Received 31 March 1999/Returned for modification 14 May
1999/Accepted 12 July 1999
Yeast strains lacking the yeast nuclear cap-binding complex (yCBC)
are viable, although impaired in growth. We have taken advantage of
this observation to carry out a genetic screen for components that show
synthetic lethality (SL) with a cbp20-
cbp80- double mutation. One set of SL interactions was
due to mutations that were complemented by components of U1 small
nuclear RNP (snRNP) and the yeast splicing commitment complex. These
interactions confirm the role of yCBC in commitment complex formation.
Physical interaction of yCBC with the commitment complex components
Mud10p and Mud2p, which may directly mediate yCBC function, was
demonstrated. Unexpectedly, we identified multiple SL mutations that
were complemented by Cbf5p and Nop58p. These are components of the two
major classes of yeast small nucleolar RNPs, which function in the
maturation of rRNA precursors. Mutants lacking yCBC were found to be
defective in rRNA processing. Analysis of the yCBC deletion phenotype
suggests that this is likely to be due to a defect in the splicing of a subset of ribosomal protein mRNA precursors.
 |
INTRODUCTION |
Most eukaryotic organisms have a
complement of three specialized RNA polymerases (pol I, pol II, and pol
III) responsible mainly for rRNA, mRNA, and tRNA synthesis,
respectively. pol II transcripts have characteristic 5' ends
consisting of a 7-methylguanosine cap structure attached by a 5'-5'
phosphotriester linkage to the first encoded nucleotide of the
transcript (66). Aside from providing protection against
5'-to-3' exonuclease activities, the cap structure plays important
roles at multiple steps in the function of pol II transcripts. In
vertebrates, the cap has been shown to stimulate pre-mRNA splicing
(30, 37, 38, 57), pre-mRNA 3' end formation by cleavage and
polyadenylation (11, 15, 19, 23), export from the nucleus of
U small nuclear RNAs (snRNAs) (22, 32), and the initiation
of translation (67).
The effect of the cap in mRNA translation is mediated by eukaryotic
initiation factor 4F (eIF-4F), a multicomponent complex whose
cap-binding subunit is eIF-4E (67). In contrast, the nuclear functions of the cap are all thought to be mediated by CBC, the nuclear
cap-binding complex. CBC consists of a heterodimer of two proteins,
CBP80 and CBP20 (30, 31, 33, 34), and evidence from in vivo
and in vitro experiments supports its role in both pre-mRNA splicing
and U snRNA export (30, 31, 44). CBC associates with the cap
structures of pre-mRNA and nuclear mRNA in vivo and accompanies mRNA
through nuclear pore complexes to the cytoplasm (78). There
is, however, no evidence that CBC plays an important role in the
nuclear export of mRNA, in contrast to its function in the export of U
snRNAs (31, 32).
While the in vitro evidence for the function of CBC in cleavage and
polyadenylation is direct (15), the current in vivo data on
this topic are less definitive. It has, however, been observed that in
cells whose largest pol II subunit is truncated, transcripts are not
efficiently capped (9, 48), and the majority of the RNAs
produced thus lack a high-affinity CBC binding site. Such uncapped
transcripts are neither spliced nor cleaved and polyadenylated
efficiently (49). Although the latter effect may reflect
direct interaction between the carboxy-terminal domain of the pol II
subunit and the cleavage and polyadenylation machinery (24,
49), the lack of CBC binding to the transcripts may also contribute to the inefficiency of their 3' end formation.
CBC has been identified in yeast (10, 20, 43). Yeast CBP80
(yCBP80) is encoded by the GCR3 gene (75), and
yCBP20 is encoded by MUD13 (10, 20). In contrast
to the data for multicellular eukaryotes discussed above, the data
reported on CBC function in yeast relate only to pre-mRNA splicing.
mud13 and gcr3 strains exhibit reduced splicing
of a reporter gene that carries a nonconsensus 5' splice site
(10) or a nonconsensus sequence in the branchpoint region
(15a). In vitro splicing is also decreased in extracts that
were biochemically depleted of CBC (43) or extracts from a
mud13 strain (10). Yeast strains that lack RNA
capping activity do not show obvious defects in mRNA cleavage or
polyadenylation (16, 63), and extracts from yeast cells that
lack CBC do not exhibit defects in 3' end formation in vitro
(15a). It is unclear whether yeast U snRNAs resemble their
vertebrate counterparts in being transported out of the nucleus during
maturation, and yCBC function in U snRNA export has therefore not yet
been tested.
In pre-mRNA splicing, yCBC and human CBC (hCBC) play analogous roles.
They increase the efficiency with which U1 snRNP binds to the
cap-proximal 5' splice site and thus increase the rate of recognition
and splicing of the cap-proximal intron (10, 43, 44). In
biochemical terms, this manifests itself as an increase in commitment
complex formation (64) in the presence of CBC (10,
43). Although the functions in pre-mRNA splicing of yCBC and hCBC
are therefore likely to be mechanistically related, the detailed
mechanism by which CBC exerts its role is not known. Attempts to
demonstrate direct interaction between hCBC and human U1 snRNP were
unsuccessful (44), resulting in the hypothesis that one or
more unknown factors mediate the CBC-dependent increase in U1 snRNP-5'
splice site interaction.
To identify this intermediary and, more generally, to obtain additional
insight into CBC function, a genetic analysis of CBC in
Saccharomyces cerevisiae has been undertaken. Twelve
distinct genes whose mutation leads to lethality in the absence of yCBC are identified. Complementation of these defects reveals that the great
majority of these genetic interactions can be explained on the basis of
yCBC function in the commitment complex assembly step of pre-mRNA
splicing. Further, evidence of physical interaction between yCBC and
two commitment complex components, Mud2p and Mud10p, is presented.
| |
MATERIALS AND METHODS |
DNA constructs.
To construct pHT80, the GCR3 gene
was PCR amplified from genomic DNA from position 
800 before the ATG
to position 290 after the stop codon of yCBP80. The amplified DNA was
digested with SmaI and SalI and cloned into the
same sites of the polylinker of pHT4467, a single-copy plasmid with
ADE2 and URA markers. The functionality of the
gene was checked by its ability to restore growth and splicing
efficiency to wild-type levels in the cbp80- strain.
pSEY8-yCBP20, a full-length yCBP20 clone from a yeast genomic library
(20), was digested with HindIII and repaired
with Klenow enzyme to obtain a 1-kbp fragment that was cloned using the
SmaI site of pHT4467 or pHT80 to generate pHT20 and pHT8020, respectively. The expression of yCBP20 and yCBP80 in these
pHT4467-derived plasmids was assayed by growth restoration of the
cbp disrupted strains and by Western blotting using extracts
isolated from cbp20-, cbp80-, and
cbp20/80- strains transformed with pHT20, pHT80, and
pHT8020 respectively.
To construct YEp20, the open reading frame (ORF) of MUD13
was amplified from pSEY8-yCBP20 (20). The fragment was
digested with BamHI and HindIII and cloned in
the same sites under the GAL10 promoter of YEp51, a
multicopy plasmid with a LEU marker (62).
Similarly, to construct YEp80, the ORF of yCBP80 was amplified with
oligonucleotides that avoid intronic sequences. The PCR fragment was
end repaired and cloned in the SmaI site of pBluescript SK+ (Stratagene) to generate pBS-GCR3. This plasmid was then
digested with EagI and BglI; the ends were
repaired with Klenow enzyme and digested with SalI. The
fragment containing GCR3 was cloned under the control of the
GAL10 promoter in YEp51. The expression of yCBP80 and yCBP20
in YEp51-derived plasmids was analyzed by growth rate restoration and
by Western blotting.
Deletion of yCBC genes.
The techniques used for growing
yeast are described elsewhere (68). Yeast cells were
transformed with DNA by the lithium acetate method (29).
Strains used for the synthetic lethal (SL) screen were derived from
YJV159 (MATa ade2 ade3 his3 leu2-3,112 trp1
ura3) (76a).
