Previous Article | Next Article 
Molecular and Cellular Biology, January 1999, p. 941-947, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Interactions between the Class II Transactivator
and CREB Binding Protein Increase Transcription of Major
Histocompatibility Complex Class II Genes
Joseph D.
Fontes,
Satoshi
Kanazawa,
Dickson
Jean, and
B. Matija
Peterlin*
Howard Hughes Medical Institute, Departments
of Medicine, Immunology, and Microbiology, University of California
San Francisco, San Francisco, California 94143-0703.
Received 10 June 1998/Returned for modification 13 August
1998/Accepted 14 October 1998
 |
ABSTRACT |
Class II major histocompatibility (class II) genes are regulated in
a B-cell-specific and gamma interferon-inducible fashion. The master
switch for the expression of these genes is the class II transactivator
(CIITA). In this report, we demonstrate that one of the functions of
CIITA is to recruit the CREB binding protein (CBP) to class II
promoters. Not only functional but also specific binding interactions
between CIITA and CBP were demonstrated. Moreover, a dominant negative
form of CBP decreased the activity of class II promoters and levels of
class II determinants on the surface of cells. Finally, the inhibition
of class II gene expression by the glucocorticoid hormone could be
attributed to the squelching of CBP by the glucocorticoid receptor. We
conclude that CBP, a histone acetyltransferase, plays an important role
in the transcription of class II genes.
 |
INTRODUCTION |
The expression of major
histocompatibility (MHC) complex class II (class II) genes is
controlled at the level of transcription. Their coordinate
B-cell-specific and gamma interferon-inducible expression is dictated
by shared cis-acting elements in their promoters. At least
four conserved sequences, called the S, X, X2, and Y boxes, have been
identified (reviewed in references 2 and
33). With the help of the heterotrimeric nuclear
factor Y complex, which binds to the Y box (29, 42, 52), the
multimeric regulatory factor X (RFX) complex binds specifically to S
and X boxes (15, 21). The X2 binding protein also
facilitates the binding of RFX to these conserved upstream sequences
(CUS) (30, 34, 41).
The occupancy of these CUS is necessary but not sufficient for the
transcription of class II genes (25); expression of the class II transactivator (CIITA) is also required (48-50).
CIITA is a 125-kDa transcriptional coactivator which does not bind to DNA directly (49) but interacts with protein complexes on
CUS. Its C-terminal 800 amino acids interact with these DNA-bound
proteins (43, 55). Indeed, weak interactions between CIITA
and RFX5, which is the largest subunit of RFX, have been described
previously (45). The N terminus of CIITA contains a
transcriptional activation domain of 143 amino acids, which is rich in
acidic amino acids (43, 55). Mutational analyses of this
region identified two putative
helices which are required for the
activation of transcription by CIITA (18). They bind to the
32-kDa subunit of TFIID, TAFII32, and presumably activate
transcription by recruiting TFIID to the promoter (18).
CIITA also recruits the B-cell-specific coactivator Bob-1 (also known
as OBF-1 or OCA-B), thereby increasing the expression of class II genes
in B cells (17).
The CREB binding protein (CBP), which interacts directly with the
phosphorylated form of CREB, was identified as a coactivator for the
transcription of cyclic AMP-responsive genes (13, 27). Subsequently, many other transcription factors were found to interact with CBP (reviewed in reference 19). Direct binding
of CBP to these transcription factors was also demonstrated (reviewed
in reference 22). CBP activates transcription
through its histone acetyltransferase (HAT) activity (7, 38)
and its ability to recruit additional proteins p/CAF (53)
and ACTR (11), which also possess HAT activities.
Additionally, CBP can acetylate general transcription factors
(20), which may contribute to its transcriptional effects.
Finally, CBP binds to RNA helicase A and thereby RNA polymerase II
holoenzyme (26, 36) as well as other general transcription
factors, which include TATA-binding protein (3, 14) and
TFIIB (27). Thus, it appears that CBP activates
transcription by more than one mechanism.
In this study, we identified CBP as a cofactor for the transcription of
class II genes. We found that CIITA and CBP cooperate synergistically
in the activation of transcription from the DRA promoter. These two
proteins also bound to each other directly, and these interactions were
highly specific. Moreover, a dominant negative form of CBP, (DN-CBP)
blocked the increased expression of class II genes by CBP. Finally, the
inhibition of class II transcription by dexamethasone, which is a
glucocorticoid hormone, was reversed by the overexpression of CBP,
indicating that it could have resulted from the squelching of CBP by
the glucocorticoid receptor (GR). From this and previous studies, it
appears that CIITA organizes multiple transcriptional activities,
integrating inputs from sequence-specific DNA-bound proteins with
various effector pathways to regulate the expression of class II genes.
 |
MATERIALS AND METHODS |
Cell culture and transfection.
The human kidney fibroblast
cell line 293T and African green monkey kidney cell line COS were
maintained in Dulbecco modified Eagle medium with 10% fetal calf serum
and streptomycin-penicillin. The human B-lymphoblastoid cell line RM3
was maintained in RPMI with 10% fetal calf serum and
streptomycin-penicillin. All cells were grown at 37°C with 5%
CO2. Transfection of 293T and COS cells was carried out
with 1 or 2 µg of plasmid DNA (including 10 ng of a plasmid
expressing hCG as a transfection control) and Lipofectamine (Life
Technologies, Gaithersburg, Md.) according to the manufacturer's instructions. RM3 cells were transfected by electroporation (300 V, 975 µF) with 20 µg of plasmid DNA including 1 µg of pEGFP (Clontech, Palo Alto, Calif.).
Plasmid DNA construction.
pSVCIITA, pSGCIITA, and pDRASCAT
(17) and pCMVCBP (a gift from M. G. Rosenfeld)
(24) were previously described. Plasmids expressing
glutathione S-transferase (GST)-CBP fusion proteins were
constructed as follows. The appropriate region of CBP was amplified by
PCR using primers containing BamHI (5' end) and
XhoI (3' end) sites. These amplified DNAs were digested with
BamHI and XhoI and subcloned into plasmid pGEX4T3
(Promega Inc., Madison, Wis.) cut with the same enzymes. Each CBP
insert was sequenced to verify identity. The primers for PCR were as
follows: GST-CBP(1-101), 5'-CGCGGATCCATGGCTGAGAACTTGC and
5'-GCACTCGAGCTAGCCACCCAGGCCCTG; GST-CBP(461-661),
5'-CGCGGATCCGGCACAGGGCAACAG and
5'-GCACCGGAGCTATATCTTGTAGATTTTCTC; GST-CBP(1621-1891),
5'- CGCGGATCCTGTATGCCACCATGG and
5'-GCACTGGAGCTAGCCTCCCATCGCCTGC; and GST-CBP(2058-2163),
5'-CGCGGATCCCCACCCAGGAGGATCTCACC and
5'-GCACTCGAGCTATGTCTTGCGATTATAG. (Numbers in parentheses
denote amino acids positions spanned by the CBP constructs.) Plasmid
pCRDN-CBP was constructed by amplifying CBP cDNA sequences from
nucleotides 5709 to 7323, adding an ATG start codon and consensus
sequence immediately preceding amino acid 1903 of CBP, and subcloning
the amplified product directly into plasmid pCR3.1 (InVitrogen,
Carlsbad, Calif.). The CBP was sequenced to verify its identity. The
primers for PCR were 5'-GCCGCCACCATGCCGCAGCCCCCTGCCCAG and
5'-CTACAAGCCCTCCACAAACTTC.
Reverse transcriptase-mediated PCR (RT-PCR).
Total RNA was
isolated from transfected 293T cells by the guanidinium acid-phenol
chloroform method (12). Reverse transcription was performed
with 1 µg of total RNA, 1 µg of oligo (dT) (Boehringer Mannheim,
Indianapolis, Ind.), and murine leukemia virus reverse transcriptase
(Boehringer Mannheim) according to the manufacturer's instructions.
One microliter of the reverse transcriptase reaction was used as the
template in a PCR with 1 U of Taq polymerase (Boehringer Mannheim) in a 50-µl reaction according to the manufacturer's instructions. The reaction conditions were 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s for 25 cycles. Then 10 µl of
each reaction product was run on a 1.5% agarose gel. The primers for CIITA were previously described (10). The primers for human TAP1 were 5'-AGGTAGACGAGGCTGGGAGCC and
5'-CATTCTGGAGCATCTGCAGG.
