Previous Article | Next Article 
Molecular and Cellular Biology, October 1999, p. 6729-6741, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulation of Cell Cycle Transcription Factor Swi4
through Auto-Inhibition of DNA Binding
Kristin
Baetz and
Brenda
Andrews*
Department of Molecular and Medical Genetics,
University of Toronto, Toronto, Ontario, Canada M5S 1A8
Received 11 May 1999/Returned for modification 11 June
1999/Accepted 22 June 1999
 |
ABSTRACT |
In Saccharomyces cerevisiae, two transcription factors,
SBF (SCB binding factor) and MBF (MCB binding factor), promote the induction of gene expression at the G1/S-phase transition
of the mitotic cell cycle. Swi4 and Mbp1 are the DNA binding components of SBF and MBF, respectively. The Swi6 protein is a common subunit of
both transcription factors and is presumed to play a regulatory role.
SBF binding to its target sequences, the SCBs, is a highly regulated
event and requires the association of Swi4 with Swi6 through their
C-terminal domains. Swi4 binding to SCBs is restricted to the late M
and G1 phases, when Swi6 is localized to the nucleus. We
show that in contrast to Swi6, Swi4 remains nuclear throughout the cell
cycle. This finding suggests that the DNA binding domain of Swi4 is
inaccessible in the full-length protein when not complexed with Swi6.
To explore this hypothesis, we expressed Swi4 and Swi6 in insect cells
by using the baculovirus system. We determined that partially purified
Swi4 cannot bind SCBs in the absence of Swi6. However, Swi4 derivatives
carrying point mutations or alterations in the extreme C terminus were
able to bind DNA or activate transcription in the absence of Swi6, and
the C terminus of Swi4 inhibited Swi4 derivatives from binding DNA in
trans. Full-length Swi4 was determined to be monomeric in
solution, suggesting an intramolecular mechanism for auto-inhibition of
binding to DNA by Swi4. We detected a direct in vitro interaction
between a C-terminal fragment of Swi4 and the N-terminal 197 amino
acids of Swi4, which contain the DNA binding domain. Together, our data
suggest that intramolecular interactions involving the C-terminal
region of Swi4 physically prevent the DNA binding domain from binding
SCBs. The interaction of the carboxy-terminal region of Swi4 with Swi6
alleviates this inhibition, allowing Swi4 to bind DNA.
 |
INTRODUCTION |
In budding yeast, commitment to
enter the mitotic cell cycle occurs in the late G1 phase at
a point called Start, which is analogous to the restriction point in
mammalian cells (32, 35). In either case, cell cycle
commitment is controlled by cyclin-dependent kinases (Cdks), whose
activation requires association with positive regulatory subunits
called cyclins. In Saccharomyces cerevisiae, passage through
Start requires activation of the Cdk Cdc28 by association with the
G1 cyclins Cln1, Cln2, and Cln3 (reviewed in reference
32). The Cdk Pho85, in association with the
G1 cyclins Pcl1 and Pcl2, has also been implicated in
regulating events at Start (15, 30). It is presumed that the
association of Cdks with different cyclins allows the phosphorylation
of substrates that are crucial for cell cycle entry. Due to the pivotal
role of cyclins and Cdks in coordinating the cell cycle, cyclin-Cdk activation is highly regulated. One important mechanism of controlling Cdk activation at Start is the G1-periodic transcription of
G1 cyclin genes.
Maximal expression of the G1 cyclin genes CLN1,
CLN2, PCL1, and PCL2 at Start requires
the activity of a transcription factor, SBF (SCB binding factor)
(15, 30, 33, 34). SBF is a complex composed of at least two
proteins, Swi4 and Swi6, which bind the repeated upstream regulatory
sequence CACGAAA (SCB [Swi4/Swi6-dependent cell cycle
box]) (2, 3, 34, 47). SBF is also required for the
G1-specific expression of the HO gene and
various cell wall biosynthetic genes (2, 9, 24). Biochemical
studies have revealed that Swi4 is the component of SBF that
specifically binds SCB sequences (4, 37). Swi4 contains an
N-terminal DNA binding domain that is sufficient for the specific
recognition of SCB sequences in vitro (37). The DNA binding
region is highly homologous to that of Mbp1, and crystallographic
studies of the Mbp1 DNA binding domain have revealed a helix-turn-helix
structure (8, 48, 50). In contrast, Swi6 has no DNA binding
activity but is present in the SBF complex because of its interaction
with Swi4 via the carboxy-terminal regions (CTRs) of the two proteins (4, 27, 37, 42).
The timing of SBF-mediated gene expression is tightly controlled and
requires multiple levels of regulation of SBF activity: the binding of
SBF to SCBs in early G1, the activation of SBF at Start,
and the dissociation of SBF from SCBs after the S phase. In vivo
footprinting studies with both an SCB reporter plasmid and the
CLN2 promoter as well as chromatin immunoprecipitation experiments show that SBF is bound to SCBs in the late M and
G1 phases (11, 23, 28). Interestingly, the
binding of SCBs by SBF is not coincident with SBF-mediated
transcription; a secondary event must occur in order to activate
SBF-dependent transcription. The activation of SBF is dependent on the
activity of Cln3/Cdc28 kinase at Start (14, 46). However,
the mechanism of Cln3-dependent activation of SBF remains a mystery,
and a direct interaction of Cln3 with SBF has not been reported. In the
G2 phase, the Clb/Cdc28 kinases become active and are
required for the repression of SBF-dependent transcription (1,
28). The repression of SBF by the Clb kinases may involve the
interaction of Clb2 with Swi4 and/or the phosphorylation of Swi4
(1). Clb2 interacts with the central ankyrin domain of Swi4
in vitro (44). It has been postulated that upon exit from
mitosis, the rapid proteolysis of the B-type cyclins allows SBF to once
again bind SCBs (28).
SBF activity is also regulated by changes in the subcellular
localization of Swi6. Swi6 is largely cytoplasmic during the S,
G2, and early M phases and is predominantly nuclear during the late M and G1 phases (43). The localization
of Swi6 is dependent on the phosphorylation of serine-160, which is
located next to a nuclear localization signal. Serine-160 is
phosphorylated during the late G1, S, and M phases and may
"hide" the nuclear localization signal, preventing the nuclear
localization of Swi6. The relocalization of Swi6 to the nucleus is
coincident with the in vivo footprinting of SCBs in the late M phase
(23, 28).
Although, until this study, the subcellular localization of Swi4 was
unknown, several lines of evidence suggested that additional control
over SBF activity occurred through the regulation of Swi4 DNA binding.
There is no evidence that full-length Swi4 can bind SCBs independently
of Swi6. In swi6
strains, SCB-driven expression of
CLN1 and CLN2 is severely reduced and the
expression of HO is eliminated despite the fact that Swi4
protein is present and stable in swi6
mutants (2, 9,
33, 34). Further, in vivo footprinting studies have shown that in
the absence of Swi6, protection of SCBs cannot be detected (23,
28). While endogenous levels of Swi4 in the absence of Swi6
cannot active SCB reporter genes, overexpression of C-terminal
truncations of Swi4 in vivo can promote Swi6-independent transcription
from SCB elements (4, 41). Ectopic expression of
wild-type Swi4 also allows some activation of SBF-dependent gene
expression, but this activation has been attributed to C-terminal
degradation of Swi4 due to overexpression (42). Together,
these observations suggest a model in which the DNA binding domain of
Swi4 is inaccessible in the full-length protein when not complexed with
Swi6. In this paper, we explore this model through a series of in vivo
and in vitro experiments.
 |
MATERIALS AND METHODS |
Strains and plasmids.
Standard methods for yeast culturing
and transformation were followed (21). Standard rich medium
and supplemented minimal medium were used (26). Yeast
strains are shown in Table 1.
To construct a full-length clone of Swi6 with convenient restriction
enzyme sites at the 5' end, an
NcoI site was introduced
at
the ATG of the
SWI6 open reading frame by PCR amplification
from a
SWI6 template with the following primers:
5'CCGGCCATGGCGTTGGAAGAAGTGG3'
and
5'CCGTCTCATTGTCATCAGTGCC3'. The 630-bp PCR product was
digested
with
NcoI and
ApaI and cloned into
NcoI-
ApaI-digested pSL1180
(Pharmacia) to create
plasmid pBA786. An
ApaI-
BglII fragment carrying
the remainder of the
SWI6 gene was then cloned into
ApaI-
BglII-digested
pBA786 to reconstitute the
entire gene (pBA788). The
BglII-
SalI
genomic
fragment containing
SWI4 was cloned into the
BamHI-
SalI
site of modified pUC18 in which the
BglII polylinker had been
incorporated at the
EcoRI-
HindIII site. The vector expressing
a
fusion of glutathione
S-transferase (GST) to the C-terminal
144 amino acids of Swi4 was generated by use of PCR to amplify
the 3'
end of Swi4. The primers used were 5'EcoRISwi4
(5'GTGCAGATCTTCGATATCAGAT'3)
and 3'EndSwi4
(5'GACTGTCGACCATGGTTATGCGTTTGCCCTC'3). The PCR product
was
digested with
EcoRI and
SalI and cloned into the
EcoRI-
SalI
sites of vector pGEX-4T-2 (Pharmacia)
to create pBA1248. The integrity
of all PCR products was confirmed by
sequence analysis. To construct
a vector for expression of Swi4 from
the constitutive glycerol-3-phosphate
dehydrogenase promoter, a
BglII-
SalI fragment containing the
SWI4 gene was cloned from vector pBA476 into the
BamHI-
SalI sites of
vector p424 GPD (ATCC 87357)
to create pBA1262. Plasmids used
for in vitro transcription-translation
of Swi4 and Swi6 have been
previously described (pBA462 for full-length
Swi4, pBA513 for
Swi6, and pBA586, a derivative of Swi4 which has an
internal deletion
of amino acids 198 to 745) (
4).
Immunofluorescence.
For indirect immunofluorescence with
Swi4 antiserum, a Swi4 polyclonal antibody was affinity purified and
preadsorbed to a 1:1 mixture of fixed yeast cells and spheroplasts of
the yeast strain BY184 essentially as described elsewhere (17, 34,
38, 51). Strain BY184 (200 ml) was grown to the log phase in
standard rich medium at 30°C, harvested, and fixed by the addition of
formaldehyde to 3.7% for 1 h at 30°C with shaking. The fixed
cells were washed twice with 1.2 M sorbitol-50 mM
K2POH4 (pH 7.5) and resuspended in 4 ml of 1.2 M sorbitol-50 mM K2POH4 (pH 7.5). Spheroplasts were made from 2 ml of fixed cells by the addition of
-mercaptoethanol to 0.1% and Zymolyase 20000T to 0.25 mg/ml,
followed by incubation for 1 h at 30°C. The spheroplasts were
washed twice with 1.2 M sorbitol-50 mM K2POH4
(pH 7.5) and added to the remaining 2 ml of whole fixed yeast cells.
The cell mixture was washed and resuspended in 4 ml of
phosphate-buffered saline (PBS). The cell mixture (200 µl) was
incubated with 200 µl of affinity-purified Swi4 antibody at 4°C for
1 h with shaking. Cells were pelleted, and the antibody supernatant was transferred to another tube containing 200 µl of
fresh cell mixture. Antibody-cell incubation was repeated seven times,
including an overnight incubation, resulting in a fivefold dilution of
the pretreated affinity-purified Swi4 antibody.
Wild-type cells (BY263) and
swi4
cells (BY184) were grown
to the early log phase and fixed in 3.6% formaldehyde at 30°C for
2 h. Cells were washed twice with 100 mM
KH
2PO
4 (pH 7.4), resuspended
in 100 mM
KH
2PO
4 (pH 7.4)-0.1%

