INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

In most organisms, telomeric DNA is composed of simple short repeat sequences which show a strand bias such that there is a G-biased strand (G strand) and a complementary C-biased strand (C strand) (25). This double-stranded repeat sequence is bound in vivo by factors such as Rap1p in Saccharomyces cerevisiae (29) and TRF1 and TRF2 in humans (4, 47, 53), which are important for the regulation of telomere repeat length, the formation of telomeric chromatin, and the integrity of individual chromosome ends. Early sequencing of ciliate telomeres indicated that the G strand extends beyond the C strand, creating a single-stranded (ss) 3' overhang of 12 to 16 bases which persists throughout the vegetative life cycle of the organism (18, 22). In contrast, in S. cerevisiae, longer G-strand overhangs that are more variable in length have been detected during late S phase, the cell cycle phase during which telomeres replicate (50). Even longer G-strand overhangs (200 ± 75 nucleotides) have been detected in humans (51). Thus, although they can be quite variable in length, the 3' ss overhang structure at telomeres has been conserved in different eukaryotic kingdoms.

Unique factors associate with the 3' ss telomeric overhang. Telomeric ss-G-strand binding proteins have been isolated and cloned from Oxytricha nova (42), Euplotes crassus (41), Tetrahymena thermophila (46), and Xenopus laevis (8). The Oxytricha and Euplotes ss-G-strand binding proteins remain bound to telomeric DNA in the presence of extremely high salt concentrations (up to 2 M NaCl) (41, 43). In contrast, telomere-binding proteins from other organisms are salt sensitive (46). Two yeast proteins, Est1p (48) and Cdc13p (16, 35), specifically associate with the yeast ss G strand in vitro, and mutations in these proteins affect telomere function in vivo. Heterogeneous nuclear ribonucleoproteins (hnRNPs) associate with RNA and play a variety of roles in RNA metabolism (reviewed in reference 49). hnRNPs A1, A2/B1, D, and E bind ss-G-strand overhang DNA in vitro, although they associate more tightly with RNA of the cognate sequence (20, 31). Recently, hnRNP A1 was shown to be essential for the maintenance of telomere length in a mouse cell line, and UP1, a truncated derivative of hnRNP A1, was shown to interact with telomerase in a cell extract (26), suggesting that hnRNP A1 acts both as a telomere-binding protein and as a splice site selection factor in vivo.

The G-strand binding protein of Chlamydomonas reinhardtii (Gbp1p) was identified and cloned on the basis of its ability to specifically associate with ssDNA containing the G-strand telomere repeat sequence (37, 38), and thus we have classified Gbp1p as a putative telomere-binding protein. RLF6 is the S. cerevisiae gene most similar to GBP1. Rlf6p binds ssDNA containing the Saccharomyces telomere repeat sequence in vitro (24, 28). Mutation of RLF6 alters the subnuclear localization of the double-stranded (ds) telomere-binding protein Rap1p but does not change other telomere-associated phenotypes (24). Gbp1p functionally complements rlf6 mutations: expression of this Chlamydomonas protein in rlf6 strains restores the subnuclear localization of Rap1p (24).

Gbp1p contains two RNA recognition motifs (RRMs) separated by a glycine-rich domain (38), an arrangement commonly found in human hnRNPs. RRMs are domains of approximately 80 to 100 amino acids (aa) that usually include at least one of two RNP consensus sequences (21), RNP-1 (K/R G F/Y G/A F V X F/Y) and RNP-2 (L/I F/Y V/I G/K N/G L/M) (5). The best-studied RRM-containing protein is hnRNP A1, an abundant nuclear protein which is important for splice site selection (7, 11). hnRNP A1 contains two RRM domains at its amino terminus and a glycine-rich domain at its carboxyl terminus. Each of the RRM domains independently binds either RNA or ssDNA but preferentially binds RNA (10, 32, 34). The conserved phenylalanines at position 5 in the RNP-1 consensus sequences of hnRNP A1 can be photochemically cross-linked to bound RNA (32), indicating a close association between this residue and the substrate. The glycine-rich domain of hnRNP A1 is sufficient for homodimerization or heterodimerization with other hnRNPs in vitro and in vivo (9).