CAT assay and FACS analysis.
The chloramphenicol
acetyltransferase (CAT) assay was performed exactly as previously
described (18). Forty-eight hours after the transfection,
RM3 cells were stained for human class II and class I determinants with
monoclonal antibodies raised against HLA-DP (Becton Dickinson, San
Jose, Calif.) and HLA-A, -B, and -C (Pharmingen, San Diego, Calif.)
determinants, respectively. After washing, cells were incubated with a
phycoerythrin-conjugated rat anti-mouse antibody (Zymed, Los Angeles,
Calif.). Fluorescence-activated cell sorting (FACS) analyses were
performed on a FACScalibur apparatus (Becton Dickinson).
Immunoprecipitation and Western blotting.
Forty-eight hours
after transfection, COS cells were washed with phosphate-buffered
saline and lysed in 1 ml of lysis buffer containing 1% Nonidet P40, 10 mM Tris (pH 7.4), 150 mM NaCl, 2 mM EDTA, and protease and phosphatase
inhibitors for 20 min at 4°C. Cell lysates were then cleared at
12,000 × g for 10 min at 4°C, and supernatants were
incubated with 10 µl of anti-CBP antibody (Santa Cruz Biotechnology,
Santa Cruz, Calif.) for 1 h at 4°C. Samples were then mixed with
15 µl of protein A-conjugated agarose beads for another hour, and
immunoprecipitates were washed four times and resuspended in sodium
dodecyl sulfate (SDS) sample buffer. Protein samples were then resolved
by SDS-polyacrylamide gel electrophoresis (PAGE) on an 8% gel and
transferred to nitrocellulose, using a Bio-Rad (Hercules, Calif.)
Western blotting apparatus. One-quarter of the lysate used for the
immunoprecipitation was also examine for the presence of CBP and CIITA
in transfected cells. Membranes were blocked with phosphate-buffered
saline containing 5% nonfat milk overnight and incubated with primary
antibodies (anti-hemagglutinin epitope [12CA5] and anti-CBP) for at
least 1 h. After three washes with Tris-buffered saline (pH 7.4)
containing 5% nonfat milk, membranes were incubated with a secondary
antibody conjugated with horseradish peroxidase for 1 h, washed
with the same buffer, and analyzed by enhanced chemiluminescence assay
(ECL kit; Amersham, Arlington Heights, Ill.).
GST pull-down assays.
GST-CBP fusion proteins were produced
and purified, and GST pull-down assays between GST-CBP and in
vitro-transcribed and -translated CIITA and CIITA deletions were
performed exactly as described elsewhere (18).
 |
RESULTS |
CBP and CIITA increase expression from the DRA promoter
synergistically.
Previous studies demonstrated that CBP
facilitates the transcriptional activation of a wide variety of genes
via its HAT domain (reviewed in reference 22) and
its ability to interact with general transcription factors (3, 14,
26, 27, 36). To determine if CBP could also activate class II
genes and if it cooperated with CIITA, transient expression assays were
performed with the human kidney fibroblast cell line 293T. Plasmid
effectors coding for CIITA (pSVCIITA) and CBP (pCMVCBP) were
cotransfected with the plasmid target pDRASCAT. CAT enzymatic assays
were performed 48 h later.
CIITA increased the expression from the DRA promoter fivefold over
baseline levels (Fig. 1A, column 2). CBP
had a smaller effect, transactivating the DRA promoter only threefold
(column 3). However, when coexpressed, CIITA and CBP transactivated the DRA promoter 15-fold (column 4). To rule out that CBP increased the
transcription of CIITA in 293T cells, total RNA was isolated from the
cotransfected 293T cells and subjected to RT-PCR. CIITA mRNA was found
to be present in equal amounts when plasmid pSVCIITA was transfected
into 293T cells, regardless of the presence of pCMVCBP (Fig. 1B, top,
lanes 2 to 4). Control RT-PCR was also performed with primers
complementary to the ubiquitously expressed human TAP1 gene (Fig. 1B,
bottom). These controls indicated that CBP did not affect expression
from the DRA promoter due to increased transcription of CIITA. We
conclude that both CBP and CIITA transactivate the DRA promoter and do
so in a synergistic manner.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
CIITA and CBP act synergistically to increase expression
from the DRA promoter. The plasmid target (pDRASCAT) was coexpressed
with CIITA and/or CBP in 293T cells (+ denotes protein expression).
Amounts of cotransfected plasmid DNA were held constant (0.25 µg of
each plasmid effector and target, balanced to a total of to 1.0 µg
with the empty plasmid vector DNA). pDRASCAT was coexpressed with empty
plasmid vector (white bar), CIITA (gray bar), CBP (striped bar), or
CIITA and CBP (black bar). Fold transactivation (Fold-TA) was
calculated from the bar graph and represents values of top bars over
the value obtained with pDRASCAT alone. CAT activities represent mean
values of three independent experiments performed in triplicate with
indicated standard errors of the mean. RT-PCR was performed on total
RNA isolated from 293T cells transfected as noted above. Primers for
CIITA mRNA (B, top; from nucleotide positions 3309 to 3507) or human
TAP1 (bottom; from nucleotide positions 1904 to 2247) were used in the
PCR.
|
|
CIITA interacts directly with CBP in cells.
Since functional
interactions between CIITA and CBP could reflect physical interactions
between the two proteins, we performed a modified one-hybrid binding
assay in 293T cells. An effector plasmid directing expression of the
fusion protein between CIITA and the DNA binding domain of the
yeast Gal4 protein (pSGCIITA) was cotransfected with a reporter
plasmid containing a single Gal4 binding site (UASg) linked to the CAT
reporter gene (pG1bCAT) (28). The hybrid Gal4-CIITA protein
increased the expression from pG1bCAT threefold over baseline levels
(Fig. 2A, column 2). However, inclusion
of pCMVCBP in the cotransfection transactivated pG1bCAT 18-fold,
indicating that CBP interacted directly with CIITA (column 3).
pCMVCBP without pSGCIITA had no effect on the transcription form
pG1bCAT (column 4). Direct interactions between CIITA and CBP could
also be demonstrated in COS cells, which were cotransfected with
pCMVCBP and pSVCIITA (Fig. 2B). Cellular lysates were incubated with an
anti-CPB antibody and then examined for the presence of CIITA in these
immunoprecipitates by Western blotting. Only when both CBP and CIITA
were coexpressed was CIITA detected in our CBP complexes (Fig. 2B, lane
2). We conclude that CBP increases the transcription of class II genes
by interacting with CIITA.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
CBP interacts with CIITA in cells. (A) CBP interacts
with CIITA in a modified one-hybrid assay in vivo. The plasmid target
(pG1bCAT) was coexpressed with Gal4-CIITA and/or CBP in 293T cells (+ denotes protein expression). Amounts of cotransfected plasmid DNA were
held constant (0.25 µg of each plasmid effector and target, balanced
to a total of to 1.0 µg with the empty plasmid vector DNA). pG1bCAT
was coexpressed with empty plasmid vector (white bar), Gal4-CIITA (grey
bar), CBP (striped bar), or Gal4-CIITA and CBP (black bar). Fold
transactivation (Fold-TA) was calculated from the bar graph and
represents values of top bars over the value obtained with pG1bCAT
alone. CAT activities represent mean values of three independent
experiments performed in triplicate with indicated standard errors of
the mean. BD, binding domain; T, TATA box. (B) CIITA can be
immunoprecipitated with CBP in cells. COS cells were transfected with
pCMVCBP (1.0 µg) alone (lane 1) or with pCMVCBP (1.0 µg) and
pSVCIITA (1.0 µg) (lane 2). The empty plasmid vector was included to
maintain the total amount of transfected plasmid at 2.0 µg.
One-quarter of the cellular lysate used for the immunoprecipitation
(IP) was examined for the presence of expressed proteins (Input).
Anti-CBP ( CBP) immunoprecipitates were also probed for the presence
of CIITA by Western blotting, HA, anti-hemagglutinin epitope
antibody.
|
|
CIITA binds to a specific domain of CBP in vitro.
Previous
studies have produced a long list of transcription factors that
interact directly with one of the four domains of CBP (22).
