro. Overall, our data demonstrate
that SAGA harbors multiple, distinct transcription-related functions,
including direct TBP interaction and nucleosomal histone acetylation.
Loss of either of these causes slight impairment in vivo, but loss of
both is highly detrimental to growth and transcription.
| |
INTRODUCTION |
The process of transcriptional
activation hinges on the ability of various factors to facilitate the
function of the transcription complex. In eukaryotes, chromatin
structure is a major obstacle to transcription by RNA polymerase
II: DNA is wound around histone proteins to form a repeating
array of nucleosomes (81), making it inaccessible to the
transcriptional machinery (53, 55). Nucleosomes must
therefore be perturbed at promoter regions prior to or during
activation, and such remodeling has been observed in a number of
studies (29, 69, 71).
In recent years, a variety of factors relevant to transcription have
been identified as involved in nucleosome remodeling or modification.
ATP-dependent remodeling of nucleosomes has been demonstrated by a
number of large protein complexes isolated from several eukaryotes
(43). The Swi-Snf complex, identified in yeast and human
cells, was shown to remodel chromatin in vivo and in vitro and
stimulate activator and basal factor binding to nucleosomal DNA
(15, 35, 38, 45, 52). The Drosophila Nurf
(73), CHRAC (76), and ACF (39)
complexes and the yeast RSC complex (10) are believed to
carry out similar functions, also through the hydrolysis of ATP.
Histone acetylation is another mechanism by which nucleosomes are
modified. The core histones (H2A, H2B, H3, and H4) can be acetylated on
the lysine side chains of their amino-terminal tail regions
(7), reducing their positive charge and presumably reducing
their affinity for negatively charged DNA or other chromatin proteins.
Substantial evidence suggests that acetylated nucleosomes are more
permissive for transcription. For example, in vivo, histones associated
with active chromosomal loci were shown to be hyperacetylated (34), while those at inactive or heterochromatin regions
were shown to be hypoacetylated (8, 42, 50, 74). In vitro, histone acetylation results in increased binding of transcriptional activators to their sites in nucleosomal DNA (77).
A more definitive link between histone acetylation and transcriptional
activation was realized with the discovery that the yeast
Saccharomyces cerevisiae transcriptional adaptor Gcn5 is a
histone acetyltransferase (HAT) (9). Gcn5 is one of a group of adaptors (also known as mediators or coactivators) that were hypothesized to provide a physical bridge between upstream DNA-bound activators and the transcriptional machinery at a promoter
(28). Since the discovery of the HAT activity of
Gcn5, additional transcriptional cofactors in yeast and
higher eukaryotes, including the TATA-binding protein
(TBP)-associated factor TAFII250 (the human
homologue of yeast TafII145/130 [49]),
p300/CBP (2, 51), and P/CAF (p300/CBP-associated factor
[82]), have been identified as HATs, suggesting that
acetylation may be important in activation. In yeast, genes encoding
adaptor proteins were originally identified by mutations that suppress
the toxicity caused by a high level of the acidic activator, Gal4-VP16
(5). Besides Gcn5 (48), these proteins include
Ada1 (37), Ada2 (5), Ada3 (57), and
Ada5 (47), and they were subsequently demonstrated to
interact physically and functionally in vivo and in vitro (11, 36, 48). The ability of the adaptors to associate with activation domains (3, 14, 68, 75) and TBP (3), a component
of TFIID, further indicated their function as part of a complex
involved in activated transcription.
The crucial role of the HAT activity for Gcn5 function was recently
demonstrated through the creation and analysis of HAT substitution
mutants. Specific alanine substitutions (44, 78) in the
previously identified HAT domain of Gcn5 (13) lower HAT activity, and loss of activity strongly correlates with defects in
growth and transcription in vivo. Moreover, acetylation of histones at
the promoter of the HIS3 gene correlates with gene activity,
and the acetylation at this promoter is reduced in the presence of
substitution mutations in Gcn5 that impair its HAT activity
(44). In addition, mutations in the HAT domain of Gcn5 correlate with perturbation of the normal chromatin structure at the
PHO5 promoter (27).
Gcn5 alone acetylates only free histones; however, as a component of
native yeast complexes, Gcn5 acetylates histones in nucleosomes (24, 63). In one study, Gcn5 was shown to be a component of two of four distinct nucleosome-acetylating activities (24). These two Gcn5-containing complexes, which acetylate histones H3 and
H2B in nucleosomes, also contained the adaptors Ada2 and Ada3. One of
these Gcn5-dependent HAT complexes had a molecular size of 0.8 MDa and
was termed the Ada complex.
The other Gcn5-dependent HAT complex, with a molecular size of about
1.8 MDa, possessed the adaptor components as well as four Spt proteins.
This complex was therefore named SAGA (Spt-Ada-Gcn5-acetyltransferase). The Spt proteins known to be present in the SAGA complex include Spt3,
Spt7, Spt8, and Spt20. Spt7 (20) and Spt20 (60)
are apparently vital to the structure of SAGA, since null mutations in
either gene causes complete disruption of the SAGA complex and severe
growth defects (24). Interestingly, spt20 null
mutants also have an Ada
phenotype: the gene was
independently identified as ADA5 in a genetic screen for
ada mutants (47).
The SPT genes were originally identified as suppressors of
Ty or 
insertions in the promoter regions of the yeast
HIS4 and LYS2 genes. The insertion mutations
abolish or otherwise alter transcription of the adjacent gene,
resulting in a His or Lys phenotype, and
strains with spt mutations restore functional transcription
of the adjacent gene (reviewed in reference 79). A
subset of five SPT genes have been grouped together based on common mutant phenotypes. This group includes SPT15, which
encodes TBP (19, 30). The other four members of this group
encode the Spt proteins contained in SAGA. Spt3 and Spt8 in particular seem to have the most direct relationship to TBP, since specific spt3 and spt15 mutations suppress each other in
an allele-specific fashion (17), implying physical
interaction. Genetic evidence also has suggested that Spt8 is required
for the functional interaction between Spt3 and TBP (18).
Furthermore, TBP, as well as other SAGA components, were pulled down
via expressed glutathione S-transferase (GST)-Spt20 from
yeast extract (59). Interestingly, TBP also coimmunoprecipitated from yeast extract with Ada3, another SAGA subunit
(64). A further potential relationship between SAGA and TBP
was identified most recently with the discovery that a subset of five
TafIIs are also present within SAGA (25).
Interestingly, the TafII possessing HAT activity,
TafII145, is not associated with SAGA. The precise
mechanism of SAGA interaction with TBP and its role in vivo remain to
be determined.
Mutations in different ADA and SPT SAGA genes
cause distinct classes of genetic and biochemical phenotypes
(26). Two classes of SAGA mutants have moderate sets of
phenotypes. Gcn5, Ada2, and Ada3 form one distinct class within SAGA
because (i) they are also present in the Ada complex, (ii) they are
required for HAT activity within both complexes, and (iii) genetic
disruptions of them exhibit Ada but not Spt
phenotypes. A second potential subgroup within SAGA is Spt3/Spt8, mutations of which exhibit a significantly less severe range of phenotypes than disruptions of either Spt20 or Spt7, and in particular exhibit an Spt, but not Ada, phenotype. The
third subgroup is Spt20/Spt7 mutations, which have severe phenotypes
and exhibit both Spt and Ada phenotypes
(47, 60). Loss of Spt20 or Spt7 completely disrupts the SAGA complex.
Further genetic support for multiple functions within SAGA comes from
an analysis of double-mutant phenotypes between mutations in SAGA genes
and mutations in genes that encode other transcription regulatory
factors (59). Specifically, spt20 and
spt7 are synthetically lethal in combination with
mutations in genes that encode members of the Swi-Snf or Srb-mediator
complex. In contrast, null mutations in the SAGA genes GCN5,
SPT3, and SPT8 do not cause inviability in
combination with mutations in these other transcription factor genes.
In this study, we sought to establish the basic functional organization
of SAGA, using genetic and biochemical analyses of certain key
components. Our results suggest that the multiple discrete biochemical
functions relate in a direct way to the distinct genetic phenotypes and
that mutant SAGA complexes, lacking certain components, contain
subfunctional activity. These data suggest a model for overall SAGA
function in the process of transcriptional activation.
| |
MATERIALS AND METHODS |
Yeast strains and media.
The yeast strains used in this
study are listed in Table 1. All FY
strains are congenic and were originally derived from the S288C
derivative FY2 (80). To introduce the snf52
null mutant allele (46) into S288C background, integrating
plasmid pLY17 was used for transplacement (1, 66) in haploid
strain FY37. All other deletion derivatives except ada
mutations have been described previously (reference
59 and references therein). Null mutants were
constructed by transforming diploids with a restriction fragment
designed to delete the gene being studied (62). In each
case, the null mutation contained a selectable nutritional marker.
Transformants were then sporulated, and tetrads were dissected to
generate haploid mutant progeny (1). In the ada1::HIS3, ada2::HIS3,
and ada3::HIS3 alleles, the entire open reading
frame of each corresponding gene was replaced with the HIS3
gene, using a fragment generated by PCR (1). The following PCR primer pairs were used to create and verify correct integration of
the corresponding ada knockout mutations:
ADA1KOLEFT
(5'-ATAGGGAAAACAAGCCCAGTAGTTTTGATTTCTTCTATCCTGTGCGGTATTTCACACCG-3'), ADA1KORITE
(5'-TATAATTACAACATACCGCATACACACACTTTTTATACAAGATTGTACTGAGAGTGC AC-3'),
ADA1LCHECK (5'-TGTGCCTTGAACATCGAACTTAC-3'),
ADA1RCHECK (5'-GCTCACTTAAGCTCGGTCACA-3'),
ADA2KOLEFT
(5'-ATCAGCGTAGTCTGAAAATATATACATTAAGCAAAAAGATGCGGTATT TCACACCG-3'),
ADA2KORITE
(5'-ACTAGTGACAATTGTAGTTACTTTTCAATTTTTTTTTTGAGATTGTACTGAGAGTGCAC-3'), ADA2LCHECK (5'-CCAGACGTTCCAAACAAATAAGTG-3'),
ADA2RCHECK (5'-CAAGGTCCCTTTATGACTTGGCC-3'), ADA3KOLEFT
(5'-TAACAAAGACGGAGCGACGAGAAGTATTGGACAGGACATCTGTGCGGTATTTCAC ACCG-3'),
ADA3KORITE
(5'-GTTATTATGCTACGTATTTTTCCTTAGAGTTCGTATATTAGATTGTACTGAGAGTGCAC-3'), ADA3LCHECK (5'-GAGCTCCGACGTGCAACGCGA-3'), and
ADA3RCHECK (5'-CCCGCGATCGGAAGTTCATGC-3'). For each
ADA gene, the corresponding KOLEFT and KORITE primers were
used in a standard PCR to amplify the HIS3 gene from pRS403 (67). The resulting PCR fragments, which contained the
HIS3 gene flanked by 78 bp of 5' and 3' noncoding sequence
from the respective ADA gene, were used to transform diploid
S288C yeast strains. We verified the correct integration event for each
mutation by using PCR with three different primer pairs (data not
shown).
ADA1 deletion mutant SB11 was created by PCR amplification
of the
HIS3 gene with chimeric primers that included
sequence upstream
from or near the end of the
ADA1 gene;
these oligonucleotides
were
5'-CGTTGCTCTTTTCATTCGTCTGTTCGTTATCATCATTGGATAGGGCTTACTCTTGGCCTCCT
CTAG-3'
(upstream) and
5'-CATCCAAAGGCGTGAAAGTCGGCTTTTCATTTAAGAAGTCCGGCAAGTCGTCGCCTCGTTCAGAATGACACG-3'
(downstream).
The resulting PCR product was transformed into a
trp1
derivative of strain PSY316 (
12), and
ada1
clones were
selected on His
selective
plates.
To investigate the relationship between the Gcn5 and Spt7 bromodomains,
GCN5 deletion strain SB326 was produced from
spt7 BrD strain FY1009 (
20) by transformation with the
BglII/
XhoI
fragment of
gcn5::URA3 hisG plasmid pyGCN5.KO
(
12) followed
by selection on 5-fluoroorotic acid (5-FOA)
plates to remove the
URA3 gene (
6). This strain
was then used for integration of
pRS306-P
ADH-yGCN5 1-439 and 1-280 by the methods described
below.
Rich (YPD), minimal, synthetic complete (SC), 5-FOA, and sporulation
media were prepared as described previously (
61). Media
for
testing Gal and Ino phenotypes were as described by Gansheroff
et al.
(
20). For caffeine (12 mM) and hydroxyurea (150 mM) plates,
SC medium was used. Standard protocols for transformation were
used in
strain constructions (
61).
Plasmid constructs.
For integration of wild-type and
bromodomain truncation mutant GCN5 into yeast, constructs
were prepared in which the appropriate open reading frames followed the
ADH1 promoter in the vector pRS306 (67). By
standard recombinant DNA techniques (65), wild-type GCN5 (coding for residues 1 to 439), and the longer of the
two mutant genes (with residues 1 to 350) were obtained as
KpnI/PvuII fragments from pPC87-yGCN5 plasmids
(13) and subcloned into KpnI/SmaI-cut
pRS306. For the other mutant plasmid (with residues 1 to 280), a
vector, pRS306-PADH, was first created by subcloning a
KpnI/PvuII fragment of pPC87 (containing the
ADH1 promoter and terminator) into pRS306 that had been
digested with BstXI, blunted by the exonuclease activities
of T4 and T7 DNA polymerase, and digested with KpnI. The
resulting plasmid was cut with NotI, and truncated
GCN5 was inserted as an EagI fragment of the
pSP64-yGCN5 clone for the 1-280 mutant (13). The
pRS306-PADH-yGCN5 1-439, 1-350, and 1-280 constructs were
then linearized with NsiI and transformed into the
gcn5 mutant FY1370. Clones were selected on
Ura medium; since pRS306 has no origin of replication,
these represent plasmid integrations into the genome at the
URA3 locus.