-mercaptoethanol-0.25 mg of Zymolyase
20000T per ml, and incubated
at 30°C for 30 min to digest the
cell wall. The cells were washed
twice in PBS containing 1.2 M
sorbitol. The cells were incubated with
PBS plus 2% bovine serum
albumin (BSA) (Sigma) for 30 min at room
temperature. The cells
were pelleted, washed once in PBS-0.2% BSA,
and incubated for
2 days at 4°C in a 1/20 dilution of
affinity-purified and preadsorbed
anti-Swi4 antibody in PBS-0.2% BSA.
The cells were washed three
times for 10 min each time with PBS-0.2%
BSA. A 1/20 dilution
of preadsorbed sheep anti-rabbit CY3-conjugated
secondary antibody
(a gift from M. Synder) in PBS-0.2% BSA was added
and incubated
for 2 h at room temperature. The cells were washed
again as outlined
above, followed by a final wash with PBS containing
0.05 µg of
diamidophenylindole (DAPI) per ml. One drop of the cell
suspension
was deposited on a polylysine-coated slide (Flow
Laboratories).
Once the cells had settled, the adherent cells were
rinsed with
PBS-0.1% BSA and mounted in 90% glycerol in PBS
containing 0.1%
p-phenylamine diamine. Cells were observed
at a magnification
of ×630 by use of a Leica DM-LB microscope with
Nomarski optics
and a Princeton charge-coupled device camera. Swi4
staining was
visualized with rhodamine fluorescence optics. A total of
800
wild-type cells were scored for nuclear staining and position
in
the cell cycle as judged by bud
size.
Construction of baculovirus vectors.
We used the Bac-N-Blue
baculovirus system (Invitrogen) to express both Swi6 and Swi4
derivatives in insect cells. To construct a baculovirus expressing
Swi6, the NcoI-HindIII fragment from pBA788
containing full-length SWI6 was cloned into the
NcoI-HindIII sites of the baculovirus
transfer vector pBlueBacIII (Invitrogen). To construct a Swi4
expression vector, a BglII fragment from pBA476 containing
full-length SWI4 was cloned into the BamHI site
of pBlueBacIII. The SWI4
Ankyrin motif (Swi4
AA) transfer vector was constructed by digestion of pBA476 with NsiI followed by
religation to create a Swi4 derivative with a 1,047-bp internal
deletion. The deleted SWI4 fragment was then cloned into the
BamHI site of the baculovirus transfer vector pBACHISA
(Invitrogen). The Swi4
144 transfer vector was constructed by cloning
the BglII-EcoRI fragment from pBA476 into the
BamHI-EcoRI site of baculovirus transfer vector
pBlueBac4.5 (Invitrogen). The transfer vectors were cotransfected with
baculovirus genomic DNA into Sf9 insect cells, and recombinant
baculoviruses were isolated and plaque purified as outlined in the
Invitrogen Bac-N-Blue transfection kit manual.
Expression and purification of Swi6 from insect cells.
Monolayers of High Five cells (Invitrogen) (107 cells in
150-cm2 flasks) were infected at a multiplicity of
infection (MOI) of 5 PFU per cell. At 45 h after infection, the
cells were harvested by centrifugation at 1,000 rpm for 5 min in a
Sorvall GLC-1 centrifuge, washed with cold water, and resuspended in
cold lysis buffer 1 (50 mM Tris-HCl [pH 7.4], 0.5 mM EDTA, 50 mM
NaCl, 1 mM phenylmethyl sulfonyl fluoride, 1 µg of leupeptin per ml,
1 µg of pepstatin per ml) at 1 ml/flask. Lysis was done by drawing
the resuspended cells eight times through a 27.5-gauge needle, and the
lysates were clarified by centrifugation at 13,000 × g
for 20 min. The lysates typically contained 10 mg of total protein/ml.
Swi6 was purified from the insect lysates as described for Swi6
expressed in bacteria (42). Proteins were precipitated with
20 to 35% ammonium sulfate, and the precipitate was resuspended and
dialyzed overnight in lysis buffer 1, further purified over a 1-ml
DEAE-Sepharose column (Pharmacia), and eluted with a salt gradient.
Peak fractions were dialyzed overnight in lysis buffer 1 with the
addition of 20% glycerol and stored at
80°C. Swi6 protein was
estimated to be at least 80% pure, as judged by Coomassie blue
staining of fractions resolved by sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (PAGE).
Expression and partial purification of SBF and Swi4 derivatives
from insect cells.
For the production of SBF (Swi6 and Swi4) in
insect cells, monolayers of High Five cells (five 150-cm2
flasks of 107 cells each) were infected with both
full-length Swi4- and Swi6-containing baculoviruses at an MOI of 5 PFU
of each virus per cell. At 45 h after infection, the cells were
harvested and lysed as outlined above for Swi6-infected cells. SBF
lysates typically contained 10 mg of total protein/ml. The lysates were
loaded on a 5-ml HiTrap heparin column (Pharmacia) preequilibrated with
buffer A (50 mM Tris-HCl [pH 7.4], 0.5 mM EDTA, 100 mM NaCl). The
column was washed with 15 ml of buffer A, and the bound proteins were
eluted with a 40-ml linear salt gradient (0.1 to 1.0 M NaCl) and
collected in 2-ml fractions. SBF peak elution occurred in fractions 12 and 13, which contained 450 to 550 mM salt, as determined by
conductivity. The peak fractions were pooled, glycerol was added to
20%, and the fractions were stored at
80°C. Peak fractions
typically contained 0.5 mg of protein/ml.
For the production of full-length Swi4, Swi4

144, or Swi4

AA in
insect cells, monolayers of High Five cells (five 150-cm
2
flasks of 10
7 cells each) were infected with the
baculovirus at an MOI of 5
PFU per cell. The purification procedure for
Swi4, Swi4

AA, or
Swi4

144 was identical to that described above
for SBF, with peak
elution in fraction 12. However, the peak for
Swi4