These sequences contain amino acids from positions 1 to 101, 461 to
661, 1621 to 1891, and 2058 and 2163 in CBP (Fig. 3A) (22). To determine if
CIITA bound specifically to CBP, we created fusion proteins between
these four domains of CBP and GST. These chimeras were used in a
binding assay with CIITA, which was transcribed and translated with
[35S]methionine in vitro. Hybrid GST-CBP proteins, along
with any bound CIITA, were resolved by SDS-PAGE and subjected to
autoradiography.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
CIITA binds to CBP via residues from positions 1621 to
1891. (A) Schematic representation of CBP. Domains which interact with
other proteins that regulate transcription of various genes are
depicted as gray and black rectangles (22). (B) In vitro
binding assays were carried out with the transcribed and translated
CIITA and GST-CBP fusion proteins containing amino acids from positions
1 to 101 (lane 4), 461 to 661 (lane 5), 1621 to 1891 (lane 6), and 2058 to 2163 (lane 7). Glutathione-Sepharose beads (lane 2) and GST alone
(lane 3) did not bind to CIITA. Lane 1 contains 10% of the input CIITA
protein. (C) Coomassie blue-stained SDS-polyacrylamide gel
demonstrating that equivalent amounts of GST-CBP fusion proteins were
included in the binding reactions.
|
|
One-tenth of the CIITA protein used for the binding reactions is
presented in Fig. 3B, lane 1. When CIITA was combined with glutathione-Sepharose beads, alone (Fig. 3B, lane 2) or complexed with
GST (lane 3), essentially no CIITA bound to our beads. Similarly, CIITA
did not bind to GST-CBP(1-101) (lane 4), GST-CBP(461-661) (lane 5), or
GST-CBP(2058-2163) (lane 7). However, CIITA bound efficiently to
GST-CBP(1621-1891) (lane 6). As indicated by the staining of the
autoradiographed gel with the Coomassie blue dye, amounts of GST and
GST-CBP fusion proteins were equivalent in these binding reactions
(Fig. 3C). Thus, CIITA binds to specific sequences of CBP which are
found in the C-terminal part of the HAT domain. This region was
previously demonstrated to bind c-Fos (8), TFIIB
(27), E1A (4, 32), RSK1 (35), and MyoD (44) (Fig. 3A).
The N-terminal activation domain of CIITA binds to CBP.
Next,
we wanted to determine which domain of CIITA was required for these
interactions with CBP. The N-terminal 143 amino acids of CIITA have
been identified as an independent transcriptional activation domain
(Fig. 4A) (43, 55). This
region is rich in acidic amino acids and also interacts with
TAFII32 (18). To map the interaction between CBP
and CIITA, two partial CIITA proteins, one spanning the activation
domain from positions 1 to 143 [CIITA(1-143)] and the other
containing amino acids from positions 144 to 1103 of
[CIITA(143-1103)], were transcribed and translated in vitro (Fig.
4A). These two truncated CIITA proteins were allowed to interact with
GST-CBP(1621-1891).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
CBP binds to the N-terminal transcriptional activation
domain of CIITA. (A) Schematic representation of CIITA (33).
Structural domains: Acidic, region rich in acidic amino acids; P/S/T,
region rich in proline, serine, and threonine residues; ATP/GTP,
putative purine ribonucleotide binding site. (B and C) In vitro binding
assays were carried out with the transcribed and translated full-length
CIITA (lane 1), CIITA(144-1103) (lane 2), and CIITA(1-143) (lane 3).
(B) GST-CBP(1621-1891) pull-down assay; (C) input CIITA and truncated
CIITA proteins used in the binding reaction.
|
|
As previously demonstrated, the full-length CIITA bound to
GST-CBP(1621-1891) (Fig. 4B, lane 1). However, CIITA(143-1103), which
lacks the N-terminal activation domain and is unable to transactivate
class II genes, did not bind significantly to GST-CBP(1621-1891) (lane
2). In sharp contrast, CIITA(1-143), which contains the transcriptional
activation domain of CIITA, bound to GST-CBP(1621-1891) (lane 3). As
demonstrated in Fig. 4C, equal amounts of these CIITA proteins were
included in our binding reactions. We conclude that CBP interacts with
CIITA via its N-terminal transcriptional activation domain.
DN-CBP inhibits the transcriptional synergy between CIITA and
CBP.
To characterize further transcriptional synergy between CIITA
and CBP, we created a dominant negative form of CBP that should inhibit the function of the wild-type protein. Two dominant negative forms of p300, a factor that is highly related to CBP, have been identified (6). We transposed the amino acid coordinates of one of these dominant negative p300 proteins onto the sequence of CBP
to create DN-CBP, containing amino acids from positions 1903 to 2441 in CBP.
A plasmid effector was constructed to express DN-CBP under the control
of the cytomegalovirus promoter (pCRDN-CBP). pSVCIITA and pCMVCBP were
cotransfected with pDRASCAT into 293T cells, resulting in
22-fold-increased CAT enzymatic activity over baseline levels (Fig.
5, column 3). Including pCRDN-CBP in a
similar cotransfection transactivated pDRASCAT only sixfold (column 4),
indicating that DN-CBP inhibited the function of its wild-type
counterpart. DN-CBP also had a smaller but reproducible effect on the
ability of CIITA to activate the DRA promoter in the absence of
exogenous CBP. In this instance, the cotransfection of pSVCIITA and
pCRDN-CBP transactivated pDRASCAT only threefold (column 5).
Cotransfecting pCRDN-CBP with pDRASCAT has no effect on the already low
baseline levels of expression form the DRA promoter (column 6). Thus,
not only does CBP promote the transcription of class II genes, but DN-CBP can block this effect.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
DN-CBP inhibits the transcriptional synergy between
CIITA and CBP. pDRASCAT was coexpressed with CIITA individually and in
combination with CBP in 293T cells. In addition, DN-CBP, which contains
amino acids from positions 1903 to 2441 in CBP, was coexpressed in
these cells. Amounts of cotransfected plasmids were kept constant (0.5 µg of pDRASCAT and pCRDN-DBP; 0.25 µg of pCMVCBP and pSVCIITA;
empty plasmid vector was included to maintain the total amount of
transfected plasmid at 2.0 µg). pDRASCAT was coexpressed with empty
plasmid vector (white bar), CIITA (gray bar), CIITA and CBP (black
bar), CIITA, CBP, and DN-CIITA (cross-hatched bar), CIITA and DN-CBP
(small-squares bar), or DN-CBP (striped bar). Fold transactivation (TA)
was calculated from the bar graph and represents values of top bars
over the value obtained with pDRASCAT alone. CAT activities represent
mean values of three different experiments performed in triplicate with
indicated standard errors of the mean.
|
|
DN-CBP reduces the expression of class II determinants on the
surface of B-lymphoblastoid cells.
To determine if CBP played a
similar role in the transcription of class II genes in B cells, where
these genes and CIITA are expressed at high levels, we coexpressed
DN-CBP and CIITA in human B-lymphoblastoid RM3 cells (33).
RM3 cells are mutant Raji cells, where CIITA is no longer functional.
However, the introduction of CIITA into these cells leads to the
expression of class II determinants at levels observed in parental Raji
cells. RM3 cells were chosen because they synchronized the expression
of DN-CBP and CIITA proteins and avoided the issues of preexisting high levels and slow turnover of class II determinants in wild-type B-lymphoblastoid cells. Identical results were also obtained with Raji
cells, which expressed DN-CBP constitutively (data not presented). Forty-eight hours after cotransfection, RM3 cells were stained for
class II and class I determinants (Fig.
