Previous Article | Next Article 
Molecular and Cellular Biology, October 1999, p. 6598-6607, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutations Affecting a Yeast Mitochondrial Inner
Membrane Protein, Pnt1p, Block Export of a Mitochondrially Synthesized
Fusion Protein from the Matrix
Shichuan
He
and
Thomas D.
Fox*
Department of Molecular Biology and Genetics,
Cornell University, Ithaca, New York 14853-2703
Received 15 April 1999/Returned for modification 13 May
1999/Accepted 13 July 1999
 |
ABSTRACT |
The machinery that inserts mitochondrially encoded proteins into
the inner membrane and translocates their hydrophilic domains through
the membrane is poorly understood. We have developed a genetic screen
for Saccharomyces cerevisiae mutants defective in this
export process. The screen is based on the fact that the hydrophilic
polypeptide Arg8mp is exported from the matrix if it is
synthesized within mitochondria as a bifunctional
Cox2p-Arg8mp fusion protein. Since export of
Arg8mp causes an Arg
phenotype, defective
mutants can be selected as Arg+. Here we show that
mutations in the nuclear gene PNT1 block the translocation
of mitochondrially encoded fusion proteins across the inner membrane.
Pnt1p is a mitochondrial integral inner membrane protein that appears
to have two hydrophilic domains in the matrix, flanking a central
hydrophobic hairpin-like anchor. While an S. cerevisiae
pnt1 deletion mutant was more sensitive to
H2O2 than the wild type was, it was respiration
competent and able to export wild-type Cox2p. However, deletion of the
PNT1 orthologue from Kluyveromyces lactis,
KlPNT1, caused a clear nonrespiratory phenotype, absence of
cytochrome oxidase activity, and a defect in the assembly of KlCox2p
that appears to be due to a block of C-tail export. Since
PNT1 was previously described as a gene affecting
resistance to the antibiotic pentamidine, our data support a
mitochondrial target for this drug.
 |
INTRODUCTION |
While the majority of mitochondrial
proteins are encoded in the nucleus and imported into the organelle
from the cytoplasm, a few important subunits of respiratory complexes
are encoded in mitochondrial DNA (mtDNA), synthesized in the matrix,
and inserted into the inner membrane from within (3, 47).
Each of the mitochondrially encoded respiratory-chain subunits of
Saccharomyces cerevisiae contains at least one hydrophilic
tail or loop that is exported to the outside surface of the inner
membrane by translocation across the lipid bilayer (48). In
addition to their important role in assembly of the respiratory
complexes, mitochondrial export translocation systems might play a role
in transporting mitochondrially encoded polypeptides out of the
organelle in animal (9) and plant (1) cells.
Export systems also could be involved in intracellular signaling by
mitochondria (31) and possibly, by analogy to whole cells
(4, 50), in removal of toxic components from the organelle.
The translocation machinery that carries out import of proteins from
the cytoplasm to mitochondria has been extensively studied (43,
45, 51). However, little is known about the inner membrane proteins responsible for export of mitochondrially coded polypeptide domains. While the topology of mitochondrial export resembles that of
bacterial secretion, the yeast genome does not encode detectable
homologues of the bacterial Sec translocase that function in
mitochondria (18). The single protein known to be involved in export is Oxa1p, a conserved nuclearly encoded integral inner membrane protein that is required for the export of the hydrophilic N
and C tails of the mitochondrially encoded precursor to cytochrome c oxidase subunit II (Cox2p) and also plays a role in ATP
synthase formation (5, 7, 8, 20, 22, 25, 28, 37). While Oxa1p interacts directly with nascent mitochondrially synthesized polypeptides (23), its precise role in membrane insertion is not clear. Surprisingly, oxa1 null mutations can be
suppressed by mutations in the nuclear gene encoding the cytochrome
c1 subunit of the bc1
complex (19). This suppression indicates that the conserved
Oxa1p function can be bypassed in the membrane insertion process,
although the mechanism of suppression has not been established.
To study the mitochondrial export machinery in vivo, we have adapted
the gene fusion approach to the study of topogenesis of proteins
encoded in S. cerevisiae mtDNA (20). As a
passenger protein-coding sequence, we used the synthetic mitochondrial
gene ARG8m, which directs the synthesis of a
soluble polypeptide within the organelle and complements nuclear
arg8 mutations (53). ARG8m
specifies, in the yeast mitochondrial genetic code, the biosynthetic enzyme normally encoded by the nuclear gene ARG8, which in
wild-type cells is synthesized in the cytoplasm and imported into the
mitochondrial matrix. Expression of a chimeric gene that encodes a
fusion protein with the Arg8mp moiety attached to the C
terminus of Cox2p results in export of the hydrophilic passenger
protein through the inner membrane to the intermembrane space (IMS)
(20).
Here we report the successful development of a genetic selection for
yeast mutants defective in the export of mitochondrially coded
proteins. The strategy is based on the fact that when
Arg8mp is exported from the matrix, it can no longer
participate in arginine biosynthesis. While novel in its application to
mitochondria, the rationale for our selection is based on schemes used
successfully to identify genes in yeast (10) and
Escherichia coli (44) that encode components of
cellular secretion machineries. The efficacy of this selection is
demonstrated by the fact that it identified a recessive mutation that
prevents the export of passenger protein moieties attached to Cox2p.
The mutated gene, PNT1, encodes a mitochondrial integral
inner membrane protein. While deletion of PNT1 in an
otherwise wild-type S. cerevisiae strain has a surprisingly modest phenotype, we found that deletion of the Kluyveromyces lactis functional homologue, KlPNT1, caused a tight
nonrespiratory phenotype and prevented normal assembly of KlCox2p into
cytochrome oxidase, suggesting that it caused defective export of
wild-type KlCox2p in that species.
 |
MATERIALS AND METHODS |
Plasmids and DNA manipulation.
Construction of the gene
fusions COX2(UTL)::ARG8m and
COX2::ARG8m and their subsequent
integration into
+ mtDNA were as previously described
(20). To construct a nuclear ARG8 plasmid
(pSH303) that encodes the same truncated Arg8p as the above
ARG8m fragment, ARG8 was amplified
from genomic DNA by PCR, and ligated to the NotI site on
pDB20, a 2µm expression vector (13). To create
BLEm, another artificial gene for mitochondrial
expression, four oligonucleotides of 100 bases each (data not shown)
were designed according to the Ble protein sequence encoded by the
bacterial Tn5 transposon (36), with consensus
yeast mitochondrial codon usage (11). The four
oligonucleotides sequentially overlapped for 20 to 25 bp and were used
to synthesize the BLEm gene by PCR. To construct
the pnt1
::LEU2 deletion, a
SpeI-NcoI fragment encompassing the
PNT1 locus was first cloned to Bluescript. PNT1
codons 3 to 348 were then replaced by a PCR-generated LEU2 gene. The resulting plasmid, pSH401, was linearized before
transformation into S. cerevisiae cells. Deletion of the
chromosomal PNT1 was confirmed by PCR analysis and genetic
complementation. To tag the wild-type chromosomal PNT1 with
three HA epitopes, an HA-URA3-HA cassette (52)
was PCR amplified with the primers
TATCATTGTTAAAATATAATTCAGAATTGGTAGCTACGAAAGATATTCAAAGGGAACAAAAGCTGG and
GTTTTAAACAATATGTACAGCATAGATAATGTCATGAATATTTACATCTACTATAGGGCGAATTGG, each tailed at the 5' end with a 50-bp PNT1 sequence
for in-frame insertion before the PNT1 stop codon. The
resulting PCR fragment was used to transform S. cerevisiae
cells. PNT1-tagged transformants were identified by PCR
analysis and were then plated on 5-fluoroorotic acid medium to isolate
PNT1::HA strain that had lost URA3
through homologous recombination.
To construct the Klpnt1 disruption plasmid, pSH502, a 550-bp
upstream fragment and a 830-bp downstream fragment immediately flanking
the KlPNT1 coding sequence (see below) were PCR amplified and ligated to the BglII-BamHI
HisG-URA3-HisG cassette released from pNKY51 (2)
and the resulting fusion was inserted into a pBluescript vector. To
disrupt KlPNT1 in K. lactis, pSH502 was linearized with XbaI and XhoI and transformed
into strain KB101 by the same procedure as that for S. cerevisiae. A strain with expected KlPNT1 deletion, as
verified by PCR analysis, was subjected to 5-fluoroorotic acid
selection, resulting in strain SH702. To clone KlPNT1 into a
K. lactis expression vector, KlPNT1 was PCR amplified from a genomic subclone (data not shown) by using a primer
pair that also introduced a His6 epitope tag at the C
terminus of KlPnt1p. The gene fusion was then ligated to the
EcoRI-HindIII sites of the K. lactis/E.
coli shuttle vector pROCS2 (6), resulting in pSH505.
Strains, growth conditions, and genetic and general methods.
Yeast strains used in this study are listed in Table
1. S. cerevisiae JKR102,
DFS188, SH39, SH40, SH404, and SH412 are isogenic or congenic to
D273-10B, and DFS160, SH45B, SH45B-41, SH401, SH349, SH402, SH135,
SH405, and SH407 are isogenic or congenic to DBY947. SH45B was
constructed by transferring the
+ mtDNA of SH39,
including the gene fusion COX2::ARG8m,
to the
0 recipient DFS160 by cytoduction. K. lactis KB101 was obtained from the American Type Culture
Collection (ATCC 96265). Standard genetic methods were as described
previously (14, 49). Nuclear transformation, mitochondrial
transformation, and gene replacement were as described previously
(20). To stabilize K. lactis transformants containing pROCS2 or pSH505, K. lactis plasmid pKD1
(6) was reconstituted from the pSPH1 clone (obtained from H. Fukuhara via N. A. Da Silva), and cotransformed with the shuttle
vectors. Yeast growth was monitored with either a Klett-Summerson
photoelectric colorimeter or a spectrophotometer.
Genetic screening and gene cloning.
Independent SH45B
cultures (1 ml each) were grown to stationary phase in yeast
extract-peptone-dextrose (YPD). Each culture was washed and spread on
minimal glucose plates lacking Arg to identify spontaneous mutants.
After incubation at 30°C for 7 days, Arg+ colonies were
replica plated onto nonfermentable glycerol-ethanol medium (YPEG).
About 10% of the arginine-prototrophs were respiration defective.
These colonies were streak purified and characterized. One to three
colonies from each plate that appeared phenotypically stable and
relatively tight for respiratory deficiency were selected as putative
mutants defective in export for further study.
The gene mutated in the tight Pet