Plasmids BD1 (
SWI1) and FB565 (
GAL11), used to
recover otherwise lethal progeny in double-mutant analysis (Table
2),
have
been described previously (
56,
59). Plasmid pGEX-3X,
for bacterial
expression of GST, was from Pharmacia, and pGST-TBP was
provided
by R. H. Reeder (Fred Hutchinson Cancer Research Center,
Seattle,
Wash.).
HAT complex purification and assays.
Nucleosomal HAT
complexes were prepared from ada1, gcn5,
gcn5 spt3, gcn5 spt8, and PSY316
wild-type cells and from wild-type and bromodomain-truncated
GCN5 integrants by the previously described purification
scheme (24): growth in 4 liters of YPD to an optical density
of 2 to 2.5 at 600 nm, cell breakage with glass beads, incubation of
extract with Ni2+-agarose and recovery of a 300 mM
imidazole eluate, and purification on a Mono Q column with a 100 to 500 mM NaCl gradient. For spt3, spt8, and
accompanying wild-type complex preparation, starting material was a
6-liter culture, and an additional Superose 6 column step was employed.
Peak Mono Q fractions of SAGA were pooled and concentrated to 0.6 ml in
a Centriprep-30 concentrator (Amicon). Samples were loaded on a
Superose 6 HR 10/30 column (Pharmacia) equilibrated in 250 mM NaCl. The
calibration of this column was as follows: thyroglobulin (669 kDa),
fraction 24; ferritin (440 kDa), fraction 27; adolase (158 kDa),
fraction 30; and ovalbumin (45 kDa), fraction 33/34.
HAT assays were performed by previously described methods
(
24): 30-µl reaction mixtures contained 2 µl of enzyme
sample,
2 µg of oligonucleosomes or 10 µg of free histones, and
0.25 µCi
of
3H-labeled acetyl coenzyme A in HAT buffer
(50 mM Tris-HCl [pH
8.0], 50 mM KCl, 5% glycerol, 0.1 mM EDTA, 1 mM
dithiothreitol,
1 mM phenylmethylsulfonyl fluoride, 10 mM sodium
butyrate) and
were incubated 30 min at 30°C. Oligonucleosomes were
prepared
as described previously (
16), and free histones
(purchased from
Sigma) were from calf thymus. Half of each reaction was
spotted
on P81 filter paper (Whatman) for histone binding, washed, and
used for liquid scintillation counting; the other half was heated
in
sodium dodecyl sulfate (SDS) sample buffer with
-mercaptoethanol
and
run on an SDS-18% polyacrylamide gel, which was fluorographed
with
Enhance (Dupont NEN) and dried. Fluorography was performed
with Kodak
X-Omat film at
70°C, with exposure times of 2.5 days
for nucleosome
assays and 1 to 1.5 days for free histone assays.
Quantitation of
histone H3 and H2B acetylated by SAGA was achieved
by cutting out these
bands from the dried gels, pulverizing them,
and using them for liquid
scintillation counting; five sets of
counts were averaged for each, and
error was 8% or
less.
Antibodies and Western blotting.
For Western blot
experiments, samples were boiled in SDS--mercaptoethanol sample
buffer, electrophoresed on SDS-8 or 10% polyacrylamide gels,
electroblotted to nitrocellulose, and visualized immunochemically by
standard methods (32). Anti-Ada2, anti-Gcn5, and anti-Spt3
antisera and anti-Spt20 affinity-purified antibodies were as described
previously (24); primary antibody dilutions used were
typically 1:4,000, 1:4,000, 1:500, and 1:2,000, respectively. Anti-TafII90, anti-TafII68, and
anti-TafII60 antisera (25) were used at
dilutions of 1:3,000, 1:6,000, and 1:6,000, respectively. Rabbit
anti-Spt8 antibodies were raised against a synthetic peptide spanning
the amino-terminal 20 amino acids (aa) of Spt8 (MDEVDDILINNQVVDDEEDD) by Cocalico Biologicals; this antiserum was used at a dilution of
1:2,000. Immunodetection was performed with a secondary antibody (goat
anti-rabbit immunoglobulin G-horseradish peroxidase conjugate; Bio-Rad)
and an enhanced chemiluminescence kit (Amersham). Some blots were
stripped of antibody before reprobing; this was accomplished with 62.5 mM Tris (pH 6.8)-2% SDS-100 mM -mercaptoethanol at 50°C for 30 min.
In vivo RNA analysis.
Yeast strains used for analyzing
transcriptional effects of the bromodomain were FY1370
(gcn5) and GCN5 wild-type and bromodomain deletion integrants as described above; for HAT domain experiments, strains were FY1370 plasmid integrants containing wild-type
GCN5, empty vector (gcn5), or GCN5
with HAT domain substitution mutations (78). Total RNA was
isolated from cultures grown in SC medium to an optical density at 600 nm of 0.8 to 1.2 by the hot phenol method as described previously
(40). To derepress HIS3 transcription, cells were
grown in SC medium lacking histidine, and 3-aminotriazole was added to
40 mM 2 h (for bromodomain study) or 6 h (for HAT domain
study) prior to RNA isolation. RNA concentration was quantitated spectrophotometrically at 260-nm wavelength; 50 µg of each RNA sample
was hybridized to a completion with an excess of
32P-end-labeled HIS3 and tRNAw
oligonucleotides and treated with S1 nuclease as described elsewhere (40, 54). HIS3 RNA levels were quantitated on a
PhosphorImager (Molecular Dynamics). S1 assays were performed in
duplicate several times (exception for mutants LKN, IFQ, and YIA,
performed once), and PhosphorImager quantitation showed less than 15%
error. tRNAw probe (bromodomain study) and PMA1
RNA (HAT domain study) were used as internal controls for equal loading.
GST-TBP binding study.
Escherichia coli DH5
, grown
in LB medium with 100 µg of ampicillin per ml, was used for induction
of GST and GST-TBP. Expression was induced with 1 mM
isopropyl--D-thiogalactopyranoside for 4 h at
37°C, and cell lysates were prepared by sonication in
phosphate-buffered saline (65) containing protease
inhibitors and rotated for 30 min at 4°C with glutathione-Sepharose
beads (Pharmacia). Samples of these beads (about 15 µl containing
several µg of GST or GST-TBP) were then rotated alone or with
Superose 6-purified wild-type (fraction 20), spt3
(fraction 21), or spt8 (fraction 21) SAGA complexes for
1 h at 4°C. Amounts of SAGA samples used (30 µl for wild-type
and spt8 strains and 20 µl for spt3 strains) were adjusted to
have similar amounts of protein, based on prior Western blotting. Each
reaction (150 µl, final volume) was adjusted to a final NaCl
concentration of approximately 60 mM and contained 100 µl of binding
buffer (20 mM HEPES [pH 7.3], 5 mM MgCl2, 0.5 mM EDTA,
15% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). The resulting beads were washed three times with 500 µl of
binding buffer with 50 mM NaCl, boiled in SDS sample buffer, and loaded
onto an SDS-10% polyacrylamide gel, which was used for Western blot
analysis with anti-Ada2, anti-Spt20, and anti-Spt3 antibodies.
| |
RESULTS |
Loss of Spt3 or Spt8 has moderate effects on SAGA structure.
Our previous results have indicated that severe phenotypes correspond
to disruption in SAGA structure; i.e., the major growth defects seen in
spt20 and spt7 mutants correlate with a
complete loss of the SAGA complex. In contrast, the mild
gcn5 phenotype corresponds to a subtly altered SAGA
complex. To test further the hypothesis that severity in mutant
phenotype relates directly to biochemical integrity of the SAGA
complex, we examined SAGA structure in the moderately defective
spt3 and spt8 and the severe
ada1 mutants and then compared their mutant phenotypes.
First, extracts were prepared from both
SPT3 and
SPT8 disruption strains to determine whether the SAGA
complex exists in the
absence of these subunits. The extracts were
chromatographed through
Ni
2+-agarose and Mono Q resins to
separate four previously identified
nucleosomal HAT complexes
(
24). Western blotting using Ada2
and Gcn5 antibodies
demonstrated that the mutant SAGA complexes
were chromatographically
distinct from wild-type SAGA:
spt3 and
spt8
SAGA complexes elute from Mono Q approximately two and seven
fractions
earlier, respectively (data not
shown).
To investigate these altered complexes further, larger-scale
preparations of SAGA from
spt3 and
spt8
mutants were fractionated
with an additional Superose 6 column step
(
24). Size determination
via anti-Ada2 Western blots of the
Superose fractions indicated
that the SAGA complexes derived from both
mutants were only slightly
smaller and eluted in a broader peak than
wild-type SAGA (Fig.
1A), suggesting that
few, if any, additional subunits were lost
along with either Spt3 or
Spt8. In addition, Spt3 is present in
spt8 SAGA (Fig.
1A), and Spt8 is present in
spt3 SAGA (Fig.
1B).
Furthermore, deletion of Spt3 or Spt8 has no effect on
Taf
II90,
Taf
II68, or Taf
II60
interaction with SAGA (Fig.
1B).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Western blot characterization of Superose 6-purified
spt3 and spt8 SAGA complexes. (A) SAGA
complexes derived from wild-type (FY631), spt3 (FY294),
and spt8 (FY462) strains were pooled, concentrated, and
run on a Superose 6 column for separation based on molecular weight.
Western blots of these fractions were performed to compare the sizes of
the complexes. Blots were visualized with dilutions of antisera raised
against the Ada2 or Spt3 proteins as indicated. (B) Western blots of
wild-type (fraction 20), spt3 (fraction 21), and
spt8 (fraction 21) SAGA, visualized with antisera
specific to Spt8, TafII90, TafII68, or
TafII60.
|
|
Ada1 is integral to SAGA structure.
In contrast to the modest
effects on structure from loss of either Gcn5 (24), Spt3, or
Spt8, our previous biochemical analyses of Spt20 and Spt7 suggested
that these proteins are critical to the structural integrity of the
SAGA complex (24). The large size of SAGA (1.8 MDa)
indicates that there may be additional proteins having a similar role
in holding the complex together. The observation that a strain bearing
an ADA1 disruption exhibits severe phenotypes similar to
those of SPT20 mutants, along with the indication that Ada1
may exist in a large complex with Ada2, Ada3, Gcn5, and Spt20 (5,
37), suggested that Ada1 might be present in SAGA and required
for its integrity.
To test whether Ada1 has a role in SAGA, cell extracts were prepared
from wild-type and
ada1 strains and tested for the
presence
and activity of SAGA. Nucleosomal HAT assays were performed on
Mono Q column fractions, following Ni
2+ chelate affinity
chromatography (
24). Extract from
ada1 cells
specifically lacked the nucleosomal HAT activity of SAGA (around
fraction 42), while the activity of the Ada complex (peak in fractions
24 to 26) was intact (Fig.
2A). This
profile is identical to that
previously observed for both
SPT20 and
SPT7 disruptions.
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Presence of Ada1 in the SAGA complex. HAT complexes were
derived from wild-type (PSY316) and ada1 (SB11) yeast
strains through the Mono Q column step of the previously described
purification procedure. (A) Fluorographs of nucleosome acetylation
assays of the even-numbered column fractions. The arrows denote the
relative positions of the four histone proteins as separated on
SDS-18% polyacrylamide gels; visualized species contain acetyl groups
labeled with 3H. Wild-type fractions displaying the
H3/H2B-acetylating activities of the Ada and SAGA complexes are
indicated at the top. (B) Western blots of the fractions, visualized
with dilutions of antisera raised against Ada1, Ada2, or Gcn5
protein.
|
|
To confirm that Ada1 is directly involved in the SAGA complex, Western
blot analysis was performed. An anti-Ada1 blot revealed
that wild-type
SAGA, but not the Ada complex, does contain Ada1
(Fig.
2B).
Furthermore, immunoblotting analyses using anti-Ada2
and anti-Gcn5
antibodies indicate that SAGA itself is lost in
the
ada1
mutant preparation, while the Ada complex was unaffected
(Fig.
2B).
Ada1 is therefore similar to Spt20 and Spt7 in that
it is required for
the overall structural integrity of
SAGA.
Three phenotypic classes of SAGA components.
Thus, structural
analysis of SAGA provides a biochemical correlation with previous
observations that disruptions of SAGA components cause phenotypes with
a range of severity. We further tested the hypothesis that loss of
components that have little detectable effect on SAGA complex integrity
result in modest phenotypes, and in contrast, loss of components that
are completely disruptive to the complex result in severe phenotypes.
Phenotypic effects of disruptions of representatives of each putative
phenotypic class are presented in Fig.
3.
Growth was
tested under various conditions known to cause growth
defects
in some yeast mutant strains (
31). As shown
previously and here,
Ada2/Gcn5 and Spt3/Spt8 each have modest
phenotypic effects. In
contrast,
ada1 causes genetic
phenotypes similar in severity
to those caused by
spt7
and
spt20 mutations and more severe
than those of the
others (
spt3,
spt8,
gcn5,
ada2, and
ada3).