The cbp20- strain (MATa ade2 ade3 his3
leu2-3,112 trp1 ura3 ycbp20/mud13::HIS3) was
obtained by transfection of YJV159 with a linear DNA in which the
HIS3 gene from plasmid Ydp-H (5) had been
inserted between the BclI and SnaBI sites of
MUD13. Transformed cells were grown on SD-His medium, and
the MUD13 deletion was confirmed by PCR amplification of
genomic DNA and Southern blotting.
To obtain the cbp80- strain (MATa ade2
ade3 his3 leu2-3,112 rp1 ura3 ycbp80/gcr3::TRP1) and the
double-knockout strain (MATa ade2 ade3 his3
leu2-3,112 trp1 ura3 ycbp80/gcr3::TRP1 ycbp20/mud13::HIS3), YJV159 and cbp20-
cells were transfected with a linear DNA carrying a disrupted copy of
the GCR3 gene. The sequence from 20 nucleotides before the
ATG to position 2700, just after the last ATG in frame, were replaced
by the TRP1 gene from plasmid Ydp-W (5).
Transformed cells where grown on SD-Trp medium, and the GCR3
deletion was confirmed by PCR amplification of genomic DNA and Southern
blotting. The doubling times of these strains were measured, and the
expression of yCBP80 and yCBP20 was analyzed by Western blotting. A
disruption of GCR3 was also generated in a MAT
strain. A GCR3 gene fragment from the SnaBI site,
200 nucleotides upstream of the ATG, to the BglII site was replaced by the HIS3 gene in strain D209 (MAT ade2
leu2 ura3 his3 rp1). PCR amplification of genomic DNA and Southern
blotting were used to verify the genotype. This strain was crossed with YJV159, the diploid was sporulated and tetrads were dissected. Strain
cbp80- (MAT ade2 ade3 leu2 trp1 ura3
ycbp80/gcr3::HIS3) was identified among the haploid
progeny by screening for the desired phenotypes. The doubling time of
this strain was 230 min, similar to that of a cbp80-
strain (Fig. 1).
The ssd1- allele was constructed by one-step PCR
(4) using the HIS3 selective marker with
integration targeting sequences that precisely delete the entire ORF.
Doubling time and viability tests.
Yeast control strain or
strains disrupted for GCR3, MUD13, or both were
grown in liquid medium to mid-log phase (optical density at 600 nm of
approximately 0.8). Cells were then diluted 20 and 40 times, and
optical density was monitored. Doubling time was calculated during
logarithmic growth. Dilutions of these strains were also plated on YPD
and allowed to grow for 48 h at 30°C (Fig. 1). Similarly, temperature-sensitive LUC
mutants (see below for description) were checked for viability. Cells
grown to mid-log phase were diluted and shifted to 37°C, and growth
was monitored.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
yCBC affects vegetative growth rate. Strain YJV159 (wild
type) was disrupted for GCR3 (cbp80-), for
MUD13 (cbp20-), or for both (cbp20/80-). These strains
were grown to mid-log phase, and four dilutions of each were plated to
compare the growth rates. The doubling time of each strain was also
assayed in liquid culture and is indicated on the right.
|
|
Mutagenesis and the SL screen.
An SL screen was performed as
described elsewhere (39). The cbp20/80- strain
was transformed with plasmid pHT8020, which encodes yCBP80, yCBP20,
Ura3p, and Ade3p. The resulting cells are red due to the
ADE3-ade2 combination. When cells were grown on 4%
glucose-YPD medium, a red to white sectoring phenotype was observed,
indicating that the strain could lose plasmid pHT8020. Cells plated on
4% glucose-YPD were exposed to 254-nm UV light (Desaga) for 30 s
to allow 10% survival; 2.8 × 105 colonies were then
screened, and 560 colonies that did not sector were isolated. Of these,
155 did not grow on 5-fluoro-orotic acid (FOA) plates, indicating that
they needed pHT8020 to survive; 42 clones showed a red color and FOA
sensitivity at different temperatures. To eliminate false positives,
these strains were transformed with plasmid YEp80, YEp20, or both.
Thirty-two strains were then able to survive on FOA plates, indicating
that the phenotype was indeed yCBC related. Most of the strains needed
both yCBP80 and yCBP20 to survive on FOA plates, but some showed weak
growth with only yCBP20 or yCBP80.
A genetic characterization was then carried out. The mutants were
crossed to the cbp80- strain, and in all cases red to white sectoring was observed, indicating that all the mutations were
recessive. Diploids were sporulated, and 10 to 12 tetrads were
dissected and analyzed phenotypically. In all cases where four spores
were recovered, the sectoring phenotype and the FOA lethality
segregated 2:2, indicating that the synthetic lethality was probably
caused by mutation at a single locus. As some of the mutants showed
temperature sensitivity, these crosses also allowed determination of
whether temperature sensitivity was linked to synthetic lethality.
Finally, the mutant strains were crossed pairwise and plated on FOA
plates. Combinations that could not grow were assigned to a
complementation group. The 32 strains were sorted into 21 complementation groups named LUC, as they are lethal unless CBC is produced.
Cloning of genes that complement LUC1 to LUC14.
Mutants were
transformed with a low-copy-number plasmid library (6),
using conditions that predict that five times the whole yeast genome
was being transformed and a probability of recovery higher than 95%.
Transformants were selected on minimal plates. The mutant strains that
showed temperature sensitivity linked to the synthetic lethality were
grown at 37°C after transformation. The other strains were grown at
30°C, and the sectoring phenotype was allowed to develop after
replica plating to YPD-4% glucose, using nitrocellulose membranes
(Protran BA 85/20; 0.45-mm pore size; Schleicher & Schuell). Plates
were screened, and sectoring colonies were plated on FOA plates.
Plasmids containing complementing genomic DNA fragments were recovered
from the positives and amplified in Escherichia coli
XL1-Blue. Retransformation into the mutant strains and rechecking of
the sectoring/FOA or temperature resistance phenotype was performed.
Insert DNA boundaries were sequenced and compared to the MIPS (Munich
Information Centre for Protein Sequences) yeast database
(50-52) to define the complementing region. As the average
insert size of the library was 10 kb, several genes were usually
present in the inserts. When several positives were isolated from a
single mutant strain, the overlapping region of the inserts helped to
define the complementing ORF. When two or more genes were still
partially or totally included in the overlap, they were cloned
independently in pRS315, a single-copy plasmid with a LEU
marker (69) and retransformed in the mutant strain. Plasmids
expressing Mud1p, and Mud2p, and SmD3p were kindly provided by M. Rosbash and B. Séraphin. Sectoring phenotype and FOA (or temperature) resistance were used to define the complementing ORF.
yCBC column preparation and binding assays.
The yCBC column
was prepared as described previously (20, 43). After
preparation, 10 µl of the column was boiled in sodium dodecyl sulfate
(SDS) sample buffer without reducing agents, and the proteins bound to
it were separated by electrophoresis in an SDS-12% polyacrylamide gel
and stained with Coomassie blue dye. Only two proteins were detected.
Western blotting analysis identified them as yCBP80 and yCBP20. An
unrelated antibody column was incubated with yeast extracts under
conditions similar to those used with a negative control.
The U1 snRNP proteins isolated in the screen and Mud2p were labeled
with [35S]methionine in an in vitro T7 coupled
transcription-translation reaction (TNT-T7 kit; Promega). The T7
promoter-containing template was obtained as a PCR amplification
product. The 5' oligonucleotides used contained the T7 promoter
sequence followed by 20 nucleotides around the ATG region of the ORF.