6). As the green fluorescence protein was
coexpressed in these cells, only 10% of the brightest cells were
analyzed by FACS. The expression of CIITA alone led to very high levels
of expression of class II determinants (Fig. 6A, dark gray peak). At a
ration of 3 to 1, DN-CBP protein led to a 60% reduction in levels of
class II determinants (HLA-DP) on these cells (Fig. 6A, black peak). In
sharp contrast, no reduction in levels of class I determinants was
observed with DN-CBP in these cells (Fig. 6B, black peak). These data
indicate that CBP plays a role in the expression of class II genes in B
cells where their transcription is high and constitutive.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
DN-CBP inhibits the expression of class II determinants
on the surface of B-lymphoblastoid RM3 cells. RM3 cells were
transfected with the pSVCIITA (5 and 15 µg of empty plasmid vector)
(dark gray peaks), with pSVCIITA (5 µg) and pCRDN-CBP (15 µg)
(black peaks), or with the empty plasmid vector (20 µg) (light gray
peaks). Cells were incubated with the anti-HLA-DP (MHC II) or
anti-HLA-A, -B, and -C (MHC I) antibodies and subsequently visualized
with a phycoerythrin-conjugated rat anti-mouse antibody. As pEGFP (1 µg) was cotransfected into these cells, only 10% of the brightest
cells were analyzed by FACS. In panel A, two light gray peaks on the
left represent unstained and anti-HLA-DP-stained RM3 cells that were
transfected with the plasmid vector alone; the light gray peak in panel
B represents unstained RM3 cells.
|
|
Increased expression of CBP can reverse the inhibition of class II
transcription by the glucocorticoid hormone.
Next, we wanted to
determine if CBP had a role in the inhibition of class II transcription
by the glucocorticoid hormone. Previous studies demonstrated that
dexamethasone (9, 47) and ursodeoxycholic acid
(51) can inhibit the transcription of class II genes and
that this inhibition requires the translocation of GR from the
cytoplasm to the nucleus. Similarly, glucocorticoid hormone can inhibit
the ability of AP-1 to activate the transcription of promoters
containing an AP-1 binding site (23, 31, 46, 54). Kamei et
al. (24) demonstrated that one mechanism by which the
inhibition of AP-1 might occur is by the squelching of a limited amount
of CBP by the ligand-bound GR in the nucleus (5). Since we
determined that CBP plays an important role in the expression of class
II genes, we wanted to test if a similar mechanism of squelching was
responsible for the inhibition of class II transcription by the
glucocorticoid hormone.
pSVCIITA was transfected into 293T cells, which transactivated pDRASCAT
41-fold (Fig. 7, column 2). When these cells were subsequently treated
with 1 µM dexamethasone, transcriptional activation fell sevenfold to
sixfold over baseline levels, even though identical amounts of pSVCIITA
and pDRASCAT were used in these transfections (column 3). However, when
pCMVCBP was cotransfected with pSVCIITA and pDRASCAT, this inhibition
by dexamethasone was reversed in a dose-dependent fashion (columns 4 and 5, respectively). With higher amounts of pCMVCBP, levels of
expression increased 32-fold despite the presence of dexamethasone,
approaching those observed in the absence of dexamethasone (compare
columns 2 and 5). We conclude that this glucocorticoid hormone inhibits
the transcription of class II genes by causing the GR to translocate to
the nucleus and compete with CIITA for a limited amount of CBP.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Increasing amounts of CBP relieve the inhibition of
class II transcription by dexamethasone. pDRASCAT was coexpressed with
CIITA, and transfected cells were treated with 1 µM dexamethasone
(DEX; striped bar) or dimethyl sulfoxide vehicle (gray bar). Increasing
amounts of CBP were coexpressed in these cells (0.25 and 0.5 µg of
pCMVCBP; black bars). Amounts of cotransfected plasmids were kept
constant (0.5 µg of pDRASCAT and 0.75 of pSVCIITA; 0.25 µg and 0.5 µg of pCMVCBP; empty plasmid vector was included to maintain the
total amount of transfected plasmid at 2.0 µg). pDRASCAT was
coexpressed with empty plasmid vector (white bar), CIITA (gray bar),
CIITA and dexamethasone (striped bar), or CIITA and different amounts
of CBP (0.25 and 0.5 µg) in the presence of dexamethasone (black
bar). Fold transactivation (TA) was calculated from the bar graph and
represents values of top bars over the value obtained with pDRASCAT
alone. CAT activities represent mean values of three independent
experiments performed in triplicate with indicated standard errors of
the mean.
|
|
 |
DISCUSSION |
CIITA is the key regulatory protein for the transcription of class
II genes (48-50). In this study, we identified CBP as an additional coactivator. CBP and CIITA not only synergized in the transcription from the DRA promoter but physically interacted with each
other. CIITA bound to CBP at residues from positions 1621 to 1891, where CBP also interacts with c-Fos (8), TFIIB (27), E1A (4, 32), RSK1 (35), and MyoD
(44) (Fig. 3A). Additionally, the binding of CBP to CIITA
occurred via the N-terminal activation domain of CIITA. DN-CBP
specifically inhibited the transcriptional synergy between CBP and
CIITA and reduced the expression of class II genes on the surface of
B-lymphoblastoid cells. Our study also provides a mechanistic insight
into the inhibition of class II transcription by the glucocorticoid
hormone. Not only did dexamethasone inhibit the transcription of class II genes, but the overexpression of CBP was able to reverse this effect.
It was reported previously that the treatment of cells with
dexamethasone inhibited the transcription of class II genes (9, 47). This inhibition required the translocation of GR to the nucleus (47). In vitro protein-DNA binding assays suggested that GR might be able to inhibit the binding of an unidentified complex
to the X1 box of the DRB1 promoter (9). However, using an in
vivo binding assay (16), we found that dexamethasone
treatment had little, if any, effect on the interaction of RFX with the X box (data not presented). Moreover, Kamei et al. demonstrated that
the inhibition of AP-1 by dexamethasone was due to the squelching of a
limited amount of CBP by GR in the nucleus (24). In these studies, the overexpression of CBP resulted in the reversal of the
inhibition by dexamethasone of transcription which depended on a
tetradecanoyl phorbol acetate-responsive element. Moreover, the
inhibition of NF-
B by STAT1 (40) and the inhibition of AP-1 and NF-
B by the androgen receptor are also due to the
competition for limiting amounts of CBP (1). Similarly, we
determined that the decreased transcription of class II genes following
the administration of dexamethasone could be reversed by the
overexpression of CBP. We conclude that the primary mechanism for the
inhibition of class II transcription by the glucocorticoid hormone is
the squelching of a limited amount of CBP, not the blocking of proteins
that interact with the X box. This mechanism is presented
diagrammatically in Fig. 8.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
Diagrammatic representation of how dexamethasone
inhibits the transcription of class II genes. (A) In the absence of
dexamethasone, CBP binds to CIITA. In turn, CIITA is attracted to class
II promoters via RFX, which binds to the X box. (B) The administration
of dexamethasone results in the translocation of the GR to the nucleus,
where it binds to CBP. In this manner, GR sequesters a limited amount
of CBP in the nucleus, leaving little to no free CBP to interact with
CIITA on class II promoters. GRE, glucocortoid response element.
|
|
Direct interactions between CIITA and CBP were mapped to the N-terminal
transcriptional activation domain of CIITA. This domain is rich in
acidic amino acids. Mutageneses of this region identified two putative
helices which are required not only for transcriptional activation
but also for the binding of CIITA to TAFII32
(18). The interaction of CBP with CREB occurs via the
so-called KIX domain, in which serine 133 of CREB is phosphorylated
(13, 27, 39). In addition, CREB has a glutamine-rich
activation domain which also interacts with human TAFII130
(37). It appears that CIITA may also function in a similar
manner, not only contacting a component of TFIID but also recruiting
CBP and its associate HAT activity. Although experiments have not ruled
out the formation of a tripartite complex composed of
TAFII32, CBP and CIITA, it seems unlikely that this would
occur due to steric considerations. Rather, CIITA probably interacts
with these two complexes at different times in the transcription cycle.
CIITA could initiate transcription via its interactions with TFIID and
subsequently promote chromatin remodeling by recruiting CBP.
CBP is the second coactivator which has been identified as a binding
partner for CIITA, which is itself a transcriptional coactivator. The
B-cell-specific coactivator Bob-1 binds to CIITA and synergizes with it
in the transcription of class II genes (17). Thus, the
transcription of class II genes depends not only on the assembly of a
complex protein-DNA structure but also on the formation of a
multipartite coactivator network. CIITA can therefore be viewed as a
transcriptional integrator, coordinating the communication between
sequence-specific DNA binding proteins with activities that promote
transcriptional initiation and promoter clearance.
 |
ACKNOWLEDGMENTS |
We thank Michael Armanini for expert secretarial assistance,
members of the Peterlin lab and Peter Kushner for helpful comments and
discussions, and G. M. Rosenfeld for pCMVCBP.