In particular, as reported
previously (
37),
ada1 is like
spt20 in that it is an inositol auxotroph and displays an
Spt
phenotype; we show here that both mutants also have
the additional
phenotype of failure to grow on media containing
caffeine or the
DNA synthesis inhibitor hydroxyurea.
View larger version (64K):
[in this window]
[in a new window]
|
FIG. 3.
Phenotypic comparison of ada1 and other
SAGA deletion mutants. Strains FY630, FY1106, FY1559, FY297, FY463,
FY1599, and FY1553 were grown overnight in liquid YPD medium. For each
strain, approximately 5 × 103 cells were spotted on
the indicated plates and grown for 2 days at 30°C. All strains
contain the his4-917 insertion mutation. Otherwise,
wild-type strains containing this allele are His, while
strains containing a mutation able to suppress this allele are
His+ (Spt phenotype).
|
|
We tested another phenotype that differed for the subgroups of SAGA
mutants: double-mutant lethality in combination with mutations
in
either
SNF/SWI genes or Srb/mediator genes. These results
(Table
2) also demonstrate that
ada1 mutations cause the same phenotypes
as
spt20 and
spt7 mutations (
59):
ada1 is lethal in combination
with every
snf/swi or Srb/mediator mutation tested. In contrast,
ada2 and
ada3 mutations did not cause
inviability in similar
double mutants (Table
2), as was also previously
seen for
spt3,
spt8, and
gcn5
mutations (
59), indicating a less critical
role for these
subunits in cellular growth. These results contrast
with those of
Pollard and Peterson (
58), who observed lethality
in double
mutants of
gcn5,
ada2, or
ada3 combined with
swi1,
albeit in a
different yeast strain background.
Thus, both biochemical and genetic evidence places Ada1 in the
Spt20/Spt7 class; i.e., it is required for SAGA complex integrity,
and
loss of it is strongly debilitating to function in vivo. In
contrast,
either Gcn5, Spt3, or Spt8 has modest effects on SAGA
structure and
function in vivo. In summary, we detect three phenotypic
and structural
classes of SAGA components: Gcn5/Ada2/Ada3, Spt3/Spt8,
and
Ada1/Spt7/Spt20.
Double mutants gcn5 spt3 and gcn5
spt8 are similar in phenotype to spt20 and
spt7 mutants.
Based on the above data, it appears
that each of the two moderate phenotypic classes contributes distinct
functions to SAGA. Because moderate phenotypes result from deletions of
genes of either class, we postulated that in the absence of one class, the function of the second class remains intact. However, in the cases
of ada1, spt7, and spt20
mutations, where the complex is completely disrupted, both functions
are lost and severe phenotypic defects result. Based on these
observations and ideas, we hypothesized that double mutants that
disrupt the function of each moderate phenotypic class simultaneously
would cause severe phenotypes similar to those of ada1,
spt7, and spt20 mutations.
To test this idea,
gcn5 spt3 and
gcn5
spt8 mutants were constructed. As had been seen previously in
other phenotypic assays
(reference
59 and Fig.
3),
neither
spt3,
spt8, nor
gcn5
cells
were severely defective (Fig.
4).
In fact,
spt3 and
spt8 strains
grew well in
the absence of inositol, in the presence of hydroxyurea
or caffeine, or
with galactose as a sole carbon source;
gcn5 cells also
grew well under all conditions except caffeine. In
contrast, the double
mutants
gcn5 spt3 and
gcn5 spt8 were
significantly more defective, failing to grow under the latter
three
conditions, and
gcn5 spt8 grew less vigorously than
the
single mutants in media lacking inositol (Fig.
4A). These levels
of
impairment are similar to what is seen in an
spt20 mutant
tested under the same conditions (Fig.
4A). These results show
that the
double mutants have severe phenotypes similar to those
of single
mutations that disrupt SAGA altogether. Importantly,
SAGA is intact in
the double mutants and can be purified by standard
methods, as shown by
immunoblot analysis of SAGA from these strains
(Fig.
4B). Overall, the
results support the idea that the two
phenotypically moderate subgroups
of components contribute distinct
biochemical functions to SAGA.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of gcn5 spt3 and
gcn5 spt8 double mutants with an spt20
mutant. (A) Strains FY2, FY293, FY1299, FY1286, FY1440, FY1719, and
FY1098 were grown overnight in liquid YPD medium. For each strain,
approximately 2 × 103 cells were spotted on the
indicated plates. Growth is shown after 2 days of incubation at 30°C,
except in the case of the caffeine plates, which were photographed
after 3 days. (B) Double-mutant SAGA complexes are intact. Mono Q
fractions from gcn5 spt3 (FY1441) and gcn5
spt8 (FY1720) HAT complex preparations were analyzed by Western
blotting. SAGA subunits were visualized with dilutions of antisera
raised against Ada2 or Spt20 protein as indicated.
|
|
Gcn5 bromodomain is important for normal levels of nucleosome
acetylation by SAGA.
We wished to characterize the biochemical
functions of the Gcn5/Ada2/Ada3 and Spt3/Spt8 subgroups in SAGA. Each
member of the Gcn5/Ada2/Ada3 subgroup previously was shown to be
required for histone acetylation, and Gcn5 was identified as the HAT
catalytic subunit. Recombinant Gcn5 acetylates free core histones and
not nucleosomes; however, both the Ada and SAGA complexes acetylate nucleosomes (24). Thus, an important question is the
determinant(s) of physical interaction with nucleosomes.
One clue to a possible determinant of nucleosome access is within the
Gcn5 protein itself. The bromodomain at the carboxyl
terminus of Gcn5
(aa 349 to 422 [
22]) is a conserved sequence
that is
found in a variety of transcription-related proteins but
has no clear
function (
33,
41,
72). In particular, the bromodomain
is
found in several transcription cofactors and coactivators that
possess
HAT activity or other nucleosome remodeling activity,
thus making the
bromodomain a candidate domain to mediate interaction
with nucleosomes.
It was shown previously that the Gcn5 bromodomain
is not required for
acetylation of free histones by recombinant
Gcn5 in vitro or for
transcriptional activation by strong activators,
but its deletion does
result in minor growth defects and reduced
activation by weak
activators (
13,
21,
48). To investigate
the role of the
bromodomain in nucleosome acetylation, we prepared
Ada and SAGA
complexes from extracts of
gcn5 cells containing
integrated copies of wild-type or bromodomain-deleted (
BrD)
GCN5.
To control for potential construct-specific
differences in stability
or expression, two independent bromodomain
mutants (
13), containing
the sequences for either the first
350 or 280 aa of the 439-aa
full-length Gcn5, were used for these
experiments.
Wild-type Ada and SAGA complexes (Mono Q peak fractions 20 and 40, respectively) showed comparable levels of histone H3-acetylating
activity on nucleosomal substrates (Fig.
5A). Ada complex fractions
derived from
the bromodomain mutants had nucleosome-acetylating
activities similar
to that of the wild-type Ada complex (fraction
20), but both mutants
displayed significantly reduced activity
by SAGA (fraction 40). A
different situation was observed when
free histones were used as a
substrate for acetylation: the levels
of acetylation by the
BrD SAGA
fractions were only moderately
lower than that of wild-type SAGA.
Quantitation of the H3/H2B
species in the HAT assays shown for fraction
40 revealed that
the nucleosomal substrates were acetylated
approximately half
as well as free histones by
BrD SAGA compared to
wild-type SAGA
(Fig.
5A, bar graph). In addition, in each case
acetylation of
free histones by SAGA was higher than free histone
acetylation
by Ada and nucleosome acetylation by either SAGA or Ada.
Anti-Ada2
and anti-Gcn5 Western blots (Fig.
5B) confirmed that these
free
histone acetylation results accurately reflected the amount of
complex in the fractions, since SAGA contained more protein than
Ada.
The immunoblots also show that the bromodomain mutants had
nearly
wild-type amounts of both Ada and SAGA.
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of Gcn5 bromodomain deletion on nucleosomal HAT
activity. Cells containing wild-type (w.t.; residues 1 to 439) or
BrD (residues 1 to 350 or 1 to 280) GCN5 were used to
prepare Mono Q fractions by the standard purification method for the
HAT complexes. (A) HAT assays with nucleosomal or free histone
substrates were performed with even-numbered fractions surrounding the
Ada and SAGA peaks; fluorographs of the resulting gels are presented.
The arrows denote the relative positions of the four histone proteins
as separated on SDS-18% polyacrylamide gels; visualized species
contain acetyl groups labeled with 3H. The bar graph at
right presents the ratio of nucleosomal to free histone H3/H2B
acetylation for SAGA fraction 40, normalized to the wild-type ratio.
(B) Samples of fractions 20 (Ada peak), 30 (negative control; no HAT
complex), and 40 (SAGA peak) were also analyzed by Western blotting.
Five microliters of each was run on SDS-polyacrylamide gels and
electroblotted to nitrocellulose, which underwent immunodetection with
dilutions of anti-Ada2, anti-Gcn5, or anti-TafII
antibodies. Markers on the Gcn5 panels indicate the Gcn5 species
visualized on equivalent portions of the blots, and their positions of
migration agreed with their predicted sizes (51, 40, and 32 kDa for the
1-439, 1-350, and 1-280 constructs, respectively). The peak SAGA
fraction from a preparation of gcn5 (FY1370) cells was
also tested for TafIIs (right).
|
|
Overall, the results show that despite the fact that SAGA fractions
derived from wild-type and Gcn5
BrD strains have copious
amounts of
Gcn5 and innate HAT activity, they acetylate nucleosomes
less
effectively than the less concentrated Ada complex. Furthermore,
the
observed defects may be due to absence of the bromodomain
and not due
to loss of other associated protein factors, since
no major differences
in size were observed in Superose 6 fractionations
of wild-type and
bromodomain mutant SAGA complexes (data not shown).
In addition,
Western analysis showed that Taf
II60, Taf
II68,
and
Taf
II90 were present in the
BrD SAGA complexes, as
well as in
gcn5 SAGA (Fig.
5B).
Since Spt7 is another SAGA component harboring a bromodomain, we also
analyzed a similar deletion within this protein. Ada
and SAGA complexes
prepared from
SPT7 BrD cells (
20) or from
a
double mutant with
GCN5 BrD were indistinguishable from
their
wild-type
SPT7 counterparts in terms of nucleosome
acetylation
or growth phenotypes under various conditions (data not
shown).
Thus, the Spt7 bromodomain has no discernible functional effect
or synthetic interaction with the Gcn5 bromodomain in these
assays.
Gcn5 bromodomain and HAT domain mutants display similar
HIS3 transcriptional defects.
In vitro, nucleosomal
acetylation by Gcn5 was specifically lowered by deletion of the
bromodomain. The effect of Gcn5 bromodomain deletion in vivo was
investigated by S1 analysis of RNA produced from the HIS3
gene, which has been shown to be regulated by Gcn5's nucleosome
acetylation activity (44). There are two RNA start sites in
HIS3 (Fig. 6A), and in
wild-type cells under basal conditions these sites are used equally
(Fig. 6C and reference 70). In strains lacking Gcn5
or bearing Gcn5 BrD, usage of the +13 start site was reduced (Fig.
6C). Also similar to the absence of Gcn5, the Gcn5 BrD strains show
diminished activation potential (Fig. 6D).
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 6.
HIS3 transcriptional defects observed in
GCN5 null, HAT domain substitution, and BrD mutants. (A)
Diagram of HIS3 promoter function. Weak and strong
TBP-binding sequences (TATA boxes) direct transcription from the +1 and
+13 start sites, respectively. The activator Gcn4 binds to multiple
upstream sites (UAS). (B) Start site usage for activated
HIS3 transcription in wild-type (w.t.), gcn5,
and GCN5 HAT domain substitution mutant strains. Activating
conditions were achieved with 3-aminotriazole. PhosphorImager
quantitation of the S1 assays is presented as the ratio of +13 to +1.
Shown at the bottom are in vitro HAT activities (as a percentage of
wild-type activity) of native SAGA complexes purified from the
indicated strains (27). (C) Start site preference for
wild-type, gcn5, and BrD strains under noninducing
conditions (no 3-aminotriazole). (D) Activated HIS3
transcription in wild-type, gcn5, and BrD strains.
PMA1 RNA and tRNA were included as internal controls for
sample loading.
|
|
Under activated conditions in wild-type cells, there is a strong
preference for the +13 start site over the +1 site (Fig.
6B and D and
reference
70). In
gcn5 cells, +13 and
+1 start
sites were used equally in induced conditions (Fig.
6B and D).
To examine the potential role of acetylation in start site usage,
we
tested the effects of HAT domain and bromodomain mutations.
HAT domain
substitution mutations, which exhibit a correlation
between HAT
competence and transcriptional activation at a model
promoter
(
78), also show a clear correlation with start site
usage
(Fig.
6B). The +13 start site was preferred in yeast strains
bearing
the LKN, IFQ, or YDR mutation (HAT-competent mutants),
and hence these
were similar to the wild type. KQL and PKM (HAT-defective
mutants) had
much reduced start site preference for +13 and were
similar to the
gcn5 strain. Finally, YIA (HAT-intermediate mutant)
showed an intermediate preference for start sites between
GCN5+ and
gcn5. Thus, the results
demonstrate a strong correlation
between HAT activity and start site
preference, indicating that
HAT activity of Gcn5 is critical for normal
start site selection
at the
HIS3 promoter.