Although most RRM-containing proteins clearly bind RNA with higher affinity than they bind DNA (49), at least one RRM-containing protein appears to preferentially bind DNA. Stage-specific activator protein 1 (SSAP-1) is a transcriptional activator of the sea urchin late histone H1 gene (12). The two RRM motifs of SSAP-1 are required for its association with either ss- or dsDNA but have little affinity for the cognate RNA molecule (12).

In this study, we investigated Gbp1p, a putative telomere end-binding protein from C. reinhardtii which contains two nonconsensus RRM domains and which binds ss telomeric DNA but not ds telomeric DNA (38). Despite the fact that a phenylalanine at position 5 in the RNP-1 consensus has been shown to have an important role in substrate binding, we found that mutation of the two RNP-1 motifs to match the conserved sequence had no measurable effect on the ability of Gbp1p to bind ssDNA or RNA or to discriminate between the two nucleic acids. We determined the specific sequence within the Chlamydomonas telomeric repeat sequence that is bound by Gbp1p. We found that monomeric Gbp1p binds either ss telomeric DNA or the cognate RNA sequence but has a small binding preference for RNA. In sharp contrast, dimeric Gbp1p associates with ssDNA with high affinity and binds RNA with much lower affinity. To the best of our knowledge, this is the first example of a protein that qualitatively changes its nucleic acid binding preference upon dimerization.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Plasmids. Plasmid pTrpE-Gbp1p (38) contains the Gbp1p coding sequence subcloned into pATH11 (23) so that it is fused with the TrpE open reading frame and is tryptophan inducible. This plasmid (also called pTrpE-IGIIC) was used as a starting point for construction of the deletion and point mutants of GBP1. pTrpE-IGII (aa 1 to 224) was made by subcloning the EcoRI-to-SacI fragment of pTrpE-GBP1 into pATH11. Similarly, pTrpE-IG (aa 1 to 144) contains the EcoRI-to-PstI fragment of pTrpE-GBP1 in pATH11, pTrpE-GIIC (aa 90 to 237) contains the Bpu1102I-to-EcoRI fragment of pTrpE-GBP1 in pATH11, and pTrpE-GII (aa 90 to 224) contains the Bpu1102I-to-SacI fragment of pTrpE-GBP1 in pATH11. pTrpE-I^FGIIC and pTrpE-IGII^FC, which contain the mutations at positions 71 (substitution of phenylalanine for isoleucine) and 203 (substitution of phenylalanine for tyrosine), respectively, were constructed by using the oligonucleotides AAACTCCACGAAACCCCAGCC and GAACTTGACGAAGCCGTAGCC to mutagenize pTrpE-GBP1 essentially as described elsewhere (1). The double-mutant plasmid (pTrpE-I^FGII^FC) was assembled from the two single-mutant plasmids by using the PstI site.

Protein preparation and analysis. (i) Extract preparation. TrpE fusion proteins were expressed in Escherichia coli RR1 cells, extracts were prepared as described elsewhere (23) and then stored at 20°C. Most of the fusion protein was present in the insoluble fraction, but the soluble fusion protein was sufficient for purification and analysis. Chlamydomonas protein extracts were prepared essentially as described previously (38). Briefly, cells were disrupted by vortexing with glass beads at 4°C in a solution containing 20 mM HEPES (pH 7.4), 50 mM NaCl, 1 mM EDTA, 5% glycerol, 1 mM dithiothreitol (DTT), and 0.1 mM phenylmethylsulfonyl fluoride (PMSF), and debris was removed by centrifugation. Gbp1p activity was stable at 20°C for at least 6 months and survived multiple freeze-thaw cycles. The total protein concentration was determined by the Bradford assay (Bio-Rad). Approximately 1 µg of total protein was used in each binding assay except where otherwise indicated.