mutant SH45B-41 was
cloned by complementation with yeast genomic DNA libraries.
Transformants
were first selected on synthetic medium and then replica
plated
to YPEG to identify respiring colonies (Pet
+). Total
genomic DNA was extracted from each colony and used to
transform
E. coli to purify the plasmid, which was then reintroduced
to SH45B-41. Clones that restored the Pet
+ phenotype were
selected for restriction mapping and
subcloning.
To clone
KlPNT1, a 2 µm plasmid-based
K. lactis
genomic DNA library obtained from L. A. Grivell (
39)
was screened for plasmids
complementing the Pet

phenotype
of
S. cerevisiae SH407 by using the same procedure
as for
the cloning of
PNT1. The DNA sequence of a 2,600-bp fragment
encompassing
KlPNT1 was
determined.
Mitochondrial isolation, subfractionation, and protein
analyses.
Mitochondrial isolation and purification, mitochondrial
membrane fractionation, alkaline extraction, mitoplasting, proteinase K
protection assay, and Western blot analysis were as previously described (15, 17, 20), except that K. lactis
strains were grown in YPD. Cytochrome c oxidase activity was
determined spectrophotometrically as previously described
(35), except that mitochondria were purified as above.
Nucleotide sequence accession number.
The sequence of the
2,600-bp fragment encompassing KlPNT1 has been deposited in
GenBank under accession no. AF157501.
 |
RESULTS |
Genetic screen for mutants defective in mitochondrial protein
export.
The wild-type nuclear ARG8 gene specifies a
precursor protein that is imported into mitochondria under the
direction of an amino-terminal targeting signal (53). Within
the matrix, Arg8p functions as acetylornithine aminotransferase in
arginine biosynthesis (21, 27). We have found that this
enzyme must be localized in the mitochondrial matrix to participate in
arginine synthesis. A strain whose nuclear ARG8 gene was
truncated at the 5' end, such that its product lacked the
amino-terminal 21 residues, exhibited an Arg
growth
phenotype despite the presence of abundant Arg8p in the cell, as
revealed by Western analysis of total protein (Fig.
1, lane 3). The inability of such cells
to make arginine must be due to mislocalization of the truncated
protein, since expression of the identical truncated protein within
mitochondria, from a synthetic mitochondrial structural gene inserted
at the COX2 locus, leads to robust Arg+ growth
despite deletion of the nuclear arg8 gene (lane 4)
(20). Thus, Arg8p located outside of the mitochondrial inner
membrane cannot participate in arginine biosynthesis.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 1.
Arg8p must be present in the mitochondrial matrix to
participate in arginine biosynthesis. The top two panels show the
growth of yeast strains on glucose medium (SD) that either contains Arg
(Min + Arg) or lacks Arg (Min Arg). The bottom panel is a
Western blot of total-cell extracts probed with anti-Arg8p antibody.
The position of Arg8p in the gel is indicated. Lanes: 1, wild-type
ARG8 strain with wild-type mtDNA (JKR102); 2, arg8::hisG strain with wild-type mtDNA (DFS188);
3, arg8::hisG strain with wild-type mtDNA (DFS188)
transformed with a nuclear 2 µm expression plasmid bearing a
truncated ARG8 gene that lacks the N-terminal 21 codons and
thus the mitochondrial targeting sequence (pSH303; see Materials and
Methods); 4, arg8::hisG strain whose mtDNA
contains a truncated ARG8m gene in place of the
COX2 coding sequence (SH40). Mitochondrial expression of
this gene produces the same protein as in lane 3 but within
mitochondria.
|
|
We have previously found that a 402-amino-acid residue
Arg8
mp moiety, synthesized within mitochondria, can be
exported in vivo
through the inner membrane to the IMS when fused to
the C terminus
of Cox2p (
20), which is normally located in
the IMS (
54).
If this export process sufficiently depletes
the matrix of mitochondrially
synthesized Arg8
mp, cells
expressing the fusion protein should be Arg

. (The outer
membrane is porous to small molecules such as acetylornithine
[
42], while the inner membrane is not, making the IMS
topologically
equivalent to the cytoplasm for this purpose.) In this
case, a
collection of Arg
+ mutants selected from a parent
expressing the Cox2p-Arg8
mp fusion protein might include
strains with defects in the protein
export process that allow the
Arg8
mp moiety of the fusion protein to remain in the
matrix.
Mitochondrial expression of the Cox2p-Arg8
mp fusion protein
supports robust respiratory growth (
20). This fact
demonstrates
that the N and C tails of the Cox2p moiety of the fusion
protein
are translocated normally through the inner membrane.
Proteolytic
removal of the Arg8
mp moiety in the IMS yields
a Cox2p-cross-reacting species comparable
in size to wild-type Cox2p
(unpublished results), which presumably
functions in cytochrome
oxidase. We would expect that an Arg
+ mutant selected as
described above, which was deficient in the
export translocation
process, would not be able to translocate
the C tail of Cox2p normally
and would therefore also exhibit
a nonrespiratory (Pet

)
growth phenotype (Fig.
2).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Rationale for a selection scheme to identify mutants
defective in protein export from the mitochondrial matrix. An
arg8 strain containing the
COX2::ARG8m chimeric gene in its mtDNA
(SH45B) exhibits an Arg growth phenotype due to export of
the Arg8mp moiety, which can function only in the matrix
(Fig. 1). The strain can respire (Pet+) due to the normal
translocation of Cox2p through the inner membrane followed by
proteolytic removal of the Arg8mp moiety (not shown). An
Arg+ growth phenotype could result from a defect in export
that results in accumulation of the Arg8mp moiety in the
matrix. If the defect is severe enough, it will also prevent the export
of Cox2p domains to the IMS and the assembly of cytochrome oxidase,
producing a Pet phenotype.
|
|
Our previous study was performed with strains in the D273-10B (ATCC
25657) genetic background, which exhibits vigorous respiratory
growth
and mitochondrial gene expression. While the bulk of Arg8
mp
was exported, we were also able to detect a low level of unexported,
matrix-localized Arg8
mp in the mitochondria of such a
strain expressing the Cox2p-Arg8
mp fusion protein.
Consistent with this observation, that strain
(SH39) had an
Arg
+ growth phenotype (
20). Thus, our previously
described strain
was unsuitable for the selection scheme. We reasoned
that lowering
the rate of mitochondrial gene expression might lower the
level
of residual unexported Arg8
mp sufficiently to produce
an Arg

phenotype. This speculation was supported by the
fact that a
D273-10B-derived diploid, heterozygous for a deletion of
the limiting
(
18a)
COX2-mRNA-specific
translational activator gene
PET111 (
40), was
Arg