We then tested the effects of the two
BrD mutations on the +13/+1
start site ratio under activated conditions. Interestingly,
these
mutants also showed a change in start site usage (Fig.
6D),
and the
effect was intermediate between those of the wild type
and HAT domain
mutants that result in complete loss of HAT activity
(compare Fig.
6D
with Fig.
6B). Thus, several aspects of transcriptional
control of
HIS3 are altered in the bromodomain mutants in a manner
resembling a defect specifically in Gcn5 HAT catalytic
function.
TBP binding by SAGA in vitro requires Spt8 but not Spt3.
We
then characterized SAGA prepared from strains bearing deletions of the
other moderate class, Spt3 or Spt8, to determine whether the
biochemical functions of the complexes were altered. SAGA complexes
purified from spt3 and spt8 cells were
tested for HAT activity, and no major differences in acetylation were observed (data not shown). Thus, in contrast to Gcn5, neither Spt3 nor
Spt8 is crucial for the HAT activity of SAGA.
SAGA complexes prepared from
SPT3 or
SPT8 mutant
strains were therefore intact and possessed HAT activity, but as
described
above, genetic evidence had indicated that these Spt proteins
are important for normal function. Previous results suggested
that Spt3
and Spt8 interact functionally, and possibly physically,
with TBP.
Although TBP does not cofractionate with SAGA (
23),
pull-downs of GST-Spt20 from yeast extracts recovered TBP along
with
the other Spt proteins (
59). Therefore, we tested
whether
SAGA interacts with TBP, and if so, whether Spt3 and/or Spt8
was
required for this
interaction.
GST-TBP was used for pull-down experiments with the
Superose-fractionated SAGA complexes derived from wild-type,
spt3, and
spt8 strains, and the binding of
complexes was monitored by Western
analysis. Wild-type SAGA interacted
with GST-TBP but not with
the GST negative control protein, as
visualized by using antibodies
to Ada2, Spt3, and Spt20 (Fig.
7). Interestingly, while SAGA lacking
Spt3 also bound to GST-TBP, SAGA lacking Spt8 showed a very low
level
of binding (Fig.
7). The finding that Spt3 was not a critical
determinant of SAGA interaction with TBP was supported by the
observation that Spt3 was present in SAGA prepared from the Spt8
disruption, which bound poorly to TBP (Fig.
7). Similarly, the
potential participation of Spt8 in TBP binding is bolstered by
the
finding that Spt8 is present in the
spt3 SAGA sample
(Fig.
1B). Altogether, these data indicate that the Spt3/Spt8 subgroup
is not critical for SAGA structure, but at least Spt8 is required
for
SAGA interaction with TBP in vitro.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
In vitro binding of wild-type, spt3, and spt8 SAGA
complexes to TBP. Glutathione-Sepharose beads containing bacterially
expressed GST or GST-TBP were incubated alone or with similar amounts
of wild-type, spt3, or spt8 SAGA complexes
at 4°C under conditions of approximately 60 mM NaCl. After washing,
Western blotting was performed with these beads to analyze the proteins
that had bound to GST (G lanes) or GST-TBP (T lanes). The input (I)
lanes contained half of the amount of SAGA used for the binding
experiments. The position of the antibody-visualized Ada2, Spt20, and
Spt3 bands on the Western blots are indicated by arrows. An
unidentified species in the GST-TBP preparation (T lanes) had a
mobility similar to but slightly slower than that of Spt3 and
cross-reacted with anti-Spt3 antibodies; the band seen in the
spt8 T lane is a combination of this species and a small
amount of Spt3.
|
|
| |
DISCUSSION |
A number of interconnected processes are involved in the
activation of transcription, and the recently discovered SAGA complex apparently combines several of them: activator interaction (through Ada2, Gcn5, and Ada3), histone acetylation (by Gcn5), and TBP interaction (through Spt8 and Spt3). We have sought to characterize the
latter two of these functions in vivo and in vitro and to analyze the
structure of SAGA by studying mutant complexes and individual subunits
in vitro. These studies indicate that while neither the Gcn5/Ada2/Ada3
nor Spt3/Spt8 subgroup is critical for SAGA structure, each confers a
distinct and important biochemical function. Either may be partially
dispensable, but loss of both is highly detrimental to overall SAGA function.
Components necessary for SAGA structure.
In this study, we
have identified Ada1 as a component of the SAGA complex, and we have
further shown that its loss leads to the physical disruption of SAGA
and severe phenotypic defects. This places it in a class with two other
previously described SAGA components with similar qualities, Spt20 and
Spt7. These three subunits each appear to be necessary for the
structure of the complex, with the critical role of holding it
together. The precise interactions among these proteins and with other
SAGA components remain to be determined, but their function could be to
link the Spt and Ada subunits within SAGA.
We have also characterized
spt3 and
spt8
mutants and find that in contrast to loss of Spt20/Spt7/Ada1, they
maintain overall
SAGA integrity, as was seen with
gcn5.
Moreover, SAGA integrity
is maintained in the double disruption of Gcn5
and either Spt3
or Spt8. Based on these data, we conclude that the
Gcn5/Ada2/Ada3
and Spt3/Spt8 groups of proteins are likely to be
peripheral within
the complex, i.e., exposed and in a position to form
protein contacts
with other factors, including histones and TBP.
Overall, the biochemical
characterization of structure nicely mirrors
the genetic analysis
of function: disruptions of the SAGA components
that are integral
for structure are extremely debilitating in vivo,
while disruptions
of the more structurally peripheral components are
less
severe.
Nucleosomal acetylation by the SAGA complex.
The most
thoroughly characterized function within the SAGA complex has been the
HAT activity of Gcn5, and recent studies indicate that the HAT domain
is required for Gcn5's role in transcription (13, 44, 78).
The experiments presented here suggest that another region of Gcn5, the
bromodomain, may have significant effects on the function of the SAGA
complex in acetylation. Specifically, removal of the bromodomain
reduces the HAT activity of SAGA on nucleosomal substrates,
even though the complex and its activity on free histones are
otherwise largely intact. One interpretation of these data is that the
bromodomain is required for physical interaction either with histones
or with other components in SAGA that bind to histones (and other
proteins would fulfill such a function in the Ada complex). Relevant to
this is the observation that the size of SAGA prepared from the BrD
strain was not grossly altered. However, small changes in size or shape
of SAGA would not be apparent due to the low sensitivity of the
Superose 6 sizing column near the void volume (where SAGA elutes). In
this view, Gcn5 possesses separate domains for catalytic HAT function
and for interaction with nucleosomal substrates. This is consistent with two previous observations. First, recombinant Gcn5 acetylates free
core histones but not nucleosome-assembled histones (24); second, mutations in TafII68 similarly reduce nucleosomal
histone acetylation without reducing free histone acetylation
(25). However, the SAGA complexes bearing Gcn5 deletions of
the bromodomain are not altered for TafII60,
TafII68, or TafII90, indicating that there may
be multiple determinants for nucleosome interaction.
A second interpretation of the data is that the bromodomain defect
could be related to the fact that nucleosome acetylation
by wild-type
SAGA is already somewhat inhibited relative to that
of the 0.8-MDa Ada
complex, as shown in Fig.
5. This unidentified
inhibitory activity, not
present in the Ada complex, may reside
with the Spt, Taf
II,
or unknown subunits of SAGA and may act by
interfering with Gcn5's
interaction with nucleosomes. Thus, the
function of the Gcn5
bromodomain in SAGA could be to counteract
this inhibition partially,
so that deletion of the domain leads
to a more complete inhibition.
Such a process would be relevant
only in the context of SAGA, since
BrD Ada complex acetylates
nucleosomes very well. Further study will
be required to determine
which of these two models is correct and how
regulation of acetylation
activity may be achieved through the
bromodomain.
In either case, it is important to note that the deletion of the
bromodomain affected transcription of the
HIS3 gene in vivo,
causing both a slight reduction in activation potency and an alteration
in start sites. These effects were also seen in a total disruption
of
Gcn5 or in HAT-defective substitution mutants of Gcn5. Thus,
the effect
of the bromodomain deletion in vivo clearly ties this
domain to
acetylation function of
Gcn5.
Bromodomains occur in numerous proteins having a role in chromatin
remodeling, including the acetyltransferases CBP and
TAF
II250,
and Snf2/Swi2, a component of the ATP-dependent
remodeling complex
Swi-Snf (
41). Our data do not necessarily
indicate that in general,
bromodomains are required for nucleosome
association. First, the
deletion of the bromodomain in Spt7 did not
affect acetylation;
second, the bromodomain of human Gcn5 interacts
with a nonhistone
DNA binding protein complex, called Ku70/80
(
4). The bromodomain-Ku
physical interaction results in
phosphorylation of human GCN5
and repression of its HAT activity,
apparently via a Ku-dependent
recruitment of DNA-dependent protein
kinase. Thus, we believe
that there may not be a unified mechanism for
bromodomains, but
rather, there may be a multiplicity of roles involved
in modulation
of activity of the resident
complex.
TBP interaction by the SAGA complex.
TBP interaction is
another function of SAGA that had been suggested by previous studies
but has been directly demonstrated here. In vitro binding experiments
show specific interaction between purified SAGA and GST-TBP. Thus,
these data agree with previous evidence that TBP interacts with Ada2
(3), Ada3 (64), or Spt20 (59) in the
context of yeast whole-cell extract.
GST-TBP interaction analysis of two mutant complexes indicated that
Spt8 is required for SAGA-TBP interaction in vitro, but
Spt3 is not. We
do not yet know whether Spt8 makes direct contact
with TBP. While the
mutant SAGA is not obviously smaller than
wild-type SAGA, the
sensitivity of Superose 6 sizing is low, as
discussed above. The three
largest Taf
IIs in SAGA are not sufficient
for TBP
interaction, because they are present in complex prepared
from the
spt8 mutant strain, which is impaired in TBP binding.
In
addition, SAGA prepared from the
tafII68 mutant
strain maintains
binding to TBP but has lost Spt3 (
25),
which underscores that
Spt3 is not required for TBP interaction in
vitro.
The requirement of Spt8, as opposed to Spt3, for TBP binding was
unexpected in light of previous in vivo results, which suggested
a
direct interaction between Spt3 and TBP and an auxiliary role
for Spt8
(
17,
18). It is possible that Spt3 contributes significantly
to the interaction under physiological conditions within the cell.
Thus, there may be multiple ways that SAGA recruits TBP, including
through Taf
IIs, and our in vitro binding assay detects only
a
subset of
them.
Model for multiple functionality of SAGA.
The spt3
gcn5 and spt8 gcn5 double mutants (Fig. 4)
apparently disrupt two in vivo functions, namely, TBP binding and nucleosome acetylation, leading to major phenotypic defects. The combined losses cause defects which approximate those of a mutant which
disrupts SAGA altogether (spt20). This provides further evidence that multiple functions are incorporated in the SAGA complex
in vivo, and that the two discussed above are needed for its full
functionality but are partially redundant. Thus, one hypothesis that
emerges from these data is that two functions of SAGA are directed at
the same objective: regulation of TBP binding to the TATA box.
Activation domain interaction is a third presumptive function of the
SAGA complex. This was indicated in earlier studies of Ada2, Ada3, and
Gcn5 function and has been shown directly by recent studies with SAGA
itself (75).
These results, along with additional findings presented in this and
previous studies, suggest an overall model for the structure
and
function of the SAGA complex, shown in Fig.
8. In this model,
SAGA consists of two
major parts with discrete functions: adaptor
related and Spt related. A
knockout of any of the identified adaptor-related
components (Gcn5,
Ada2, or Ada3) leads to moderate growth defects
and resistance to the
toxicity of overexpressed GAL4-VP16, while
knockouts of the shown Spt
proteins result in defective phenotypes
of varying severity and in
suppression of Ty element insertion
in a promoter. At the interface
between these two parts would
be Ada1, Spt20, and Spt7 proteins,
identified as being important
to SAGA structural integrity; knockouts
of any of these have combined
Ada
and Spt
phenotypes. A number of unknown proteins, as well as the several
Taf
IIs mentioned above, are also present in SAGA.
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 8.
Model for SAGA structure and function in transcription.
Depicted is a hypothetical gene with an upstream activation sequence
(UAS) and TATA box; the DNA is wound around nucleosomes (cylinders).
The SAGA complex, composed of adaptor (white) and Spt (black)
functional regions and held together by several structurally important
proteins (grey), is proposed to interact with the an activator (such as
Gcn4) at the UAS through Ada2. This allows the HAT activity of Gcn5, in
cooperation with its bromodomain (BrD), to acetylate (Ac = acetyl
group) the amino-terminal tails of nucleosomal histones, providing more
effective TATA binding of TBP. Further regulation is provided by
SAGA-TBP interaction, principally through Spt8, in conjunction with
Spt3 and/or other factors. The large white and black circles represent
unidentified members of SAGA; several TafIIs are also
present in SAGA (25), but their exact role in the complex
has yet to be defined.
|
|
As the complex approaches a promoter, the Ada2 subunit would interact
with the activation domain of an activator bound to
an upstream
activating sequence, bringing Gcn5 and the Spt components
in proximity
with the promoter. We propose that after this recruitment,
the Gcn5
moiety of SAGA functions to acetylate histones within
the nucleosome(s)
of the promoter region, with the assistance
of the bromodomain, thereby
remodeling the chromatin structure
in a localized region. This makes
the TATA box available to TBP,
and its DNA binding and/or interaction
with general transcription
factors may be regulated through contact
with Spt8, Spt3, Taf
IIs,
or undetermined SAGA subunits. In
this model, loss of either acetylation
of the nucleosomes at the TATA
box (e.g.,
gcn5) or loss of TBP
regulation (e.g.,
spt8) is tolerated, but loss of both functions
(e.g.,
gcn5 spt3 and
ada1) is highly
detrimental.