In the case of MUD1, the 5' oligonucleotide was longer and
included the sequence from the ATG to the sixth nucleotide after the
intron. The 3' end oligonucleotides used contained the sequence
complementary to the last 20 nucleotides of the ORF. The PCR was done
with standard conditions for cloned Pfu polymerase
(Stratagene), 1 µg of plasmid DNA, and 20 to 25 cycles. The PCR
product was purified by using a Qiaquick PCR purification kit (Qiagen);
0.5 µg of the amplified product was incubated in a 50-µl reaction
mixture with the reticulocyte lysate TNT-T7 mix (Promega) that couples
transcription and translation. The labeled proteins were then diluted
to 500 µl with phosphate-buffered saline-8.5% glycerol and
centrifuged through a Nanosep 30K filter (Pall Filtron) at 10,000 rpm
(Biofuge A; Heraeus) at 4°C until a 10-fold concentration was
achieved. This step was repeated twice to eliminate the unincorporated [35S]methionine.
The control and yCBC columns were washed in binding buffer (50 mM Tris
[pH 7.5], 150 mM NaCl, and 10% glycerol in complete protease
inhibitor cocktail from Boehringer Mannheim); 15 µl of control or
yCBC column beads (corresponding to 1.5 µg of yCBC) was mixed with 3 µl of labeled proteins in a final volume of 200 µl of binding
buffer. The mixture was rotated for 2 h at 4°C. The beads were
pelleted, and the supernatant was recovered. The beads were washed
three times with 1 ml of binding buffer. Supernatant and pellet
fractions were separated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and visualized by fluorography.
Northern hybridization.
RNA was extracted as described
previously (71), separated by electrophoresis, and
transferred to a filter. For hybridization to snoRNAs, the
oligonucleotides anti-U3 (5'-CUAUAGAAAUGAUCCU), anti-U14
(5'-TCACTCAGACATCCTAGG), anti-snR10
(5'-CUIUUAAAUUUICIUU), snR3 (TCGATCTTCGTACTGTCT),
and anti-snR30 (ATGTCTGCAGTATGGTTTTAC) were used.
Oligonucleotide anti-U3 is largely composed of 2'-O-methyl RNA.
For hybridization to mRNAs, the oligonucleotides used were anti-ACT1
(5'-TCTTGGTCTACCGACGATAGATGGGAAGACAGCA), anti-RPS9A
(5'-GTTGTATACTTTTGTATTTCT), anti-RPS9B
(5'-TGTTGCTTAGTCTTAGTTG), anti-RPS11A
(5'-CTTGCTGGTTGCTTAATTT), anti-RPS11B
(5'-TCCCTGGCTTGATACGTT), anti-RPS3
(5'-GACACCGTCAGCGACTAG), anti-RPS10A
(5'-GCTTGGTTGAAATCCTTC), anti-RPL16A
(5'-CTCGATTTGTTCTTCACCTTC), anti-RPL16B
(5'-CCAACCAACCAACAATAATAC), anti-RPL22A
(5'-CTTAATCTGTTGTTTTGGTGG), anti-RPL22B
(5'-GTGGTTGATATTTGTGAAACG), anti-RPL10
(5'-CTGTAACATCTAGCTGGTC), anti-RPL30
(5'-GGTTGATAGAATCTTGGGAT), anti-RPL28
(5'-GTGCTTTCTGTGCTTACCGATACGACCTTTACCG), and anti-RPL25 (TTTCTTAGCGGCAGTAGCC).
For pre-rRNA hybridization, oligonucleotides depicted in Fig. 4A were
used: 001 (5'-CCAGTTACGAAAATTCTTG), 002 (5'-GCTCTTTGCTCTTGCC), 003 (5'-TGTTACCTCTGGGCCC),
007 (5'-CTCCGCTTATTGATATGC), 008 (5'-CATGGCTTAATCTTTGAGAC), and 013 (5'-GGCCAGCAATTTCAAGTTA).
| |
RESULTS |
It was previously determined that GCR3, which encodes
yCBP80, and MUD13, which encodes yCBP20, are not essential
genes in S. cerevisiae (10, 75), strongly
suggesting that yCBC is not necessary for yeast vegetative growth. To
further investigate this, the growth of yeast strains lacking
GCR3 (cbp80-), MUD13 (cbp20-) or both genes (cbp20/80-) was
analyzed. As shown in Fig. 1, strains that lack either CBP80 or CBP20
individually grow slowly at 30°C on rich medium either on plates or
in liquid culture. The growth defects are similar at higher (37°C) or
lower (23°C) temperatures (data not shown). Analysis of extracts made
from the strains by Western blotting showed that while the
cbp20- strain accumulated amounts of yCBP80 similar to
those accumulated by the wild-type strain, the cbp80-
strain accumulated fourfold less yCBP20 than the wild type, suggesting
that yCBP20 is unstable in the absence of yCBP80 (data not shown).
Since CBP80 and CBP20 need to heterodimerize to bind to capped RNA
(30, 31) it was not surprising that the two single-deletion
strains showed similar growth defects. It was unexpected, however, that
a strain lacking both yCBP80 and yCBP20 (cbp20/80-) grew
better than strains with either single deletion (Fig. 1). This
suggested that the production of either CBP80 or CBP20 alone had a
dominant negative effect on growth.
SL interactions.
Since a yeast strain lacking both yCBP80 and
yCBP20 could grow reasonably well, the double-deletion background
served as the basis for a search for genes whose mutation would prove
lethal in the absence of CBC (see Materials and Methods for details). In this way, 21 complementation groups that were lethal unless CBC was
produced (LUC) were characterized (see Materials and Methods). Fourteen
of these complementation groups were rescued by transformation with
low-copy-number plasmids containing yeast genomic DNA inserts and named
LUC1 to LUC14. In 12 of the 14 cases, the gene responsible for
complementation was identified by further analysis, usually through
transformation with subfragments of the original DNA insert of the
complementing plasmid (Table 1). Many of
these complementation groups were represented only once in the
collection of SL strains, showing that the screen is unlikely to be
saturated.
The LUC genes can be divided into four main groups: (i) those that
encode splicing factors that are components of yeast commitment complexes (LUC1 to LUC6); (ii) components of yeast small nucleolar RNPs
(snoRNPs) (LUC8 and LUC9); (iii) genes with a function in RNA
metabolism that seems unconnected to known CBC functions (LUC10 and
LUC13); and (iv) genes with no obvious direct connection to RNA
metabolism (LUC11, LUC12, and LUC14).
Genetic interactions between yCBC and splicing factors.
MUD13, which encodes yCBP20, was characterized on the basis
of a mutant allele that caused synthetic lethality when present in
combination with an otherwise viable mutant form of U1 snRNA (10). This finding, together with biochemical data (10,
43), showed that yCBC functioned in the commitment complex
assembly step of yeast pre-mRNA splicing. Commitment complexes form on intron-containing pre-mRNAs in the absence of ATP hydrolysis. There are
two commitment complexes, CC1 and CC2, both of which depend on U1
snRNP-5' splice site interaction (64, 65). In addition, CC2
requires interaction between Mud2p and branch point binding protein
(BBP), which bind at and near the branchpoint region of the intron, and
U1 snRNP bound at the 5' splice site (1, 2, 7, 65). The
identities of genes complementing LUC1 to LUC6 are consistent with the
function of yCBC in commitment complex assembly.
LUC1, LUC2, and LUC6 were initially assigned to this category.
LUC1/MUD1 encodes the yeast U1A homologue and also causes
synthetic lethality with the truncated U1 snRNA used to identify
MUD13 (46). U1A is a conserved component of U1
snRNP. LUC2/MUD2 was also found in the truncated U1 snRNA SL
screen and encodes the yeast homologue of U2AF65 (1). Both
U2AF65 and Mud2p are involved in very early steps of intron recognition
(1, 2, 7, 61, 83). LUC6 is complemented by SMD3,
which encodes one of the core components of the spliceosomal snRNPs
(60; see also reference 47).
Although not specific for U1 snRNP, in fact an SMD3 allele
that causes synthetic lethality together with a mutant U2 snRNA has
previously been isolated (81); mutation of SmD3p could be
expected to affect U1 snRNP function at early stages of splicing.