.
To construct an Arg

haploid strain for our selection
scheme, we transferred the mitochondrial genome encoding the
Cox2p-Arg8
mp fusion protein into a strain whose nuclear
genetic background
was derived from DBY947 (
41), a strain
closely related to S288C
(ATCC 26108). The respiration rate of this
strain background was
roughly half that of D273-10B related strains,
when cells were
grown in YPEG (unpublished data). The resulting strain,
SH45B,
was indeed Arg

, and its steady-state cellular
level of Arg8
mp was lower than that of the corresponding
strain in the D273-10B
background (unpublished results). However, it is
important to
note that mitochondrial expression of unexported forms of
Arg8
mp in strains isogenic to SH45B does produce an
Arg
+ phenotype, suggesting that it is export of the SH45B
fusion protein
that depletes the matrix of active enzyme. Western blot
analysis
of protease-treated mitochondria and mitoplasts derived from
SH45B
confirmed that the Arg8
mp moiety of the full-length
Cox2p-Arg8
mp fusion protein was largely exported through
the inner membrane
to the IMS, as were two small
Arg8
mp-cross-reacting fragments (Fig.
3, left). Furthermore, SH45B
exhibited a
Pet
+ growth phenotype, demonstrating normal export and
assembly of
the Cox2p moiety. Thus, strain SH45B appears to be a useful
parent
for the isolation of export mutants by selecting for an
Arg
+ phenotype and screening among those mutants for clones
that also
exhibit a respiratory defect (to eliminate background
mutations
that, for example, simply increase mitochondrial gene
expression).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Export defect of the mitochondrially synthesized
Cox2p-Arg8mp fusion protein from mitochondria of the mutant
SH45B-41. Mitochondria (MT) expressing Cox2p-Arg8mp were
isolated from the parental strain SH45B (left panel) and the mutant
strain SH45B-41 (right panel) and were converted to mitoplasts (MP) in
the absence or presence of proteinase K (100 µg/ml), as indicated
above each lane. Samples were run on sodium dodecyl sulfate (SDS)-10%
polyacrylamide gels, immunoblotted, and probed with anti-Arg8p (top
panels). The position of the full-length Cox2p-Arg8mp
fusion protein is indicated. Two Arg8mp fragments, of
roughly 33 kDa, known to be located in the IMS (20), are
present in the mitochondria of SH45B but not SH45B-41. The same blots
were stripped and reprobed with anti-cytochrome
b2 (Cyt b2) (an IMS marker) and
anti-citrate synthase (a matrix marker) (bottom).
|
|
Isolation and characterization of an export-defective nuclear
mutant.
SH45B spontaneously gives rise to Arg+ clones,
and roughly 10% of these also exhibit at least a partial
Pet
phenotype. To test whether this screen might be
effective in identifying strains with mitochondrial export defects, we
chose one such mutant with a tight Pet
phenotype,
SH45B-41, for detailed analysis. SH45B-41 contains a single recessive
nuclear mutation: when mated with a
0 tester strain, it
yielded respiring diploids. When these diploids were sporulated, the
Pet
phenotype segregated 2:2.
To determine whether the Arg
+ Pet

phenotype
of the SH45B-41 mutant was due to defective export of the
Cox2p-Arg8
mp fusion protein, we isolated its mitochondria
and subjected them
to mitoplasting (disruption of the outer membrane)
and protease
digestion (Fig.
3, right). These experiments revealed that
the
full-length fusion protein of the mutant was largely protected
from
external protease by mitoplasts. Furthermore, the mitochondria
from the
mutant lacked the two small Arg8
mp-cross-reacting fragments
that are present in the parental strain
(Fig.
3, right). As shown
previously (
20) and confirmed by the
experiment of Fig.
3,
these fragments of the mitochondrially synthesized
fusion protein are
localized in the IMS. Thus, in contrast to
the parental strain, the
Arg8
mp moiety of the mutant had remained inside the inner
membrane.
(The partial protease sensitivity of the full-length fusion
protein
in mutant mitoplasts apparently reflects some leakage of
proteinase
K across the inner membrane.) These results strongly suggest
that
the Arg
+ Pet

phenotype of SH45B-41 is
due to failure of translocation of the
C-terminal portion of the
Cox2p-Arg8
mp fusion protein across the inner
membrane.
The export defect is caused by mutation of the PNT1
gene.
To identify the nuclear gene mutated in SH45B-41, two
genomic libraries of S. cerevisiae DNA were screened for
clones that restored a Pet+ phenotype to the mutant. Nine
overlapping clones were obtained, and the complementing gene,
PNT1, was identified by subcloning. PNT1 had been
previously identified as a gene that caused resistance to the drug
pentamidine when present on a high-copy-number vector in S. cerevisiae (34). It is a unique gene that encodes a
protein of 423 amino acids. The protein, Pnt1p, has no significant
sequence similarity to any other known or predicted protein. Sequence
analysis of the gene isolated from SH45B-41 revealed that the mutation, pnt1-41, caused a missense substitution, W382R, in the
C-terminal portion of Pnt1p.
We disrupted the chromosomal copy of
PNT1 in the parental
strain SH45B by replacing codons 3 to 348 with
LEU2 (see
Materials
and Methods). The resulting
pnt1
::LEU2 strain (SH401) exhibited
the same
Arg
+ Pet