(ii) Immunoaffinity purification. A 500-µl portion of TrpE fusion protein extract or 500 µg of Chlamydomonas protein was mixed with 50 µg of polyclonal anti-Gbp1p in a solution consisting of 20 mM Tris-HCl (pH 8.0), 350 mM NaCl, 1 mM EDTA, 0.1% Nonidet P-40 (NP-40), and 0.1 mM PMSF. Complexes were allowed to form on ice for 1 h prior to the addition of 80 µl of protein A-agarose suspension (Santa Cruz Biotechnology). The suspension was mixed for 1 h at 4°C, and the beads were washed three times with 1 ml of chilled binding buffer. Gbp1p was eluted from the beads by two successive washed with 0.5 ml of a solution containing 100 mM glycine (pH 11.0), 2 M NaCl, 10 mM DTT, 1 mM EDTA, and 0.1 mM PMSF at room temperature (5 min each). Eluates were dialyzed against 200 ml of a buffer consisting of 20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, 50% glycerol, and 0.1 mM PMSF at 4°C overnight and then stored at 20°C.

(iii) DNA affinity purification. A 500-µg portion of Chlamydomonas protein or 500 µl of TrpE fusion protein extract was mixed with 5 µg of the oligonucleotide (TTTTAGGG)₄ with a biotin molecule covalently attached to the 5' end (Integrated DNA Technologies, Inc.) in 1 ml of buffer (20 mM HEPES [pH 7.4], 50 mM NaCl, 1 mM EDTA, 5% glycerol, 0.05% NP-40). After incubation of the mixture on ice for 30 min, 150 µl of immobilized streptavidin (Boehringer Mannheim) was added, and the resulting suspension was shaken for 1 h at 4°C. The beads were washed three times with 1 ml of ice-cold binding buffer, and Gbp1p was eluted from the beads by two successive washes with 200 µl of a solution containing 20 mM Tris-HCl (pH 8.0), 1 M NaCl, 1 mM EDTA, 5% glycerol, and 0.05% NP-40 at room temperature (10 min each). Eluates were dialyzed against 200 ml of a buffer consisting of 20 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, 50% glycerol, and 0.1 mM PMSF at 4°C overnight and then stored at 20°C. DNA affinity purification was found to yield more protein activity than immunoaffinity purification. To obtain higher concentrations of the fusion protein for the experiment shown in Fig. 5, the protocol was scaled up fivefold and the dialyzed protein was redialyzed against solid polyvinylpyrrolidone (molecular weight, 40,000) at 4°C for 2 h to further concentrate it and then stored at 20°C.

(iv) Protein analysis. Prior to being subjected to immunoblotting, proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 10% gels, transferred to a polyvinylidene difluoride membrane, and blocked with 1% nonfat dry milk. Anti-Gbp1p serum at a dilution of 1:5,000 was used to probe the membrane, and protein was detected by enhanced chemiluminescence or chemofluorescence (Amersham). The anti-Gbp1p serum reacted with only one protein in the Chlamydomonas cell extract. Ammoniacal silver staining was performed as described elsewhere (1). Unstained Mark-12 protein markers (Novex) were used for the precise determination of molecular mass.

Nucleic acid binding assays. (i) Electrophoretic mobility shift assays (EMSAs). Protein extracts or purified proteins were mixed with 1 ng of 5' ³²P-end-labeled oligonucleotide and competitors in 20 µl of buffer (10 mM Tris-HCl [pH 8.0], 50 mM NaCl, 1.25 mM MgCl₂, 0.125 mM EDTA, 1 mM DTT, 6% glycerol, 0.125% NP-40, 2% Ficoll [final concentrations]). Inclusion of a nonspecific competitor [either E. coli DNA or poly (dI-dC)] had no affect on the assay when either purified protein or crude cell extract was used. Protein and nucleic acid preparations were incubated for 15 min on ice and then for 15 min at room temperature before being loaded on either a 4% or a 5% native polyacrylamide gel (30:1 acrylamide/bisacrylamide) in 0.5× Tris-borate-EDTA (TBE). Complexes were separated in 0.5× TBE at 4°C and 150 V for 2.5 h. The gels were dried and exposed to film or analyzed with a PhosphorImager (Storm 840; Molecular Dynamics).