This work was supported by a postdoctoral fellowship grant from the
Arthritis Foundation to J.D.F. and a grant from the Nora Eccles
Treadwell Foundation to B.M.P.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Howard Hughes
Medical Institute, Departments of Medicine, Immunology, and
Microbiology, University of California San Francisco, San Francisco, CA
94143-0703. Phone: (415) 502-1902. Fax: (415) 502-1901. E-mail:
matija{at}itsa.ucsf.edu.
 |
REFERENCES |
| 1.
|
Aarnisalo, P.,
J. J. Palvimo, and O. A. Janne.
1998.
CREB-binding protein in androgen receptor-mediated signaling.
Proc. Natl. Acad. Sci. USA
95:2122-2127[Abstract/Free Full Text].
|
| 2.
|
Abdulkadir, S. A., and S. J. Ono.
1995.
How are class II MHC genes turned on and off?
FASEB J.
9:1429-1435[Abstract].
|
| 3.
|
Abraham, S. E.,
S. Lobo,
P. Yaciuk,
H. G. Wang, and E. Moran.
1993.
p300, and p300-associated proteins, are components of TATA-binding protein (TBP) complexes.
Oncogene
8:1639-1647[Medline].
|
| 4.
|
Arany, Z.,
D. Newsome,
E. Oldread,
D. M. Livingston, and R. Eckner.
1995.
A family of transcriptional adaptor proteins targeted by the E1A oncoprotein.
Nature
374:81-84[Medline].
|
| 5.
|
Arias, J.,
A. S. Alberts,
P. Brindle,
F. X. Claret,
T. Smeal,
M. Karin,
J. Feramisco, and M. Montminy.
1994.
Activation of cAMP and mitogen responsive genes relies on a common nuclear factor.
Nature
370:226-229[Medline].
|
| 6.
|
Avantaggiati, M. L.,
V. Ogryzko,
K. Gardner,
A. Giordano,
A. S. Levine, and K. Kelly.
1997.
Recruitment of p300/CBP in p53-dependent signal pathways.
Cell
89:1175-1184[Medline].
|
| 7.
|
Bannister, A. J., and T. Kouzarides.
1996.
The CBP co-activator is a histone acetyltransferase.
Nature
384:641-643[Medline].
|
| 8.
|
Bannister, A. J., and T. Kouzarides.
1995.
CBP-induced stimulation of c-Fos activity is abrogated by E1A.
EMBO J.
14:4758-4762[Medline].
|
| 9.
|
Celada, A.,
S. McKercher, and R. A. Maki.
1993.
Repression of major histocompatibility complex IA expression by glucocorticoids: the glucocorticoid receptor inhibits the DNA binding of the X box DNA binding protein.
J. Exp. Med.
177:691-698[Abstract/Free Full Text].
|
| 10.
|
Chang, C. H.,
J. D. Fontes,
M. Peterlin, and R. A. Flavell.
1994.
Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes.
J. Exp. Med.
180:1367-1374[Abstract/Free Full Text].
|
| 11.
|
Chen, H.,
R. J. Lin,
R. L. Schiltz,
D. Chakravarti,
A. Nash,
L. Nagy,
M. L. Privalsky,
Y. Nakatani, and R. M. Evans.
1997.
Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300.
Cell
90:569-580[Medline].
|
| 12.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 13.
|
Chrivia, J. C.,
R. P. Kwok,
N. Lamb,
M. Hagiwara,
M. R. Montminy, and R. H. Goodman.
1993.
Phosphorylated CREB binds specifically to the nuclear protein CBP.
Nature
365:855-859[Medline].
|
| 14.
|
Dallas, P. B.,
P. Yaciuk, and E. Moran.
1997.
Characterization of monoclonal antibodies raised against p300: both p300 and CBP are present in intracellular TBP complexes.
J. Virol.
71:1726-1731[Abstract].
|
| 15.
|
Durand, B.,
M. Kobr,
W. Reith, and B. Mach.
1994.
Functional complementation of major histocompatibility complex class II regulatory mutants by the purified X-box-binding protein RFX.
Mol. Cell. Biol.
14:6839-6847[Abstract/Free Full Text].
|
| 16.
|
Fontes, J. D.,
N. Jabrane-Ferrat, and B. M. Peterlin.
1997.
Assembly of functional regulatory complexes on MHC class II promoters in vivo.
J. Mol. Biol.
270:336-345[Medline].
|
| 17.
|
Fontes, J. D.,
N. Jabrane-Ferrat,
C. R. Toth, and B. M. Peterlin.
1996.
Binding and cooperative interactions between two B cell-specific transcriptional coactivators.
J. Exp. Med.
183:2517-2521[Abstract/Free Full Text].
|
| 18.
|
Fontes, J. D.,
B. Jiang, and B. M. Peterlin.
1997.
The class II transactivator CIITA interacts with the TBP-associated factor TAFII32.
Nucleic Acids Res.
25:2522-2528[Abstract/Free Full Text].
|
| 19.
|
Goldman, P. S.,
V. K. Tran, and R. H. Goodman.
1997.
The multifunctional role of the co-activator CBP in transcriptional regulation.
Recent Prog. Horm. Res.
52:103-119.
|
| 20.
|
Imhof, A.,
X. J. Yang,
V. V. Ogryzko,
Y. Nakatani,
A. P. Wolffe, and H. Ge.
1997.
Acetylation of general transcription factors by histone acetyltransferases.
Curr. Biol.
7:689-692[Medline].
|
| 21.
|
Jabrane-Ferrat, N.,
J. D. Fontes,
J. M. Boss, and B. M. Peterlin.
1996.
Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions.
Mol. Cell. Biol.
16:4683-4690[Abstract].
|
| 22.
|
Janknecht, R., and T. Hunter.
1996.
Versatile molecular glue. Transcriptional control.
Curr. Biol.
6:951-954[Medline].
|
| 23.
|
Jonat, C.,
H. J. Rahmsdorf,
K. K. Park,
A. C. Cato,
S. Gebel,
H. Ponta, and P. Herrlich.
1990.
Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone.
Cell
62:1189-1204[Medline].
|
| 24.
|
Kamei, Y.,
L. Xu,
T. Heinzel,
J. Torchia,
R. Kurokawa,
B. Gloss,
S. C. Lin,
R. A. Heyman,
D. W. Rose,
C. K. Glass, and M. G. Rosenfeld.
1996.
A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors.
Cell
85:403-414[Medline].
|
| 25.
|
Kara, C. J., and L. H. Glimcher.
1991.
In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome.
Science
252:709-712[Abstract/Free Full Text].
|
| 26.
|
Kee, B. L.,
J. Arias, and M. R. Montminy.
1996.
Adaptor-mediated recruitment of RNA polymerase II to a signal-dependent activator.
J. Biol. Chem.
271:2373-2375[Abstract/Free Full Text].
|
| 27.
|
Kwok, R. P.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richards,
H. P. Bächinger,
R. G. Brennan,
S. G. Roberts,
M. R. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature.
370:223-226[Medline].
|
| 28.
|
Lin, Y. S.,
M. F. Carey,
M. Ptashne, and M. R. Green.
1988.
GAL4 derivatives function alone and synergistically with mammalian activators in vitro.
Cell
54:659-664[Medline].
|
| 29.
|
Linhoff, M. W.,
K. L. Wright, and J. P. Ting.
1997.
CCAAT-binding factor NF-Y and RFX are required for in vivo assembly of a nucleoprotein complex that spans 250 base pairs: the invariant chain promoter as a model.
Mol. Cell. Biol.
17:4589-4596[Abstract].
|
| 30.
|
Louis-Plence, P.,
C. S. Moreno, and J. M. Boss.
1997.
Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the conserved regulatory regions of HLA class II genes.
J. Immunol.
159:3899-3909[Abstract].
|
| 31.
|
Lucibello, F. C.,
E. P. Slater,
K. U. Jooss,
M. Beato, and R. Müller.
1990.
Mutual transrepression of Fos and the glucocorticoid receptor: involvement of a functional domain in Fos which is absent in FosB.
EMBO J.
9:2827-2834[Medline].
|
| 32.
|
Lundblad, J. R.,
R. P. Kwok,
M. E. Laurance,
M. L. Harter, and R. H. Goodman.
1995.
Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP.
Nature
374:85-88[Medline].
|
| 33.
|
Mach, B.,
V. Steimle,
E. Martinez-Soria, and W. Reith.
1996.