AA was broader.
The production of Swi4 and the Swi4 derivatives
in insect cells
was significantly reduced in the absence of
coexpression with
Swi6. Using Western blot and gel shift assays, we
estimated that
this procedure caused an eightfold enrichment of Swi4
and significantly
decreased the levels of insect cell proteins that
bound nonspecifically
to SCB-containing probes (see
Results).
Gel retardation assay.
Yeast extracts were prepared and gel
shift assays were performed with an SCB-containing probe as previously
described (2). Binding reactions were performed with 20 µl
of assay buffer (25 mM Tris-HCl [pH 7.4], 10% glycerol, 3 mM
MgCl2, 0.2 mM EDTA). Poly(dI · dC)-poly(dI · dC) (Pharmacia) was added at 5 µg/reaction mixture for crude yeast
and crude insect cell extracts and at 1 µg/reaction mixture for
partially purified protein samples. Unlabeled wild-type and mutant SCB
competitors were prepared from annealed oligonucleotides as described
previously and added to the binding reaction mixtures as indicated
elsewhere (4). For competition experiments with the Swi4 C
terminus, a recombinant protein composed of the last 144 amino acids of
Swi4 fused to GST (GST-4CTR) was purified from Escherichia
coli harboring the appropriate expression plasmid as previously
described (31). The GST-4CTR protein was incubated with
thrombin while still bound to glutathione-S-Sepharose 4B
beads (Pharmacia). The C-terminal fragment of Swi4 was eluted from
bound GST and dialyzed in buffer A. The final concentration of the
C-terminal fragment of Swi4 (the CTR) was 0.2 µg/µl. Gel
retardation assays with this fragment were performed as described
above, except that the reaction mixtures were incubated at 4°C for 20 min prior to the addition of the probe and for 10 minutes at room
temperature after the addition of the probe.
Screen for Swi4 CTR mutants.
To generate random mutations in
the Swi4 CTR, the last 432 nucleotides of SWI4 were
amplified by PCR with Taq DNA polymerase, the primers
5'EcoRI (5'GTGCAGATCTTCGATATCAGAT3') and 3'MutSalI (5'CCTAGACTTCAGGTTGTCTT3'), and the SWI4 gene as
a template. The PCR product was digested with EcoRI and
SalI and cloned into vector pBA1262 that had been digested
with EcoRI and SalI. The resulting pool of
mutagenized SWI4 plasmids was used to transform BY185 (swi6
SCB::lacZ) (20).
The colonies were transferred to nitrocellulose filters and assayed for
-galactosidase activity as described previously (7).
Transformants that turned blue before the BY185 transformant containing
the vector alone were selected. Mutant plasmids were isolated from the
yeast strains, passaged through E. coli, and used to
retransform BY185 to confirm that the increase in
-galactosidase
activity was due to the plasmid-borne SWI4 gene
(40). Once increased
-galactosidase activity was
confirmed, the mutated SWI4 genes were sequenced. To
determine whether the Swi4 proteins encoded by the mutated
SWI4 genes could still interact with Swi6 in vivo, the
mutated SWI4 genes were used to transform BY184
(swi4
SCB::lacZ), yeast extracts
were prepared, and gel shift assays were performed with an
SCB-containing probe as described above.
Glycerol gradients.
Sedimentation in glycerol gradients was
performed essentially as described previously (12). Glycerol
gradients (4 ml of 40 to 10% [vol/vol] glycerol in buffer A) were
poured in seven steps of 500 µl and allowed to equilibrate for 1 h at room temperature, followed by 1 h at 4°C. Partially
purified Swi4, Swi4
144, or SBF preparations (50 µg) were layered
on top of the gradient along with 100 µg of an internal control
protein (catalase, from the Pharmacia gel filtration
high-molecular-weight calibration kit). A control gradient with 100 µl of protein markers containing 100 µg each of catalase, aldolase,
and albumin (Pharmacia) was run in parallel. The gradients were
centrifuged in a SW60.1 rotor at 55,000 rpm for 13 h. Two-drop
fractions (90 to 100 µl) were collected from the bottom of the tube
with a syringe needle. The Bio-Rad protein assay was used to detect
molecular weight standards and the internal control protein catalase.
To assay fractions containing Swi4 or Swi4 derivatives, 50 µl of each
fraction was analyzed by immunoblotting with anti-Swi4 antibodies and
visualized by chemiluminescence.
In vitro transcription and translation of Swi4 and Swi6.
To
produce full-length Swi4, full-length Swi6, and Swi4 with an internal
deletion, the plasmid templates pBA462, pBA513, and pBA548,
respectively, were used as recommended in the T7 "TnT" coupled
reticulocyte lysate system (Promega). To produce Swi4
421 and
Swi4
896, pBA462 was linearized with XbaI and
NsiI, respectively, used as a template in the TnT system.
Batch affinity chromatography.
GST and GST-4CTR were
purified from E. coli harboring the appropriate expression
plasmids as previously described (31). For affinity
chromatography with insect cell-derived Swi4 and Swi6, GST and GST-4CTR
were bound to glutathione S-Sepharose 4B beads at a
concentration of 1 µg/µl of beads. Either GST or GST-4CTR beads (10 µl) were incubated with 10 µg of partially purified Swi4,
Swi4
144, or Swi6 for 45 min at 4°C. The beads were harvested, and
the unbound supernatant was collected. The beads were washed in 1 ml of
lysis buffer 2 (50 mM Tris-HCl [pH 7.4], 0.5 mM EDTA, 50 mM NaCl)
four times for 5 min each time followed by four washes for 5 min each
time in RIPA-500 buffer (50 mM Tris-HCl [pH 7.5], 0.1% SDS, 0.5%
deoxycholate, 500 mM NaCl, 1% Triton X-100). After the final wash, the
beads were resuspended in 25 µl of 1× SDS-polyacrylamide gel loading
dye and boiled. The bound and one-half of the unbound supernatant
fractions were separated by SDS-6% PAGE. The proteins were
transferred to nitrocellulose, and the Swi4 derivatives were detected
by Western blotting as outlined above. For affinity chromatography with
in vitro-translated and -transcribed Swi4 and Swi6, 15 µl of either
GST or GST-4CTR beads was incubated with 30 µl of PBS and 7 µl of
either in vitro-translated Swi4, Swi6, Swi4
421, Swi4
Anks, or
Swi4
896 for 2 h at 4°C. The beads were harvested, and the unbound supernatant was collected. The beads incubated with Swi4, Swi6,
Swi4
421, and Swi4
Anks were washed three times for 2 min each time
in 100 µl of RIPA-500 buffer followed by a wash in PBS. The beads
incubated with Swi4
896 were washed three times for 2 min each time
in 100 µl of buffer A followed by a wash in PBS. After the final
wash, the beads were resuspended in 30 µl of 1× SDS-polyacrylamide
gel loading dye and boiled. The bound and one-half of the unbound
supernatant fractions were separated by SDS-10% PAGE. The gels were
fixed, treated with Amplify (Amersham), dried, and exposed to X-ray film.
 |
RESULTS |
Nuclear localization of Swi4 throughout the cell cycle.
In
vivo footprinting analysis and chromatin immunoprecipitation assays
showed that SCBs are bound by SBF throughout the G1 phase,
indicating that Swi4 and Swi6 must be nuclear at least in
G1 (11, 23, 28). Indeed, Swi6 localization
studies have confirmed that the majority of Swi6 is nuclear throughout
the late M and G1 phases but is largely cytoplasmic during
the rest of the cell cycle (43). The nuclear localization of
Swi6 is coincident with the binding of SBF to SCBs, implying that Swi4 must be present in the nucleus at the time of Swi6 localization. To
investigate the subcellular localization of Swi4 throughout the cell
cycle, we developed an indirect immunofluorescence assay with Swi4
antibodies on wild-type and swi4
log-phase cells. No distinct staining was seen when swi4
cells were stained
with Swi4 antiserum (Fig. 1). To assay
wild-type cells for Swi4 staining, 800 wild-type cells were scored for
nuclear staining (with DAPI) and position in the cell cycle by
assessing bud morphology. We found that 60% of all cells scored had a
distinct Swi4 staining signal, suggesting that our protocol or
antibodies were not optimized to achieve 100% staining. However, for
the 60% of cells that were stained, nuclear staining was seen in cells
at all stages of the cell cycle, in both unbudded and budded forms. We
conclude that, unlike Swi6, whose localization changes throughout the
cell cycle, Swi4 remains nuclear throughout the cell cycle.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 1.
Subcellular localization of Swi4. Swi4 localization was
assayed by indirect immunofluorescence with Swi4 antiserum and a
fluorescein isothiocyanate-conjugated secondary antibody. Wild-type
(Wt) and swi4 cells were photographed at a magnification
of ×630 with an imaging system (see Materials and Methods).
Photographs of the same fields of cells viewed with Nomarski optics and
stained with DAPI to visualize cell nuclei are also shown.
|
|
The Swi4-Swi6 complex from insect cells can bind SCBs in
vitro.
Since Swi4 is nuclear in the S, G2, and M
phases but fails to bind SCBs, we next sought to investigate the
mechanism regulating Swi4 binding to DNA. To generate reagents useful
for our studies, we constructed vectors for expressing Swi4 and Swi6 in
insect cells. While Swi6 can be purified from E. coli,
attempts at expressing Swi4 in bacteria have met with limited success
(42, 47). To determine whether Swi4 and Swi6 produced in
insect cells formed a functional SBF complex, we performed gel
retardation analysis by using an SCB-containing probe. Incubation of
the probe with crude yeast extracts from wild-type, swi4
,
and swi6
cells showed the formation of SBF in the
wild-type extracts (Fig. 2, lanes 2 to
4), as previously described (2, 4, 33, 34, 42, 47).
Incubation of the probe with crude insect cell lysates from cells
coinfected with baculovirus vectors expressing Swi4 and Swi6 led to the
formation of a major complex that comigrated with SBF from yeast
extracts (Fig. 2, lane 6). This complex was not seen when extracts from
uninfected insect cells were used in the assay (Fig. 2, lane 5). Since
the SBF complex formed from insect cells and yeast extracts migrated at
the same position, SBF is likely composed of only Swi4 and Swi6