(ii) Cross-linking. Protein extract was mixed with 1 ng of 5' ³²P-end-labeled oligonucleotide and competitor in 10 µl of buffer (20 mM HEPES [pH 7.4], 50 mM NaCl, 1 mM EDTA, 5% glycerol, 0.05% NP-40 [final concentrations]). The mixture was incubated on ice for five min before the addition of 1 µl of 10% formaldehyde, and cross-linking was allowed to proceed at room temperature for 20 min. SDS loading buffer (5 µl) was added to each sample, and the complexes were resolved by SDS-PAGE through 10% polyacrylamide gels. The gels were fixed for 5 min in 10% acetic acid-10% methanol before being dried and exposed to film or analyzed with a PhosphorImager. Inclusion of a nonspecific competitor [either E. coli DNA or poly(dI-dC)] had no effect on the assay. To elute cross-linked bands from the gel, the reaction was scaled up 10-fold and the product was electrophoresed through a gel with wide lanes. The wet, unfixed gel was exposed to film overnight with orientation markers, and the three complexes were excised from the gel with a razor blade. Protein-DNA complexes were electroeluted from the gel slices into dialysis tubing in 0.5× TBE for 15 min at 100 V and 4°C and recovered by precipitation with 4 volumes of cold acetone and 10 µg of bovine serum albumin per sample as a carrier. The pellet was resuspended, and either the cross-linking was reversed by incubation at 65°C for 4 h followed by immunoblotting (see Fig. 5A) or the complexes were digested with protease (see Fig. 5B). Complexes were digested with 0, 0.8, or 16 ng of proteinase K (Boehringer Mannheim) in a solution containing 20 mM HEPES (pH 7.4), 50 mM NaCl, 1 mM EDTA, and 5% glycerol at 37°C for 20 min. Immediately after digestion, the samples were electrophoresed through an SDS-16% polyacrylamide gel that was processed for autoradiography as described above.

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

Analysis of the RNP-1 octads of Gbp1p. RNP-1 octads contain a highly conserved phenylalanine residue at position 5 (F5) (5) that has been photochemically cross-linked to bound RNA (32), suggesting that this residue either contacts or is very close to the RNA. One of the striking features of Gbp1p is that neither RRM-I nor RRM-II matches the consensus at this site (38). This difference from the consensus sequence also occurs in the Saccharomyces proteins Rlf6p, Nsr1p, and Tom34p, which suggests that these proteins can be grouped as a subfamily of RRM-containing proteins lacking F5 (24). Most RRM-containing proteins associate with RNA, but members of this subfamily lacking F5 have been shown to preferentially associate with ssDNA. Gbp1p in a whole-cell extract preferentially associates with telomeric G-strand ssDNA and not with the cognate RNA sequence (38). Rlf6p and Nsr1p bind telomeric G-strand ssDNA (24, 28). Thus, we hypothesized that the lack of F5 in RNP-1 might account for the unusual binding specificity of Gbp1p and perhaps of the subfamily in general. To test this hypothesis, GBP1 was subcloned into pATH11 to construct a plasmid that directs the production of a TrpE-Gbp1p fusion protein in E. coli (TrpE-IGIIC). We first confirmed that TrpE-IGIIC could be stably expressed and immunopurified from E. coli. TrpE-IGIIC specifically bound Chlamydomonas telomeric ssDNA (data not shown), demonstrating that no eukaryote-specific posttranslational modifications or auxillary proteins are required for this association. Additionally, we noted that TrpE-Gbp1p was remarkably heat stable (incubation at 65°C for 10 min resulted in less than a 20% reduction in binding activity [data not shown]) and that the TrpE-Gbp1p-ssDNA complex (unlike ciliate telomere-binding proteins [41, 43]) was highly sensitive to the NaCl concentration (diminishing greatly at NaCl concentrations above 200 mM [data not shown]). We constructed plasmids directing the expression of fusion proteins in which position 5 of the RNPs were mutated to phenylalanine in RRM-I (TrpE-I^FGIIC), RRM-II (TrpE-IGII^FC), or in both RRMs (TrpE-I^FGII^FC) (Fig. 1A). These fusion proteins were expressed in E. coli by tryptophan starvation and purified by immunoaffinity chromatography with a polyclonal anti-Gbp1p serum. All proteins were stable in E. coli and were analyzed qualitatively and quantitatively by immunoblotting with anti-Gbp1p serum (Fig. 1B).