Regulation of MHC class II genes: lessons from a disease.
Annu. Rev. Immunol.
14:301-331[Medline].
|
| 34.
|
Moreno, C. S.,
P. Emery,
J. E. West,
B. Durand,
W. Reith,
B. Mach, and J. M. Boss.
1995.
Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome.
J. Immunol.
155:4313-4321[Abstract].
|
| 35.
|
Nakajima, T.,
A. Fukamizu,
J. Takahashi,
F. H. Gage,
T. Fisher,
J. Blenis, and M. R. Montminy.
1996.
The signal-dependent coactivator CBP is a nuclear target for pp90RSK.
Cell
86:465-474[Medline].
|
| 36.
|
Nakajima, T.,
C. Uchida,
S. F. Anderson,
C. G. Lee,
J. Hurwitz,
J. D. Parvin, and M. Montminy.
1997.
RNA helicase A mediates association of CBP with RNA polymerase II.
Cell
90:1107-1112[Medline].
|
| 37.
|
Nakajima, T.,
C. Uchida,
S. F. Anderson,
J. D. Parvin, and M. Montminy.
1997.
Analysis of a cAMP-responsive activator reveals a two-component mechanism for transcriptional induction via signal-dependent factors.
Genes Dev.
11:738-747[Abstract/Free Full Text].
|
| 38.
|
Ogryzko, V. V.,
R. L. Schiltz,
V. Russanova,
B. H. Howard, and Y. Nakatani.
1996.
The transcriptional coactivators p300 and CBP are histone acetyltransferases.
Cell
87:953-959[Medline].
|
| 39.
|
Parker, D.,
K. Ferreri,
T. Nakajima,
V. J. LaMorte,
R. Evans,
S. C. Koerber,
C. Hoeger, and M. R. Montminy.
1996.
Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism.
Mol. Cell. Biol.
16:694-703[Abstract].
|
| 40.
|
Parry, G. C., and N. Mackman.
1997.
Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-kappaB-mediated transcription.
J. Immunol.
159:5450-5456[Abstract].
|
| 41.
|
Reith, W.,
M. Kobr,
P. Emery,
B. Durand,
C. A. Siegrist, and B. Mach.
1994.
Cooperative binding between factors RFX and X2bp to the X and X2 boxes of MHC class II promoters.
J. Biol. Chem.
269:20020-20025[Abstract/Free Full Text].
|
| 42.
|
Reith, W.,
C. A. Siegrist,
B. Durand,
E. Barras, and B. Mach.
1994.
Function of major histocompatibility complex class II promoters requires cooperative binding between factors RFX and NF-Y.
Proc. Natl. Acad. Sci. USA
91:554-558[Abstract/Free Full Text].
|
| 43.
|
Riley, J. L.,
S. D. Westerheide,
J. A. Price,
J. A. Brown, and J. M. Boss.
1995.
Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA).
Immunity
2:533-543[Medline].
|
| 44.
|
Sartorelli, V.,
J. Huang,
Y. Hamamori, and L. Kedes.
1997.
Molecular mechanisms of myogenic coactivation by p300: direct interaction with the activation domain of MyoD and with the MADS box of MEF2C.
Mol. Cell. Biol.
17:1010-1026[Abstract].
|
| 45.
|
Scholl, T.,
S. K. Mahanta, and J. L. Strominger.
1997.
Specific complex formation between the type II bare lymphocyte syndrome-associated transactivators CIITA and RFX5.
Proc. Natl. Acad. Sci. USA
94:6330-6334[Abstract/Free Full Text].
|
| 46.
|
Schüle, R.,
P. Rangarajan,
S. Kliewer,
L. J. Ransone,
J. Bolado,
N. Yang,
I. M. Verma, and R. M. Evans.
1990.
Functional antagonism between oncoprotein c-Jun and the glucocorticoid receptor.
Cell
62:1217-1226[Medline].
|
| 47.
|
Schwiebert, L. M.,
R. P. Schleimer,
S. F. Radka, and S. J. Ono.
1995.
Modulation of MHC class II expression in human cells by dexamethasone.
Cell. Immunol.
165:12-19[Medline].
|
| 48.
|
Silacci, P.,
A. Mottet,
V. Steimle,
W. Reith, and B. Mach.
1994.
Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the transactivator gene CIITA.
J. Exp. Med.
180:1329-1336[Abstract/Free Full Text].
|
| 49.
|
Steimle, V.,
L. A. Otten,
M. Zufferey, and B. Mach.
1993.
Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome).
Cell
75:135-146[Medline].
|
| 50.
|
Steimle, V.,
C. A. Siegrist,
A. Mottet,
B. Lisowska-Grospierre, and B. Mach.
1994.
Regulation of MHC class II expression by interferon-gamma mediated by the transactivator gene CIITA.
Science
265:106-109[Abstract/Free Full Text].
|
| 51.
|
Tanaka, H.,
Y. Makino,
T. Miura,
F. Hirano,
K. Okamoto,
K. Komura,
Y. Sato, and I. Makino.
1996.
Ligand-independent activation of the glucocorticoid receptor by ursodeoxycholic acid. Repression of IFN-gamma-induced MHC class II gene expression via a glucocorticoid receptor-dependent pathway.
J. Immunol.
156:1601-1608[Abstract].
|
| 52.
|
Wright, K. L.,
B. J. Vilen,
Y. Itoh-Lindstrom,
T. L. Moore,
G. Li,
M. Criscitiello,
P. Cogswell,
J. B. Clarke, and J. P. Ting.
1994.
CCAAT box binding protein NF-Y facilitates in vivo recruitment of upstream DNA binding transcription factors.
EMBO J.
13:4042-4053[Medline].
|
| 53.
|
Yang, X. J.,
V. V. Ogryzko,
J. Nishikawa,
B. H. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.
Nature
382:319-324[Medline].
|
| 54.
|
Yang-Yen, H. F.,
J. C. Chambard,
Y. L. Sun,
T. Smeal,
T. J. Schmidt,
J. Drouin, and M. Karin.
1990.
Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction.
Cell
62:1205-1215[Medline].
|
| 55.
|
Zhou, H., and L. H. Glimcher.
1995.
Human MHC class II gene transcription directed by the carboxyl terminus of CIITA, one of the defective genes in type II MHC combined immune deficiency.
Immunity
2:545-553[Medline].
|
Molecular and Cellular Biology, January 1999, p. 941-947, Vol. 19, No. 1
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Voong, L. N., Slater, A. R., Kratovac, S., Cressman, D. E.
(2008). Mitogen-activated Protein Kinase ERK1/2 Regulates the Class II Transactivator. J. Biol. Chem.
283: 9031-9039
[Abstract]
[Full Text]
-
Xu, Y., Harton, J. A., Smith, B. D.
(2008). CIITA Mediates Interferon-{gamma} Repression of Collagen Transcription through Phosphorylation-dependent Interactions with Co-repressor Molecules. J. Biol. Chem.
283: 1243-1256
[Abstract]
[Full Text]
-
Bewry, N. N., Bolick, S. C. E., Wright, K. L., Harton, J. A.
(2007). GTP-dependent Recruitment of CIITA to the Class II Major Histocompatibility Complex Promoter. J. Biol. Chem.
282: 26178-26184
[Abstract]
[Full Text]
-
Rybtsova, N., Leimgruber, E., Seguin-Estevez, Q., Dunand-Sauthier, I., Krawczyk, M., Reith, W.
(2007). Transcription-coupled deposition of histone modifications during MHC class II gene activation. Nucleic Acids Res
35: 3431-3441
[Abstract]
[Full Text]
-
Drozina, G., Kohoutek, J., Nishiya, T., Peterlin, B. M.
(2006). Sequential Modifications in Class II Transactivator Isoform 1 Induced by Lipopolysaccharide Stimulate Major Histocompatibility Complex Class II Transcription in Macrophages. J. Biol. Chem.
281: 39963-39970
[Abstract]
[Full Text]
-
Tosi, G., Pilotti, E., Mortara, L., Barbaro, A. D. L., Casoli, C., Accolla, R. S.
(2006). Inhibition of human T cell leukemia virus type 2 replication by the suppressive action of class II transactivator and nuclear factor Y. Proc. Natl. Acad. Sci. USA
103: 12861-12866
[Abstract]
[Full Text]
-
Gialitakis, M., Kretsovali, A., Spilianakis, C., Kravariti, L., Mages, J., Hoffmann, R., Hatzopoulos, A. K., Papamatheakis, J.