phenotype as the original mutant
SH45B-41 (see below), and it
was complemented by
PNT1 on a
plasmid. Moreover, a strain bearing
the
pnt1
::LEU2 allele failed to complement SH45B-41
for respiratory
growth.
Pnt1p is a mitochondrial inner membrane protein.
The protein
product of PNT1 has not been previously characterized. To
allow the detection of Pnt1p, it was tagged at its C terminus with
three HA epitopes by addition of the appropriate sequence
(52) to the 3' end of the chromosomal PNT1 coding
sequence (see Materials and Methods). This alteration did not interfere with Pnt1p function as judged by the ability of PNT1-HA to
fully complement the Pet
phenotype of pnt1-41.
To determine the subcellular location of Pnt1p, we constructed an
otherwise wild-type strain, SH404, in which PNT1-HA replaced
PNT1. Highly purified mitochondria from SH404 contained a
protein of the expected size that reacted with anti-HA antibody (Fig.
4A, lane 2). This protein was barely
detectable in the cytosolic fraction from SH404 (lane 3). The anti-HA
antibody failed to react with any protein of this size in mitochondria from a wild-type strain lacking the epitope (lane 1), confirming that
the species detected in SH404 was Pnt1p-HA. We conclude that Pnt1p is a
nuclearly encoded mitochondrial protein.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Pnt1p is an integral mitochondrial membrane protein. (A)
Epitope-tagged Pnt1p copurified with mitochondria. Mitochondria from
wild-type strain DFS188 (lane 1) and from the PNT1-HA strain
SH404 (lane 2) were purified on Nycodenz gradients (17).
These mitochondria (20 µg) and the cytosolic fraction from SH404 (20 µg) (lane 3) were run on an SDS-10% polyacrylamide gel,
immunoblotted, and probed with anti-HA monoclonal antibody (see
Materials and Methods). (B) Pnt1p was not extractable from membranes by
alkaline carbonate. Mitochondria purified from SH404 expressing
Pnt1p-HA were sonicated and separated into a membrane pellet (lane 2)
and soluble supernatant by centrifugation (lane 1). An aliquot of the
membrane fraction was extracted with sodium carbonate (pH 11.5),
followed by centrifugation to separate pelleted integral membrane
proteins (lane 4) and solubilized proteins in the supernatant (lane 3).
The sample were resolved by SDS-polyacrylamide gel electrophoresis
(PAGE), immunoblotted, and probed with anti-HA antibody (top). The same
blot was then stripped and reprobed with antiserum against Arg8p, a
known mitochondrial matrix protein (bottom).
|
|
To determine whether Pnt1p-HA is soluble or membrane bound, the
purified mitochondria from SH404 were sonicated and centrifuged.
Pnt1p-HA was present in the membrane pellet (Fig.
4B, lane 2)
but
absent from the soluble supernatant (lane 1). Extraction of
the
pelleted membranes with alkaline sodium carbonate (
15)
failed
to solubilize Pnt1p-HA (lanes 3 and 4). These results indicate
that Pnt1p is an integral mitochondrial membrane
protein.
To examine the submitochondrial location and topology of Pnt1p-HA,
purified mitochondria from SH404 were subjected to mitoplasting
and
protease digestion prior to Western analysis (Fig.
5A). Proteinase
K treatment of
detergent-solubilized mitochondria eliminated the
Pnt1p-HA signal,
demonstrating that the epitope is labile to protease.
However, Pnt1p-HA
was protected from digestion by proteinase K
in both whole mitochondria
and mitoplasts: the C-terminal epitope
remained detectable on the
full-length protein, and no shorter
immunoreactive species were
generated. Similar results were obtained
in experiments where Pnt1p was
tagged at its C terminus with a
hexahistidine epitope (unpublished
results). Taken together with
the data in Fig.
4B, these results
strongly suggest that Pnt1p
is an integral inner membrane protein that
is not accessible to
protease digestion from the outside.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Pnt1p is an inner membrane protein that is inaccessible
to protease added to mitoplasts, leading to a proposed topology. (A)
Mitochondria (MT) were purified from strain SH404 and converted to
mitoplasts (MP) by osmotic shock (20) in the absence or
presence of proteinase K (100 µg/ml), as indicated for each lane.
Mitoplasts were also treated with proteinase K in the presence of 1%
octylglucoside (right lane) to solubilize the inner membrane. Treated
samples were resolved by SDS-PAGE, immunoblotted, and probed with
anti-HA (top), with anti-cytochrome b2 (cyt
b2) as an IMS marker (middle), and with anti-Arg8p as a
matrix marker (bottom). (B) Pnt1p hydrophobicity plot (30)
showing a distinct hydrophobic domain of about 31 residues near the
middle of the protein. (C) Proposed topology for Pnt1p in the
mitochondrial inner membrane based on protease protection assays,
hydrophobicity analysis, and the positive inside rule (16).
IM, inner membrane.
|
|
A hydrophobicity plot of the Pnt1p sequence (Fig.
5B) reveals a highly
hydrophobic region in the center of the protein between
residues 198 and 228. Residues 209 and 210 are both acidic (E),
suggesting that this
region could form a hairpin-like membrane
anchor. Both domains flanking
the hydrophobic region are largely
hydrophilic and positively charged.
Taking these observations
together, we propose (Fig.
5C) that Pnt1p is
anchored to the inner
membrane by a hairpin-like hydrophobic domain,
with both the N-
and the C-terminal domains facing the matrix.
Virtually no residues
would be exposed on the outer surface of the
inner
membrane.
The absence of Pnt1p has only modest effects on otherwise wild-type
S. cerevisiae cells.
Both the pnt1-41 and
pnt1
::LEU2 mutations prevent respiratory growth
of cells whose mtDNA encodes the Cox2p-Arg8mp fusion
protein. We also examined the effect of the
pnt1
::LEU2 deletion on the growth of strains
whose mtDNA encoded either another fusion protein,
Cox2p-Blemp, or wild-type Cox2p (Fig.
6). The synthetic gene
BLEm specifies, in the yeast mitochondrial
genetic code, the 126-residue bleomycin-resistant protein
(36) of the bacterial transposon Tn5 (unpublished
results). Fusion of this relatively short passenger moiety to the C
terminus of Cox2p did not affect the respiratory growth of an otherwise
wild-type strain. However, expression of the Cox2p-Blemp
fusion protein in a pnt1
::LEU2 nuclear mutant
resulted in a Pet
phenotype (Fig. 6), suggesting that
membrane translocation of this fusion protein was also dependent on
Pnt1p function. Consistent with this interpretation,
pnt1
::LEU2 cells expressing either mitochondrially encoded fusion protein lacked cytochrome oxidase activity (data not shown).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 6.
Deletion of PNT1 prevents respiratory growth
of strains expressing Cox2p fusion proteins but not wild-type Cox2p.
Each strain was streaked on YPD and YPEG, and the plates were incubated
at 30°C for 4 or 5 days, respectively. The relevant nuclear genotypes
(PNT1 or pnt1 ) and mitochondrial genotypes
(COX2, COX2::ARG8m or
COX2::BLEm) are indicated for each
sector.
|
|
Interestingly, the
pnt1
::LEU2 mutation did not
appear to affect the respiratory growth of a strain containing
wild-type mtDNA
on solid nonfermentable medium (Fig.
6), although in
liquid medium
with poor aeration the
pnt1
::LEU2
mutant grew slower than the
wild type did. To determine whether the
absence of Pnt1p had any
effect on the biogenesis of cytochrome
oxidase, we assayed this
enzyme in mitochondria purified from isogenic
PNT1 and
pnt1
::LEU2 strains growing
on nonfermentable medium (Fig.
7). In the
absence
of Pnt1p, cytochrome oxidase specific activity was reduced to
58% of the wild-type level. This suggests that Pnt1p plays a role
in
the efficient biogenesis of cytochrome oxidase. However, export
of the
wild-type Cox2p C-tail cannot be completely dependent upon
Pnt1p
function.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
The absence of Pnt1p reduces cytochrome c
oxidase activity in mitochondria from an S. cerevisiae
strain containing wild-type mtDNA. Mitochondria were isolated from
mid-log-phase cells of two isogenic strains, DFS188 (PNT1)
and SH412 (pnt1 ::LEU2), that were grown in YPEG
at 30°C. The mitochondria were purified on Nycodenz gradients
(17) prior to the assay. Specific activity was determined
spectrophotometrically as the rate of oxidation of reduced horse heart
cytochrome c and is expressed as the change in optical
density at 550 nm per minute per milligram of mitochondrial proteins
(35). The error bars show the standard deviation of four
independent measurements.
|
|
We also examined the frequency of


(cytoplasmic
petite) mtDNA deletion mutants in cultures of isogenic wild-type and
pnt1
::LEU2 mutant strains, both of which
contained wild-type mtDNA. Cultures
of each strain were grown in
complete medium containing either
fermentable (glucose [YPD]) or
nonfermentable (ethanol plus glycerol
[YPEG]) carbon sources and
sampled during logarithmic growth as
well as during the stationary
phase for a period of several weeks.
mtDNA of the wild-type strain was
very stable under all these
conditions (Fig.
8). During logarithmic growth on glucose
and
subsequent incubation of the cultures, the absence of Pnt1p had
no
effect on the stable maintenance of
+ mtDNA. However,
the
pnt1
::LEU2 culture grown in YPEG
accumulated
increased numbers of


cells, which rose
dramatically over a period of days and weeks
(Fig.
8). After 45 days,
roughly 17% of the viable
pnt1
::LEU2 cells had
lost the ability to respire. These nonrespiring cells
were


mutants with deletions of various regions of mtDNA,
as judged
by their ability to recombine with
mit
testers (data not shown). The fact that

pnt1
::LEU2 cells accumulated
during growth on nonfermentable
carbon sources, which selects against
nonrespiring mutants, suggests
that the absence of Pnt1p has a more
deleterious effect in cells
actively engaged in respiration. Consistent
with this idea, we
found that the
pnt1
::LEU2
mutation increased the sensitivity
of otherwise wild-type cells to
growth inhibition by H
2O
2 on medium
containing
nonfermentable carbon sources (Fig.
9).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 8.
Absence of Pnt1p causes increased 
accumulation when grown in nonfermentable carbon sources. Single
colonies of the isogenic strains DFS188 (PNT1) and SH412
(pnt1 ::LEU2) grown on nonfermentable medium
(YPEG) were inoculated to liquid YPD and allowed to grow to saturation.
Aliquots of cells of each strain were then inoculated into fresh liquid
YPD or YPEG and incubated at 30°C for the times indicated. Samples
were taken periodically from each culture, diluted, and plated onto
YPD. These YPD plates were replica-plated to YPEG, and colonies that
failed to grow on YPEG were scored as  .
|
|