The product of NAM8, which complements LUC3, was originally
proposed to have a role in mitochondrial RNA splicing (13)
and later implicated in meiosis-specific nuclear pre-mRNA splicing events (54). Recently, however, it was identified, along
with the products of SNU56/MUD10, which complements LUC4,
and SNU71, which complements LUC5, as a novel component of
the yeast U1 snRNP (21). These three proteins are all stably
associated with yeast U1 snRNA but are not present in vertebrate U1
snRNP (14, 21). Since yCBC and U1 snRNP are both commitment
complex components, these findings provide a reasonable explanation for
the synthetic lethality that results when these three genes are mutated
on a yCBC null background.
YDL087c, which complements LUC7, is not functionally
characterized. We have found putative vertebrate homologues by
examination of the DNA databases. These homologues have SR domains,
characteristic of a large family of metazoan splicing factors (59,
82), consistent with the possibility that the LUC7 SL phenotype
is also due to mutation of a protein involved in pre-mRNA splicing.
Further characterization of this complementation group is in progress.
Physical interaction between CBC and yeast splicing factors.
As described in the introduction, hCBC was shown to stimulate U1 snRNP
binding to the cap-proximal 5' splice site but not to interact directly
with U1 snRNP (44). This suggested that one or more
mediators of hCBC-U1 snRNP interaction must exist. The analogous role
in splicing of yCBC, and the presence of several additional proteins in
yeast U1 snRNP compared to its human counterpart (14, 21),
suggested that one or more of these proteins might form a direct
interaction with yCBC.
To examine this possibility, yCBC was purified from yeast extracts by
immune-affinity chromatography using an antibody directed against the N
terminus of yCBP80 (20, 43). The column was washed
extensively with buffer containing 1 M NaCl; upon subsequent SDS
elution, only yCBP80 and yCBP20 were detected by Coomassie blue
staining. Mud2p, Snu71p, and Mud10p were synthesized and labeled with
[35S]methionine by in vitro transcription and translation
and passed over the column. Mud2p and Mud10p were clearly retained on
the column (Fig. 2, lanes 1 to 5 and 11 to
15), while Snu71p (lanes 6 to 10), Nam8p
and Luc7p (data not shown) were not retained. Since yCBC could not be
prepared in recombinant form but had to be purified from yeast extract,
and since the Mud2p and Mud10p proteins were produced in reticulocyte
lysate, we cannot be certain that the interactions observed are direct
rather than mediated by a factor in the lysate, nor is it certain
whether posttranslational modifications are required for the
interactions. Indeed, Mud10p produced in E. coli lysate did
not bind to the CBC column (data not shown), suggesting a possible role
for modification of this protein in CBC interaction. Despite these
caveats, the interactions observed make Mud2p and Mud10p strong
candidates for mediating the interactions that allow yCBC to stimulate
commitment complex formation. Additional support for this possibility
comes from the observation that yCBC and Mud10p were found to interact
by the two-hybrid method in yeast (16a).
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
yCBC interacts with Mud2p and with Mud10p.
[35S]methionine-labeled Mud2p/Luc2p (lanes 1 to 5),
Snu71p/Luc5p (lanes 6 to 10), and Mud10p/Luc4p (lanes 11 to 15) were
incubated with a control column (MOCK) or with a yCBC column as
indicated. Samples were fractionated into nonbound supernatant (S) and
bound pellet (P) fractions and analyzed by SDS-polyacrylamide gel
electrophoresis. In lanes 1, 6, and 11, 25% of the input protein was
loaded.
|
|
yCBC deletion strains exhibit defects in rRNA processing.
LUC8
(two strains) and LUC9 (five strains) were complemented by the
CBF5 and NOP58 genes, respectively. Cbf5p and
Nop58p are both components of snoRNP complexes. The large number of
snoRNA species present in eukaryotic cells can be divided into two
families on the basis of conserved sequence elements (reviewed in
reference 41). Nop58p associates with the box C+D
family of snoRNAs (18, 80), most of which function as guides
to direct ribose methylation on pre-rRNA (35, 72). Cbf5p is
likely to be the rRNA pseudouridine synthase which is guided by the box
H+ACA family of snoRNAs to sites of pseudouridine formation on pre-rRNA
(17, 40, 55, 72). In addition to their roles in pre-rRNA
modification, both classes of snoRNA include members that are critical
for pre-rRNA processing at three early cleavage sites designated
A0, A1, and A2 (see Fig. 4).
In the presence of functional CBC, the two LUC8 strains and five LUC9
strains were temperature sensitive for growth at 37°C and the LUC9
strains were additionally strongly cold sensitive for growth at 16°C
(Fig. 3). Following transfer from 25 to
37°C, the luc8-sl1 strain showed an inhibition of pre-rRNA
processing (Fig. 4 and
5A), while the luc8-sl2 strain
showed a largely nonconditional processing inhibition (Fig. 5A and C).
The processing defects resemble those seen in strain depleted of Cbf5p;
the 35S pre-rRNA accumulated, while the 32S, 27SA2, and 20S
pre-rRNAs were depleted (Fig. 4). Aberrant processing intermediates
(the 21S, 22S, and 23S RNAs) were also detected (Fig. 5A and data not
shown). These phenotypes are indicative of the inhibition of processing
at sites A0, A1, and A2. The LUC9
strains showed a mild pre-rRNA processing defect at 37°C (Fig. 5A)
and stronger inhibition of processing following transfer from 30 to
16°C (Fig. 5C). Again, the phenotype was indicative of the inhibition
of processing at sites A0, A1, and
A2. Similar inhibition is seen in strains genetically
depleted of Nop58p (80).
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Growth of the LUC8 and LUC9 strains carrying functional
CBC. Dilutions (1- to 102-fold) of luc8 and
luc9 strains along with the wild-type isogenic (WT) control
strain were spotted on minimal plates at 16, 23, 30, and 37°C and
incubated for 3 days.
|
|
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
The yeast pre-rRNA processing pathway. (A) Structure of
the pre-rRNA with positions of oligonucleotides used for hybridization.
In the 35S pre-rRNA, the mature 18S, 5.8S, and 25S rRNA sequences are
flanked by the 5' and 3' external transcribed spacers (5' ETS and 3'
ETS) and separated by internal transcribed spacers 1 and 2 (ITS1 and
ITS2). (B) Major pre-rRNA processing pathway in yeast. Note that a
minor alternative pathway in ITS1 generates an alternative form of 5.8S
rRNA (5.8SL) that is extended 5' to site BIL
(not shown). (C) Structures of the aberrant 23S and 21S RNAs.
|
|
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
Northern analysis of pre-rRNA (A and C) and snoRNA (B
and D) levels in LUC8 and LUC9 strains. RNA was extracted following
growth at 23°C and 18 h after transfer to 37°C (A and B) or
following growth at 30°C and 12 h after transfer to 16°C (C
and D). The oligonucleotide probes used in panels A and C were 003 (top) and 002 (bottom). WT, wild type.
|
|
The SL strains LUC8 and LUC9, expressing yCBP80 and yCBP20, have both
rRNA processing and snoRNA stability defects that are consistent with
mutations in CBF5 and NOP58, respectively (Fig. 5). Nop58p is required for the stability of the box C+D class of
snoRNAs, while Cbf5p is required for stability of box H+ACA snoRNAs
(18, 41a). The luc8-sl1 strain was found to
result in conditional depletion of the box H+ACA snoRNA snR3 at 37°C, while luc8-sl2 resulted in nonconditional depletion of snR3
(Fig. 5B and D). Depletion of the essential box H+ACA snoRNA, snR30, was substantially less marked at 23 or 30°C (data not shown). None of
the LUC9 strains resulted in clear depletion of the box C+D snoRNA, U14
(Fig. 5B and D).
The genetic interaction of CBC with components of both major classes of
snoRNP suggested that deletion of CBC might affect pre-rRNA processing.
This possibility was tested by Northern hybridization using probes
specific for either mature rRNAs (Fig.