proteins. We cannot exclude the possibility that other proteins are
present in this complex; however, the proteins would need to be present
in both yeast and insect cells. We conclude that SBF can be
functionally reconstituted by the expression of Swi4 and Swi6 in insect
cells.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
Reconstitution of SBF in insect cells. A gel retardation
assay with an SCB-containing probe and either crude yeast or insect
cell lysates is shown. The labeled probe contained three SCB sequences
from the upstream region of the HO gene (see reference
2). The following extracts were used in the binding
assays: lane 1, probe alone; lanes 2 to 4, 10 µg of crude yeast
extract from swi4 , swi6 , and wild-type
strains, respectively; lane 5, 10 µg of crude cell lysate from
uninfected insect cells; and lane 6, 10 µg of crude cell lysate from
insect cells coinfected with Swi4- and Swi6-expressing baculovirus
vectors. The migration positions of the SBF complex and the unbound
probe are indicated to the right.
|
|
Inhibition of Swi4 binding to DNA in the absence of Swi6.
Although it is clear that Swi4 binds DNA in the context of SBF, there
is no evidence that Swi4 can bind DNA on its own. Two observations led
us to hypothesize that the DNA binding domain of Swi4 is inaccessible
in the full-length protein when not complexed with Swi6. First,
SCB-driven gene expression is reduced or eliminated in a
swi6
strain even though Swi4 is present and nuclear
throughout the cell cycle (this study, 2, 9, 33,
34). Second, in vivo footprinting studies have shown that in
the absence of Swi6, the binding of Swi4 to SCB sequences cannot be
detected (23, 28). In order to rigorously test the
hypothesis that the DNA binding domain of Swi4 is inaccessible in the
full-length protein, we partially purified both Swi4 and Swi6 from
insect cells. We adapted previously established procedures to purify
Swi6 produced in insect cells (Fig. 3A,
lane 3) (42, 47). We used a heparin column to greatly enrich
both Swi4 and SBF expressed in insect cells (Fig. 3B and C).
Coexpression of Swi4 with Swi6-containing baculoviruses significantly
increased the production of Swi4, suggesting that a Swi4-Swi6
interaction may stabilize Swi4 in insect cells. In contrast, Swi4 was
poorly produced when expressed in the absence of Swi6 in insect cells.
However, by using heparin-agarose chromatography, we were able to
obtain an eightfold purification of Swi4, as assessed by densitometry
of Swi4 Western blots and by measurement of the specific activity of
Swi4 in a gel shift assay (Fig. 3C and data not shown). Further, the
purification procedure reduced the levels of nonspecific DNA binding
proteins in the insect cell extracts. Problems with insolubility were
encountered when the Swi4 heparin fractions were subjected to
additional purification steps.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
SCB binding activity of partially purified Swi4, Swi6,
and SBF. (A) Purification of Swi6 protein expressed in insect cells.
Swi6-containing fractions obtained during purification were analyzed by
SDS-6% PAGE followed by Coomassie blue staining. Lane 1, crude lysate
from insect cells expressing Swi6 protein; lane 2, 20 to 35% ammonium
sulfate precipitation; lane 3, DEAE-Sepharose fraction. A 10-µl
aliquot of each fraction was loaded per lane. (B) Purification of SBF
expressed in insect cells. SBF-containing fractions obtained during
purification were analyzed as described in panel A for Swi6. Lane 1, crude lysate from insect cells infected with both SWI4- and
SWI6-expressing baculoviruses; lane 2, heparin-agarose
fraction. A 10-µl aliquot each of the crude and partially purified
fractions was loaded. (C) Enrichment of Swi4 expressed in insect cells.
Swi4-containing fractions obtained during purification were separated
by SDS-6% PAGE and analyzed by Western blotting with
affinity-purified Swi4 antiserum. Lane 1, crude lysate from insect
cells infected with a SWI4-expressing baculovirus vector (10 µg); lane 2, heparin-agarose fraction (10 µg). For panels A through
C, the migration positions of molecular weight markers are indicated to
the left (in thousands). (D) Gel retardation assay with partially
purified SBF, Swi4, and Swi6. A labeled SCB-containing probe (see the
legend to Fig. 2) was incubated with the following protein
preparations: lane 1, no extract; lanes 2 to 4, SBF heparin-agarose
fraction (1 µg); lane 5, Swi6 DEAE-Sepharose fraction (3 µg); lane
6, Swi4 heparin-agarose fraction (5 µg); and lanes 7 to 9, both
partially purified Swi4 and Swi6 fractions. Where indicated above the
lanes, a 100-fold molar excess of either wild-type SCB competitor
(Comp.) DNA (Wt) or mutated SCB competitor DNA (Mut) was added. The
migration position of SBF is shown to the right. The asterisk in lane 6 marks the migration position of a complex composed of the
SCB-containing probe and either full-length Swi4 or a small C-terminal
truncation of Swi4.
|
|
We used our purified Swi6 and Swi4 preparations in gel retardation
assays to assess the binding of full-length Swi4 to SCBs
in the absence
of Swi6. First, we confirmed that our partially
purified SBF fractions
supported SBF complex formation in vitro
(Fig.
3D, lane 2). Binding was
specific for SCB DNA, since the
SBF complex was inhibited by a
wild-type SCB oligonucleotide competitor
and not by a mutant SCB
oligonucleotide competitor, confirming
that the purification procedure
did not alter the SCB binding
ability of SBF produced in insect cells
(Fig.
3D, lanes 3 and
4). Incubation of partially purified Swi4 with
purified Swi6 allowed
for efficient reconstitution of the SBF complex
in vitro (Fig.
3D, lane 7). Incubation of the C-terminal half of Swi6
fused to
GST with partially purified Swi4 also produced an SBF complex
(data not shown). The reconstituted SBF complex was inhibited
by
wild-type SCB competitor and not by a mutant SCB competitor
(Fig.
3D,
lanes 8 and 9). In contrast, incubation of full-length
Swi4 with the
SCB-containing probe led to the formation of a series
of
faster-migrating complexes (Fig.
3D). These complexes likely
represent
SCB binding by C-terminal truncations of Swi4, since
they were
inhibited by wild-type SCB DNA and were unaffected by
the addition of
Swi6. One minor complex, indicated by an asterisk
in Fig.
3D, may
reflect binding of the SCB-containing probe by
full-length Swi4. We
used phosphorimager analysis to compare the
amount of this minor
complex to the amount of the SBF complex
formed upon the addition of
excess Swi6. Our analysis suggested
that less than 5% of the Swi4
protein in the assay participated
in the minor complex (data not
shown). Therefore, if the minor
product indeed contains full-length
Swi4, the ability of intact
Swi4 to bind SCBs in the absence of Swi6
must be severely compromised.
Since we were using partially purified
components derived from
a heterologous system, our results suggest that
full-length Swi4
cannot bind DNA efficiently in the absence of Swi6. No
experiments
with recombinant full-length Swi4 have been previously
reported.
The mechanism of inhibition appears intrinsic to Swi4 and is
alleviated
upon the interaction of Swi6 with Swi4 through the Swi4
CTR.
Domains required for auto-inhibition of Swi4 binding to DNA.
As outlined earlier, several lines of evidence suggested that the C
terminus of Swi4 is necessary for the regulation of Swi4 binding to
DNA. To confirm this hypothesis, we expressed a truncated version of
Swi4, Swi4
144, lacking the C-terminal 144 amino acids, in insect
cells. We had previously used gel retardation assays to show that
Swi4
144 in crude yeast extracts formed a Swi6-independent complex
with SCB DNA (4). A similar result was obtained with an in
vitro-translated truncation of Swi4 (37). We used Swi4
144 that had been partially purified from insect cells in a gel shift assay
with an SCB-containing probe. Swi4
144 formed a specific complex with
DNA that was efficiently competed by wild-type but not by mutated
SCB-containing DNA (Fig. 4B, lanes 4, 6, and 7). Since Swi6 interacts with Swi4 through the last 78 amino acids of Swi4, the addition of Swi6 did not affect Swi4
144 DNA binding (Fig. 4B, lane 6) (44). A larger Swi4 truncation,
Swi4
421, behaved in a similar manner (data not shown). Our results
confirm the hypothesis that the C-terminal 144 amino acids of Swi4 are involved in the inhibition of Swi4 binding to DNA.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of SCB binding by deletion derivatives of Swi4.
(A) Schematic of the Swi4 derivatives expressed in insect cells. The
relative positions of the N-terminal DNA binding domain, the multiple
ankyrin repeats, and the C-terminal Swi6 interaction domain are
indicated. His indicates the presence of an N-terminal histidine tag.
(B) Gel retardation assay with partially purified SBF or C-terminally
truncated Swi4 (Swi4 144). A labeled SCB-containing probe (see the
legend to Fig. 2) was incubated with the following protein
preparations: lane 1, no extract; lane 2, SBF heparin-agarose fraction
(1 µg); lane 3, 3 µg of purified Swi6; and lanes 4 to 7, 5 µg of
partially purified Swi4 144. Lane 5 also contains 3 µg of a Swi6
DEAE-Sepharose fraction. In lanes 6 and 7, a 100-fold molar excess of
either wild-type SCB competitor (Comp.) DNA (Wt) or mutated SCB
competitor DNA (Mut) was added. (C) Gel retardation assay with
partially purified SBF or a Swi4 internal deletion derivative
(Swi4 AA). The labeled SCB-containing probe was incubated with the
following protein preparations: lane 1, no extract; lane 2, SBF
heparin-agarose fraction (1 µg); lane 3, 3 µg of purified Swi6;
lane 4, 5 µg of partially purified Swi4 AA; and lanes 5 to 7, 5 µg of partially purified Swi4 AA and 3 µg of purified Swi6. In
lanes 6 and 7, a 100-fold molar excess of either wild-type SCB
competitor DNA (Wt) or mutated SCB competitor DNA (Mut) was added.
|
|
Ankyrin motifs have been implicated in the auto-inhibition of numerous
transcription factors, including NF-