This model assumes that SAGA is an independent complex with multiple
functions, but the exact relationship between Ada and
SAGA has not yet
been established. The two HAT complexes are known
to have Gcn5, Ada2,
and Ada3 in common, but other subunit identities
await the direct
characterization and comparison of purified samples
Ada
and SAGA may
well be functionally distinct complexes that only
share a few subunits.
Further characterization of SAGA will shed
light on this
issue.
The present functional analyses of SAGA illustrate an important
concept, i.e., in large complexes, individual components have
distinct
biochemical functions. The combined biochemical and genetic
analysis of
SAGA yields unique insights into function. In general,
these studies
are a paradigm for further studies of this multicomponent
complex, as
well as other large acetylation and deacetylation
complexes now under
investigation.
| |
ACKNOWLEDGMENTS |
S. M. Roberts and P. A. Grant contributed equally to
this work.
We thank R. Candau for preparation of the ADA1 disruption
strain SB11, Z. Yang for technical assistance in the preparation of
Spt7BrD HAT complexes, and N. Barlev for advice on binding assays.
We thank R. Reeder for the gift of GST-TBP plasmid, J. Reese and M. Green for TafII antibodies, and A. Navas, Z. Zhou, and S. Elledge for informing us that spt20 mutants have an
HUS phenotype. We thank G. Moore for helpful discussions
and critical comments on the manuscript.
This research was supported by grants from the National Institutes of
General Medical Sciences to S.L.B., F.W., and J.L.W. and from the
National Science Foundation and the Council for Tobacco Research to
S.L.B. P.A.G. was supported by a postdoctoral fellowship from the
American Cancer Society. An NIH Cancer Core training grant to the
Wistar Institute supported D.E.S. and L.J.D.; D.E.S. was also supported
by an NIH postdoctoral fellowship.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: The Wistar
Institute, 3601 Spruce St., Room 358, Philadelphia, PA 19104. Phone:
(215) 898-3922. Fax: (215) 898-0663. E-mail:
berger{at}wistar.upenn.edu.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1994.
Current protocols in molecular biology.
Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Bannister, A. J., and T. Kouzarides.
1996.
The CBP co-activator is a histone acetyltransferase.
Nature
384:641-643[Medline].
|
| 3.
|
Barlev, N. A.,
R. Candau,
L. Wang,
P. Darpino,
N. Silverman, and S. L. Berger.
1995.
Characterization of physical interactions of the putative transcriptional adaptor, ADA2, with acidic activation domains and TATA-binding protein.
J. Biol. Chem.
270:19337-19344[Abstract/Free Full Text].
|
| 4.
|
Barlev, N. A.,
V. Poltoratsky,
T. Owen-Hughes,
C. Ying,
L. Liu,
J. L. Workman, and S. L. Berger.
1998.
Repression of GCN5 histone acetyltransferase activity via bromodomain-mediated binding and phosphorylation by the Ku/DNA-dependent protein kinase complex.
Mol. Cell. Biol.
18:1349-1358[Abstract/Free Full Text].
|
| 5.
|
Berger, S. L.,
B. Piña,
N. Silverman,
G. A. Marcus,
J. Agapite,
J. L. Regier,
S. J. Triezenberg, and L. Guarente.
1992.
Genetic isolation of ADA2: a potential transcriptional adaptor required for function of certain acidic activation domains.
Cell
70:251-265[Medline].
|
| 6.
|
Boeke, J. D.,
F. LaCroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[Medline].
|
| 7.
|
Bradbury, E. M.
1992.
Reversible histone modifications and the chromosome cell cycle.
Bioessays
14:9-16[Medline].
|
| 8.
|
Braunstein, M.,
A. B. Rose,
S. G. Holmes,
C. D. Allis, and J. R. Broach.
1993.
Transcriptional silencing in yeast is associated with reduced nucleosome acetylation.
Genes Dev.
7:592-604[Abstract/Free Full Text].
|
| 9.
|
Brownell, J. E.,
J. Zhou,
T. Ranalli,
R. Kobayashi,
D. G. Edmondson,
S. Y. Roth, and C. D. Allis.
1996.
Tetrahymena histone acetyltransferase A: a transcriptional co-activator linking gene expression to histone acetylation.
Cell
84:843-851[Medline].
|
| 10.
|
Cairns, B. R.,
Y. Lorch,
Y. Li,
M. Zhang,
L. Lacomis,
H. Erdjument-Bromage,
P. Tempst,
J. Du,
B. Laurent, and R. D. Kornberg.
1996.
RSC, an essential, abundant chromatin-remodeling complex.
Cell
87:1249-1260[Medline].
|
| 11.
|
Candau, R., and S. L. Berger.
1996.
Structural and functional analysis of yeast putative adaptors: evidence for an adaptor complex in vivo.
J. Biol. Chem.
271:5237-5345[Abstract/Free Full Text].
|
| 12.
|
Candau, R.,
P. A. Moore,
L. Wang,
N. Barlev,
C. Y. Ying,
C. A. Rosen, and S. L. Berger.
1996.
Identification of functionally conserved human homologues of the yeast adaptors ADA2 and GCN5.
Mol. Cell. Biol.
16:593-602[Abstract].
|
| 13.
|
Candau, R.,
J. Zhou,
C. D. Allis, and S. L. Berger.
1997.
Histone acetyltransferase activity and interaction with ADA2 are critical for GCN5 function in vivo.
EMBO J.
16:555-565[Medline].
|
| 14.
|
Chiang, Y. C.,
P. Komarnitsky,
D. Chase, and C. L. Denis.
1996.
ADR1 activation domains contact the histone acetyltransferase GCN5 and the core transcriptional factor TFIIB.
J. Biol. Chem.
271:32359-32365[Abstract/Free Full Text].
|
| 15.
|
Côté, J.,
J. Quinn,
J. L. Workman, and C. L. Peterson.
1994.
Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF complex.
Science
265:53-60[Abstract/Free Full Text].
|
| 16.
|
Côté, J.,
R. T. Utley, and J. L. Workman.
1995.
Analysis of transcription factor binding to nucleosomes.
Methods Mol. Genet.
6:108-128.
|
| 17.
|
Eisenmann, D. M.,
K. M. Arndt,
S. L. Ricupero,
J. W. Rooney, and F. Winston.
1992.
SPT3 interacts with TFIID to allow normal transcription in Saccharomyces cerevisiae.
Genes Dev.
6:1319-1331[Abstract/Free Full Text].
|
| 18.
|
Eisenmann, D. M.,
C. Chapon,
S. M. Roberts,
C. Dollard, and F. Winston.
1994.
The Saccharomyces cerevisiae SPT8 gene encodes a very acidic protein that is functionally related to SPT3 and TATA-binding protein.
Genetics
137:647-657[Abstract].
|
| 19.
|
Eisenmann, D. M.,
C. Dollard, and F. Winston.
1989.
SPT15, the gene encoding the yeast TATA binding factor TFIID, is required for normal transcription initiation in vivo.
Cell
58:1183-1191[Medline].
|
| 20.
|
Gansheroff, L. J.,
C. Dollard,
P. Tan, and F. Winston.
1995.
The Saccharomyces cerevisiae SPT7 gene encodes a very acidic protein important for transcription in vivo.
Genetics
139:523-536[Abstract].
|
| 21.
|
Georgakopoulos, T.,
N. Gounalaki, and G. Thireos.
1995.
Genetic evidence for the interaction of the yeast transcriptional co-activator proteins GCN5 and ADA2.
Mol. Gen. Genet.
246:723-728[Medline].
|
| 22.
|
Georgakopoulos, T., and G. Thireos.
1992.
Two distinct yeast transcriptional activators require the function of the GCN5 protein to promote normal levels of transcription.
EMBO J.
11:4145-4152[Medline].
|
| 23.
| Grant, P. A. Unpublished data.
|
| 24.
|
Grant, P. A.,
L. Duggan,
J. Côté,
S. M. Roberts,
J. E. Brownell,
R. Candau,
R. Ohba,
T. Owen-Hughes,
C. D. Allis,
F. Winston,
S. L. Berger, and J. L. Workman.
1997.
Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex.
Genes Dev.
11:1640-1650[Abstract/Free Full Text].
|
| 25.
|
Grant, P. A.,
D. Schieltz,
M. G. Pray-Grant,
D. J. Steger,
J. C. Reese,
J. R. Yates III, and J. L. Workman.
1998.
A subset of TAFIIs are integral components of the SAGA complex required for nucleosome acetylation and transcription stimulation.
Cell
94:45-53[Medline].
|
| 26.
|
Grant, P. A.,
D. E. Sterner,
L. J. Duggan,
J. L. Workman, and S. L. Berger.
1998.
The SAGA unfolds: convergence of transcription regulators in chromatin-modifying complexes.
Trends Cell. Biol.
8:193-197.
[Medline] |
| 27.
|
Gregory, P. D.,
A. Schmid,
M. Zavari,
L. Liu,
S. L. Berger, and W. Hörz.
1998.
Absence of Gcn5 HAT activity defines a novel state in the opening of chromatin at the PHO5 promoter in yeast.
Mol. Cell
1:495-505[Medline].
|
| 28.
|
Guarente, L.
1995.
Transcriptional coactivators in yeast and beyond.
Trends Biochem. Sci.
20:517-521[Medline].
|
| 29.
|
Hager, G.,
C. Smith,
J. Svaren, and W. Hörz.
1995.
Initiation of expression: remodelling genes, p. 89-103.
In
S. C. R. Elgin (ed.), Chromatin structure and gene expression, vol. 9. IRL Press, Oxford, England.
|
| 30.
|
Hahn, S.,
S. Buratowski,
P. A. Sharp, and L. Guarente.
1989.
Isolation of the gene encoding the yeast TATA binding protein TFIID: a gene identical to the SPT15 suppressor of Ty element insertions.
Cell
58:1173-1181[Medline].
|
| 31.
|
Hampsey, M.
1997.
A review of phenotypes in Saccharomyces cerevisiae.
Yeast
13:1099-1133[Medline].
|
| 32.
|
Harlow, E., and I. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Haynes, S. R.,
C. Dollard,
F. Winston,
S. Beck,
J. Trowsdale, and I. B. Dawid.
1992.
The bromodomain: a conserved sequence found in human, Drosophila and yeast proteins.
Nucleic Acids Res.
20:2603[Free Full Text].
|
| 34.
|
Hebbes, T. R.,
A. L. Clayton,
A. W. Thorne, and C. Crane-Robinson.
1994.
Core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken beta-globin chromosomal domain.
EMBO J.
13:1823-1830[Medline].
|
| 35.
|
Hirschhorn, J. N.,
S. A. Brown,
C. D. Clark, and F. Winston.
1992.
Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure.
Genes Dev.
6:2288-2298[Abstract/Free Full Text].
|
| 36.
|
Horiuchi, J.,
N. Silverman,
G. A. Marcus, and L. Guarente.
1995.
ADA3, a putative transcriptional adaptor, consists of two separable domains and interacts with ADA2 and GCN5 in a trimeric complex.
Mol. Cell. Biol.
15:1203-1209[Abstract].
|
| 37.
|
Horiuchi, J.,
N. Silverman,
B. Piña,
G. A. Marcus, and L. Guarente.
1997.
ADA1, a novel component of the ADA/GCN5 complex, has broader effects than GCN5, ADA2, or ADA3.
Mol. Cell. Biol.
17:3220-3228[Abstract].
|
| 38.
|
Imbalzano, A. N.,
H. Kwon,
M. R. Green, and R. E. Kingston.
1994.
Facilitated binding of TATA-binding protein to nucleosomal DNA.
Nature
370:481-485[Medline].
|
| 39.
|
Ito, T.,
M. Bulger,
M. J. Pazin,
R. Kobayashi, and J. T. Kadonaga.
1997.
ACF, an ISWI-containing and ATP-utilizing chromatin assembly and remodeling factor.
Cell
90:145-155[Medline].
|
| 40.
|
Iyer, V., and K. Struhl.
1996.
Absolute mRNA levels and transcriptional initiation rates in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5208-5212[Abstract/Free Full Text].
|
| 41.
|
Jeanmougin, F.,
J.-M. Wurtz,
B. Le Douarin,
P. Chambon, and R. Losson.
1997.
The bromodomain revisited.
Trends Biochem. Sci.
22:151-153[Medline].
|
| 42.
|
Jeppesen, P., and B. M. Turner.
1993.
The inactive X chromosome in female mammals is distinguished by a lack of histone H4 acetylation, a cytogenetic marker for gene expression.
Cell
74:281-289[Medline].
|
| 43.
|
Kingston, R. E.,
C. A. Bunker, and A. N. Imbalzano.
1996.
Repression and activation by multiprotein complexes that alter chromatin structure.
Genes Dev.
10:905-920[Abstract/Free Full Text].
|
| 44.
|
Kuo, M.-H.,
J. Zhou,
P. Jambeck,
M. E. A. Churchill, and C. D. Allis.
1998.
Histone acetyltransferase activity of yeast Gcn5p is required for the activation of target genes in vivo.
Genes Dev.