6A) or pre-rRNAs (Fig. 6B to F) in
strains lacking yCBP80 and/or yCBP20.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 6.
yCBC is required for normal pre-rRNA processing. For
Northern blot analysis of mature and precursor rRNAs, RNA was extracted
from wild-type (WT) and cbp strains as indicated. (A)
Hybridization with a probe complementary to the mature 18S and 25S
RNAs; (B) hybridization with a probe complementary to the 5' region of
ITS1 (oligonucleotide 002); (C) hybridization with a probe
complementary to the 3' region of ITS1, downstream of site
A3 (oligonucleotide 001); (D) hybridization with a probe
complementary to the central region of ITS1, between sites
A2 and A3 (oligonucleotide 003); (E and F)
hybridization with a probe complementary to the 5' region of ITS2
(oligonucleotide 013). (G) Ratios of steady-state levels of mature 18S
and 25S rRNAs. The positions of mature and precursor rRNA species are
indicated; 21S and 20S pre-rRNAs are not well resolved; the identity of
the 32S intermediate was verified by hybridizing a riboprobe
complementary to the region between sites A0 and
A1. Positions of the oligonucleotide probes are depicted in
Fig. 4.
|
|
Several pre-rRNA species accumulated to abnormally high levels in all
three deletion strains; the 35S primary transcript, the 32S pre-rRNA,
and an aberrant 21S rRNA (see also Fig. 4). In contrast, the level of
the 27SA2 pre-rRNA was strongly reduced. The 21S
intermediate extends from site A0 to A3, and
results from cleavage of the 32S pre-rRNA at site A3 in the
absence of cleavage at site A2. We conclude that
A2 cleavage is particularly inhibited in the mutants. The
overall pattern of defects, however, suggests that not only
A2, but also the A0 and A1 cleavage
events are slowed. Levels of 27SB and 7S pre-rRNAs were not altered
(Fig. 6E and F), indicating that the pathway of 5.8S/25S rRNA synthesis
is not affected by yCBC deletion (Fig. 4). We conclude that the absence of Cbp20p or Cbp80p inhibits processing at sites A0,
A1, and A2, with the greatest effects on
A2. Processing at later steps on the pathway of 5.8S/25S
synthesis does not appear to be affected. No clear reduction in the
levels of mature 25S or 18S rRNAs was observed (Fig. 6A and G), so the
inhibition of mature rRNA synthesis is unlikely to be directly
responsible for the slow growth of the cbp deletion strains.
Four snoRNA species are required for pre-rRNA processing at sites
A0, A1, and A2: U3 and U14, which
are associated with Nop58p (27, 41a, 45, 80), and snR30 and
snR10, which are associated with Cbf5p (40, 53, 70). Among
these, the rRNA processing phenotype observed in the cbp
deletions strains is most similar to this observed upon deletion of the
SNR10 gene (70). Depletion of Nop58p or Cbf5p
leads to loss of the snoRNAs with which they are associated;
moreover, several snoRNAs, including U18 and U24, are encoded
within pre-mRNA introns, and their synthesis could be inhibited by
splicing defects. We therefore examined the steady-state levels of
snoRNAs in the CBC deletion strains. No change in the steady-state
levels of any of these snoRNAs was observed (Fig. 7 and data not shown).
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
yCBC does not affect accumulation of various snoRNAs.
For Northern blot analysis of low-molecular-weight RNAs, RNA was
extracted from wild-type and cbp strains as indicated. The
probes used for hybridization are described in Materials and Methods.
|
|
Many snoRNAs, including U3, snR10, and snR30 snoRNAs, carry
hypermethylated 5' cap structures (26, 53, 79). The cap structures on the U3 and U8 snoRNAs have been reported to be required for nucleolar localization (28; but see reference
42) and therefore, presumably, for function. The
efficiency of cap hypermethylation in the cbp strains was
assessed by immunoprecipitation using a m2,2,7G
cap-specific serum (R1131) and an monoclonal antibody that reacts with
both m2,2,7G and m7G cap structures (H20;
kindly provided by R. Lührmann). No difference in
immunoprecipitation was observed between RNAs extracted from the
wild-type and cbp20- strains, suggesting that the
cbp strains were not deficient in snoRNA cap
hypermethylation (data not shown).
Defects in ribosome assembly caused by inefficient splicing of the
pre-mRNAs encoding ribosomal proteins can inhibit pre-rRNA processing
in yeast (references 8 and 58 and
references therein). Since processing defects were detected mainly in
the small ribosomal subunit rRNA, we first investigated the splicing of
small subunit ribosomal protein (RPS) pre-mRNAs in the CBC
deletion strains. As a control, we utilized the temperature sensitive
prp2-1 strain, which exhibits a strong splicing block at the
nonpermissive temperature (37°C) and consequent accumulation of
pre-mRNAs (reference 58 and Fig.
8). Since CBC plays
roles in the U1 snRNP-5' splice site interaction and commitment complex
assembly (10, 43, 44), we initially analyzed pre-mRNAs with
nonconsenus 5' splice sites (73). RPS9A and
RSP9B contain GUACGU instead of
GUAUGU; while RPS11A and
RPS11B contain GUAUGA instead of
GUAUGU (Fig. 8B).
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 8.
yCBC affects steady-state levels of mRNAs of
ribosomal proteins. RNA was extracted from either wild-type or
cbp strains as indicated. Additionally, control RNA was
extracted from a temperature-sensitive-lethal splicing-deficient
prp2-1 strain grown either at the permissive temperature
(25°C) or after shift to the nonpermissive temperature (37°C) for
60 min. (A) Analysis of RPS and RPL mRNAs and
pre-mRNAs. The positions of mature and precursor mRNAs are indicated.
Probes used for hybridization are described in Materials and Methods.
(B) Sequences at the 5' splice sites of pre-mRNAs analyzed in this
study. Nonconsensus residues are underlined. All pre-mRNAs tested
contain one intron, and in all cases it is located close to the 5' end
of the pre-mRNA.
|
|
Analysis of the steady-state levels of these mRNAs shows that splicing
of the pre-mRNAs is inhibited. A similar degree of splicing inhibition
was observed in the single and double cbp deletion strains
(Fig. 8A, I to VI), while the different pre-mRNAs showed various
degrees of inhibition. The level of RPS11A mRNA was not
significantly altered, and there was no detectable accumulation of
nonspliced pre-mRNA. By contrast, the mature RPS9A,
RSP9B, and RPS11B mRNAs were depleted in the
deletion strains and pre-mRNAs accumulated (Fig. 8A, I to VI; Table
2). The accumulation of unspliced
precursors indicated that splicing of these pre-mRNAs is indeed
defective. The defects in the splicing of RPS9A and RPS11B were particularly strong. These differences may be
explained by examination of the pre-mRNA sequences. In addition to
nonconsensus 5' splice sites, RPS9A and RPS11B
also lack optimal polypyrimidine tract and branchpoint region sequences
(CACUAAC and
GACUAAU, respectively, instead of
UACUAAC). Since reporter introns with either 5' splice site
or branchpoint mutations are very poorly spliced in strains lacking
yCBC (references 10 and 15a), this may contribute to their
inefficient splicing in the absence of CBC. The splicing of actin
pre-mRNA (Fig. 8A, XVIII) was not altered in the yCBC deletion strains.