B (reviewed in
reference
18). We next used convenient restriction sites in
the Swi4 gene to construct a baculoviral Swi4 derivative, Swi4

AA,
with an internal deletion of 349 amino acids. This deletion disrupts
the first ankyrin domain of Swi4 along with a significant region
between the DNA binding domain and the ankyrin domain. The first
and
fourth ankyrin domains of Swi4 were first identified due to
their
similarity to other ankyrin domains. Upon closer inspection,
it became
apparent that Swi4 has three other degenerate ankyrin
repeats
(
6). Single amino acid changes in the ankyrin repeats
of
both Swi6 and Swi4 result in proteins that are temperature
sensitive
for function (
14a,
16,
42). This finding suggests
that
deletion of the first ankyrin repeat in Swi4

AA should greatly
reduce, if not abolish, the function of the ankyrin domains. Unlike
Swi4

144, Swi4

AA had only a limited ability to bind DNA in the
absence of Swi6 (Fig.
4C, lane 4). Full binding was restored upon
the
addition of Swi6 (Fig.
4C, lanes 5 to 7). We conclude that
the
inhibition of Swi4 binding to DNA does not involve amino acids
199 to
547 of
Swi4.
Point mutations in the Swi4 CTR allow Swi6-independent activation
of SBF-dependent transcription.
Our in vitro experiments showed
that the inhibition of Swi4 binding to DNA was relieved by deletion of
the C-terminal 144 amino acids of Swi4. The C-terminal 78 amino acids
of Swi4 are required for interaction with Swi6 (44). This
region of Swi4 is conserved in other members of the Swi4 family of
transcription factors and is predicted to be highly
-helical in
structure (Fig. 5A). To determine whether
the region of the Swi4 C terminus involved in the inhibition of Swi4
DNA binding was separable from the Swi6 interaction domain, we
undertook a screen for point mutations in the CTR-encoding portion of
SWI4 that alleviate the DNA binding inhibition of Swi4. We
used PCR-mediated mutagenesis to introduce random mutations into the
region encoding the C-terminal 144 amino acids of Swi4. The mutagenized
SWI4 fragments were cloned into a SWI4 gene on a
2µm plasmid to allow expression from the constitutive GPD promoter.
We transformed the pool of CTR mutants into a swi6
strain
carrying an integrated SCB::lacZ
reporter gene. Using a
-galactosidase filter test, we identified
Swi4 mutants which, in the absence of Swi6, allowed a higher level of
SCB::lacZ expression than that seen
with the wild-type SWI4 gene expressed from the same vector.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
Gel retardation analysis of wild-type SWI4
and mutant swi4 alleles with yeast cell extracts. (A)
Alignment of the extreme CTRs of Swi4 family members. Residues
identical to those in Swi4 or conservative substitutions are boxed.
Putative alpha helices are indicated by arrows, as predicted by the PHD
protein structure algorithm. The shaded box shows the amino acids that
were deleted in Swi4-3.3. The asterisks indicate the positions of the
point mutations E1076G and N1092Y in mutant Swi4-GY. (B) A labeled
SCB-containing probe was incubated with 10 µg of crude extract from a
swi4 yeast strain (BY184) transformed with the following
plasmids: lane 1, no extract; lane 2, empty vector, p424 GPD; lane 3, p424 GPD-Swi4 (wild-type [wt] SWI4); lane 4, p424
GPD-Swi4-9.1; lane 5, p424 GPD-Swi4-9.2; lane 6, p424 GPD-Swi4-3.3; and
lane 7, p424 GPD-Swi4-GYr. The SWI4 mutations in the various
plasmids are described in Table 2 and in the text. The migration
positions of SBF and a complex of Swi4-9.2 and the SCB-containing probe
are indicated to the right. (C) Western blot analysis of extracts used
in the binding assay shown in panel B. Fifty micrograms of the crude
yeast lysates used in the gel retardation analysis were separated by
SDS-6% PAGE, and the Swi4 protein in the extracts was visualized with
Swi4 antiserum. The Swi4 protein present in each extract is indicated
above the lanes (see panel B).
|
|
Using this screen, we identified four new
SWI4 mutants
(Table
2). Two mutants, Swi4-9.1 and
Swi4-9.2, were the result of
improper ligation of the PCR product into
the
SWI4-containing
vector. Mutant Swi4-9.1 had an addition
of 12 amino acids to the
C terminus of Swi4 (A-N-F-N-K-I-L-T-L-T-I-S).
This addition resulted
in a fourfold increase in SCB-dependent
expression in the absence
of Swi6. Mutant Swi4-9.2 had a large
C-terminal truncation at
amino acid 803 that allowed for a threefold
activation of
SCB::
lacZ expression in
the absence of Swi6. These results support our in
vitro data
demonstrating that the C terminus of Swi4 inhibits
Swi4 DNA binding. We
also identified a smaller C-terminal truncation
in our screen. In
Swi4-3.3, a 1-bp deletion in the codon for L1081
resulted in the
truncation of 12 amino acids from the C terminus
of Swi4 and the
addition of 4 amino acids (N-W-T-I). This smaller
alteration resulted
in a modest but reproducible induction of
SCB::
lacZ expression (Table
2).
Finally, we isolated a fourth
mutant, Swi4-C26, which had three point
mutations: N995H, E1076G,
and N1092Y. By separating the N995H mutation
from the E1076G and
N1092Y mutations, we were able to determine that
the twofold induction
in
SCB::
lacZ
activity was due to the two most C-terminal mutations.
The mutant
carrying these two mutations was named Swi4-GY.
Since the CTR of Swi4 is also required for the interaction with Swi6,
we next examined whether our new Swi4 mutants could
still interact with
Swi6. To answer this question, we performed
DNA binding assays with an
SCB-containing probe and crude yeast
extracts from a
swi4
strain transformed with plasmids encoding
the Swi4 mutants. Western
blot analysis with an anti-Swi4 antibody
showed that all the Swi4
mutant proteins were expressed (Fig.
5C). Crude lysates from cells
expressing mutant Swi4-9.2, which
lacks the Swi6 interaction domain,
did not support SBF complex
formation; however, a distinct,
faster-migrating species was formed
(Fig.
5B, lane 5). In contrast,
crude lysates from cells expressing
wild-type Swi4, or the Swi4 mutants
Swi4-9.1, Swi4-3.3, and Swi4-GY,
supported SBF complex formation (Fig.
5B, lanes 4, 6, and 7).
The mutants Swi4-3.3 and Swi4-GY appeared to
form the SBF-DNA
complex less efficiently, a result which correlated
with decreased
expression levels, as determined by Western blot
analysis (Fig.
5C, lanes 5 and 6). Although we saw SBF complex
formation by the
Swi4 CTR mutants in the presence of Swi6, we did not
see a lower-molecular-weight
complex that might correspond to binding
of the Swi4 CTR mutant
proteins to SCBs in the absence of Swi6 (data
not shown). We presume
that the ability of the Swi4 CTR mutants to bind
SCBs in the absence
of Swi6 is sufficient to yield increased
SCB-dependent transcription
but may be undetectable by our biochemical
assay. Our results
suggest that small alterations in the extreme C
terminus of Swi4
may alleviate DNA binding inhibition but do not affect
the interaction
with
Swi6.
A C-terminal fragment of Swi4 can inhibit Swi4 DNA binding in
trans.
Both truncations and point mutations in the C
terminus of Swi4 appear to alleviate the inhibition of Swi4 DNA
binding. Our results suggest that the C terminus of Swi4 may inhibit
the DNA binding of a C-terminal truncation of Swi4. To test this model, we performed gel retardation assays with an SCB-containing probe, partially purified Swi4
144, and the C-terminal 144 amino acids of
Swi4 (the CTR) (Fig. 6). The CTR fragment
was purified by thrombin cleavage of a GST-CTR fusion protein (see
Materials and Methods). Incubation of Swi4
144 with increasing
amounts of the CTR prior to the addition of the SCB-containing probe
resulted in an inhibition of Swi4
144 binding to the SCB-containing
probe (Fig. 6, lane 7). At low concentrations of the CTR, the amount of
the Swi4
144-SCB complex appeared to increase slightly. This increase
may have been due to the small amounts of GST which were present in the CTR preparation. We found that the use of GST alone also increased the
amount of the Swi4
144-SCB complex (Fig. 6, lane 4). Presumably, GST
acts to nonspecifically stabilize complex formation in our assay.
Nonetheless, our gel shift assays show that the CTR of Swi4 can
functionally interact with an N-terminal region of Swi4 to inhibit Swi4
binding to DNA.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibition of Swi4 144-SCB complex formation by the
CTR of Swi4. A gel retardation assay with an SCB-containing probe is
shown (see the legend to Fig. 2). The probe was incubated with the
following protein preparations: lane 1, no extract; lane 2, SBF
heparin-agarose fraction (1 µg); and lanes 3 to 7, 2 µg of
partially purified Swi4 144. Lane 4 also contained 1 µg of GST, and
lanes 5 to 7 also contained increasing amounts (in micrograms) of
purified Swi4 CTR (C-terminal 144 amino acids of Swi4). The migration
positions of the SBF-SCB and Swi4 144-SCB complexes are indicated on
the left.
|
|
Analysis of Swi4 complexes on glycerol gradients.
Since our in
vitro studies were performed with partially purified reagents expressed
in insect cells, it is unlikely that Swi4 autoinhibition depends on
another protein binding the CTR of Swi4. Rather, our results suggest
that the CTR of Swi4 may be involved in an inter- or intramolecular
interaction with another region or molecule of Swi4 to inhibit DNA
binding. To determine whether Swi4 forms dimers or multimers in
solution, we analyzed protein size by glycerol gradient sedimentation.
Swi4 ran at approximately 67 kDa, a mass which is drastically smaller
than its predicted mass of 123 kDa (Fig.
7). This result suggests that, in
solution, Swi4 must be highly asymmetric in shape and monomeric in
nature. Truncating the C-terminal 144 amino acids of Swi4 did not
significantly change the sedimentation of Swi4. In contrast, the
addition of Swi6 to Swi4 greatly increased the sedimentation of Swi4
(Fig. 7, top panel). SBF ran at 180 kDa, a size which is close to the predicted size of a heterodimer of Swi4 (123 kDa) and Swi6 (91 kDa).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Glycerol gradient sedimentation of Swi4, Swi4 144, and
SBF. Fifty micrograms of partially purified Swi4, Swi4 144, and SBF
was analyzed by glycerol gradient sedimentation. Glycerol gradients (4 ml of 10 to 40% [vol/vol] glycerol) were centrifuged in an SW60.1
rotor for 13 h at 55,000 rpm. Fractions from the gradients were
analyzed on Western blots with anti-Swi4 antibody. The peak fractions
of molecular weight (MW) standards run in parallel gradients are
indicated by C (catalase, 232,000), A (aldolase, 158,000), and B