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 9.
Deletion of PNT1 causes increased sensitivity
to oxidative damage by H2O2. Equal amounts of
cells of strains DFS188 (PNT1) and SH412
(pnt1 ::LEU2), grown to early stationary phase,
were evenly spread on plates (35 by 10 mm) containing 3 ml of YPEG, and
3 µl of 30% H2O2 was pipetted onto filter
disks in the center of the plates. The plates were incubated for 2 days
at 30°C and photographed.
|
|
In K. lactis, absence of the homologous KlPnt1p
prevents respiratory growth, assembly of cytochrome oxidase, and,
apparently, export of the Cox2p C tail.
We isolated a functional
homologue of PNT1 from K. lactis,
KlPNT1, by its ability to complement the Pet
phenotype of a S. cerevisiae pnt1 deletion strain that
carried COX2::ARG8m in its mtDNA (see
Materials and Methods). KlPnt1p and Pnt1p have only about 27% identity
and 48% similarity in amino acid sequence. However, the hydrophobicity
plot of the KlPnt1p sequence (not shown) resembles that of Pnt1p (Fig.
5B), and the central hydrophobic region is also interrupted by two
acidic E residues.
We deleted the
KlPNT1 gene from the nuclear genome of a
K. lactis strain with normal mtDNA (see Materials and
Methods). The
resulting mutant was unable to grow on nonfermentable
medium (Fig.
10A), indicating that
respiratory growth is more dependent on
KlPNT1 in
K. lactis than on
PNT1 in
S. cerevisiae. To
determine whether
this defect could be due to diminished cytochrome
c oxidase, we
assayed the enzyme in mitochondria isolated
from the
Klpnt1 deletion
strain as well as the parental
wild-type strain. In
K. lactis,
the deletion essentially
eliminated cytochrome oxidase activity
(Fig.
10B), in contrast to the
modest effect of the corresponding
mutation in
S. cerevisiae
(Fig.
7). Western blot analysis of these
mitochondria with anti-Cox2p
revealed that the
Klpnt1 deletion
did not block the
accumulation of Cox2p, although it did reduce
the steady-state level
relative to the wild type (Fig.
11 and
data
not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 10.
Deletion of the K. lactis gene
KlPNT1 causes a nonrespiratory phenotype and the absence of
cytochrome c oxidase activity. (A) The Klpnt1
deletion strain (SH702) was transformed with either a KlPNT1
plasmid (pSH505) or the empty vector (pROCS2). The transformants were
streaked on glucose minimal medium (SD-ura) selecting for the plasmids
or on YPEG and incubated at 30°C for 2 days before being
photographed. (B) Crude mitochondria were isolated from KB101
(KlPNT1) and SH702 (Klpnt1 ::hisG) as
described in Materials and Methods, and cytochrome oxidase was assayed
by the same procedure as in the experiment Fig. 7. The error bars show
the standard deviation of four independent measurements.
|
|

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 11.
Absence of KlPnt1p causes a defect in KlCox2p assembly
that is apparently due to a block of C-tail export. (A) The absence of
KlPnt1p blocks the assembly of KlCox2p into the cytochrome oxidase
complex. Mitochondria were isolated and purified from KB101
(KlPNT1) and SH702 (Klpnt1 ::hisG).
Purified mitochondria (75 µg for each sample) were solubilized with
1% octylglucoside, mixed with the indicated amounts of proteinase K (0 to 150 µg/ml) in a total volume of 200 µl, and incubated on ice for
20 min. Proteinase K was inactivated by the addition of 2 mM
phenylmethylsulfonyl fluoride followed by incubation with 10%
trichloroacetic acid at 65°C for 10 min. Samples were chilled on ice
for 5 min and centrifuged. Protein samples (10 µg/lane for KB101, and
20 µg/lane for SH702) were separated on a 14% polyacrylamide-SDS
gel, blotted, and probed with the anti-Cox2p monoclonal antibody CCO6.
The right panel was exposed longer to achieve comparable intensities
for unproteolyzed wild-type and mutant samples. (B) The purified
mitochondria were subjected to mitoplasting in the absence or presence
of 75 µg of proteinase K per ml, as described for S. cerevisiae (see Materials and Methods). Proteinase K inactivation
and immunoblotting were carried out as described for panel A. The same
gel blot was then stripped and reprobed with anti-Tim10p, which
recognizes a soluble IMS protein in S. cerevisiae
(29), to demonstrate successful removal of the outer
membrane.
|
|
To ask whether the cytochrome oxidase deficiency of the
K. lactis
Klpnt1 mutant might be due to defective export of Cox2p
domains,
we first examined the protease K sensitivity of KlCox2p
in
detergent-solubilized mitochondria. Solubilized cytochrome
oxidase from
wild-type
S. cerevisiae is highly resistant to proteolysis
(
12). Purified wild-type (KB101) and mutant (SH702)
K. lactis mitochondria were solubilized with the mild detergent octyl
glucoside,
incubated with various amounts of protease K, and then
analyzed
by Western blotting with the anti-Cox2p monoclonal antibody
CCO6
(
46), which, as we have previously shown
(
20), recognizes
an epitope in the C-tail domain (Fig.
11A).
Assembled KlCox2p from
solubilized wild-type mitochondria was highly
resistant to proteinase
K digestion, and at high concentrations of
proteinase K an 18-kDa
immunoreactive fragment was generated,
suggesting preferential
cleavage of the KlCox2p matrix loop. In
contrast, solubilized
KlCox2p from the
Klpnt1 deletion
mutant mitochondria was much
more sensitive to protease K, and there
was no evidence of the
stable 18-kDa subfragment under any conditions,
suggesting that
KlPnt1p is necessary for assembly of KlCox2p into the
protease-resistant
cytochrome oxidase complex. In parallel experiments,
KlCox2p from
wild-type mitochondria was completely resistant to
trypsin, while
the KlCox2p from mutant mitochondria was highly
sensitive (data
not
shown).
If the unassembled protease-sensitive KlCox2p were normally exported in
the mitochondria lacking KlPnt1p, it should be sensitive
to digestion
by protease K in mitoplasts. On the other hand, if
export were
defective in the absence of KlPnt1p, this unassembled
KlCox2p should be
protected from protease K by the intact inner
membrane of mutant
(SH702) mitoplasts. As expected for an export
defect, we found that
KlCox2p was largely protected from protease
K in mitoplasts lacking
KlPnt1p (Fig.
11B, right). The assembled
KlCox2p in wild-type
K. lactis mitoplasts was, of course, also
resistant to protease K
digestion (Fig.
11B, left), as previously
shown for
S. cerevisiae (
24). Interestingly, a fraction of KlCox2p
from the mutant mitoplasts was shortened by proteinase K treatment
(Fig.
11B, right, lane 4), suggesting the possibility that some
N tail
export occurred in the absence of KlPnt1p. These results
suggest that
in
K. lactis, KlPnt1p is required for the export