View larger version (28K): [in this window] [in a new window]   FIG. 1.   Gbp1p with point mutations in one or both RNP-1 motifs. (A) Schematic representation of the two single mutants and one double mutant of Gbp1p as TrpE fusion proteins. The fifth residue in one or both of the RNP motifs was mutated to a phenylalanine to match the RNP-1 consensus sequence. (B) Immunoblot of the wild-type and point-mutant TrpE-Gbp1p proteins. The fusion proteins were produced in E. coli, purified by immunoaffinity chromatography, and detected with anti-Gbp1p serum. The upper band (arrow) is the predicted size for the TrpE-Gbp1p fusion; the lower band is likely a breakdown product, and its quantity differed among preparations (compare with Fig. 7B).

View larger version (33K): [in this window] [in a new window]   FIG. 2.   Point mutations in the RNP-1 motifs do not affect the association of Gbp1p with ssDNA or RNA either quantitatively or qualitatively. (A) Wild-type and point-mutant proteins shown in Fig. 1A were analyzed by EMSA with radiolabeled dCG3 as a probe. The arrow indicates the major protein-DNA complex. (B) Wild-type and point-mutant proteins were analyzed by EMSA with radiolabeled r(UUUUAGGG)3 rCG3 as a probe. The arrow indicates the major protein-RNA complex. (C) Wild-type and point-mutant TrpE-Gbp1p fusion protein or Gbp1p isolated from a Chlamydomonas extract by immunoaffinity chromatography (C.r. Gbp1p) was used in an EMSA with radiolabeled dCG3. Increasing amounts of unlabeled dCG3 (squares) or rCG3 (diamonds) were added to compete with the complexes. Complexes were quantitated by PhosphorImager analysis, and the data were normalized to the amount of complex present in the absence of competitor and plotted.

Gbp1p and ssDNA form three distinct complexes. Another possible explanation for the difference between the results of Petracek et al. (38) and those shown in Fig. 2 is that different amounts of protein were used. To begin to address this possibility, EMSAs were performed with a range of crude Chlamydomonas extract concentrations (Fig. 3). As the protein concentration increased, three distinct complexes were observed, and the relative abundance of each complex changed with increasing protein-to-probe ratio. The relative abundance of the uppermost complex varied from experiment to experiment. At high protein concentrations, only one complex was observed. Because the original characterization of Gbp1p was performed at very high protein concentrations (>10 µg of total protein per assay) (38), it was the binding characteristics of this one complex that were reported.

View larger version (70K): [in this window] [in a new window]   FIG. 3.   Three forms of Gbp1p-ssDNA complex exist within an extract. Increasing amounts of a Chlamydomonas whole-cell extract were incubated with 1 ng of radiolabeled dCG3 and analyzed by EMSA. The three complexes detected can each be alleviated via competition by unlabeled dCG3, and all contain Gbp1p as determined by an EMSA-immunoblot (data not shown). A model to explain the three complexes that is consistent with the observed concentration-dependent transitions between the complexes is presented on the right.

Gbp1p dimers have a strong preference for ssDNA, and Gbp1p monomers have a weak preference for RNA. To investigate the possibility that the different isoforms of Gbp1p in Fig. 3 associate differently with RNA and ssDNA, we performed competition experiments with labeled dCG3 and either unlabeled dCG3 or unlabeled rCG3. We performed this experiment at a concentration of Chlamydomonas extract at which the putative Gbp1p monomer and Gbp1p dimer complexes were clearly visible in an EMSA (Fig. 4A). In this experiment, the most slowly migrating band (seen in Fig. 3) was not readily visible, although in other experiments this complex was observed and its binding affinity was similar to that of the intermediate complex. The putative Gbp1p monomer and dimer complexes responded similarly to the addition of the ssDNA competitor (Fig. 4A, lanes 7 to 10). Interestingly, these two complexes responded very differently to the RNA competitor (lanes 3 to 6). The putative Gbp1p dimer had a strong preference for ssDNA; a 15-fold excess of unlabeled dCG3 outcompeted the labeled dCG3 nearly completely, while a 15-fold excess of unlabeled rCG3 had essentially no effect (Fig. 4A, compare lanes 9 and 3, upper complexes). In contrast, the Gbp1p monomer had similar affinities for RNA and ssDNA, with a slight preference for RNA (Fig. 4A, compare lanes 9 and 3, lower complexes; also shown more clearly in Fig. 3C). Thus, the putative Gbp1p monomeric and dimeric isoforms have different binding preferences for ssDNA and RNA. Furthermore, the putative Gbp1p monomer had binding preferences like those observed for purified Gbp1p and TrpE-Gbp1p (Fig. 2), while the putative Gbp1p dimer exhibited binding preferences like those observed for Gbp1p from Chlamydomonas extracts (38).