12:627-639[Abstract/Free Full Text].
|
| 45.
|
Kwon, H.,
A. N. Imbalzano,
P. A. Khavari,
R. E. Kingston, and M. R. Green.
1994.
Nucleosome disruption and enhancement of activator binding by a human SWI/SNF complex.
Nature
370:477-481[Medline].
|
| 46.
|
Laurent, B. C.,
M. A. Treitel, and M. Carlson.
1990.
The SNF5 protein of Saccharomyces cerevisiae is a glutamine- and proline-rich transcriptional activator that affects expression of a broad spectrum of genes.
Mol. Cell. Biol.
10:5616-5625[Abstract/Free Full Text].
|
| 47.
|
Marcus, G. A.,
J. Horiuchi,
N. Silverman, and L. Guarente.
1996.
ADA5/SPT20 links the ADA and SPT genes, which are involved in yeast transcription.
Mol. Cell. Biol.
16:3197-3205[Abstract].
|
| 48.
|
Marcus, G. A.,
N. Silverman,
S. L. Berger,
J. Horiuchi, and L. Guarente.
1994.
Functional similarity and physical association between GCN5 and ADA2: putative transcriptional adaptors.
EMBO J.
13:4807-4815[Medline].
|
| 49.
|
Mizzen, C. A.,
X.-J. Yang,
T. Kokubo,
J. E. Brownell,
A. J. Bannister,
T. Owen-Hughes,
J. Workman,
L. Wang,
S. L. Berger,
T. Kouzarides,
Y. Nakatani, and C. D. Allis.
1996.
The TAFII250 subunit of TFIID has histone acetyltransferase activity.
Cell
87:1261-1270[Medline].
|
| 50.
|
O'Neill, L. P., and B. M. Turner.
1995.
Histone H4 acetylation distinguishes coding regions of the human genome from heterochromatin in a differentiation-dependent but transcription-independent manner.
EMBO J.
14:3946-3957[Medline].
|
| 51.
|
Ogryzko, V. V.,
R. L. Schlitz,
V. Russanova,
B. H. Howard, and Y. Nakatani.
1996.
The transcriptional coactivators p300 and CBP are histone acetyltransferases.
Cell
87:953-959[Medline].
|
| 52.
|
Owen-Hughes, T.,
R. T. Utley,
J. Côté,
C. L. Peterson, and J. L. Workman.
1996.
Persistent site-specific remodeling of a nucleosome array by transient action of the SWI/SNF complex.
Science
273:513-516[Abstract].
|
| 53.
|
Owen-Hughes, T., and J. L. Workman.
1994.
Experimental analysis of chromatin function in transcription control.
Crit. Rev. Eukaryotic Gene Expr.
4:403-441[Medline].
|
| 54.
|
Ozer, J.,
L. E. Lezina,
J. Ewing,
S. Audi, and P. M. Lieberman.
1998.
Association of transcription factor IIA with TATA binding protein is required for transcriptional activation of a subset of promoters and cell cycle progression in Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:2559-2570[Abstract/Free Full Text].
|
| 55.
|
Paranjape, S. M.,
R. T. Kamakaka, and J. T. Kadonaga.
1994.
Role of chromatin structure in the regulation of transcription by RNA polymerase II.
Annu. Rev. Biochem.
63:265-297[Medline].
|
| 56.
|
Peterson, C. L., and I. Herskowitz.
1992.
Characterization of the yeast SWI1, SWI2, and SWI3 genes, which encode a global activator of transcription.
Cell
68:573-583[Medline].
|
| 57.
|
Piña, B.,
S. Berger,
G. A. Marcus,
N. Silverman,
J. Agapite, and L. Guarente.
1993.
ADA3: a gene, identified by resistance to GAL4-VP16, with properties similar to and different from those of ADA2.
Mol. Cell. Biol.
13:5981-5989[Abstract/Free Full Text].
|
| 58.
|
Pollard, K. J., and C. L. Peterson.
1997.
Role for ADA/GCN5 products in antagonizing chromatin-mediated transcriptional repression.
Mol. Cell. Biol.
17:6212-6222[Abstract].
|
| 59.
|
Roberts, S. M., and F. Winston.
1997.
Essential functional interactions of SAGA, a Saccharomyces cerevisiae complex of Spt, Ada, and Gcn5 proteins, with the Snf/Swi and Srb/mediator complexes.
Genetics
147:451-465[Abstract].
|
| 60.
|
Roberts, S. M., and F. Winston.
1996.
SPT20/ADA5 encodes a novel protein functionally related to the TATA-binding protein and important for transcription in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:3206-3213[Abstract].
|
| 61.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 62.
|
Rothstein, R. J.
1983.
One-step gene disruption in yeast.
Methods Enzymol.
101:202-211[Medline].
|
| 63.
|
Ruiz-García, A. B.,
R. Sendra,
M. Pamblanco, and V. Tordera.
1997.
Gcn5p is involved in the acetylation of histone H3 in nucleosomes.
FEBS Lett.
403:186-190[Medline].
|
| 64.
|
Saleh, A.,
V. Lang,
R. Cook, and C. J. Brandl.
1997.
Identification of native complexes containing the yeast coactivator/repressor proteins NGG1/ADA3 and ADA2.
J. Biol. Chem.
272:5571-5578[Abstract/Free Full Text].
|
| 65.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 66.
|
Scherer, S., and R. W. Davis.
1979.
Replacement of chromosome segments with altered DNA sequences constructed in vitro.
Proc. Natl. Acad. Sci. USA
76:4951-4955[Abstract/Free Full Text].
|
| 67.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 68.
|
Silverman, N.,
J. Agapite, and L. Guarente.
1994.
Yeast ADA2 protein binds to the VP16 protein activation domain and activates transcription.
Proc. Natl. Acad. Sci. USA
91:11665-11668[Abstract/Free Full Text].
|
| 69.
|
Steger, D. J., and J. L. Workman.
1996.
Remodeling chromatin structures for transcription: What happens to the histones?
Bioessays
18:875-884[Medline].
|
| 70.
|
Struhl, K.
1986.
Constitutive and inducible Saccharomyces cerevisiae promoters: evidence for two distinct molecular mechanisms.
Mol. Cell. Biol.
6:3847-3853[Abstract/Free Full Text].
|
| 71.
|
Svaren, J., and W. Hörz.
1996.
Regulation of gene expression by nucleosomes.
Curr. Opin. Genet. Dev.
6:164-170[Medline].
|
| 72.
|
Tamkun, J. W.,
R. Deuring,
M. P. Scott,
M. Kissinger,
A. M. Pattatucci,
T. C. Kaufman, and J. A. Kennison.
1992.
brahma: a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SWI2.
Cell
68:561-572[Medline].
|
| 73.
|
Tsukiyama, T., and C. Wu.
1995.
Purification and properties of an ATP dependent nucleosome remodeling factor.
Cell
83:1011-1020[Medline].
|
| 74.
|
Turner, B. M.,
A. J. Birley, and J. Lavender.
1992.
Histone H4 isoforms acetylated at specific lysine residues define individual chromosomes and chromatin domains in Drosophila polytene nuclei.
Cell
69:375-384[Medline].
|
| 75.
|
Utley, R. T.,
K. Ikeda,
P. A. Grant,
J. Côté,
D. J. Steger,
A. Eberharter,
S. John, and J. L. Workman.
1998.
Transcriptional activators direct histone acetyltransferase complexes to nucleosomes.
Nature
394:498-502[Medline].
|
| 76.
|
Varga-Weisz, P. D.,
M. Wilm,
E. Bonte,
K. Dumas,
M. Mann, and P. B. Becker.
1997.
Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II.
Nature
388:598-602[Medline].
|
| 77.
|
Vettese-Dadey, M.,
P. A. Grant,
T. R. Hebbes,
C. Crane-Robinson,
C. D. Allis, and J. L. Workman.
1996.
Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro.
EMBO J.
15:2508-2518[Medline].
|
| 78.
|
Wang, L.,
L. Liu, and S. L. Berger.
1998.
Critical residues for histone acetylation by GCN5, functioning in Ada and SAGA complexes, are also required for transcriptional function in vivo.
Genes Dev.
12:640-653[Abstract/Free Full Text].
|
| 79.
|
Winston, F.
1992.
Analysis of SPT genes: a genetic approach toward analysis of TFIID, histones, and other transcription factors of yeast, p. 1271-1293.
In
S. L. McKnight, and K. R. Yamamoto (ed.), Transcriptional regulation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 80.
|
Winston, F.,
C. Dollard, and S. L. Ricupero-Hovasse.
1995.
Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C.
Yeast
11:53-55[Medline].
|
| 81.
|
Wolffe, A. P.
1992.
Chromatin: structure and function.
Academic Press, London, England.
|
| 82.
|
Yang, X.-J.,
V. V. Ogryzko,
J. Nishikawa,
B. H. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral E1A oncoprotein.
Nature
382:319-324[Medline].
|
Molecular and Cellular Biology, January 1999, p. 86-98, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jacobson, S., Pillus, L.
(2009). The SAGA Subunit Ada2 Functions in Transcriptional Silencing. Mol. Cell. Biol.
29: 6033-6045
[Abstract]
[Full Text]
-
Sellam, A., Askew, C., Epp, E., Lavoie, H., Whiteway, M., Nantel, A.
(2009). Genome-wide Mapping of the Coactivator Ada2p Yields Insight into the Functional Roles of SAGA/ADA Complex in Candida albicans. Mol. Biol. Cell
20: 2389-2400
[Abstract]
[Full Text]
-
Nagy, Z., Riss, A., Romier, C., le Guezennec, X., Dongre, A. R., Orpinell, M., Han, J., Stunnenberg, H., Tora, L.
(2009). The Human SPT20-Containing SAGA Complex Plays a Direct Role in the Regulation of Endoplasmic Reticulum Stress-Induced Genes. Mol. Cell. Biol.
29: 1649-1660
[Abstract]
[Full Text]
-
Biddick, R. K., Law, G. L., Chin, K. K. B., Young, E. T.
(2008). The Transcriptional Coactivators SAGA, SWI/SNF, and Mediator Make Distinct Contributions to Activation of Glucose-repressed Genes. J. Biol. Chem.
283: 33101-33109
[Abstract]
[Full Text]
-
Helmlinger, D., Marguerat, S., Villen, J., Gygi, S. P., Bahler, J., Winston, F.
(2008). The S. pombe SAGA complex controls the switch from proliferation to sexual differentiation through the opposing roles of its subunits Gcn5 and Spt8. Genes Dev.
22: 3184-3195
[Abstract]
[Full Text]
-
Mohibullah, N., Hahn, S.
(2008). Site-specific cross-linking of TBP in vivo and in vitro reveals a direct functional interaction with the SAGA subunit Spt3. Genes Dev.
22: 2994-3006
[Abstract]
[Full Text]
-
Vernarecci, S., Ornaghi, P., Bagu, A., Cundari, E., Ballario, P., Filetici, P.
(2008). Gcn5p Plays an Important Role in Centromere Kinetochore Function in Budding Yeast. Mol. Cell. Biol.
28: 988-996
[Abstract]
[Full Text]
-
Chekanova, J. A., Abruzzi, K. C., Rosbash, M., Belostotsky, D. A.
(2008). Sus1, Sac3, and Thp1 mediate post-transcriptional tethering of active genes to the nuclear rim as well as to non-nascent mRNP. RNA
14: 66-77
[Abstract]
[Full Text]
-
Liu, X., Vorontchikhina, M., Wang, Y.-L., Faiola, F., Martinez, E.
(2008). STAGA Recruits Mediator to the MYC Oncoprotein To Stimulate Transcription and Cell Proliferation. Mol. Cell. Biol.
28: 108-121
[Abstract]
[Full Text]
-
Laprade, L., Rose, D., Winston, F.
(2007). Characterization of New Spt3 and TATA-Binding Protein Mutants of Saccharomyces cerevisiae: Spt3 TBP Allele-Specific Interactions and Bypass of Spt8. Genetics
177: 2007-2017
[Abstract]
[Full Text]
-
Adkins, M. W., Williams, S. K., Linger, J., Tyler, J. K.
(2007). Chromatin Disassembly from the PHO5 Promoter Is Essential for the Recruitment of the General Transcription Machinery and Coactivators. Mol. Cell. Biol.
27: 6372-6382
[Abstract]
[Full Text]
-
Mutiu, A. I., Hoke, S. M. T., Genereaux, J., Hannam, C., MacKenzie, K., Jobin-Robitaille, O., Guzzo, J., Cote, J., Andrews, B., Haniford, D. B., Brandl, C. J.
(2007). Structure/Function Analysis of the Phosphatidylinositol-3-Kinase Domain of Yeast Tra1. Genetics
177: 151-166
[Abstract]
[Full Text]
-
James, N., Landrieux, E., Collart, M. A.
(2007). A SAGA-Independent Function of SPT3 Mediates Transcriptional Deregulation in a Mutant of the Ccr4-Not Complex in Saccharomyces cerevisiae. Genetics
177: 123-135
[Abstract]
[Full Text]
-
Koehler, R. N., Rachfall, N., Rolfes, R. J.
(2007). Activation of the ADE Genes Requires the Chromatin Remodeling Complexes SAGA and SWI/SNF. Eukaryot Cell
6: 1474-1485
[Abstract]
[Full Text]
-
Bu, P., Evrard, Y. A., Lozano, G., Dent, S. Y. R.