of the
KlCox2p C tail and is at least partially required for the
export of the
KlCox2p N
tail.
 |
DISCUSSION |
The machinery that inserts mitochondrially encoded proteins into
the inner membrane and translocates their hydrophilic domains through
the membrane is poorly understood. We have developed a genetic screen
for S. cerevisiae mutants defective in the translocation of
mitochondrially encoded hydrophilic protein domains through the inner
membrane to the IMS. The screen is based on the fact that the
hydrophilic polypeptide Arg8mp is exported from the matrix
when it is synthesized within mitochondria as a bifunctional
Cox2p-Arg8mp fusion protein (20). Apparently,
the export system that translocates the large acidic C-tail of Cox2p
through the inner membrane continues to translocate the
Arg8mp fused to it (Fig. 2). However, Arg8mp
participates in the arginine biosynthetic pathway only if it is located
within the matrix (Fig. 1). Thus, export of Arg8mp causes
an Arg
growth phenotype in the strain developed for this
study. Export of the fusion protein also supports the assembly of
functional cytochrome c oxidase (20), presumably
after proteolytic removal of Arg8mp in the IMS. Thus, the
parent strain is Pet+ (respiratory competent).
From our parent strain, we selected Arg+ mutants, with the
expectation that some should be Arg+ because they fail to
export Arg8mp and thus allow it to function in the matrix.
We anticipated that among the Arg+ mutants isolated, those
that were deficient in protein export should also be unable to assemble
cytochrome c oxidase normally and therefore would exhibit an
unselected Pet
(respiratory deficient) phenotype. In this
study we have analyzed the gene PNT1, identified by one such
recessive nuclear mutation, and the protein it encodes. In the absence
of functional Pnt1p, the C-terminal Arg8mp moiety of the
Cox2p-Arg8mp fusion protein is not translocated through the
inner membrane and remains largely in the matrix. Furthermore, the
Cox2p moiety of the fusion protein is not assembled into active
cytochrome c oxidase, suggesting that its C tail is also
trapped on the inside. Thus, the selection scheme appears to yield
export-defective mutants.
We examined the subcellular location and topology of a functional,
epitope-tagged form of Pnt1p that was expressed from the PNT1 chromosomal locus. Pnt1p-HA was specifically located in
mitochondria. Submitochondrial fractionation and protease protection
experiments demonstrated that Pnt1p-HA was an integral inner membrane
protein, as would be expected for a protein involved in export.
Proteolytic treatment of mitoplasts failed either to destroy the
C-terminal HA epitope of Pnt1p-HA or to generate a shorter
epitope-tagged product, suggesting that none of the polypeptide is
accessible on the outside of the inner membrane.
The predicted Pnt1p sequence contains a central hydrophobic region of
approximately 31 amino acids (residues 198 to 228) that is interrupted
by two acidic Glu residues (at positions 209 and 210). Flanking this
hydrophobic region are N- and C-terminal positively charged hydrophilic
domains. We therefore propose that Pnt1p is anchored to the inner
membrane by a central hairpin-like membrane anchor, with both flanking
hydrophilic domains on the inside (matrix side) of the membrane (Fig.
5). Such a topology is consistent with the "positive inside rule"
(55), although this "rule" is broken by several
nuclearly encoded mitochondrial inner membrane proteins
(16). Interestingly, our original mutation,
pnt1-41, caused a missense substitution, W382R, in the
C-terminal domain. However, while our data show that Pnt1p is necessary
for export of the Cox2p-Arg8mp fusion protein, they do not
demonstrate that it plays a direct role in translocation.
The failure of pnt1 mutants to export the C-terminal portion
of the Cox2p-Arg8mp fusion protein results in a
Pet
growth phenotype. We also observed the same
Pet
phenotype in a pnt1 mutant whose mtDNA
encoded a different fusion protein, Cox2p-Blem (Fig. 6).
However, the pnt1 deletion mutation had only modest effects
on S. cerevisiae strains containing wild-type mtDNA,
reducing cytochrome c oxidase activity by about 40% without
affect respiratory growth under normal conditions. In contrast to the
modest effects of pnt1 deletion in S. cerevisiae,
we found that deletion of the functionally homologous gene,
KlPNT1, from the nuclear genome of a K. lactis
strain containing wild-type mtDNA caused a clear nonrespiratory
phenotype, the absence of cytochrome oxidase activity, and a defect in
the assembly of KlCox2p that appears to be due to a C-tail export
defect. Taken together, these results demonstrate an important
physiological role for KlPnt1p in K. lactis and suggest that
overlapping functions may exist in S. cerevisiae.
The possible redundancy of Pnt1p in S. cerevisiae is not
simply due to a second homologous gene, since PNT1 is unique
in the genome. However, partial functional redundancy involving
nonhomologous proteins has a well-known precedent in the translocation
apparatus that imports cytoplasmically synthesized precursors into the
organelle. For example, the mitochondrial import system can function at
least partially in the absence of either the Tom70p or Tom20p receptor proteins (26, 32, 38). Furthermore, as noted above, even the
highly conserved protein Oxa1p can be rendered dispensable for inner
membrane translocation in yeast by mutations affecting the membrane
anchor of cytochrome c1 (19). While
the mechanism of this suppression is not clear, it does support the
idea that there is at least latent functional redundancy in the
mitochondrial export translocation machinery in S. cerevisiae.
While Pnt1p has not been studied as intensively as Oxa1p, it appears to
have a distinct function. In the absence of Pnt1p, mitochondrially
synthesized Cox2p-Arg8mp cannot be exported and the
accumulated enzyme in the matrix is sufficient to support arginine
biosynthesis. However, while oxa1 mutations also prevent the
export of Cox2p-Arg8mp, they greatly decrease the
steady-state level of the accumulated fusion protein (20) to
the point that cells exhibit an Arg
growth phenotype
(unpublished results). Thus, Oxa1p plays a role in stabilizing
mitochondrial proteins, a phenomenon also noted by others
(19), that Pnt1p does not.
Pnt1p is not necessary for the maintenance of wild-type
(
+) mtDNA. In pnt1 deletion mutant cells
grown on glucose medium and incubated on the same medium for several
weeks, there was no significant accumulation of 
mtDNA
deletions. However, cultures of pnt1 mutant cells grown under respiratory conditions accumulated significantly more