View larger version (45K): [in this window] [in a new window]   FIG. 4.   Monomeric Gbp1p has a slight preference for binding RNA; dimeric Gbp1p has a strong preference for binding ssDNA. (A) EMSA using 0 () or 15 ng (+) of Chlamydomonas extract and radiolabeled dCG3. The molar fold excess of either rCG3 (C.r. extract) or dCG3 unlabeled competitor oligonucleotide that was added to each reaction is shown above the autoradiogram. (B) Three distinct DNA-protein complexes are identified in a cross-linking assay using radiolabeled dCG3 and Chlamydomonas extract. These complexes are named A, B, and C (from largest to smallest) and are all dependent on the presence of the extract and the cross-linker. The molar fold excess of either dCG3, rCG3, or TGD (G2T4)5 unlabeled competitor oligonucleotide that was added to each reaction is shown above the autoradiogram.

All three complexes contain Gbp1p and only Gbp1p. We next sought to test our model (presented in Fig. 3) which predicts that the only protein in all three complexes is Gbp1p. To determine which of the cross-linked complexes contain Gbp1p, the presence or absence of Gbp1p in each of the complexes was determined in a denaturing gel. The cross-linking assay was scaled up fourfold, and the positions of the three complexes were determined in an unfixed, wet gel by autoradiography. Each complex was excised and eluted from the gel before the cross-linking was reversed. The proteins (no longer cross-linked to DNA or to each other) were resolved by denaturing gel electrophoresis, and Gbp1p was detected by immunoblotting. Full-length Gbp1p was detected in all three complexes, but not in a gel slice excised from the region between complexes B and C (Fig. 5A). More Gbp1p was found in the gel slice representing complex C, probably because excess, unbound Gbp1p was not resolved from complex C. These results indicated that Gbp1p was intact in all of these complexes and that the multiple bands were not due to partial degradation of the protein. Therefore, we conclude that Gbp1p is found in all three complexes.

View larger version (53K): [in this window] [in a new window]   FIG. 5.   All three complexes contain Gbp1p and, likely, only Gbp1p. (A) Gbp1p is present in all three complexes. Complexes A, B, and C (or a region of the gel between B and C [Control]) were gel purified, the cross-linking was reversed, and the presence of Gbp1p (arrow) in the recovered proteins was assayed by immunoblotting with anti-Gbp1p serum. (B) Gbp1p is the only protein cross-linked to dCG3 in all three complexes. Complexes A, B, and C were gel purified, the cross-linked protein-DNA complexes were not () or were (+) subjected to limited proteolysis, and the resulting cross-linked fragments were resolved by SDS-PAGE on a 16% gel. The major proteolytic fragments are indicated by the arrows. (C) Anti-Gbp1p interferes with complexes B and C but not with complex A. Chlamydomonas extract (C.r. extract) was cross-linked to labeled dCG3 in the absence () or presence (+) of increasing amounts of anti-Gbp1p or anti-Rap1p serum as indicated. (D) Recombinant Gbp1p forms dimers. Full-length Gbp1p fused to TrpE was purified by DNA affinity chromatography and concentrated. Increasing amounts of the fusion protein (1, 3, or 10 µl) were assayed by EMSA with labeled dCG3 as a probe. The arrows indicate the two major TrpE-Gbp1p-dCG3 complexes.