(2006). Coordinated changes of histone modifications and HDAC mobilization regulate the induction of MHC class II genes by Trichostatin A. Nucleic Acids Res
34: 765-772
[Abstract]
[Full Text]
-
Zika, E., Fauquier, L., Vandel, L., Ting, J. P.-Y.
(2005). Interplay among coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-{gamma}-inducible MHC-II gene expression. Proc. Natl. Acad. Sci. USA
102: 16321-16326
[Abstract]
[Full Text]
-
Wang, A. H., Gregoire, S., Zika, E., Xiao, L., Li, C. S., Li, H., Wright, K. L., Ting, J. P., Yang, X.-J.
(2005). Identification of the Ankyrin Repeat Proteins ANKRA and RFXANK as Novel Partners of Class IIa Histone Deacetylases. J. Biol. Chem.
280: 29117-29127
[Abstract]
[Full Text]
-
Desfosses, Y., Solis, M., Sun, Q., Grandvaux, N., Van Lint, C., Burny, A., Gatignol, A., Wainberg, M. A., Lin, R., Hiscott, J.
(2005). Regulation of Human Immunodeficiency Virus Type 1 Gene Expression by Clade-Specific Tat Proteins. J. Virol.
79: 9180-9191
[Abstract]
[Full Text]
-
Gomez, J. A., Majumder, P., Nagarajan, U. M., Boss, J. M.
(2005). X Box-Like Sequences in the MHC Class II Region Maintain Regulatory Function. J. Immunol.
175: 1030-1040
[Abstract]
[Full Text]
-
Wang, Y., Curry, H. M., Zwilling, B. S., Lafuse, W. P.
(2005). Mycobacteria Inhibition of IFN-{gamma} Induced HLA-DR Gene Expression by Up-Regulating Histone Deacetylation at the Promoter Region in Human THP-1 Monocytic Cells. J. Immunol.
174: 5687-5694
[Abstract]
[Full Text]
-
Adamski, J., Benveniste, E. N.
(2005). 17{beta}-Estradiol Activation of the c-Jun N-Terminal Kinase Pathway Leads to Down-Regulation of Class II Major Histocompatibility Complex Expression. Mol. Endocrinol.
19: 113-124
[Abstract]
[Full Text]
-
Xu, Y., Wang, L., Buttice, G., Sengupta, P. K., Smith, B. D.
(2004). Major Histocompatibility Class II Transactivator (CIITA) Mediates Repression of Collagen (COL1A2) Transcription by Interferon {gamma} (IFN-{gamma}). J. Biol. Chem.
279: 41319-41332
[Abstract]
[Full Text]
-
Park, W. S., Bae, Y., Chung, D. H., Choi, Y.-L., Kim, B. K., Sung, Y. C., Choi, E. Y., Park, S. H., Jung, K. C.
(2004). T cell expression of CIITA represses Th1 immunity. Int Immunol
16: 1355-1364
[Abstract]
[Full Text]
-
Muhlethaler-Mottet, A., Krawczyk, M., Masternak, K., Spilianakis, C., Kretsovali, A., Papamatheakis, J., Reith, W.
(2004). The S Box of Major Histocompatibility Complex Class II Promoters Is a Key Determinant for Recruitment of the Transcriptional Co-activator CIITA. J. Biol. Chem.
279: 40529-40535
[Abstract]
[Full Text]
-
Adamski, J., Ma, Z., Nozell, S., Benveniste, E. N.
(2004). 17{beta}-Estradiol Inhibits Class II Major Histocompatibility Complex (MHC) Expression: Influence on Histone Modifications and CBP Recruitment to the Class II MHC Promoter. Mol. Endocrinol.
18: 1963-1974
[Abstract]
[Full Text]
-
Blois, J. T., Mataraza, J. M., Mecklenbrauker, I., Tarakhovsky, A., Chiles, T. C.
(2004). B Cell Receptor-induced cAMP-response Element-binding Protein Activation in B Lymphocytes Requires Novel Protein Kinase C{delta}. J. Biol. Chem.
279: 30123-30132
[Abstract]
[Full Text]
-
Osborne, A. R., Zhang, H., Fejer, G., Palubin, K. M., Niesen, M. I., Blanck, G.
(2004). Oct-1 Maintains an Intermediate, Stable State of HLA-DRA Promoter Repression in Rb-defective Cells: AN Oct-1-CONTAINING REPRESSOSOME THAT PREVENTS NF-Y BINDING TO THE HLA-DRA PROMOTER. J. Biol. Chem.
279: 28911-28919
[Abstract]
[Full Text]
-
Nagarajan, U. M., Long, A. B., Harreman, M. T., Corbett, A. H., Boss, J. M.
(2004). A Hierarchy of Nuclear Localization Signals Governs the Import of the Regulatory Factor X Complex Subunits and MHC Class II Expression. J. Immunol.
173: 410-419
[Abstract]
[Full Text]
-
Le Tulzo, Y., Pangault, C., Amiot, L., Guilloux, V., Tribut, O., Arvieux, C., Camus, C., Fauchet, R., Thomas, R., Drenou, B.
(2004). Monocyte Human Leukocyte Antigen-DR Transcriptional Downregulation by Cortisol during Septic Shock. Am. J. Respir. Crit. Care Med.
169: 1144-1151
[Abstract]
[Full Text]
-
Casoli, C., De Lerma Barbaro, A., Pilotti, E., Bertazzoni, U., Tosi, G., Accolla, R. S.
(2004). The MHC class II transcriptional activator (CIITA) inhibits HTLV-2 viral replication by blocking the function of the viral transactivator Tax-2. Blood
103: 995-1001
[Abstract]
[Full Text]
-
Xu, Y., Wang, L., Buttice, G., Sengupta, P. K., Smith, B. D.
(2003). Interferon {gamma} Repression of Collagen (COL1A2) Transcription Is Mediated by the RFX5 Complex. J. Biol. Chem.
278: 49134-49144
[Abstract]
[Full Text]
-
Tzortzakaki, E., Spilianakis, C., Zika, E., Kretsovali, A., Papamatheakis, J.
(2003). Steroid Receptor Coactivator 1 Links the Steroid and Interferon {gamma} Response Pathways. Mol. Endocrinol.
17: 2509-2518
[Abstract]
[Full Text]
-
Sisk, T. J., Nickerson, K., Kwok, R. P. S., Chang, C.-H.
(2003). Phosphorylation of class II transactivator regulates its interaction ability and transactivation function. Int Immunol
15: 1195-1205
[Abstract]
[Full Text]
-
Zika, E., Greer, S. F., Zhu, X.-S., Ting, J. P.-Y.
(2003). Histone Deacetylase 1/mSin3A Disrupts Gamma Interferon-Induced CIITA Function and Major Histocompatibility Complex Class II Enhanceosome Formation. Mol. Cell. Biol.
23: 3091-3102
[Abstract]
[Full Text]
-
Jabrane-Ferrat, N., Nekrep, N., Tosi, G., Esserman, L., Peterlin, B. M.
(2003). MHC class II enhanceosome: how is the class II transactivator recruited to DNA-bound activators?. Int Immunol
15: 467-475
[Abstract]
[Full Text]
-
Raval, A., Weissman, J. D., Howcroft, T. K., Singer, D. S.
(2003). The GTP-Binding Domain of Class II Transactivator Regulates Its Nuclear Export. J. Immunol.
170: 922-930
[Abstract]
[Full Text]
-
Nagarajan, U. M., Bushey, A., Boss, J. M.
(2002). Modulation of Gene Expression by the MHC Class II Transactivator. J. Immunol.
169: 5078-5088
[Abstract]
[Full Text]
-
Mudhasani, R., Fontes, J. D.
(2002). The Class II Transactivator Requires brahma-Related Gene 1 To Activate Transcription of Major Histocompatibility Complex Class II Genes. Mol. Cell. Biol.
22: 5019-5026
[Abstract]
[Full Text]
-
Sengupta, P. K., Fargo, J., Smith, B. D.
(2002). The RFX Family Interacts at the Collagen (COL1A2) Start Site and Represses Transcription. J. Biol. Chem.