mutants upon prolonged incubation than did similarly
incubated wild-type cultures. This result suggests that the activity of Pnt1p may play a role, direct or indirect, in protecting mitochondria from oxidative damage. Consistent with this idea, pnt1
deletion mutants exhibited increased sensitivity to the oxidant
H2O2, compared to the wild type. An interesting
hypothesis for the role of Pnt1p in protecting against oxidative damage
is that it could promote transport out of the matrix of components
damaged by reactive oxygen species. Such a "detoxification" system
could be required for the export of the aberrant C-terminally modified
Cox2p-fusion proteins we generated.
PNT1 was originally isolated in a screen for yeast genes
that affected resistance to pentamidine, an antimicrobial drug that has
been used clinically to treat pneumonia in AIDS patients infected with
the fungus Pneumocystis carinii (33). As shown
previously (33) and confirmed by us (data not shown),
overexpression of PNT1 increases pentamidine resistance
while deletion of PNT1 makes yeast more sensitive. Growth of
S. cerevisiae on nonfermentable carbon sources is far more
sensitive to pentamidine than is growth on fermentable sugar,
suggesting that the drug interacts with mitochondrial targets
(34). While the identity of these targets remains unknown,
our finding that Pnt1p is a mitochondrial inner membrane protein
confirms the importance of the organelle in pentamidine action. The
involvement of Pnt1p in mitochondrial export suggests the possibility
that drug resistance involves the removal of damaged targets, or
pentamidine itself, from the matrix by an active-transport mechanism.
 |
ACKNOWLEDGMENTS |
We thank T. L. Mason for anti-Cox2p and for help in
performing cytochrome oxidase assays. We also thank B. S. Glick,
C. Koehler, and G. Schatz for other antisera; N. Da Silva, H. Fukuhara,
and M. Bianchi for K. lactis plasmids; and L. A. Grivell for the K. lactis library.
This work was supported by the U.S. National Institutes of Health in
the form of a National Research Service Award (GM18093) to S.H. and a
grant (GM29362) to T.D.F.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Genetics, Biotechnology Building, Cornell
University, Ithaca, NY 14853-2703. Phone: (607) 254-4835. Fax: (607)
255-6249. E-mail: tdf1{at}cornell.edu.
Present address: Monsanto Life Sciences Co., St. Louis, MO 63167.
 |
REFERENCES |
| 1.
|
Abad, A. R.,
B. J. Mehrtens, and S. A. Mackenzie.
1995.
Specific expression in reproductive tissues and fate of a mitochondrial sterility-associated protein in cytoplasmic male-sterile bean.
Plant Cell
7:271-285[Abstract].
|
| 2.
|
Alani, E.,
L. Cao, and N. Kleckner.
1987.
A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.
Genetics
116:541-545[Abstract/Free Full Text].
|
| 3.
|
Attardi, G., and G. Schatz.
1988.
Biogenesis of mitochondria.
Annu. Rev. Cell Biol.
4:289-333.
|
| 4.
|
Balzi, E., and A. Goffeau.
1995.
Yeast multidrug resistance: the PDR network.
J. Bioenerg. Biomembr.
27:71-76[Medline].
|
| 5.
|
Bauer, M.,
M. Behrens,
K. Esser,
G. Michaelis, and E. Pratje.
1994.
PET1402, a nuclear gene required for proteolytic processing of cytochrome oxidase subunit 2 in yeast.
Mol. Gen. Genet.
245:272-278[Medline].
|
| 6.
|
Bianchi, M. M.,
R. Santarelli, and L. Frontali.
1991.
Plasmid functions involved in the stable propagation of the pKD1 circular plasmid in Kluyveromyces lactis.
Curr. Genet.
19:155-161[Medline].
|
| 7.
|
Bonnefoy, N.,
F. Chalvet,
P. Hamel,
P. P. Slonimski, and G. Dujardin.
1994.
OXA1, a Saccharomyces cerevisiae nuclear gene whose sequence is conserved from prokaryotes to eukaryotes controls cytochrome oxidase biogenesis.
J. Mol. Biol.
239:201-212[Medline].
|
| 8.
|
Bonnefoy, N.,
M. Kermorgant,
O. Groudinsky,
M. Minet,
P. P. Slonimski, and G. Dujardin.
1994.
Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1 mutation in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:11978-11982[Abstract/Free Full Text].
|
| 9.
|
Dabhi, V. M., and K. F. Lindahl.
1995.
MtDNA-encoded histocompatibility antigens.
Methods Enzymol.
260:466-485[Medline].
|
| 10.
|
Deshaies, R. J., and R. Schekman.
1987.
A yeast mutant defective at an early stage in import of secretory protein precursors into the endoplasmic reticulum.
J. Cell. Biol.
105:633-645[Abstract/Free Full Text].
|
| 11.
|
Dujon, B.
1981.
Mitochondrial genetics and functions, p. 505-635.
In
J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces: life cycle and inheritance. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 12.
|
Eytan, G. D., and G. Schatz.
1975.
Cytochrome c oxidase from bakers' yeast. V. Arrangement of the subunits in the isolated and membrane-bound enzyme.
J. Biol. Chem.
250:767-774[Abstract/Free Full Text].
|
| 13.
|
Fikes, J. D.,
D. M. Becker,
F. Winston, and L. Guarente.
1990.
Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae.
Nature
346:291-294[Medline].
|
| 14.
|
Fox, T. D.,
L. S. Folley,
J. J. Mulero,
T. W. McMullin,
P. E. Thorsness,
L. O. Hedin, and M. C. Costanzo.
1991.
Analysis and manipulation of yeast mitochondrial genes.
Methods Enzymol.
194:149-165[Medline].
|
| 15.
|
Fujiki, Y.,
A. L. Hubbard,
S. Fowler, and P. B. Lazarow.
1982.
Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum.
J. Cell Biol.
93:97-102[Abstract/Free Full Text].
|
| 16.
|
Gavel, Y., and G. Von Heijne.
1992.
The distribution of charged amino acids in mitochondrial inner-membrane proteins suggests different modes of membrane integration for nuclearly and mitochondrially encoded proteins.
Eur. J. Biochem.
205:1207-1215[Medline].
|
| 17.
|
Glick, B. S., and L. A. Pon.
1995.
Isolation of highly purified mitochondria from Saccharomyces cerevisiae.
Methods Enzymol.
260:213-223[Medline].
|
| 18.
|
Glick, B. S., and G. von Heijne.
1996.
Saccharomyces cerevisiae mitochondria lack a bacterial-type Sec machinery.
Protein Sci.
5:2651-2652[Medline].
|
| 18a.
| Green-Willms, N. S., and T. D. Fox.
Unpublished data.
|
| 19.
|
Hamel, P.,
C. Lemaire,
N. Bonnefoy,
P. Brivet-Chevillotte, and G. Dujardin.
1998.
Mutations in the membrane anchor of yeast cytochrome c1 compensate for the absence of Oxa1p and generate carbonate-extractable forms of cytochrome c1.
Genetics
150:601-611[Abstract/Free Full Text].
|
| 20.
|
He, S., and T. D. Fox.
1997.
Membrane translocation of mitochondrially coded Cox2p: distinct requirements for export of amino- and carboxy-termini, and dependence on the conserved protein Oxa1p.
Mol. Biol. Cell
8:1449-1460[Abstract].
|
| 21.
|
Heimberg, H.,
A. Boyen,
M. Crabeel, and N. Glansdorff.
1990.
Escherichia coli and Saccharomyces cerevisiae acetylornithine aminotransferases: evolutionary relationship with ornithine aminotransferases.
Gene
90:69-78[Medline].
|
| 22.
|
Hell, K.,
J. Herrmann,
E. Pratje,
W. Neupert, and R. A. Stuart.
1997.
Oxa1p mediates the export of the N- and C-termini of pCoxII from the mitochondrial matrix to the intermembrane space.
FEBS Lett.
418:367-370[Medline].
|
| 23.
|
Hell, K.,
J. M. Herrmann,
E. Pratje,
W. Neupert, and R. A. Stuart.
1998.
Oxa1p, an essential component of the N-tail protein export machinery in mitochondria.
Proc. Natl. Acad. Sci. USA
95:2250-2255[Abstract/Free Full Text].
|
| 24.
|
Herrmann, J. M.,
H. Koll,
R. A. Cook,
W. Neupert, and R. A. Stuart.
1995.
Topogenesis of cytochrome oxidase subunit II: mechanisms of protein export from the mitochondrial matrix.
J. Biol. Chem.
270:27079-27086[Abstract/Free Full Text].
|
| 25.
|
Herrmann, J. M.,
W. Neupert, and R. A. Stuart.
1997.
Insertion into the mitochondrial inner membrane of a polytopic protein, the nuclear-encoded Oxa1p.
EMBO J.
16:2217-2226[Medline].
|
| 26.
|
Hines, V.,
A. Brandt,
G. Griffiths,
H. Horstmann,
H. Brütsch, and G. Schatz.
1990.
Protein import into yeast mitochondria is accelerated by the outer membrane protein MAS70.
EMBO J.
9:3191-3200[Medline].
|
| 27.
|
Jauniaux, J.-C.,
L. A. Urrestarazu, and J.-M. Wiame.
1978.
Arginine metabolism in Saccharomyces cerevisiae: subcellular localization of the enzymes.
J. Bacteriol.
133:1096-1107[Abstract/Free Full Text].
|
| 28.
|
Kermorgant, M.,
N. Bonnefoy, and G. Dujardin.
1997.