(bovine albumin, 67,000). Fraction numbers are shown at the top of the
figure, with the bottom of the gradients on the left.
|
|
Interaction of the CTR of Swi4 with N-terminal domains.
Our
glycerol gradient assays revealed that Swi4 was monomeric in solution,
suggesting that the inhibition of Swi4 binding to DNA involves an
intramolecular interaction. In order to determine whether the
C-terminal 144 amino acids of Swi4 were capable of protein-protein
interactions within Swi4, we used GST-4CTR (Fig. 8A) and performed batch affinity
chromatography assays with either insect cell-produced Swi4 derivatives
or in vitro-translated Swi4 derivatives. GST or GST-4CTR was incubated
with full-length Swi4, Swi4
144, or Swi6 produced from insect cells
(Fig. 8B). GST-4CTR efficiently bound Swi6 (Fig. 8B, lane 12), as
previously demonstrated (42). GST-4CTR also bound
full-length Swi4 and Swi4
144 (Fig. 8B, lanes 4 and 8), showing that
the C-terminal 144 amino acids of Swi4 can interact in vitro with the
first 949 amino acids of Swi4. These results are consistent with our
gel shift analysis results showing a functional inhibition of
Swi4
144 binding to SCBs by the CTR. To further define the N-terminal
interaction domain of Swi4, affinity chromatography experiments were
conducted with a series of in vitro-transcribed and -translated Swi4
derivatives (Swi4, Swi4
421, Swi4
Anks, and Swi4
896) (Fig. 8A).
Like the insect cell-produced proteins, the C-terminal 144 amino acids of Swi4 interacted with in vitro-translated full-length Swi4 (Fig. 8C,
lane 4). GST-4CTR also bound both Swi4
421 and Swi4
Anks, indicating that the Swi4-Swi4 interaction does not require the ankyrin
motifs or the C terminus of Swi4 (Fig. 8C, lanes 12 and 16). Further,
GST-4CTR interacted directly with the N-terminal 197 amino acids of
Swi4, which contain the DNA binding domain of Swi4 (Fig. 8C, lane 20).
This interaction appeared weaker than interactions between GST-4CTR and
larger N-terminal fragments of Swi4, suggesting that other parts of
Swi4 may provide structural support for this interaction. We have
previously found that Swi4 fails to interact in vitro with C-terminally
truncated Swi6 (4), showing that protein derivatives
containing the Swi4 CTR are not indiscriminate ligands. Together with
our evidence that Swi4 is monomeric in solution, our data suggest that
the C terminus of Swi4 is involved in an intramolecular interaction
with an N-terminal DNA binding region of Swi4 and that, in the absence
of Swi6, this interaction causes an inhibition of Swi4 DNA binding.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 8.
Binding of the C-terminal 144 amino acids of Swi4 to
Swi6 and N-terminal regions of Swi4 in vitro. (A) Schematic of the Swi4
proteins used in the assay. The relative positions of the DNA binding
domain, ankyrin motifs, and C-terminal domain (Swi6 interaction domain)
are depicted. aa, amino acids. (B) Ten micrograms of partially purified
Swi4, Swi4 144, or Swi6 derived from insect cell extracts (see Fig.
2) was incubated with either GST or GST-4CTR immobilized on glutathione
beads. The unbound (U) and bound (B) fractions were separated by
SDS-6% PAGE. The gels were then blotted and incubated with Swi4
antiserum (lanes 1 to 8) or Swi6 antiserum (lanes 9 to 12) to identify
the Swi4 or Swi6 proteins. The migration positions of molecular weight
markers are indicated to the left (in thousands). (C) Seven microliters
of in vitro-translated Swi4, Swi6, Swi4 421, Swi4 Anks, and
Swi4 896 was incubated with either GST or GST-4CTR immobilized on
glutathione beads. The unbound (U) and bound (B) fractions were
separated by SDS-10% PAGE. The migration positions of molecular
weight markers are indicated to the left (in thousands).
|
|
 |
DISCUSSION |
We found that Swi4 is nuclear throughout the cell cycle and yet is
incapable of promoting transcription in the absence of Swi6. We
reconstituted active SBF in vitro from Swi4 and Swi6 expressed in a
baculovirus system in insect cells. Partially purified full-length Swi4
could not bind SCBs in the absence of Swi6; however, Swi4 derivatives
truncated at the C terminus or carrying point mutations in the extreme
C terminus were able to bind DNA or activate transcription in the
absence of Swi6. Further, the binding of a C-terminally truncated Swi4
protein to SCBs was inhibited by the addition of a C-terminal fragment
of Swi4 in trans. Full-length Swi4 was monomeric in solution,
suggesting an intramolecular mechanism for auto-inhibition of binding
to DNA by Swi4. We detected a direct interaction between a C-terminal
fragment of Swi4 and the N-terminal 197 amino acids of Swi4, which
contain the DNA binding domain of Swi4. Our data suggest that the
interaction of the CTR of Swi4 with the N-terminal DNA binding domain
of Swi4 physically inhibits the DNA binding domain from binding SCBs.
Interaction of the CTR of Swi4 with Swi6 alleviates this inhibition,
allowing Swi4 to bind DNA.
The C terminus of Swi4 inhibits the binding of Swi4 to SCBs.
Our experiments implicate the extreme C terminus of Swi4 in the
auto-inhibition of Swi4 binding to DNA. The C terminus of Swi4 also
contains the Swi6 interaction domain, which has been localized to the
last 78 amino acids of Swi4 (44). As depicted in Fig. 5A,
this region of Swi4 is very similar to comparable regions in other
members of the Swi4 family and has been predicted to contain alpha
helices with an amphipathic character (8, 42, 44). While our
screen for mutations in the CTR of Swi4 was not saturating, we isolated
a large truncation of Swi4 and three isolates with different mutations
that affect the extreme C terminus of Swi4. One mutant, Swi4-GY,
carried two mutations in the extreme C terminus of Swi4, E1076G and
N1092Y. While we have yet to separate the mutations, it is interesting
to note that both map to conserved residues (Fig. 5A). In another
mutant, Swi4-3.3, a predicted alpha helix is deleted from the Swi4 C
terminus. Notably, both of these latter mutants could still bind Swi6
to form SBF in vitro. This result suggests that the domain or residues responsible for the Swi4-Swi6 interaction may be distinct from those
necessary for Swi4 auto-inhibition. Alternatively, the domains or
residues required for the Swi4 auto-inhibitory function and the
Swi4-Swi6 interaction function may be shared and our SBF assay was not
sufficiently sensitive to detect a decrease in the Swi4-Swi6 interaction. It will be interesting to determine whether the Swi4-Swi6 and Swi4-Swi4 interaction domains are fully separable. We suspect that
the Swi6 interaction domain may localize to the conserved residues or
putative alpha helices N terminal to the more C-terminal region that
our data implicate in Swi4 auto-inhibition.
Model for Swi4 DNA binding inhibition.
We found that Swi4 was
largely monomeric in solution and that the CTR of Swi4 could interact
with the N-terminal 197 amino acids containing the DNA binding domain
of Swi4 in vitro. Further, the addition of the CTR of Swi4 to a binding
reaction mixture containing a C-terminally truncated Swi4 protein
(Swi4
144) inhibited DNA binding by Swi4
144. Together, our data
suggest an intramolecular model for the inhibition of Swi4 binding to
DNA. Interestingly, intramolecular interactions within the Swi6 protein
have recently been reported (41). The internal ankyrin
domains of Swi6 form a stabilized central structure with which adjacent
transcriptional activation domains interact. We propose that the
intramolecular interaction of the CTR of Swi4 with the N-terminal
region of Swi4 results in the DNA binding domain of Swi4 becoming
inaccessible or incapable of binding DNA in the absence of Swi6 (Fig.
9). Upon the addition of Swi6, the
Swi4-Swi4 interaction is disrupted, alleviating the inhibition.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 9.
Model of the auto-inhibition of Swi4 binding to DNA.
(Left) An intramolecular interaction involving the extreme C terminus
of Swi4 (CTR) and a more N-terminal region of the protein is depicted.
Our data suggest that when Swi4 is not bound to Swi6, the CTR of Swi4
is free to form an intramolecular interaction with the DNA binding
domain of Swi4, preventing Swi4 binding to SCBs (CACGAAA).
(Right) The binding of Swi6 to the CTR of Swi4 disrupts the
intramolecular interaction of Swi4, allowing Swi4 to bind to SCBs.
|
|
Our batch affinity chromatography analysis showed that the CTR of Swi4
can interact directly with the N-terminal 197 amino
acids of Swi4. This
result suggests that the inhibition of Swi4
DNA binding by the CTR may
be due to a direct masking of the DNA
binding domain. Alternatively,
the CTR of Swi4 may interact with
amino acids outside the core DNA
binding domain, causing a conformational
change in the DNA binding
domain. Swi4 proteins containing a fusion
of the minimal DNA binding
domain (amino acids 36 to 170) to the
C-terminal 146 amino acids or 65 amino acids of Swi4 were reported
to form a complex with DNA in the
absence of Swi6 (
37). If an
intramolecular interaction is
the mechanism for Swi4 auto-inhibition,
then the CTR of Swi4 may
interact either with the first 36 amino
acids of Swi4, which are
N-terminal to the DNA binding domain,
or with amino acids 170 to 197, which lie C-terminal to the DNA
binding domain. Alternatively, direct
fusion of the CTR with the
DNA binding domain may cause a
conformational rigidity that prevents
the intramolecular interaction.
Indeed, it has been suggested
that both Swi4 and Swi6 have inherent
modularity and flexibility
that are crucial for their in vivo function
(
41). Hydrodynamic
analysis and proteolytic cleavage studies
of Swi6 have determined
that the N-terminal 15-kDa domain of Swi6 is
connected to the
central ankyrin region of Swi6 by a long and
potentially flexible
linker region. This 15-kDa region appears to have
no function,
and it is thought to represent a nonfunctional remnant of
a DNA
binding domain from a common ancestor which has remained active
in some family members (reviewed in reference
8).
Members of
the Swi4-Swi6 family of transcription factors have a similar
domain
structure, and the flexible arm adjoining the N-terminal domain
of Swi6 with the central core ankyrin domain may be a conserved
feature
of the entire family. This arm may provide the flexibility
needed for
the N-terminal DNA binding domain of Swi4 to interact
with the
C-terminal
domain.
Intramolecular interactions have been implicated in the regulation of
DNA binding for many transcription factors, including
numerous Ets
family members, such as Ets-1 and GABP