(2007). Loss of Gcn5 Acetyltransferase Activity Leads to Neural Tube Closure Defects and Exencephaly in Mouse Embryos. Mol. Cell. Biol.
27: 3405-3416
[Abstract]
[Full Text]
-
Morris, S. A., Rao, B., Garcia, B. A., Hake, S. B., Diaz, R. L., Shabanowitz, J., Hunt, D. F., Allis, C. D., Lieb, J. D., Strahl, B. D.
(2007). Identification of Histone H3 Lysine 36 Acetylation as a Highly Conserved Histone Modification. J. Biol. Chem.
282: 7632-7640
[Abstract]
[Full Text]
-
Luthra, R., Kerr, S. C., Harreman, M. T., Apponi, L. H., Fasken, M. B., Ramineni, S., Chaurasia, S., Valentini, S. R., Corbett, A. H.
(2007). Actively Transcribed GAL Genes Can Be Physically Linked to the Nuclear Pore by the SAGA Chromatin Modifying Complex. J. Biol. Chem.
282: 3042-3049
[Abstract]
[Full Text]
-
Shukla, A., Bajwa, P., Bhaumik, S. R.
(2006). SAGA-associated Sgf73p facilitates formation of the preinitiation complex assembly at the promoters either in a HAT-dependent or independent manner in vivo. Nucleic Acids Res
34: 6225-6232
[Abstract]
[Full Text]
-
Li, S., Chen, X., Ruggiero, C., Ding, B., Smerdon, M. J.
(2006). Modulation of Rad26- and Rpb9-mediated DNA Repair by Different Promoter Elements. J. Biol. Chem.
281: 36643-36651
[Abstract]
[Full Text]
-
Guelman, S., Suganuma, T., Florens, L., Weake, V., Swanson, S. K., Washburn, M. P., Abmayr, S. M., Workman, J. L.
(2006). The Essential Gene wda Encodes a WD40 Repeat Subunit of Drosophila SAGA Required for Histone H3 Acetylation.. Mol. Cell. Biol.
26: 7178-7189
[Abstract]
[Full Text]
-
Kohler, A., Pascual-Garcia, P., Llopis, A., Zapater, M., Posas, F., Hurt, E., Rodriguez-Navarro, S.
(2006). The mRNA Export Factor Sus1 Is Involved in Spt/Ada/Gcn5 Acetyltransferase-mediated H2B Deubiquitinylation through Its Interaction with Ubp8 and Sgf11. Mol. Biol. Cell
17: 4228-4236
[Abstract]
[Full Text]
-
Fukuda, H., Sano, N., Muto, S., Horikoshi, M.
(2006). Simple histone acetylation plays a complex role in the regulation of gene expression.. Brief Funct Genomic Proteomic
5: 190-208
[Abstract]
[Full Text]
-
Johnsson, A., Xue-Franzen, Y., Lundin, M., Wright, A. P. H.
(2006). Stress-specific role of fission yeast gcn5 histone acetyltransferase in programming a subset of stress response genes.. Eukaryot Cell
5: 1337-1346
[Abstract]
[Full Text]
-
Fish, R. N., Ammerman, M. L., Davie, J. K., Lu, B. F., Pham, C., Howe, L., Ponticelli, A. S., Kane, C. M.
(2006). Genetic Interactions Between TFIIF and TFIIS. Genetics
173: 1871-1884
[Abstract]
[Full Text]
-
Mitra, D., Parnell, E. J., Landon, J. W., Yu, Y., Stillman, D. J.
(2006). SWI/SNF Binding to the HO Promoter Requires Histone Acetylation and Stimulates TATA-Binding Protein Recruitment.. Mol. Cell. Biol.
26: 4095-4110
[Abstract]
[Full Text]
-
Shukla, A., Stanojevic, N., Duan, Z., Sen, P., Bhaumik, S. R.
(2006). Ubp8p, a Histone Deubiquitinase Whose Association with SAGA Is Mediated by Sgf11p, Differentially Regulates Lysine 4 Methylation of Histone H3 In Vivo.. Mol. Cell. Biol.
26: 3339-3352
[Abstract]
[Full Text]
-
Leroy, C., Cormier, L., Kuras, L.
(2006). Independent Recruitment of Mediator and SAGA by the Activator Met4. Mol. Cell. Biol.
26: 3149-3163
[Abstract]
[Full Text]
-
Yu, C., Palumbo, M. J., Lawrence, C. E., Morse, R. H.
(2006). Contribution of the Histone H3 and H4 Amino Termini to Gcn4p- and Gcn5p-mediated Transcription in Yeast. J. Biol. Chem.
281: 9755-9764
[Abstract]
[Full Text]
-
van Oevelen, C. J. C., van Teeffelen, H. A. A. M., van Werven, F. J., Timmers, H. Th. M.
(2006). Snf1p-dependent Spt-Ada-Gcn5-acetyltransferase (SAGA) Recruitment and Chromatin Remodeling Activities on the HXT2 and HXT4 Promoters. J. Biol. Chem.
281: 4523-4531
[Abstract]
[Full Text]
-
Biswas, D., Yu, Y., Mitra, D., Stillman, D. J.
(2006). Genetic Interactions Between Nhp6 and Gcn5 With Mot1 and the Ccr4-Not Complex That Regulate Binding of TATA-Binding Protein in Saccharomyces cerevisiae. Genetics
172: 837-849
[Abstract]
[Full Text]
-
Liu, Y., Xu, X., Singh-Rodriguez, S., Zhao, Y., Kuo, M.-H.
(2005). Histone H3 Ser10 Phosphorylation-Independent Function of Snf1 and Reg1 Proteins Rescues a gcn5- Mutant in HIS3 Expression. Mol. Cell. Biol.
25: 10566-10579
[Abstract]
[Full Text]
-
Martens, J. A., Wu, P.-Y. J., Winston, F.
(2005). Regulation of an intergenic transcript controls adjacent gene transcription in Saccharomyces cerevisiae. Genes Dev.
19: 2695-2704
[Abstract]
[Full Text]
-
Milgrom, E., West, R. W. Jr., Gao, C., Shen, W.-C. W.
(2005). TFIID and Spt-Ada-Gcn5-Acetyltransferase Functions Probed by Genome-wide Synthetic Genetic Array Analysis Using a Saccharomyces cerevisiae taf9-ts Allele. Genetics
171: 959-973
[Abstract]
[Full Text]
-
Carre, C., Szymczak, D., Pidoux, J., Antoniewski, C.
(2005). The Histone H3 Acetylase dGcn5 Is a Key Player in Drosophila melanogaster Metamorphosis. Mol. Cell. Biol.
25: 8228-8238
[Abstract]
[Full Text]
-
Biswas, D., Yu, Y., Prall, M., Formosa, T., Stillman, D. J.
(2005). The Yeast FACT Complex Has a Role in Transcriptional Initiation. Mol. Cell. Biol.
25: 5812-5822
[Abstract]
[Full Text]
-
van Oevelen, C. J. C., van Teeffelen, H. A. A. M., Timmers, H. T. M.
(2005). Differential Requirement of SAGA Subunits for Mot1p and Taf1p Recruitment in Gene Activation. Mol. Cell. Biol.
25: 4863-4872
[Abstract]
[Full Text]
-
Palhan, V. B., Chen, S., Peng, G.-H., Tjernberg, A., Gamper, A. M., Fan, Y., Chait, B. T., La Spada, A. R., Roeder, R. G.
(2005). Polyglutamine-expanded ataxin-7 inhibits STAGA histone acetyltransferase activity to produce retinal degeneration. Proc. Natl. Acad. Sci. USA
102: 8472-8477
[Abstract]
[Full Text]
-
Meng, X., Webb, P., Yang, Y.-F., Shuen, M., Yousef, A. F., Baxter, J. D., Mymryk, J. S., Walfish, P. G.
(2005). E1A and a nuclear receptor corepressor splice variant (N-CoRI) are thyroid hormone receptor coactivators that bind in the corepressor mode. Proc. Natl. Acad. Sci. USA
102: 6267-6272
[Abstract]
[Full Text]
-
Qiu, H., Hu, C., Zhang, F., Hwang, G. J., Swanson, M. J., Boonchird, C., Hinnebusch, A. G.
(2005). Interdependent Recruitment of SAGA and Srb Mediator by Transcriptional Activator Gcn4p. Mol. Cell. Biol.
25: 3461-3474
[Abstract]
[Full Text]
-
Prather, D. M., Larschan, E., Winston, F.
(2005). Evidence that the Elongation Factor TFIIS Plays a Role in Transcription Initiation at GAL1 in Saccharomyces cerevisiae. Mol. Cell. Biol.
25: 2650-2659
[Abstract]
[Full Text]
-
Ingvarsdottir, K., Krogan, N. J., Emre, N. C. T., Wyce, A., Thompson, N. J., Emili, A., Hughes, T. R., Greenblatt, J. F., Berger, S. L.
(2005). H2B Ubiquitin Protease Ubp8 and Sgf11 Constitute a Discrete Functional Module within the Saccharomyces cerevisiae SAGA Complex. Mol. Cell. Biol.
25: 1162-1172
[Abstract]
[Full Text]
-
Larschan, E., Winston, F.
(2005). The Saccharomyces cerevisiae Srb8-Srb11 Complex Functions with the SAGA Complex during Gal4-Activated Transcription. Mol. Cell. Biol.
25: 114-123
[Abstract]
[Full Text]
-
Game, J. C., Williamson, M. S., Baccari, C.
(2005). X-Ray Survival Characteristics and Genetic Analysis for Nine Saccharomyces Deletion Mutants That Show Altered Radiation Sensitivity. Genetics
169: 51-63
[Abstract]
[Full Text]
-
Gao, C., Wang, L., Milgrom, E., Shen, W.-C. W.
(2004). On the Mechanism of Constitutive Pdr1 Activator-mediated PDR5 Transcription in Saccharomyces cerevisiae: EVIDENCE FOR ENHANCED RECRUITMENT OF COACTIVATORS AND ALTERED NUCLEOSOME STRUCTURES. J. Biol. Chem.
279: 42677-42686
[Abstract]
[Full Text]
-
Qi, D., Larsson, J., Mannervik, M.
(2004). Drosophila Ada2b Is Required for Viability and Normal Histone H3 Acetylation. Mol. Cell. Biol.
24: 8080-8089
[Abstract]
[Full Text]
-
Powell, D. W., Weaver, C. M., Jennings, J. L., McAfee, K. J., He, Y., Weil, P. A., Link, A. J.
(2004). Cluster Analysis of Mass Spectrometry Data Reveals a Novel Component of SAGA. Mol. Cell. Biol.
24: 7249-7259
[Abstract]
[Full Text]
-
Eriksson, P., Biswas, D., Yu, Y., Stewart, J. M., Stillman, D. J.
(2004). TATA-Binding Protein Mutants That Are Lethal in the Absence of the Nhp6 High-Mobility-Group Protein. Mol. Cell. Biol.
24: 6419-6429
[Abstract]
[Full Text]
-
Merla, G., Howald, C., Antonarakis, S. E., Reymond, A.
(2004). The subcellular localization of the ChoRE-binding protein, encoded by the Williams-Beuren syndrome critical region gene 14, is regulated by 14-3-3. Hum Mol Genet
13: 1505-1514
[Abstract]
[Full Text]
-
Jacobson, S., Pillus, L.
(2004). Molecular Requirements for Gene Expression Mediated by Targeted Histone Acetyltransferases. Mol. Cell. Biol.
24: 6029-6039
[Abstract]
[Full Text]
-
Warfield, L., Ranish, J. A., Hahn, S.
(2004). Positive and negative functions of the SAGA complex mediated through interaction of Spt8 with TBP and the N-terminal domain of TFIIA. Genes Dev.
18: 1022-1034
[Abstract]
[Full Text]
-
Fan, Q., An, L., Cui, L.
(2004). Plasmodium falciparum Histone Acetyltransferase, a Yeast GCN5 Homologue Involved in Chromatin Remodeling. Eukaryot Cell
3: 264-276
[Abstract]
[Full Text]
-
Stebbins, J. L., Triezenberg, S. J.
(2004). Identification, Mutational Analysis, and Coactivator Requirements of Two Distinct Transcriptional Activation Domains of the Saccharomyces cerevisiae Hap4 Protein. Eukaryot Cell
3: 339-347
[Abstract]
[Full Text]
-
Boukaba, A., Georgieva, E. I., Myers, F. A., Thorne, A. W., Lopez-Rodas, G., Crane-Robinson, C., Franco, L.
(2004). A Short-range Gradient of Histone H3 Acetylation and Tup1p Redistribution at the Promoter of the Saccharomyces cerevisiae SUC2 Gene. J. Biol. Chem.
279: 7678-7684
[Abstract]
[Full Text]
-
Buryskova, M., Pospisek, M., Grothey, A., Simmet, T., Burysek, L.
(2004). Intracellular Interleukin-1{alpha} Functionally Interacts with Histone Acetyltransferase Complexes. J. Biol. Chem.
279: 4017-4026
[Abstract]
[Full Text]
-
Bhaumik, S. R., Raha, T., Aiello, D. P., Green, M. R.
(2004). In vivo target of a transcriptional activator revealed by fluorescence resonance energy transfer. Genes Dev.
18: 333-343
[Abstract]
[Full Text]
-
Daniel, J. A., Torok, M. S., Sun, Z.-W., Schieltz, D., Allis, C. D., Yates, J. R. III, Grant, P. A.