RPS3 encodes a small subunit ribosomal protein but does not
contain an intron (Fig. 8A VII), while the introns in RPS10A
and RPS10B (data shown only for RPS10A [Fig. 8A, VIII]) have a consensus 5' splice site. For each of these genes there was a
clear decrease in mRNA, although this was not accompanied by an
increase in the RPS10A or RPS10B pre-mRNAs (data
not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
PhosphorImager (Molecular Dynamics) analysis of the
accumulation of RPS9A, RPS11B,
RPL30, and RPL28 pre-mRNAs
and mRNAsa
|
|
Since the levels of many pre-mRNAs and mRNAs encoding small subunit
ribosomal proteins were affected in cbc strains, we examined whether this would also be the case for large ribosomal subunit (RPL) pre-mRNAs. The 5' splice sites of these pre-mRNAs are
GUACGU for RPL16A and RPL16B,
GUAUGA for RPL22A, GUACGU for
RPL22B, and GUCAGU for RPL30, compared
to the consensus GUAUGU (Fig. 8B). The steady-state levels
of these mRNAs were also decreased in all cbc strains,
particularly for RPL16A and RPL16B (Fig. 8A, IX-XIV; RPL16B and RPL22B were very similar to
RPL16A and RPL22A [data not shown]). The
decrease in the level of mRNA was clearly accompanied by accumulation
of pre-mRNA only in the case of RPL30 (Table 2). Note that
the 5' splice site of RPL30 pre-mRNA has two nonconsensus
residues. RPL25 and RPL28 (CYH2)
pre-mRNAs have consensus 5' splice sites, whereas RPL10
pre-mRNA has no intron. There was no significant reduction in the
levels of these three mRNAs in the cbc strain. We conclude
that the splicing of the pre-mRNAs with suboptimal splice sites is
strongly inhibited in strains lacking CBC. The degree of inhibition
varies between different pre-mRNAs with weak 5' splice sites (Fig. 8A;
Table 2), reflecting the differing relative levels of importance of CBC
function in the splicing of those pre-mRNAs. Note that the reduction in
some ribosomal protein mRNAs without concomitant increase in pre-mRNA, and the reduction in mRNAs from genes without introns, could well be a
consequence of the impaired growth of the strains and consequent reduction in ribosome synthesis.
Other SL complementing genes.
LUC11 (Table 1) is complemented
by GCR1, a transcriptional activator required for expression
of multiple genes involved in glucose metabolism (3, 25).
Since the gene encoding yCBP80, GCR3, was first identified
in a search for additional mutants that affected growth on glucose
(75), the finding of gcr1 mutants in our screen
was not a surprise. As would be expected, the alleles of
GCR1 recovered from the synthetic lethal screen did not
cause lethality when the strains were plated on nonfermentable carbon sources (data not shown). Three additional complementation groups among
the seven for which no complementing plasmid was recovered also failed
to produce lethality when grown on nonfermentable carbon sources,
suggesting that additional genes involved in glucose metabolism are
likely to be involved in producing the SL phenotype. A possible
explanation for both the earlier and present findings with
GCR1 is the report that the GCR1 gene includes an
intron with a nonconsensus 5' splice site (GUAUGA
instead of GUAUGU [73]).
There is no obvious reason why SRV2 (LUC12) or any of the
genes on the LUC14 complementing plasmid (Table 1) should, when mutated, generate a lethal phenotype in the absence of CBC. Similarly, although it is possible to speculate on possible functional connections between pol III transcripts (e.g., U6 snRNA) and CBC, the identity of
any of the genes that complement LUC13 is not readily explicable. Given
the role of CBC in U snRNA transport in vertebrates (31) and
the existence of an abundant complex in yeast between CBC and yeast
importin (Srp1p), a mediator of nuclear protein import (20), it was of interest that the temperature-sensitive
allele of LUC10/SSD1 recovered in this screen accumulates
poly(A)-containing RNA in the nucleus at nonpermissive temperature
(data not shown). LUC10/SSD1 was the only strain isolated in
the screen showing this phenotype. However, an ssd1-
allele with a precise deletion of the entire ORF did not exhibit
nuclear poly(A) accumulation (21a). Sequence analysis
suggests that SSD1 likely encodes an exonuclease of the
RNase II family (76), consistent with a role in RNA
metabolism, but no change in mRNA stability was detected in either the
cbp deletion strains or luc10-1 strain
(15a).
| |
DISCUSSION |
An extensive genetic analysis has been carried out with yCBC.
Although there is strong evidence that vertebrate CBC is
multifunctional (see the introduction), all of the genetic interactions
with yCBC that are readily explicable are consistent with the function
of yCBC at the commitment complex assembly stage of yeast pre-mRNA splicing (10, 43). Two strong candidates for direct physical interaction with yCBC in the commitment complex were identified: Mud10p, which does not yet have an identified vertebrate homologue; and
Mud2p, the yeast U2AF65 homologue (1). Examination of
interaction between human CBC and U2AF65, using techniques similar to
those used here, indicate that these proteins also interact in vitro (15a). Surprisingly, however, the SR repeat-containing
domain of U2AF65 (83) which is not conserved in yeast Mud2p
(1) is the region required for this interaction. Further
investigation of this interaction is in progress.
The approach used here, that of screening for genetic interactions that
produce synthetic lethality, has previously been used successfully to
identify several components of the yeast commitment complex (1, 2,
10, 46), and our analysis provides a strong confirmation of the
usefulness of the approach in this case. Like the nuclear pore complex
(12) or the Srb complex that forms part of the basal pol II
transcription machinery (36), the commitment complex
consists of a large number of components held together by multiple
individual interactions, many of which may be relatively weak. Such
complexes appear to represent particularly sensitive, and therefore
productive, targets for this form of genetic analysis. This is
presumably because a mutation that affects an individual interaction is
often insufficient to destabilize the whole complex, whereas disruption
of multiple combinations of two interactions will cause destabilization.
An interesting aspect of our data concerns the role of CBC in
commitment complex formation and function. Based on previous data on
vertebrate splicing, CBC has been viewed functionally as a cofactor
that increases the interaction between U1 snRNP and the cap-proximal 5'
splice site (44). The yeast equivalent of this function
might be fulfilled by the CBC-Mud10p interaction. Other results
presented here suggest the yCBC function may be more complicated.
First, both genetic and physical interaction between CBC and Mud2p were
observed. Mud2p is not required for the interaction of U1 snRNP with
pre-mRNA during formation of the initial commitment complex, CC1
(1); rather, it is needed for CC2 formation. Since Mud2p
binds to the pyrimidine tract of the intron, i.e., 3' of the
BBP-branchpoint region complex (2, 7), this might suggest
that yCBC's role extends beyond U1 snRNP function. Further evidence
for this hypothesis comes from comparing the efficiencies of splicing
between RSP9A and RSP9B pre-mRNAs and between
RSP11A and RSP11B pre-mRNAs. These two pairs of
pre-mRNAs exhibit markedly different splicing efficiencies in the
absence of CBC. These differences do not correlate with differences at the 5' splice site, where U1 snRNP interaction occurs, but with differences in the pyrimidine tract regions of the introns. These results might suggest that yCBC stabilizes both U1 snRNP-5' splice site
and Mud2p-3' splice site interactions.
CBC and pre-rRNA processing.
An unexpected result from these
analyses was the identification of five SL strains that could be
complemented by NOP58 and two that were complemented by
CBF5. These genes encode essential nucleolar proteins that
are core components of the box C+D and box H+ACA families of snoRNPs,
respectively (reviewed in reference 41). Nop58p and
Cbf5p are both required for the early pre-rRNA processing steps at
sites A0, A1, and A2 on the pathway
of 18S rRNA synthesis. The SL strains were each found to have defects in pre-rRNA processing at these steps, in the presence of functional CBC. Similarly, strains lacking CBC were found to be defective in the
cleavage of sites A0, A1, and A2,
with the greatest effect on site A2. Synergistic inhibition
of rRNA synthesis is therefore likely to underlie the observed SL
interactions. A large number of genes encode pre-rRNA processing
factors, and it is unclear why only two complementation groups were
isolated in multiple strains. One possibility is that snoRNAs with
which Nop58p and Cbf5p associate also play roles in the modification of
spliceosomal snRNAs and therefore participate, indirectly, in pre-mRNA
splicing. Box C+D snoRNAs guide 2'-O-methylation of several positions
in the U6 snRNA in vertebrates (74); however, equivalent
guide RNAs have not been identified in yeast.