Definition of the Gbp1p-binding site. The probe used for both the EMSA and the cross-linking assay described above contains three copies of a TTTTAGGG repeat (dCG3). Depending on the exact sequence recognized by Gbp1p, this oligonucleotide likely contains multiple Gbp1p-binding sites. Our model predicts that a probe with only one binding site will not be able to form complex B (two Gbp1p molecules bound to two sites on one oligonucleotide) but will be able to form complexes A and C. To design a probe with only one Gbp1p-binding site, we first determined the minimal sequence necessary for Gbp1p binding. We tested six circularly permutated 8-mer oligonucleotides for their ability to compete with the Gbp1p monomer-dCG3 complex (complex C) in the cross-linking assay. Gbp1p was capable of binding three of the octamers (Fig. 6A). The sequence common to these three oligonucleotides was GGGTTT, indicating that this sequence of the Chlamydomonas ss-G-strand telomere is minimally sufficient for Gbp1p binding. Additionally, in the two cases in which GGGTTT (underlined) was located at the 5' or 3' end of the oligonucleotides (TAGGGTTT and GGGTTTTA), the binding affinity was lower than when the sequence was located in the middle (AGGGTTTT), suggesting that flanking DNA may assist in Gbp1p binding.

View larger version (42K): [in this window] [in a new window]   FIG. 6.   Definition of the Gbp1p binding site. (A) The minimal binding site for Gbp1p in the Chlamydomonas ss-G-strand telomere is GGGTTT. Chlamydomonas extract was covalently cross-linked to the radiolabeled dCG3 oligonucleotide in the presence of increasing amounts of the indicated unlabeled oligonucleotides. The resulting complexes were separated by denaturing gel electrophoresis, and the band corresponding to the Gbp1p monomer was quantitated by PhosphorImager analysis. The intensity of this band, relative to that in a reaction with no competitor, is plotted as a function of the molar fold excess of the competitor binding sites over the probe binding sites. (B) The GGT trinucleotide within the minimal binding site is critical for Gbp1p binding. Crucial nucleotides in the binding site were determined as for panel A, using the indicated oligonucleotides, in which each base was systematically changed to a cytosine (underlined). (C) Gbp1p also associates with telomere sequences from S. cerevisiae, Arabidopsis thaliana, and humans. The relative affinities of Gbp1p for ss-G-strand telomere sequences from other species were determined as for panel A by oligonucleotide competition. (D) Multiple binding sites per oligonucleotide are required for formation of complex B. Cross-linking was performed as described in the legend to Fig. 5B, using Chlamydomonas extract and either labeled dCG1 (AGGGTTTT) or labeled dCG3 (TTTTAGGG)3.

Domain analysis of Gbp1p. Sequence analysis of Gbp1p revealed the presence of two RRMs separated by an Arg-Gly-Gly domain, as well as a short carboxyl-terminal domain (38). The presence of two RRM domains suggests that a single Gbp1p molecule may be able to bind simultaneously to two nucleic acid molecules. To determine if the two RRM domains are able to associate independently with nucleic acids, we constructed deletion mutants of TrpE-Gbp1p. Four deletion variants of the pTrpE-IGIIC plasmid were created to eliminate the carboxyl-terminal domain and/or one of the two RRM domains (Fig. 7A). The fusion proteins were induced in E. coli and purified by immunoaffinity chromatography. Immunoblotting showed that all fusion proteins were produced and were stable (Fig. 7B). Approximately equal amounts of the proteins were assayed for activity in an EMSA using dCG3. TrpE-Gbp1p formed one major complex with the ssDNA; a second, minor complex was seen with some protein preparations (Fig. 7C). The major complex likely corresponds to the TrpE-Gbp1p monomer, and the minor complex likely corresponds to one of the dimer complexes.

View larger version (42K): [in this window] [in a new window]   FIG. 7.   RRM-I, RRM-II, and the carboxyl-terminal domain of Gbp1p are required for DNA binding. (A) Schematic representation of TrpE fusion proteins. Full-length Gbp1p (IGIIC, containing RRM-I, the glycine-rich domain, RRM-II, and the carboxyl-terminal domain) and various deletion derivatives were fused in frame with the TrpE protein. Dashed lines indicate deleted sequences. (B) Immunoblot of the five deletion variants of TrpE-Gbp1p. The fusion proteins were produced in E. coli, purified by immunoaffinity chromatography, and detected with anti-Gbp1p serum. (C) Only full-length Gbp1p binds DNA. The TrpE-Gbp1p deletion variants were assayed for DNA binding in an EMSA with radiolabeled (TTTTAGGG)3 (dCG3) being used as a probe. The thick arrow indicates the major TrpE-Gbp1p-ssDNA complex; the thin arrow a second, minor complex evident in some preparations.