(reviewed
in reference
5). The ability of Ets-1 to bind DNA is negatively
regulated by at least two domains: an N-terminal region and a
C-terminal region (
22,
29). Recent studies revealed that
direct
interactions between the Ets-1 inhibitory N-terminal region and
both the Ets domain and the Ets-1 inhibitory C-terminal region
are
responsible for the intramolecular inhibition of Ets-1 DNA
binding
activity (
25,
36,
45). In the full-length protein,
the two
inhibitory domains interact allosterically, placing stress
on the Ets
domain and destabilizing DNA contacts. Loss of coupling
between the two
domains leads to an altered conformation in the
N-terminal inhibitory
region, allowing the Ets domain to make
stable contacts with DNA.
However, this relaxed conformation is
transient, and reestablishment of
the interaction between the
inhibitory regions causes the repression of
DNA binding. Stable
DNA-Ets-1 interactions are established through
several mechanisms
which disrupt the Ets-1 intramolecular interaction,
including
phosphorylation of the N-terminal inhibitory region and a
direct
protein-protein interaction with the N-terminal inhibitory
region
(
19,
39). A similar method of DNA binding inhibition
has also
been established for GABP

, whose interaction with the
ankyrin-containing
protein GABP

allows GABP

to bind DNA (
10,
13,
49). Although
there is little sequence homology between Swi4
and the Ets family
of proteins, the recent determination of the crystal
structure
of the DNA binding domain of the Swi4 family member Mbp1
revealed
that the Swi4 family and the Ets family proteins do share a
common
fold in their core DNA binding domains. The core consists of a
short strand N terminal to the helix-turn-helix and a