Strains lacking CBC were found to be defective in the splicing of
pre-mRNAs that encode ribosomal proteins, particularly those in which
the sequences at both the 5' and 3' ends of the intron were
nonconsensus. The pre-rRNA processing defect in the cbc
mutants may therefore be a consequence of reduced, or imbalanced,
ribosomal protein synthesis. In the cbc strain, the
steady-state level of the mature rRNAs was not clearly altered,
suggesting that reduced rRNA synthesis is not the direct cause of the
growth defect. This phenotype resembles that seen in strains lacking
the snoRNA, snR10 (70). Like Cbp20p and Cbp80p, snR10 is not
essential, but its absence impairs cell growth. Pre-rRNA processing is
inhibited at sites A0, A1, and A2,
with the greatest effect on A2. Accumulation of mature rRNA
is, however, not prevented, and the impaired growth is probably due to
a defect in ribosome assembly (77). We speculate that an
alteration in the stoichiometry of the ribosomal proteins interferes
with normal ribosome assembly, leading to the synthesis of partially
defective ribosomal subunits.
We thank B. Séraphin for the plasmid expressing SmD3p and
the single-copy plasmid genomic library, M. Rosbash for plasmids expressing Mud1p and Mud2p, R. Lührmann for yeast extracts and anticap antibodies, D. Görlich for anti-yCBP80 antibody and the pSEY8-yCBP20 plasmid, H. Tekotte for plasmid pHT4467, B. Dichtl and J. Venema for advice on the SL screen, and E. Hartmann for discussions
early in the project and for providing a different yCBP20 deletion
strain. Bertrand Séraphin, Mutsuhito Ohno, Juan Valcárcel,
Alexandra Segref, and Gert-Jan Arts provided useful criticisms of the manuscript.
P.F. was a recipient of a fellowship from the EU TMR program, and J.K.
received a fellowship from EMBO.
| 1.
|
Abovich, N.,
X. C. Liao, and M. Rosbash.
1994.
The yeast MUD2 protein: an interaction with PRP11 defines a bridge between commitment complexes and U2 snRNP addition.
Genes Dev.
8:843-854[Abstract/Free Full Text].
|
| 2.
|
Abovich, N., and M. Rosbash.
1997.
Cross-intron bridging interactions in the yeast commitment complex are conserved in mammals.
Cell
89:403-412[Medline].
|
| 3.
|
Baker, H. V.
1991.
GCR1 of Saccharomyces cerevisiae encodes a DNA binding protein whose binding is abolished by mutations in the CTTCC sequence motif.
Proc. Natl. Acad. Sci. USA
88:9443-9447[Abstract/Free Full Text].
|
| 4.
|
Baudin-Baillieu, A.,
E. Guillemet,
C. Cullinand, and F. Lacroute.
1997.
Construction of a yeast strain deleted for the TRP1 promoter and coding region that enhances the efficiency of the polymerase chain reaction-disruption method.
Yeast
13:353-356[Medline].
|
| 5.
|
Berben, G.,
J. Dumont,
V. Gilliquet,
P. A. Bolle, and F. Hilger.
1991.
The Ydp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae.
Yeast
7:475-477[Medline].
|
| 6.
|
Berges, T.,
E. Petfalski,
D. Tollervey, and E. C. Hurt.
1994.
Synthetic lethality with fibrillarin identifies Nop77p, a nucleolar protein required for pre-rRNA processing and modification.
EMBO J.
13:3136-3148[Medline].
|
| 7.
|
Berglund, J. A.,
K. Chua,
N. Abovich,
R. Reed, and M. Rosbash.
1997.
The splicing factor BBP interacts specifically with the pre-mRNA branchpoint sequence UACUAAC.
Cell
89:781-787[Medline].
|
| 8.
|
Bromley, S.,
L. Hereford, and M. Rosbash.
1982.
Further evidence that the rna2 mutation of Saccharomyces cerevisiae affects mRNA processing.
Mol. Cell. Biol.
2:1205-1211[Abstract/Free Full Text].
|
| 9.
|
Cho, E. J.,
T. Takagi,
C. R. Moore, and S. Buratowski.
1997.
mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain.
Genes Dev.
11:3319-3326[Abstract/Free Full Text].
|
| 10.
|
Colot, H. V.,
F. Stutz, and M. Rosbash.
1996.
The yeast splicing factor Mud13p is a commitment complex component and corresponds to CBP20, the small subunit of the nuclear cap-binding complex.
Genes Dev.
10:1699-1708[Abstract/Free Full Text].
|
| 11.
|
Cooke, C., and J. C. Alwine.
1996.
The cap and the 3' splice site similarly affect polyadenylation efficiency.
Mol. Cell. Biol.
16:2579-2584[Abstract].
|
| 12.
|
Doye, V., and E. Hurt.
1997.
From nucleoporins to nuclear pore complexes.
Curr. Opin. Cell Biol.
9:401-411[Medline].
|
| 13.
|
Ekwall, K.,
M. Kermorgant,
G. Dujardin,
O. Groudinsky, and P. P. Slonimski.
1992.
The NAM8 gene in Saccharomyces cerevisiae encodes a protein with putative RNA binding motifs and acts as a suppressor of mitochondrial splicing deficiencies when overexpressed.
Mol. Gen. Genet.
233:136-144[Medline].
|
| 14.
|
Fabrizio, P.,
S. Esser,
B. Kastner, and R. Lührmann.
1994.
Isolation of S. cerevisiae snRNPs: comparison of U1 and U4/U6.U5 to their human counterparts.
Science
264:261-265[Abstract/Free Full Text].
|
| 15.
|
Flaherty, S. M.,
P. Fortes,
E. Izaurralde,
I. W. Mattaj, and G. M. Gilmartin.
1997.
Participation of the nuclear cap binding complex in pre-mRNA 3' processing.
Proc. Natl. Acad. Sci. USA
94:11893-11898[Abstract/Free Full Text].
|
| 15a.
| Fortes, P., and I. W. Mattaj. Unpublished data.
|
| 16.
|
Fresco, L. D., and S. Buratowski.
1996.
Conditional mutants of the yeast mRNA capping enzyme show that the cap enhances, but is not required for, mRNA splicing.
RNA
2:584-596[Abstract].
|
| 16a.
| Fromont-Racine, M., and P. Legrain. Personal
communication.
|
| 17.
|
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily defined secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956[Abstract/Free Full Text].
|
| 18.
|
Gautier, T.,
T. Berges,
D. Tollervey, and E. Hurt.
1997.
Nucleolar KKE/D repeat proteins Nop56p and Nop58p interact with Nop1p and are required for ribosome biogenesis.
Mol. Cell. Biol.
17:7088-7098[Abstract].
|
| 19.
|
Gilmartin, G. M.,
M. A. McDevitt, and J. R. Nevins.
1988.
Multiple factors are required for specific RNA cleavage at a poly(A) addition site.
Genes Dev.
2:578-587[Abstract/Free Full Text].
|
| 20.
|
Görlich, D.,
R. Kraft,
S. Kostka,
F. Vogel,
E. Hartmann,
R. A. Laskey,
I. W. Mattaj, and E. Izaurralde.
1996.
Importin provides a link between nuclear protein import and U snRNA export.
Cell
87:21-32[Medline].
|
| 21.
|
Gottschalk, A.,
J. Tang,
O. Puig,
J. Salgado,
G. Neubauer,
H. V. Colot,
M. Mann,
B. Séraphin,
M. Rosbash,
R. Lührmann, and P. A. Fabrizio.
1998.
Comprehensive biochemical and genetic analysis of the yeast U1 snRNP reveals five novel proteins.
RNA
4:374-393[Abstract].
|
| 21a.
| Grosshans, H., J. Kufel, and D. Tollervey.
Unpublished data.
|
| 22.
|
Hamm, J., and I. W. Mattaj.
1990.
Monomethylated cap structures facilitate RNA export from the nucleus.
Cell
63:109-118[Medline].
|
| 23.
|
Hart, R. P.,
M. A. McDevitt, and J. R. Nevins.
1985.