277: 24926-24937
[Abstract]
[Full Text]
-
Shao, L., Sperber, K.
(2002). Impaired Regulation of HLA-DR Expression in Human Immunodeficiency Virus-Infected Monocytes. CVI
9: 739-746
[Full Text]
-
Morris, A. C., Beresford, G. W., Mooney, M. R., Boss, J. M.
(2002). Kinetics of a Gamma Interferon Response: Expression and Assembly of CIITA Promoter IV and Inhibition by Methylation. Mol. Cell. Biol.
22: 4781-4791
[Abstract]
[Full Text]
-
Frontini, M., Imbriano, C., diSilvio, A., Bell, B., Bogni, A., Romier, C., Moras, D., Tora, L., Davidson, I., Mantovani, R.
(2002). NF-Y Recruitment of TFIID, Multiple Interactions with Histone Fold TAFIIs. J. Biol. Chem.
277: 5841-5848
[Abstract]
[Full Text]
-
Holling, T. M., van der Stoep, N., Quinten, E., van den Elsen, P. J.
(2002). Activated Human T Cells Accomplish MHC Class II Expression Through T Cell-Specific Occupation of Class II Transactivator Promoter III. J. Immunol.
168: 763-770
[Abstract]
[Full Text]
-
Gobin, S. J. P., van Zutphen, M., Westerheide, S. D., Boss, J. M., van den Elsen, P. J.
(2001). The MHC-Specific Enhanceosome and Its Role in MHC Class I and {beta}2-Microglobulin Gene Transactivation. J. Immunol.
167: 5175-5184
[Abstract]
[Full Text]
-
Zhu, X.-S., Ting, J. P.-Y.
(2001). A 36-Amino-Acid Region of CIITA Is an Effective Inhibitor of CBP: Novel Mechanism of Gamma Interferon-Mediated Suppression of Collagen {alpha}2(I) and Other Promoters. Mol. Cell. Biol.
21: 7078-7088
[Abstract]
[Full Text]
-
Harton, J. A., Zika, E., Ting, J. P.-Y.
(2001). The Histone Acetyltransferase Domains of CREB-binding Protein (CBP) and p300/CBP-associated Factor Are Not Necessary for Cooperativity with the Class II Transactivator. J. Biol. Chem.
276: 38715-38720
[Abstract]
[Full Text]
-
Sisk, T. J., Roys, S., Chang, C.-H.
(2001). Self-Association of CIITA and Its Transactivation Potential. Mol. Cell. Biol.
21: 4919-4928
[Abstract]
[Full Text]
-
Li, G., Harton, J. A., Zhu, X., Ting, J. P.-Y.
(2001). Downregulation of CIITA Function by Protein Kinase A (PKA)-Mediated Phosphorylation: Mechanism of Prostaglandin E, Cyclic AMP, and PKA Inhibition of Class II Major Histocompatibility Complex Expression in Monocytic Lines. Mol. Cell. Biol.
21: 4626-4635
[Abstract]
[Full Text]
-
Kanazawa, S., Peterlin, B. M.
(2001). Combinations of dominant-negative class II transactivator, p300 or CDK9 proteins block the expression of MHC II genes. Int Immunol
13: 951-958
[Abstract]
[Full Text]
-
Linhoff, M. W., Harton, J. A., Cressman, D. E., Martin, B. K., Ting, J. P.-Y.
(2001). Two Distinct Domains within CIITA Mediate Self-Association: Involvement of the GTP-Binding and Leucine-Rich Repeat Domains. Mol. Cell. Biol.
21: 3001-3011
[Abstract]
[Full Text]
-
Gourley, T. S., Chang, C.-H.
(2001). Cutting Edge: The Class II Transactivator Prevents Activation-Induced Cell Death by Inhibiting Fas Ligand Gene Expression. J. Immunol.
166: 2917-2921
[Abstract]
[Full Text]
-
Magner, W. J., Kazim, A. L., Stewart, C., Romano, M. A., Catalano, G., Grande, C., Keiser, N., Santaniello, F., Tomasi, T. B.
(2000). Activation of MHC Class I, II, and CD40 Gene Expression by Histone Deacetylase Inhibitors. J. Immunol.
165: 7017-7024
[Abstract]
[Full Text]
-
Spilianakis, C., Papamatheakis, J., Kretsovali, A.
(2000). Acetylation by PCAF Enhances CIITA Nuclear Accumulation and Transactivation of Major Histocompatibility Complex Class II Genes. Mol. Cell. Biol.
20: 8489-8498
[Abstract]
[Full Text]
-
Hake, S. B., Masternak, K., Kammerbauer, C., Janzen, C., Reith, W., Steimle, V.
(2000). CIITA Leucine-Rich Repeats Control Nuclear Localization, In Vivo Recruitment to the Major Histocompatibility Complex (MHC) Class II Enhanceosome, and MHC Class II Gene Transactivation. Mol. Cell. Biol.
20: 7716-7725
[Abstract]
[Full Text]
-
Ito, K., Barnes, P. J., Adcock, I. M.
(2000). Glucocorticoid Receptor Recruitment of Histone Deacetylase 2 Inhibits Interleukin-1beta -Induced Histone H4 Acetylation on Lysines 8 and 12. Mol. Cell. Biol.
20: 6891-6903
[Abstract]
[Full Text]
-
Harton, J. A., Ting, J. P.-Y.
(2000). Class II Transactivator: Mastering the Art of Major Histocompatibility Complex Expression. Mol. Cell. Biol.
20: 6185-6194
[Full Text]
-
Sisk, T. J., Gourley, T., Roys, S., Chang, C.-H.
(2000). MHC Class II Transactivator Inhibits IL-4 Gene Transcription by Competing with NF-AT to Bind the Coactivator CREB Binding Protein (CBP)/p300. J. Immunol.
165: 2511-2517
[Abstract]
[Full Text]
-
Zhu, X.-S., Linhoff, M. W., Li, G., Chin, K.-C., Maity, S. N., Ting, J. P.-Y.
(2000). Transcriptional Scaffold: CIITA Interacts with NF-Y, RFX, and CREB To Cause Stereospecific Regulation of the Class II Major Histocompatibility Complex Promoter. Mol. Cell. Biol.
20: 6051-6061
[Abstract]
[Full Text]
-
Taxman, D. J., Cressman, D. E., Ting, J. P.-Y.
(2000). Identification of Class II Transcriptional Activator-Induced Genes by Representational Difference Analysis: Discoordinate Regulation of the DN{alpha}/DO{beta} Heterodimer. J. Immunol.
165: 1410-1416
[Abstract]
[Full Text]
-
Aittomaki, S., Pesu, M., Groner, B., Janne, O. A., Palvimo, J. J., Silvennoinen, O.
(2000). Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fc{gamma} Receptor I in Monocytes. J. Immunol.
164: 5689-5697
[Abstract]
[Full Text]
-
Masternak, K., Muhlethaler-Mottet, A., Villard, J., Zufferey, M., Steimle, V., Reith, W.
(2000). CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev.
14: 1156-1166
[Abstract]
[Full Text]
-
Saifuddin, M., Roebuck, K. A., Chang, C.-h., Ting, J. P. Y., Spear, G. T.
(2000). Cutting Edge: Activation of HIV-1 Transcription by the MHC Class II Transactivator. J. Immunol.
164: 3941-3945
[Abstract]
[Full Text]
-
Nagarajan, U. M., Peijnenburg, A., Gobin, S. J. P., Boss, J. M., van den Elsen, P. J.
(2000). Novel Mutations Within the RFX-B Gene and Partial Rescue of MHC and Related Genes Through Exogenous Class II Transactivator in RFX-B-Deficient Cells. J. Immunol.
164: 3666-3674
[Abstract]
[Full Text]
-
Boisvert, F.-M., Hendzel, M. J., Bazett-Jones, D. P.
(2000). Promyelocytic Leukemia (PML) Nuclear Bodies Are Protein Structures that Do Not Accumulate RNA. J. Cell Biol.
148: 283-292
[Abstract]
[Full Text]
-
Kretsovali, A., Spilianakis, C., Dimakopoulos, A., Makatounakis, T., Papamatheakis, J.
(2001). Self-association of Class II Transactivator Correlates with Its Intracellular Localization and Transactivation. J. Biol. Chem.
276: 32191-32197
[Abstract]
[Full Text]