-hairpin
C
terminal to the helix-turn-helix (
48,
50). Although the
structure of Mbp1 outside the core diverged from that of the Ets
proteins, similar allosteric forces may contribute to the DNA
binding
inhibition of the Swi4 family of transcription
factors.
Role of Swi4 DNA binding inhibition in the regulation of SBF.
Clb/Cdc28 activity is necessary for the dissociation of SBF from the
CLN2 promoter in the G2 phase and mitosis
(23, 28). Clb2 immunoprecipitation experiments have shown
that Swi4 can interact with Clb2 during the M phase and that Swi4 is
phosphorylated in vivo (1, 44). Interestingly, the
interaction of Clb2 with Swi4 appears to be independent of Swi6. These
observations have led to the suggestion that a Clb interaction with
Swi4 is necessary for preventing Swi4 from binding DNA. Our data
suggest that the inhibition of Swi4 DNA binding is intrinsic to Swi4
and does not require any other proteins. The role of Clb may not be to
inhibit Swi4 DNA binding but rather to promote the dissociation of SBF from SCBs. Clb-dependent regulation of SBF may occur through a disruption of the Swi4-Swi6 interaction. Once Swi4 and Swi6 are dissociated from each other, Swi6 is transported from the nucleus, allowing the CTR of Swi4 to form an intramolecular interaction with the
DNA binding domain of Swi4, thereby inhibiting Swi4 DNA binding.
Interestingly, gel retardation assays with whole-cell extracts of
synchronized cells arrested at different stages of the cell cycle show
that the SBF-DNA complex can form at all stages of the cell cycle
(47). This result suggests that the inhibition of Swi4 DNA
binding is immediately relieved upon the addition of Swi6. To test this
model, it will be important to determine the relative affinities of
Swi4-Swi4 and Swi4-Swi6 interactions.
It is unlikely that Swi6 is fully excluded from the nucleus throughout
the M and G
2 phases, although SBF footprinting is not
detected. It is possible that the formation of the SBF-DNA complex
is
undetectable in the M and G
2 phases because Clb/Cdc28 is
continually
disrupting the SBF complex and Swi6 is actively transported
from
the nucleus. Alternatively, in addition to the auto-inhibition
of
Swi4 DNA binding, there may be another mechanism regulating
SBF-DNA
complex formation during the G
2 and M phases. Both the
role
and sites of Swi4 phosphorylation by Clb2/Cdc28 have yet
to be
established. One possibility is that the phosphorylation
of Swi4 may
alter the affinity of the Swi4-Swi6 interaction or
the stability of
Swi4 auto-inhibition. There is one consensus
Cdc28 phosphorylation site
in the CTR of Swi4 (S1007) and numerous
other potential sites in the
CTR and the N-terminal DNA binding
domain. It will be interesting to
determine whether Clb/Cdc28
phosphorylates these sites and whether
phosphorylation contributes
to the regulation of Swi4 DNA
binding.
 |
ACKNOWLEDGMENTS |
We thank B. Funnell, H. Friesen, J. Moffatt, and D. McCallum for
critical comments on the manuscript.
K.B. is a research student of the National Cancer Institute of Canada
and is supported with funds provided by the Terry Fox Run. This work
was supported by a grant from the Medical Research Council of Canada to
B.A., who is a scientist of the Medical Research Council of Canada.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Medical Genetics, University of Toronto, Rm. 4287, Medical Sciences Building, 1 Kings College Circle, Toronto, Ontario,
Canada M5S 1A8. Phone: (416) 978-8562. Fax: (416) 971-2494. E-mail:
brenda.andrews{at}utoronto.ca.
 |
REFERENCES |
| 1.
|
Amon, A.,
M. Tyers,
B. Futcher, and K. Nasmyth.
1993.
Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1 cyclins.
Cell
74:993-1007[Medline].
|
| 2.
|
Andrews, B. J., and I. Herskowitz.
1989.
Identification of a DNA binding factor involved in cell-cycle control of the yeast HO gene.
Cell
57:21-29[Medline].
|
| 3.
|
Andrews, B. J., and I. Herskowitz.
1989.
The yeast SWI4 protein contains a motif present in developmental regulators and is part of a complex involved in cell-cycle-dependent transcription.
Nature
342:830-833[Medline].
|
| 4.
|
Andrews, B. J., and L. A. Moore.
1992.
Interaction of the yeast Swi4 and Swi6 cell cycle regulatory proteins in vitro.
Proc. Natl. Acad. Sci. USA
89:11852-11856[Abstract/Free Full Text].
|
| 5.
|
Bassuk, A. G., and J. M. Leiden.
1997.
The role of Ets transcription factors in the development and function of the mammalian immune system.
Adv. Immunol.
64:65-104[Medline].
|
| 6.
|
Bork, P.
1993.
Hundreds of ankyrin-like repeats in functionally diverse proteins; mobile modules that cross phyla horizontally?
Proteins
17:363-374[Medline].
|
| 7.
|
Breeden, L., and K. Nasmyth.
1985.
Regulation of HO.
Cold Spring Harbor Symp. Quant. Biol.
50:643-650[Abstract/Free Full Text].
|
| 8.
|
Breeden, L. L. (ed.).
1996.
Start-specific transcription in yeast.
Curr. Top. Microbiol. Immunol.
208:95-127[Medline].
|
| 9.
|
Breeden, L. L., and K. Nasmyth.
1987.
Cell cycle control of the yeast HO gene: cis- and trans-acting regulators.
Cell
48:389-397[Medline].
|
| 10.
|
Brown, T., and S. McKnight.
1992.
Specificities of protein-protein and protein-DNA interaction of GABP and two newly defined Ets-related proteins.
Genes Dev.
6:2502-2512[Abstract/Free Full Text].
|
| 11.
|
Cosma, M. P.,
T. Tanaka, and K. Nasmyth.
1999.
Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter.
Cell
97:299-311[Medline].
|
| 12.
|
Davey, M. J., and B. E. Funnell.
1994.
The P1 plasmid partition protein ParA: a role for ATP in site specific DNA binding.
J. Biol. Chem.
269:29908-29913[Abstract/Free Full Text].
|
| 13.
|
de la Brousse, F.,
E. Birkenmeier,
D. King,
B. Rowe, and S. McKnight.
1994.
Molecular and genetic characterization of GABP .
Genes Dev.
8:1853-1865[Abstract/Free Full Text].
|
| 14.
|
Dirick, L.,
T. Bohm, and K. Nasmyth.
1995.
Roles and regulation of Cln/Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae.
EMBO J.
14:4803-4813[Medline].
|
| 14a.
| Donoviel, M. Personal communication.
|
| 15.
|
Espinoza, F. H.,
J. Ogas,
I. Herskowitz, and D. O. Morgan.
1994.
Cell cycle control by a complex of the cyclin HCS26(PCL1) and the kinase PHO85.
Science
266:1388-1391[Abstract/Free Full Text].
|
| 16.
|
Ewaskow, S. P.,
J. M. Sidorova,
J. Hendle,
J. C. Emery,
D. E. Lycan,
K. Y. J. Zhang, and L. L. Breeden.
1998.
Mutation and modeling analysis of the Saccharomyces cerevisiae Swi6 ankyrin repeats.
Biochemistry
37:4437-4450[Medline].
|
| 17.
|
Gehrung, S., and M. Snyder.
1990.
The SPA2 gene of Saccharomyces cerevisiae is important for pheromone-induced morphogenesis and efficient mating.
J. Cell Biol.
111:1451-1464[Abstract/Free Full Text].
|
| 18.
|
Ghosh, S.,
M. J. May, and E. B. Kopp.
1998.
NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses.
Annu. Rev. Immunol.
16:225-260[Medline].
|
| 19.
|
Giese, K.,
C. Kingsley,
J. Kirshner, and R. Grosschedl.
1995.
Assembly and function of a TCR enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions.
Genes Dev.
9:995-1008[Abstract/Free Full Text].
|
| 20.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425[Free Full Text].
|
| 21.
|
Guthrie, C., and G. R. Fink.
1991.
Guide to yeast genetics and molecular biology, vol. 194.
Academic Press, Inc., San Diego, Calif.
|
| 22.
|
Hagman, J., and R. Grosschedl.
1992.
An inhibitory carboxyl-terminal domain in Ets-1 and Ets-2 mediates differential binding of ETS family factors to promoter sequences of the mb-1 gene.
Proc. Natl. Acad. Sci. USA
89:8889-8893[Abstract/Free Full Text].
|
| 23.
|
Harrington, L. A., and B. J. Andrews.
1996.
Binding to the yeast Swi4,6-dependent cell cycle box, CACGAAA, is cell cycle regulated in vivo.
Nucleic Acids Res.
24:558-565[Abstract/Free Full Text].
|
| 24.
|
Igual, J.,
A. Johnson, and L. Johnston.
1996.
Coordinated regulation of gene expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase pathway for yeast cell integrity.
EMBO J.
15:5001-5013[Medline].
|
| 25.
|
Jonsen, M. D.,
J. M. Peterson,
Q. P. Xu, and B. J. Graves.
1996.
Characterization of the cooperative function of inhibitory sequences in Ets-1.
Mol. Cell. Biol.
16:2065-2073[Abstract].
|
| 26.
|
Kaiser, C.,
S. Michaelis, and A. Mitchell.
1994.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 27.
|
Koch, C.,
T. Moll,
M. Neuberg,
H. Ahorn, and K. Nasmyth.
1993.
A role for the transcription factors Mbp1 and Swi4 in progression from G1 to S phase.
Science
261:1551-1557[Abstract/Free Full Text].
|
| 28.
|
Koch, C.,
A. Schleiffer,
G. Ammerer, and K. Nasmyth.
1996.
Switching transcription on and off during the yeast cell cycle: Cln/Cdc28 kinases activate bound transcription factor SBF (Swi4/Swi6) at Start, whereas Clb/Cdc28 kinases displace it from the promoter in G2.
Genes Dev.
10:129-141[Abstract/Free Full Text].
|
| 29.
|
Lim, F.,
N. Kraut,
J. Frampton, and T. Graf.
1992.
DNA binding by c-Ets-1, but not v-Ets, is repressed by an intramolecular mechanism.
EMBO J.
11:643-652[Medline].
|
| 30.
|
Measday, V.,
L. Moore,
J. Ogas,
M. Tyers, and B. Andrews.
1994.
The PCL2(ORF2)-PHO85 cyclin dependent kinase complex: a cell cycle regulator in yeast.
Science
266:1391-1395[Abstract/Free Full Text].
|
| 31.
|
Measday, V.,
L. Moore,
R. Retnakaran,
J. Lee,
M. Donoviel,
A. M. Neiman, and B. Andrews.
1997.
A family of cyclin-like proteins that interact with Pho85 cyclin-dependent kinase.
Mol. Cell. Biol.
17:1212-1223[Abstract].
|
| 32.
|
Nasmyth, K.
1993.
Control of the yeast cell cycle by the Cdc28 protein kinase.
Curr. Opin. Cell Biol.
5:166-179[Medline].
|
| 33.
|
Nasmyth, K., and L. Dirick.
1991.
The role of SWI4 and SWI6 in the activity of G1 cyclins in yeast.
Cell
66:1015-1026[Medline].
|
| 34.
|
Ogas, J.,
B. J. Andrews, and I. Herskowitz.
1991.
Transcriptional activation of CLN1, CLN2 and a putative new G1 cyclin (HCS26) by Swi4, a positive regulator of G1 specific transcription.
Cell
66:1015-1026.
|
| 35.
|
Pardee, A. B.
1989.
G1 events and regulation of cell proliferation.
Science
246:603-608[Abstract/Free Full Text].
|
| 36.
|
Petersen, J.,
J. Skalicky,
L. Donaldson,
L. McIntosh,
T. Alber, and B. Graves.
1995.
Modulation of transcription factor Ets-1 DNA binding: DNA-induced unfolding of helix.
Science
269:1866-1868[Abstract/Free Full Text].
|
| 37.
|
Primig, M.,
S. Sockanathan,
H. Auer, and K. Nasmyth.
1992.
Anatomy of a transcription factor important for the Start of the cell cycle in Saccharomyces cerevisiae.
Nature
358:593-597[Medline].
|
| 38.
|
Pringle, J. R.,
A. E. M. Adams,
D. G. Drubins, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-601[Medline].
|
| 39.
|
Rabault, B., and J. Ghysdael.
1994.
Calcium-induced phosphorylation of ETS1 inhibits its specific DNA binding activity.
J. Biol. Chem.
269:28143-28151[Abstract/Free Full Text].
|
| 40.
|
Rose, M., and D. Botstein.
1983.
Construction and use of gene fusions to lacZ ( -galactosidase) that are expressed in yeast.
Methods Enzymol.
101:167-180[Medline].
|
| 41.
|
Sedgwick, S. G.,
I. A. Taylor,
A. C. Adam,
A. Spanos,
S. Howell,
B. A. Morgan,
M. K. Treiber,
N. Kanuga,
G. R. Banks,
R. Foord, and S. J. Smerdon.
1998.
Structural and functional architecture of the yeast cell-cycle transcription factor Swi6.
J. Mol. Biol.
281:763-775[Medline].
|
| 42.
|
Sidorova, J. M., and L. L. Breeden.
1993.
Analysis of the SWI4/SWI6 protein complex, which directs G1/S-specific transcription in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:1069-1077[Abstract/Free Full Text].
|
| 43.
|
Sidorova, J. M.,
G. E. Mikesell, and L. L. Breeden.
1995.
Cell cycle-regulated phosphorylation of Swi6 controls its nuclear localization.
Mol. Cell. Biol.
6:1641-1658.
|
| 44.
|
Siegmund, R. F., and K. Nasmyth.
1996.
The Saccharomyces cerevisiae Start-specific transcription factor Swi4 interacts through the ankyrin repeats with the mitotic Clb2/Cdc28 kinase and through its conserved carboxy terminus with Swi6.
Mol. Cell. Biol.
16:2647-2655[Abstract].
|
| 45.
|
Skalicky, J.,
L. Donaldson,
J. Petersen,
B. Graves, and L. McIntosh.
1996.
Structural coupling of the inhibitory regions flanking the ETS domain of murine Ets-1.
Protein Sci.
5:296-309[Medline].
|
| 46.
|
Stuart, D., and C. Wittenberg.
1995.
CLN3, not positive feedback, determines CLN2 transcription in cycling cells.
Genes Dev.
9:2780-2794[Abstract/Free Full Text].
|
| 47.
|
Taba, M. R. M.,
I. Muroff,
D. Lydall,
G. Tebb, and K. Nasmyth.
1991.
Changes in a Swi4,6-DNA binding complex occur at the time of HO activation in yeast.
Genes Dev.
5:2000-2013[Abstract/Free Full Text].
|
| 48.
|
Taylor, I. A.,
M. K. Treiber,
L. Olivi, and S. J. Smerdon.
1997.
The X-ray structure of the DNA-binding domain from the Saccharomyces cerevisiae cell-cycle transcription factor Mbp1 at 2.1A resolution.
J. Mol. Biol.
272:1-8[Medline].
|
| 49.
|
Thompson, C.,
A. Brown, and S. McKnight.
1991.
Convergence of Ets- and Notch-related structural motifs in a heteromeric DNA binding complex.
Science
253:762-768[Abstract/Free Full Text].
|
| 50.
|
Xu, R. M.,
C. Koch,
Y. Liu,
J. R. Horton,
D. Knapp,
K. Nasmyth, and X. Cheng.
1997.
Crystal structure of the DNA-binding domain of Mbp1, a transcription factor important in cell-cycle control of DNA synthesis.
Structure
5:349-358[Medline].
|
| 51.
| YGAC Website. [Online.]
http://ycmi.med.yale.edu/YGAC/antibodycleanup.html. [3 August
1999, last date accessed.]
|
Molecular and Cellular Biology, October 1999, p. 6729-6741, Vol. 19, No. 10
0270-7306/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kim, K.-Y., Truman, A. W., Levin, D. E.
(2008). Yeast Mpk1 Mitogen-Activated Protein Kinase Activates Transcription through Swi4/Swi6 by a Noncatalytic Mechanism That Requires Upstream Signal. Mol. Cell. Biol.
28: 2579-2589
[Abstract]
[Full Text]
-
Li, Z., Shaw, S. M., Yedwabnick, M. J., Chan, C.
(2006). Using a state-space model with hidden variables to infer transcription factor activities. Bioinformatics
22: 747-754
[Abstract]
[Full Text]
-
Levin, D. E.
(2005). Cell Wall Integrity Signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev.
69: 262-291
[Abstract]
[Full Text]
-
Nemeth, A., Strohner, R., Grummt, I., Langst, G.
(2004). The chromatin remodeling complex NoRC and TTF-I cooperate in the regulation of the mammalian rRNA genes in vivo. Nucleic Acids Res
32: 4091-4099
[Abstract]
[Full Text]
-
Geymonat, M., Spanos, A., Wells, G. P., Smerdon, S. J., Sedgwick, S. G.
(2004). Clb6/Cdc28 and Cdc14 Regulate Phosphorylation Status and Cellular Localization of Swi6. Mol. Cell. Biol.
24: 2277-2285
[Abstract]
[Full Text]
-
Yeger-Lotem, E., Margalit, H.
(2003). Detection of regulatory circuits by integrating the cellular networks of protein-protein interactions and transcription regulation. Nucleic Acids Res
31: 6053-6061
[Abstract]
[Full Text]
-
Costanzo, M., Schub, O., Andrews, B.
(2003). G1 Transcription Factors Are Differentially Regulated in Saccharomyces cerevisiae by the Swi6-Binding Protein Stb1. Mol. Cell. Biol.
23: 5064-5077
[Abstract]
[Full Text]
-
Queralt, E., Igual, J. C.
(2003). Cell Cycle Activation of the Swi6p Transcription Factor Is Linked to Nucleocytoplasmic Shuttling. Mol. Cell. Biol.
23: 3126-3140
[Abstract]
[Full Text]
-
Prado, F., Vicent, G., Cardalda, C., Beato, M.
(2002). Differential Role of the Proline-rich Domain of Nuclear Factor 1-C Splice Variants in DNA Binding and Transactivation. J. Biol. Chem.
277: 16383-16390
[Abstract]
[Full Text]
-
Sidorova, J. M., Breeden, L. L.
(2002). Precocious S-Phase Entry in Budding Yeast Prolongs Replicative State and Increases Dependence Upon Rad53 for Viability. Genetics
160: 123-136
[Abstract]
[Full Text]
-
Gari, E., Volpe, T., Wang, H., Gallego, C., Futcher, B., Aldea, M.
(2001). Whi3 binds the mRNA of the G1 cyclin CLN3 to modulate cell fate in budding yeast. Genes Dev.
15: 2803-2808
[Abstract]
[Full Text]
-
Baetz, K., Moffat, J., Haynes, J., Chang, M., Andrews, B.
(2001). Transcriptional Coregulation by the Cell Integrity Mitogen-Activated Protein Kinase Slt2 and the Cell Cycle Regulator Swi4. Mol. Cell. Biol.
21: 6515-6528
[Abstract]
[Full Text]