(2004). Deubiquitination of Histone H2B by a Yeast Acetyltransferase Complex Regulates Transcription. J. Biol. Chem.
279: 1867-1871
[Abstract]
[Full Text]
-
EMRE, N.C.T., BERGER, S.L.
(2004). Histone H2B Ubiquitylation and Deubiquitylation in Genomic Regulation. Cold Spring Harb Symp Quant Biol
69: 289-300
[Abstract]
-
Yoon, S., Qiu, H., Swanson, M. J., Hinnebusch, A. G.
(2003). Recruitment of SWI/SNF by Gcn4p Does Not Require Snf2p or Gcn5p but Depends Strongly on SWI/SNF Integrity, SRB Mediator, and SAGA. Mol. Cell. Biol.
23: 8829-8845
[Abstract]
[Full Text]
-
De Wulf, P., McAinsh, A. D., Sorger, P. K.
(2003). Hierarchical assembly of the budding yeast kinetochore from multiple subcomplexes. Genes Dev.
17: 2902-2921
[Abstract]
[Full Text]
-
Topalidou, I., Papamichos-Chronakis, M., Thireos, G.
(2003). Post-TATA Binding Protein Recruitment Clearance of Gcn5-Dependent Histone Acetylation within Promoter Nucleosomes. Mol. Cell. Biol.
23: 7809-7817
[Abstract]
[Full Text]
-
Henry, K. W., Wyce, A., Lo, W.-S., Duggan, L. J., Emre, N.C. T., Kao, C.-F., Pillus, L., Shilatifard, A., Osley, M. A., Berger, S. L.
(2003). Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8. Genes Dev.
17: 2648-2663
[Abstract]
[Full Text]
-
Meng, X., Yang, Y.-F., Cao, X., Govindan, M. V., Shuen, M., Hollenberg, A. N., Mymryk, J. S., Walfish, P. G.
(2003). Cellular Context of Coregulator and Adaptor Proteins Regulates Human Adenovirus 5 Early Region 1A-Dependent Gene Activation by the Thyroid Hormone Receptor. Mol. Endocrinol.
17: 1095-1105
[Abstract]
[Full Text]
-
Barbaric, S., Reinke, H., Horz, W.
(2003). Multiple Mechanistically Distinct Functions of SAGA at the PHO5 Promoter. Mol. Cell. Biol.
23: 3468-3476
[Abstract]
[Full Text]
-
Swanson, M. J., Qiu, H., Sumibcay, L., Krueger, A., Kim, S.-j., Natarajan, K., Yoon, S., Hinnebusch, A. G.
(2003). A Multiplicity of Coactivators Is Required by Gcn4p at Individual Promoters In Vivo. Mol. Cell. Biol.
23: 2800-2820
[Abstract]
[Full Text]
-
Yu, Y., Eriksson, P., Bhoite, L. T., Stillman, D. J.
(2003). Regulation of TATA-Binding Protein Binding by the SAGA Complex and the Nhp6 High-Mobility Group Protein. Mol. Cell. Biol.
23: 1910-1921
[Abstract]
[Full Text]
-
Remboutsika, E., Yamamoto, K., Harbers, M., Schmutz, M.
(2002). The Bromodomain Mediates Transcriptional Intermediary Factor 1alpha -Nucleosome Interactions. J. Biol. Chem.
277: 50318-50325
[Abstract]
[Full Text]
-
Pray-Grant, M. G., Schieltz, D., McMahon, S. J., Wood, J. M., Kennedy, E. L., Cook, R. G., Workman, J. L., Yates III, J. R., Grant, P. A.
(2002). The Novel SLIK Histone Acetyltransferase Complex Functions in the Yeast Retrograde Response Pathway. Mol. Cell. Biol.
22: 8774-8786
[Abstract]
[Full Text]
-
Hall, D. B., Struhl, K.
(2002). The VP16 Activation Domain Interacts with Multiple Transcriptional Components as Determined by Protein-Protein Cross-linking in Vivo. J. Biol. Chem.
277: 46043-46050
[Abstract]
[Full Text]
-
Bhaumik, S. R., Green, M. R.
(2002). Differential Requirement of SAGA Components for Recruitment of TATA-Box-Binding Protein to Promoters In Vivo. Mol. Cell. Biol.
22: 7365-7371
[Abstract]
[Full Text]
-
Sterner, D. E., Belotserkovskaya, R., Berger, S. L.
(2002). SALSA, a variant of yeast SAGA, contains truncated Spt7, which correlates with activated transcription. Proc. Natl. Acad. Sci. USA
99: 11622-11627
[Abstract]
[Full Text]
-
Wu, P.-Y. J., Winston, F.
(2002). Analysis of Spt7 Function in the Saccharomyces cerevisiae SAGA Coactivator Complex. Mol. Cell. Biol.
22: 5367-5379
[Abstract]
[Full Text]
-
Desmoucelles, C., Pinson, B., Saint-Marc, C., Daignan-Fornier, B.
(2002). Screening the Yeast "Disruptome" for Mutants Affecting Resistance to the Immunosuppressive Drug, Mycophenolic Acid. J. Biol. Chem.
277: 27036-27044
[Abstract]
[Full Text]
-
Ricci, A. R., Genereaux, J., Brandl, C. J.
(2002). Components of the SAGA Histone Acetyltransferase Complex Are Required for Repressed Transcription of ARG1 in Rich Medium. Mol. Cell. Biol.
22: 4033-4042
[Abstract]
[Full Text]
-
Laprade, L., Boyartchuk, V. L., Dietrich, W. F., Winston, F.
(2002). Spt3 Plays Opposite Roles in Filamentous Growth in Saccharomyces cerevisiae and Candida albicans and Is Required for C. albicans Virulence. Genetics
161: 509-519
[Abstract]
[Full Text]
-
Kirschner, D. B., vom Baur, E., Thibault, C., Sanders, S. L., Gangloff, Y.-G., Davidson, I., Weil, P. A., Tora, L.
(2002). Distinct Mutations in Yeast TAFII25 Differentially Affect the Composition of TFIID and SAGA Complexes as Well as Global Gene Expression Patterns. Mol. Cell. Biol.
22: 3178-3193
[Abstract]
[Full Text]
-
Morillon, A., Benard, L., Springer, M., Lesage, P.
(2002). Differential Effects of Chromatin and Gcn4 on the 50-Fold Range of Expression among Individual Yeast Ty1 Retrotransposons. Mol. Cell. Biol.
22: 2078-2088
[Abstract]
[Full Text]
-
Sterner, D. E., Wang, X., Bloom, M. H., Simon, G. M., Berger, S. L.
(2002). The SANT Domain of Ada2 Is Required for Normal Acetylation of Histones by the Yeast SAGA Complex. J. Biol. Chem.
277: 8178-8186
[Abstract]
[Full Text]
-
Howe, L., Auston, D., Grant, P., John, S., Cook, R. G., Workman, J. L., Pillus, L.
(2001). Histone H3 specific acetyltransferases are essential for cell cycle progression. Genes Dev.
15: 3144-3154
[Abstract]
[Full Text]
-
Durso, R. J., Fisher, A. K., Albright-Frey, T. J., Reese, J. C.
(2001). Analysis of TAF90 Mutants Displaying Allele-Specific and Broad Defects in Transcription. Mol. Cell. Biol.
21: 7331-7344
[Abstract]
[Full Text]
-
Martinez, E., Palhan, V. B., Tjernberg, A., Lymar, E. S., Gamper, A. M., Kundu, T. K., Chait, B. T., Roeder, R. G.
(2001). Human STAGA Complex Is a Chromatin-Acetylating Transcription Coactivator That Interacts with Pre-mRNA Splicing and DNA Damage-Binding Factors In Vivo. Mol. Cell. Biol.
21: 6782-6795
[Abstract]
[Full Text]
-
Kirchner, J., Sanders, S. L., Klebanow, E., Weil, P. A.
(2001). Molecular Genetic Dissection of TAF25, an Essential Yeast Gene Encoding a Subunit Shared by TFIID and SAGA Multiprotein Transcription Factors. Mol. Cell. Biol.
21: 6668-6680
[Abstract]
[Full Text]
-
Bhaumik, S. R., Green, M. R.
(2001). SAGA is an essential in vivo target of the yeast acidic activator Gal4p. Genes Dev.
15: 1935-1945
[Abstract]
[Full Text]
-
Larschan, E., Winston, F.
(2001). The S. cerevisiae SAGA complex functions in vivo as a coactivator for transcriptional activation by Gal4. Genes Dev.
15: 1946-1956
[Abstract]
[Full Text]
-
Manning, E. T., Ikehara, T., Ito, T., Kadonaga, J. T., Kraus, W. L.
(2001). p300 Forms a Stable, Template-Committed Complex with Chromatin: Role for the Bromodomain. Mol. Cell. Biol.
21: 3876-3887
[Abstract]
[Full Text]
-
Denis, C. L., Chiang, Y.-C., Cui, Y., Chen, J.
(2001). Genetic Evidence Supports a Role for the Yeast CCR4-NOT Complex in Transcriptional Elongation. Genetics
158: 627-634
[Abstract]
[Full Text]
-
Gangloff, Y.-G., Sanders, S. L., Romier, C., Kirschner, D., Weil, P. A., Tora, L., Davidson, I.
(2001). Histone Folds Mediate Selective Heterodimerization of Yeast TAFII25 with TFIID Components yTAFII47 and yTAFII65 and with SAGA Component ySPT7. Mol. Cell. Biol.
21: 1841-1853
[Abstract]
[Full Text]
-
Schultz, D. C., Friedman, J. R., Rauscher, F. J. III
(2001). Targeting histone deacetylase complexes via KRAB-zinc finger proteins: the PHD and bromodomains of KAP-1 form a cooperative unit that recruits a novel isoform of the Mi-2{alpha} subunit of NuRD. Genes Dev.
15: 428-443
[Abstract]
[Full Text]
-
Suter, B., Schnappauf, G., Thoma, F.
(2000). Poly(dA{middle dot}dT) sequences exist as rigid DNA structures in nucleosome-free yeast promoters in vivo. Nucleic Acids Res
28: 4083-4089
[Abstract]
[Full Text]
-
Chen, Z., Manley, J. L.
(2000). Robust mRNA Transcription in Chicken DT40 Cells Depleted of TAFII31 Suggests Both Functional Degeneracy and Evolutionary Divergence. Mol. Cell. Biol.
20: 5064-5076
[Abstract]
[Full Text]
-
Sterner, D. E., Berger, S. L.
(2000). Acetylation of Histones and Transcription-Related Factors. Microbiol. Mol. Biol. Rev.
64: 435-459
[Abstract]
[Full Text]
-
Kuras, L., Kosa, P., Mencia, M., Struhl, K.
(2000). TAF-Containing and TAF-Independent Forms of Transcriptionally Active TBP in Vivo. Science
288: 1244-1248
[Abstract]
[Full Text]
-
John, S., Howe, L., Tafrov, S. T., Grant, P. A., Sternglanz, R., Workman, J. L.
(2000). The Something About Silencing protein, Sas3, is the catalytic subunit of NuA3, a yTAFII30-containing HAT complex that interacts with the Spt16 subunit of the yeast CP (Cdc68/Pob3)-FACT complex. Genes Dev.
14: 1196-1208
[Abstract]
[Full Text]
-
Anafi, M., Yang, Y.-F., Barlev, N. A., Govindan, M. V., Berger, S. L., Butt, T. R., Walfish, P. G.
(2000). GCN5 and ADA Adaptor Proteins Regulate Triiodothyronine/GRIP1 and SRC-1 Coactivator-Dependent Gene Activation by the Human Thyroid Hormone Receptor. Mol. Endocrinol.
14: 718-732
[Abstract]
[Full Text]
-
Matangkasombut, O., Buratowski, R. M., Swilling, N. W., Buratowski, S.
(2000). Bromodomain factor 1 corresponds to a missing piece of yeast TFIID. Genes Dev.
14: 951-962
[Abstract]
[Full Text]
-
Yu, Y., Eriksson, P., Stillman, D. J.
(2000). Architectural Transcription Factors and the SAGA Complex Function in Parallel Pathways To Activate Transcription. Mol. Cell. Biol.
20: 2350-2357
[Abstract]
[Full Text]
-
Ha, N., Hellauer, K., Turcotte, B.
(2000). Fusions with histone H3 result in highly specific alteration of gene expression. Nucleic Acids Res
28: 1026-1035
[Abstract]
[Full Text]
-
Welihinda, A. A., Tirasophon, W., Kaufman, R. J.
(2000). The Transcriptional Co-activator ADA5 Is Required for HAC1 mRNA Processing in Vivo. J. Biol. Chem.
275: 3377-3381
[Abstract]
[Full Text]
-
Belotserkovskaya, R., Sterner, D. E., Deng, M., Sayre, M. H., Lieberman, P. M., Berger, S. L.
(2000). Inhibition of TATA-Binding Protein Function by SAGA Subunits Spt3 and Spt8 at Gcn4-Activated Promoters. Mol. Cell. Biol.
20: 634-647
[Abstract]
[Full Text]
-
Gangloff, Y.-G., Werten, S., Romier, C., Carré, L., Poch, O., Moras, D., Davidson, I.
(2000). The Human TFIID Components TAFII135 and TAFII20 and the Yeast SAGA Components ADA1 and TAFII68 Heterodimerize to Form Histone-Like Pairs. Mol. Cell. Biol.
20: 340-351
[Abstract]
[Full Text]
Top
Abstract
Introduction