Oxa1p, which is required for cytochrome c oxidase and ATP synthase complex formation, is embedded in the mitochondrial inner membrane.
Curr. Genet.
31:302-307[Medline].
|
| 29.
|
Koehler, C. M.,
E. Jarosch,
K. Tokatlidis,
K. Schmid,
R. J. Schweyen, and G. Schatz.
1998.
Import of mitochondrial carriers mediated by essential proteins of the intermembrane space.
Science
279:369-373[Abstract/Free Full Text].
|
| 30.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[Medline].
|
| 31.
|
Liao, X., and R. A. Butow.
1993.
RTG1 and RTG2: Two yeast genes required for a novel path of communication from mitochondria to the nucleus.
Cell
72:61-71[Medline].
|
| 32.
|
Lithgow, T.,
T. Junne,
C. Wachter, and G. Schatz.
1994.
Yeast mitochondria lacking the two import receptors Mas20p and Mas70p can efficiently and specifically import precursor proteins.
J. Biol. Chem.
269:15325-15330[Abstract/Free Full Text].
|
| 33.
|
Ludewig, G., and C. Staben.
1994.
Characterization of the PNT1 pentamidine resistance gene of Saccharomyces cerevisiae.
Antimicrob. Agents Chemother.
38:2850-2856[Abstract/Free Full Text].
|
| 34.
|
Ludewig, G.,
J. M. Williams,
Y. Li, and C. Staben.
1994.
Effects of pentamidine isethionate on Saccharomyces cerevisiae.
Antimicrob. Agents Chemother.
38:1123-1128[Abstract/Free Full Text].
|
| 35.
|
Mason, T. L.,
R. O. Poyton,
D. C. Wharton, and G. Schatz.
1973.
Cytochrome c oxidase from bakers' yeast. I. Isolation and properties.
J. Biol. Chem.
248:1346-1354[Abstract/Free Full Text].
|
| 36.
|
Mazodier, P.,
P. Cossart,
E. Giraud, and F. Gasser.
1985.
Completion of the nucleotide sequence of the central region of Tn5 confirms the presence of three resistance genes.
Nucleic Acids Res.
13:195-205[Abstract/Free Full Text].
|
| 37.
|
Meyer, W.,
M. Bauer, and E. Pratje.
1997.
A mutation in cytochrome oxidase subunit 2 restores respiration of the mutant pet ts1402.
Curr. Genet.
31:401-407[Medline].
|
| 38.
|
Moczko, M.,
B. Ehmann,
F. Gartner,
A. Honlinger,
E. Schafer, and N. Pfanner.
1994.
Deletion of the receptor MOM19 strongly impairs import of cleavable preproteins into Saccharomyces cerevisiae mitochondria.
J. Biol. Chem.
269:9045-9051[Abstract/Free Full Text].
|
| 39.
|
Mulder, W.,
I. Scholten,
R. de Boer, and L. Grivell.
1994.
Sequence of the HAP3 transcription factor of Kluyveromyces lactis predicts the presence of a novel 4-cysteine zinc-finger motif.
Mol. Gen. Genet.
245:96-106[Medline].
|
| 40.
|
Mulero, J. J., and T. D. Fox.
1993.
Alteration of the Saccharomyces cerevisiae COX2 5'-untranslated leader by mitochondrial gene replacement and functional interaction with the translational activator protein PET111.
Mol. Biol. Cell
4:1327-1335[Abstract].
|
| 41.
|
Neff, N. F.,
J. H. Thomas,
P. Grisafi, and D. Botstein.
1983.
Isolation of the -tubulin gene from yeast and demonstration of its essential function in vivo.
Cell
33:211-219[Medline].
|
| 42.
|
Nelson, B. D., and F. Kabir.
1986.
The role of the mitochondrial outer membrane in energy metabolism of tumor cells.
Biochimie
68:407-415[Medline].
|
| 43.
|
Neupert, W.
1997.
Protein import into mitochondria.
Annu. Rev. Biochem.
66:863-917[Medline].
|
| 44.
|
Oliver, D. B., and J. Beckwith.
1981.
E. coli mutant pleiotropically defective in the export of secreted proteins.
Cell
25:765-772[Medline].
|
| 45.
|
Pfanner, N.,
E. A. Craig, and A. Honlinger.
1997.
Mitochondrial preprotein translocase.
Annu. Rev. Cell Dev. Biol.
13:25-51[Medline].
|
| 46.
|
Pinkham, J. L.,
A. M. Dudley, and T. L. Mason.
1994.
T7 RNA polymerase-dependent expression of COXII in yeast mitochondria.
Mol. Cell. Biol.
14:4643-4652[Abstract/Free Full Text].
|
| 47.
|
Pon, L., and G. Schatz.
1991.
Biogenesis of yeast mitochondria, p. 333-406.
In
J. R. Broach, J. R. Pringle, and E. W. Jones (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis and energetics, vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 48.
|
Poyton, R. O.,
D. M. J. Duhl, and G. H. D. Clarkson.
1992.
Protein export from the mitochondrial matrix.
Trends Cell Biol.
2:369-375.
[Medline] |
| 49.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1988.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 50.
|
Saier, M. H., Jr.,
I. T. Paulsen,
M. K. Sliwinski,
S. S. Pao,
R. A. Skurray, and H. Nikaido.
1998.
Evolutionary origins of multidrug and drug-specific efflux pumps in bacteria.
FASEB J.
12:265-274[Abstract/Free Full Text].
|
| 51.
|
Schatz, G.
1996.
The protein import system of mitochondria.
J. Biol. Chem.
271:31763-31766[Free Full Text].
|
| 52.
|
Schneider, B. L.,
W. Seufert,
B. Steiner,
Q. H. Yang, and A. B. Futcher.
1995.
Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae.
Yeast
11:1265-1274[Medline].
|
| 53.
|
Steele, D. F.,
C. A. Butler, and T. D. Fox.
1996.
Expression of a recoded nuclear gene inserted into yeast mitochondrial DNA is limited by mRNA-specific translational activation.
Proc. Natl. Acad. Sci. USA
93:5253-5257[Abstract/Free Full Text].
|
| 54.
|
Tsukihara, T.,
H. Aoyama,
E. Yamashita,
T. Tomizaki,
H. Yamaguchi,
K. Shinzawa-Itoh,
R. Nakashima,
R. Yaono, and S. Yoshikawa.
1995.
Structures of metal sites of oxidized bovine heart cytochrome c oxidase at 2.8 Å.
Science
269:1069-1074[Abstract/Free Full Text].
|
| 55.
|
von Heijne, G.
1986.
The distribution of positively charged residues in bacterial inner membrane proteins correlates with the trans-membrane topology.
EMBO J.
5:3021-3027[Medline].
|
Molecular and Cellular Biology, October 1999, p. 6598-6607, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fiumera, H. L., Dunham, M. J., Saracco, S. A., Butler, C. A., Kelly, J. A., Fox, T. D.
(2009). Translocation and Assembly of Mitochondrially Coded Saccharomyces cerevisiae Cytochrome c Oxidase Subunit Cox2 by Oxa1 and Yme1 in the Absence of Cox18. Genetics
182: 519-528
[Abstract]
[Full Text]
-
Fiumera, H. L., Broadley, S. A., Fox, T. D.
(2007). Translocation of Mitochondrially Synthesized Cox2 Domains from the Matrix to the Intermembrane Space. Mol. Cell. Biol.
27: 4664-4673
[Abstract]
[Full Text]
-
Frazier, A. E., Taylor, R. D., Mick, D. U., Warscheid, B., Stoepel, N., Meyer, H. E., Ryan, M. T., Guiard, B., Rehling, P.
(2006). Mdm38 interacts with ribosomes and is a component of the mitochondrial protein export machinery.. JCB
172: 553-564
[Abstract]
[Full Text]
-
Demlow, C. M., Fox, T. D.
(2003). Activity of Mitochondrially Synthesized Reporter Proteins Is Lower Than That of Imported Proteins and Is Increased by Lowering cAMP in Glucose-Grown Saccharomyces cerevisiae Cells. Genetics
165: 961-974
[Abstract]
[Full Text]
-
Naithani, S., Saracco, S. A., Butler, C. A., Fox, T. D.
(2003). Interactions among COX1, COX2, and COX3 mRNA-specific Translational Activator Proteins on the Inner Surface of the Mitochondrial Inner Membrane of Saccharomyces cerevisiae. Mol. Biol. Cell
14: 324-333
[Abstract]
[Full Text]
-
Basselin, M., Denise, H., Coombs, G. H., Barrett, M. P.
(2002). Resistance to Pentamidine in Leishmania mexicana Involves Exclusion of the Drug from the Mitochondrion. Antimicrob. Agents Chemother.
46: 3731-3738
[Abstract]
[Full Text]
-
Saint-Georges, Y., Hamel, P., Lemaire, C., Dujardin, G.
(2001). Role of positively charged transmembrane segments in the insertion and assembly of mitochondrial inner-membrane proteins. Proc. Natl. Acad. Sci. USA
98: 13814-13819
[Abstract]
[Full Text]
-
Broadley, S. A., Demlow, C. M., Fox, T. D.
(2001). Peripheral Mitochondrial Inner Membrane Protein, Mss2p, Required for Export of the Mitochondrially Coded Cox2p C Tail in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 7663-7672
[Abstract]
[Full Text]
-
Preuss, M., Leonhard, K., Hell, K., Stuart, R. A., Neupert, W., Herrmann, J. M.
(2001). Mba1, a Novel Component of the Mitochondrial Protein Export Machinery of the Yeast Saccharomyces cerevisiae. JCB
153: 1085-1096
[Abstract]
[Full Text]
-
Liu, M., Spremulli, L.
(2000). Interaction of Mammalian Mitochondrial Ribosomes with the Inner Membrane. J. Biol. Chem.
275: 29400-29406
[Abstract]
[Full Text]
-
Saracco, S. A., Fox, T. D.
(2002). Cox18p Is Required for Export of the Mitochondrially Encoded Saccharomyces cerevisiae Cox2p C-Tail and Interacts with Pnt1p and Mss2p in the Inner Membrane. Mol. Biol. Cell
13: 1122-1131
[Abstract]
[Full Text]