Poly(A) site cleavage in a HeLa nuclear extract is dependent on downstream sequences.
Cell
43:677-683[Medline].
|
| 24.
|
Hirose, Y., and J. L. Manley.
1998.
RNA polymerase II is an essential mRNA polyadenylation factor.
Nature
395:93-96[Medline].
|
| 25.
|
Holland, M. J.,
T. Yokoi,
J. P. Holland,
K. Myambo, and M. A. Innis.
1987.
The GCR1 gene encodes a positive transcriptional regulator of the enolase and glyceraldehyde-3-phosphate dehydrogenase gene families in Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:813-820[Abstract/Free Full Text].
|
| 26.
|
Hughes, J. M. X.,
D. A. M. Konings, and G. Cesareni.
1987.
The yeast homologue of U3 snRNA.
EMBO J.
6:2145-2155[Medline].
|
| 27.
|
Hughes, J. M., and M. Ares, Jr.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 28.
|
Jacobson, M. R., and T. Pederson.
1998.
A 7-methylguanosine cap commits U3 and U8 small nuclear RNAs to the nucleolar localization pathway.
Nucleic Acids Res.
26:756-760[Abstract/Free Full Text].
|
| 29.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 30.
|
Izaurralde, E.,
J. Lewis,
C. McGuigan,
M. Jankowska,
E. Darzynkiewicz, and I. W. Mattaj.
1994.
A nuclear cap binding protein complex involved in pre-mRNA splicing.
Cell
78:657-668[Medline].
|
| 31.
|
Izaurralde, E.,
J. Lewis,
C. Gamberi,
A. Jarmolowski,
C. McGuigan, and I. W. Mattaj.
1995.
A cap-binding protein complex mediating U snRNA export.
Nature
376:709-712[Medline].
|
| 32.
|
Jarmolowski, A.,
W. C. Boelens,
E. Izaurralde, and I. W. Mattaj.
1994.
Nuclear export of different classes of RNA is mediated by specific factors.
J. Cell Biol.
124:627-635[Abstract/Free Full Text].
|
| 33.
|
Kataoka, N.,
M. Ohno,
K. Kangawa,
Y. Tokoro, and Y. Shimura.
1994.
Cloning of a complementary DNA encoding an 80 kilodalton nuclear cap binding protein.
Nucleic Acids Res.
22:3861-3865[Abstract/Free Full Text].
|
| 34.
|
Kataoka, N.,
M. Ohno,
I. Moda, and Y. Shimura.
1995.
Identification of the factors that interact with NCBP, an 80 kDa nuclear cap binding protein.
Nucleic Acids Res.
23:3638-3641[Abstract/Free Full Text].
|
| 35.
|
Kiss-László, Z.,
Y. Henry,
J.-P. Bachellerie,
M. Caizergues-Ferrer, and T. Kiss.
1996.
Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs.
Cell
85:1077-1088[Medline].
|
| 36.
|
Koleske, A. J., and R. A. Young.
1995.
The RNA polymerase II holoenzyme and its implications for gene regulation.
Trends Biochem. Sci.
20:113-116[Medline].
|
| 37.
|
Konarska, M. M.,
R. A. Padgett, and P. A. Sharp.
1984.
Recognition of cap structure in splicing in vitro of mRNA precursors.
Cell
38:731-736[Medline].
|
| 38.
|
Krainer, A. R.,
T. Maniatis,
B. Ruskin, and M. R. Green.
1984.
Normal and mutant human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro.
Cell
36:993-1005[Medline].
|
| 39.
|
Kranz, J. E., and C. Holm.
1990.
Cloning by function: an alternative approach for identifying yeast homologues of genes from other organisms.
Proc. Natl. Acad. Sci. USA
87:6629-6633[Abstract/Free Full Text].
|
| 40.
|
Lafontaine, D. L. J.,
C. Bousquet-Antonelli,
Y. Henry,
M. Caizergues-Ferrer, and D. Tollervey.
1998.
The box H+ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase.
Genes Dev.
12:527-537[Abstract/Free Full Text].
|
| 41.
|
Lafontaine, D. L. J., and D. Tollervey.
1998.
Birth of the snoRNPs: the evolution of the modification guide snoRNAs.
Trends Biochem. Sci.
23:383-388[Medline].
|
| 41a.
| Lafontaine, D. L. J., and D. Tollervey.
Unpublished data.
|
| 42.
|
Lange, T. S.,
A. V. Borovjagin, and S. A. Gerbi.
1998.
Nucleolar localization elements in U8 snoRNA differ from sequences required for rRNA processing.
RNA
4:789-800[Abstract].
|
| 43.
|
Lewis, J. D.,
D. Görlich, and I. W. Mattaj.
1996.
A yeast cap binding protein complex (yCBC) acts at an early step in pre-mRNA splicing.
Nucleic Acids Res.
24:3332-3336[Abstract/Free Full Text].
|
| 44.
|
Lewis, J. D.,
E. Izaurralde,
A. Jarmolowski,
C. McGuigan, and I. W. Mattaj.
1996.
A nuclear cap-binding complex facilitates association of U1 snRNP with the cap-proximal 5' splice site.
Genes Dev.
10:1683-1698[Abstract/Free Full Text].
|
| 45.
|
Li, H. D.,
J. Zagorski, and M. J. Fournier.
1990.
Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:1145-1152[Abstract/Free Full Text].
|
| 46.
|
Liao, X. C.,
J. Tang, and M. Rosbash.
1993.
An enhancer screen identifies a gene that encodes the yeast U1 snRNP A protein: implications for snRNP protein function in pre-mRNA splicing.
Genes Dev.
7:419-428[Abstract/Free Full Text].
|
| 47.
|
Lührmann, R.,
B. Kastner, and M. Bach.
1990.
Structure of spliceosomal snRNPs and their role in pre-mRNA splicing.
Biochim. Biophys. Acta
1087:265-292[Medline].
|
| 48.
|
McCracken, S.,
N. Fong,
E. Rosonina,
K. Yankulov,
G. Brothers,
D. Siderovski,
A. Hessel,
S. Foster,
S. Shuman, and D. L. Bentley.
1997.
5'-capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II.
Genes Dev.
11:3306-3318[Abstract/Free Full Text].
|
| 49.
|
McCracken, S.,
N. Fong,
K. Yankulov,
S. Ballantyne,
G. Pan,
J. Greenblatt,
S. D. Patterson,
M. Wickens, and D. L. Bentley.
1997.
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[Medline].
|
| 50.
|
Mewes, H. W.,
K. Albermann,
K. Heumann,
S. Liebl, and F. Pfeiffer.
1997.
MIPS: a database for protein sequences, homology data and yeast genome information.
Nucleic Acids Res.
25:28-30[Abstract/Free Full Text].
|
| 51.
|
Mewes, H. W.,
K. Albermann,
M. Bähr,
D. Frishman,
A. Gleissner,
J. Hani,
K. Heumann,
K. Kleine,
A. Maierl,
S. G. Oliver,
F. Pfeiffer, and A. Zollner.
1997.
Overview of the yeast genome.
Nature
387:7-65[Medline].
|
| 52.
|
Mewes, H. W.,
J. Hani,
F. Pfeiffer, and D. Frishman.
1998.
MIPS: a database for protein sequences and complete genomes.
Nucleic Acids Res.
26:33-37[Abstract/Free Full Text].
|
| 53.
|
Morrissey, J. P., and D. Tollervey.
1993.
Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis.
Mol. Cell. Biol.
13:2469-2477[Abstract/Free Full Text].
|
| 54.
|
Nakagawa, T., and H. Ogawa.
1997.
Involvement of the MRE2 gene of yeast in formation of meiosis-specific double-strand breaks and crossover recombination through RNA splicing.
Genes Cells
2:65-79[Abstract].
|
| 55.
|
Ni, J.,
A. L. Tien, and M. J. Fournier.
1997.
Small nucleolar RNAs direct site-speci |
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