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

Characterization of Gbp1p. Like many RRM-containing proteins, Gbp1p contains more than one RRM; however, both RRM domains are required for Gbp1p to associate with a single binding site on ssDNA. In contrast, for many proteins (including hnRNP A1 [32]), a single RRM is sufficient for RNA binding. Even small deletions in the carboxyl terminus of the protein ablate its ability to bind ssDNA. The phenylalanine at position 5 of the core RNP-1 sequence is one of the most highly conserved residues in RNP-1 (5), and it contacts the RNA associated with hnRNP A1 (32); yet Gbp1p, Rlf6p, and other proteins that bind G-strand telomeric DNA do not contain a phenylalanine at position 5 of any of their RNP-1 domains (24). This led us to ask whether F5 was important for the nucleic acid binding preference of Gbp1p. When we mutated position 5 of RRM-I and/or RRM-II to resemble the consensus motif, we found no effect on the ability to bind ssDNA or RNA or to discriminate between the two nucleic acids. Thus, the nonconsensus sequence of position 5 of the RNP does not control the discrimination by Gbp1p between ssDNA and RNA.

Dimerization of Gbp1p changes the binding specificity. Monomeric Gbp1p associates with either RNA or ssDNA, showing a slight binding preference for RNA. Yet dimeric Gbp1p, which is most readily identified in a Chlamydomonas cell extract due to its abundance, associates preferentially with ssDNA. This profound change in the binding characteristics of Gbp1p based on its dimerization state may have substantial physiological implications. The importance of dimerization of telomere-interacting proteins has been recently emphasized. In S. cerevisiae, telomerase is a complex that contains at least two functional telomerase RNAs (40), suggesting that the telomerase enzyme may need to dimerize to be functional. The Saccharomyces telomere-binding protein Rap1p associates with ds telomeric DNA as a dimer (10a). In humans, TRF1 (a structural homolog of Rap1p) also binds human ds telomeric DNA as a dimer (3). In vivo, telomeres are clustered both in S. cerevisiae (30) and in at least some mammalian cell types (52). Recently, Froelich-Ammon et al. (14) reported that the accessibility of Oxytricha telomere DNA to telomerase is regulated by the dimerization state of the telomere end-binding protein. When ss-G-strand DNA is bound by an  monomer, it is accessible to telomerase; in contrast, when it is bound by a homo-(₂) or heterodimer (), it is inaccessible to telomerase (14). Dimerization is thus an emerging theme in telomere biology.

Is Gbp1p a telomere end-binding protein, and what might it be doing at the telomeres? Gbp1p has been classified as a putative telomere-binding protein based on its ability to associate specifically with the ssDNA containing the Chlamydomonas telomere sequence (38) and its ability to functionally complement an rlf6 mutation that causes the mislocalization of the telomere-binding protein, Rap1p (24). Additionally, Gbp1p is similar to the mammalian protein hnRNP A1, which has recently been shown to affect telomere length control in cell culture and to bind telomerase in vitro (26). The facts that genes similar to GBP1 from S. cerevisiae and humans have telomeric phenotypes and that the binding specificity of Gbp1p matches the Chlamydomonas ss telomeric sequence are consistent with the idea that Gbp1p is a bona fide telomere-binding protein. However, the ability of monomeric Gbp1p to associate specifically with RNA and the abundance of Gbp1p (both of which are reminiscent of hnRNP A1) suggest that Gbp1p is not exclusively a telomere-binding protein. Regardless of whether it has a role at telomeres, it is likely that Gbp1p has other roles in the cell as well. Genetic studies in S. cerevisiae implicate proteins other than Rlf6p (e.g., Est1p and Cdc13p) as the principle in vivo telomere-regulating proteins (16, 27, 35, 48). Although the precise in vivo role(s) of Gbp1p remains to be determined, the previously unrealized ability of Gbp1p to modulate its nucleic acid discrimination by homodimerization gives this protein the ability to play a unique role in the cell.